Molecular detection/diagnosis reagent for tumor

10876168 ยท 2020-12-29

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention discloses a tumor molecular detection/diagnostic reagent, which takes excrement as a detection sample and includes an SDC2 gene methylation detection reagent. The methylation level of the SDC2 gene detected in the excrement has an extremely high relevance to the onset of the colorectal cancer. The sensitivity of the SDC2 gene in the excrement is 87 percent and the specificity is up to 98 percent or even higher than that in tissue.

Claims

1. A tumor molecular detection/diagnostic reagent comprising an SDC2 gene methylation detection reagent, wherein the SDC2 gene methylation detection reagent contains a first amplification primer and a second amplification primer, and wherein said first amplification primer consists of the nucleotide sequence of SEQ ID NO: 3 and said second amplification primer consists of the nucleotide sequence of SEQ ID NO: 4.

2. The detection/diagnostic reagent according to claim 1, wherein said tumor molecular detection/diagnostic reagent further comprises DNA capturing reagents.

3. The detection/diagnostic reagent according to claim 2, wherein the DNA capturing reagents are capturing magnetic beads.

4. The detection/diagnostic reagent according to claim 3, wherein the capturing magnetic beads comprise a capturing sequence for the SDC2 gene.

5. The detection/diagnostic reagent according to claim 4, wherein the capturing sequence is selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

6. The detection/diagnostic reagent according to claim 3, wherein the capturing magnetic beads comprise a capturing for a CpG island of the SDC2 gene.

7. The detection/diagnostic reagent according to claim 1, wherein the SDC2 gene methylation detection reagent is a methylation detection reagent for a CpG island.

8. The detection/diagnostic reagent according to claim 1, wherein said detection/diagnostic reagent further comprises a detection probe.

9. The detection/diagnostic reagent according to claim 8, wherein the detection probe has a sequence selected from the group consisting of SEQ ID NO: 25 and SEQ ID NO: 26.

10. The detection/diagnostic reagent according to claim 1, wherein the tumor is intestinal cancer or precancerous adenoma.

11. The detection/diagnostic reagent according to claim 10, wherein the intestinal cancer is colorectal cancer.

12. A tumor detection/diagnostic kit, comprising the detection/diagnostic reagent according to claim 1.

13. The tumor detection/diagnostic kit according to claim 12, wherein the tumor is intestinal cancer or precancerous adenoma.

14. The tumor detection/diagnostic kit according to claim 13, wherein the intestinal cancer is colorectal cancer.

15. A method of detecting an intestinal tumor in a human subject comprising: obtaining a sample of excrement from a human subject; extracting DNA from said sample of excrement; amplifying the DNA using the tumor molecular detection/diagnostic reagent of claim 1; and detecting the presence of an intestinal tumor in the human subject when the level of the amplification product is greater in comparison to the level of an amplification product in control excrement samples from human subjects that do not have intestinal tumors.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A and 1B depict an ROC (receiver operating characteristic) curve of detecting colorectal cancer (A) and precancerous adenoma (polypus having a diameter more than or equal to 1 cm) (B) based on the SDC2 gene;

(2) FIGS. 2A and 2B depict an ROC curve of detecting colorectal cancer (A) and precancerous adenoma (polypus having a diameter more than or equal to 1 cm) (B) based on the NDRG4 gene;

(3) FIGS. 3A and 3B depict an ROC curve of detecting colorectal cancer (A) and precancerous adenoma (polypus having a diameter more than or equal to 1 cm) (B) based on the BMP3 gene;

(4) FIGS. 4A and 4B depict an ROC curve of detecting colorectal cancer (A) and precancerous adenoma (polypus having a diameter more than or equal to 1 cm) (B) based on the Septin9 gene;

(5) FIGS. 5 to 15 are amplification curves of primers SM-0 to SM-10, successively;

(6) FIG. 16 is a fluorescent PCR detection result (probe 1);

(7) FIG. 17 is a fluorescent PCR detection result (probe 2).

DETAILED DESCRIPTION OF THE INVENTION

(8) The present invention discloses a tumor molecular detection/diagnostic reagent. A person skilled in the art can make proper improvements on process parameters by referring to contents in this text. It should be particularly noted that it is evident for the person skilled in the art to make all similar replacements and changes that shall all be deemed as being included in the present invention. The method and application of the present invention have been described by means of preferred embodiments, and it is obvious for relevant persons to make changes or proper alterations and combinations to the method and application described in this text without departing from the contents, spirit and scope of the present invention to implement and apply the technologies of the present invention.

(9) Raw materials and reagents which are used in the tumor molecular detection/diagnostic reagent provided by the present invention may be all purchased on the market.

(10) A further description will be made to the technical solution of the present invention by specific embodiments, and the specific embodiments are not representative of limitations to the scope of protection of the present invention. Some nonessential modifications and adjustments that are made by others according to the theory of the present invention shall still fall within the scope of protection of the present invention.

Embodiment 1 Sample Treatment and DNA Extraction

(11) An excrement sample and a buffer solution are mixed and ground according to a ratio of 1 g of excrement to 4 ml of buffer solution, and then the mixture is centrifugated so as to reserve supernate and abandon precipitates.

(12) 8 ml of the supernate is centrifugated at 4000 rpm for 5 min, and then 5 ml of the centrifugated supernate is transferred into a new centrifugal tube which is pre-filled with 3 ml of cell lysis buffer and has the volume of 15 ml.

(13) 100 ul of capturing magnetic beads are added into each centrifugal tubes which are incubated in a water bath kettle at 92 DEG C. for 10 min and incubated in a table concentrator at 100 rpm at room temperature for 1 h, and then after short centrifugation, the centrifugal tubes are placed on a magnetic frame for 5 min so as to abandon the supernate.

(14) There are two available capturing probes, which are both effective and can capture target fragments.

(15) TABLE-US-00001 Capturingprobe1: SEQIDNO.1: AGCCCGCGCACACGAATCCGGAGCAGAGTACCG Capturingprobe2: SEQIDNO.2: CTCCTGCCCAGCGCTCGGCGCAGCCCGC

(16) 500 ul of a cleaning solution is added into the centrifugal tube having the volume of 15 ml, and then the centrifugal tube is shaken for uniform mixing to enable the magnetic beads on the tube wall to be suspended completely; and after short centrifugation, the solution is transferred into a new centrifugal tube having the volume of 2 ml. The centrifugal tube is incubated in a dry bath incubator at 900 rpm at room temperature for 1 min, and then is placed on the magnetic frame for 1 min so as to abandon the supernate. The above-mentioned operation is repeated for 4 times.

(17) 55 ul of eluent is added, and after short centrifugation, the centrifugal tube is incubated in the dry bath incubator at 900 rpm at 92 DEG C. for 10 min. After short centrifugation, the centrifugal tube is placed on the magnetic frame, and 50 ul of eluent is transferred into a new EP tube within 3 min.

(18) A DNA fragment in the step 6 is methylated with an EZ methylation kit (a product of the Zymo Research Company), and a final sample is subjected to PCR detection.

(19) Analysis of the capturing efficiency of the capturing probes:

(20) The two capturing probes are used for capturing the same sample, and the concentrations of the captured DNA fragments are measured through an ultraviolet spectrophotometer, obtaining results as follows:

(21) TABLE-US-00002 Concentration of DNA (ng/uL) Used probe OD260 (50(ng/uL) OD260) SEQ ID NO. 1 1.9 95 SEQ ID NO. 2 1.7 85

(22) The two probes can capture the target fragments. The effect of SEQ ID NO: 1 is better than that of SEQ ID NO: 2, the optimal experiment adopts the probes.

Embodiment 2 PCR (Polymerase Chain Reaction) Detection Process

(23) A PCR system and procedures are respectively as shown in Table 1 and Table 2.

(24) TABLE-US-00003 TABLE 1 PCR system Component Adding amount (ul) Forward primer (FP) (100 uM) 0.125 Backward primer (RP) (100 uM) 0.125 Probe (100 uM) 0.05 dNTP (10 mM) 1 Magnesium ion 5 5*buffer 5 Reaction enzyme 0.5 Nuclease-free water 8.2 DNA to be detected 5 Total 25

(25) TABLE-US-00004 TABLE 2 PCR procedures Cycle number Temperature ( C.) Time (s) 1 95 300 10 95 20 62 30 70 30 40 95 20 58 60 72 30 (Collection of fluorescence) 1 37 30

(26) Primers are designed, and their amplification efficiency is researched (as shown in Table 3). The amplification system and the procedures are as mentioned above.

(27) TABLE-US-00005 TABLE3 Primersandamplificationefficiency Sequence Amplification number Primername Sequence result SEQIDNO.3 SM-0FP GAGGAAGCGAGCGTTTTC FIG.5 SEQIDNO.4 SM-0RP AAAATACCGCAACGATTACGA SEQIDNO.5 SM-1FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.6 SEQIDNO.6 SM-1RP CGCAACGATTACGACTCAAACTCGA SEQIDNO.7 SM-2FP TAGGAGGAGGAAGTGAGTGTTTTTG FIG.7 SEQIDNO.8 SM-2RP ACCACAACAATTACAACTCAAACTCAA SEQIDNO.9 SM-3FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.8 SEQIDNO.10 SM-3RP CCGCAACGATTACGACTCAAACTCG SEQIDNO.11 SM-4FP TAGGAGGAGGAAGTGAGTGTTTTTG FIG.9 SEQIDNO.12 SM-4RP ACCACAACAATTACAACTCAAACTCAA SEQIDNO.13 SM-5FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.10 SEQIDNO.14 SM-SRP CGCAACGATTACGACTCAAACTCGA SEQIDNO.15 SM-6FP TAGGAGGAGGAAGTGAGTGTTTTTG FIG.11 SEQIDNO.16 SM-6RP CCACAACAATTACAACTCAAACTCAA SEQIDNO.17 SM-7FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.12 SEQIDNO.18 SM-7RP CCGCAACGATTACGACTCAAACTCG SEQIDNO.19 SM-8FP TAGGAGGAGGAAGTGAGTGTTTTTG FIG.13 SEQIDNO.20 SM-8RP CCACAACAATTACAACTCAAACTCAA SEQIDNO.21 SM-9FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.14 SEQIDNO.22 SM-9RP CGCAACGATTACGACTCAAACTCGA SEQIDNO.23 SM-10FP GTAGGAGGAGGAAGTGAGTGTTTTTG FIG.15 SEQIDNO.24 SM-10RP ACCACAACAATTACAACTCAAACTCAA

(28) The PCR results of the primers are respectively as shown in FIGS. 5 to 15. It can be seen from the results that the primers SEQ ID NO: 3 and SEQ ID NO: 4 have the highest amplification efficiency.

(29) The primer pair of SEQ ID NO: 3 and SEQ ID NO: 4, which has the highest amplification efficiency, is used.

(30) The detection probes are further designed. Optimized detection probe examples are as follows.

(31) TABLE-US-00006 Probe1:SEQIDNO.25: AGTTTCGAGTTCGAGTTTTCGAGTTTG Probe2:SEQIDNO.26: CAAACTCGAAAACTCGAACTCGAAACT

(32) Ten holes are repeated. The experiment is performed twice. The PCR system and procedures are as shown in Table 1 and Table 2.

(33) Fluorescence curves of the probe 1 and probe 2 are respectively as shown in FIG. 16 and FIG. 17.

(34) It can be seen from the results that the probe 1 and the probe 2 can ensure that the PCR process is performed normally. By contrast, a fluorescence value obtained by the probe 2 is higher, and is more favorable for the judgment on the result, particularly for the judgment on a positive sample.

(35) The probe 2 is adopted to detect the sample in the optimal experiment.

Embodiment 3 Sample Detection

(36) Excrement samples of 46 patients definitely diagnosed as suffering from intestinal cancer based on enteroscopy and pathological examination, excrement samples of 46 patients definitely diagnosed as suffering from precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on enteroscopy and pathological examination, and excrement samples of 46 patients definitely diagnosed as normal based on enteroscopy were clinically collected.

(37) The above-mentioned excrement samples were treated and subjected to DNA extraction according to the method in Embodiment 1. The 138 samples were subjected to PCR detection by using the PCR detection process in Embodiment 2.

(38) The 46 intestinal cancer patients (Ca) (definitely diagnosed as suffering from the intestinal cancer based on the enteroscopy), the 46 normal patients (Norm) (definitely diagnosed as normal based on the enteroscopy), and the 46 precancerous adenoma patients (polypus having a diameter more than or equal to 1 cm, LA, definitely diagnosed that the diameter of the polypus is more than or equal to 1 cm based on the enteroscopy) were detected.

(39) Data were processed and analyzed by using MedCalc software.

(40) Results are as shown in FIGS. 1A and 1B, and in FIGS. 2A and 2B.

(41) FIG. 1A is an ROC (receiver operating characteristic) curve of detecting the colorectal cancer based on the SDC2 gene, and FIG. 1B is an ROC curve of detecting the precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on the SDC2 gene.

(42) For the colorectal cancer, the detection sensitivity of the SDC2 gene is 87 percent, and the specificity is 98 percent. The area under the receiver curve is 0.953.

(43) For the precancerous adenoma (polypus having a diameter more than or equal to 1 cm), the detection sensitivity of the SDC2 gene is 73 percent, and the specificity is 96 percent. The area under the receiver curve is 0.882.

Embodiment 4 Detection Results of Other Exemplar Molecular Markers

(44) In a process of exploring the technical solution of the present invention, the inventor had explored various intestinal cancer markers.

(45) With reference to the system design methods of Embodiment 1, 2 and 3, excrement detection for the NDRG4 gene, the BMP3 gene and the Septin9 gene was explored in the present invention.

(46) After the optimal detection method was performed on those genes respectively, the clinically samples in Embodiment 3 were analyzed in the same way.

(47) Results obtained by detecting the colorectal cancer and the precancerous adenoma based on the NDRG4 gene are as shown in FIGS. 2A and 2B.

(48) FIG. 2A is an ROC curve of detecting the colorectal cancer based on the NDRG4 gene, and FIG. 2B is an ROC curve of detecting the precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on the NDRG4 gene.

(49) For the colorectal cancer, the detection sensitivity of the NDRG4 gene is 65.2 percent, and the specificity is 97.8 percent. The area under the receiver curve is 0.826.

(50) For the precancerous adenoma (polypus having a diameter more than or equal to 1 cm), the detection sensitivity of the NDRG4 gene is 45.7 percent, and the specificity is 97.8 percent. The area under the receiver curve is 0.694.

(51) Results obtained by detecting the colorectal cancer and the precancerous adenoma based on the BMP3 gene are as shown in FIGS. 3A and 3B.

(52) FIG. 3A is an ROC curve of detecting the colorectal cancer based on the BMP3 gene, and FIG. 3B is an ROC curve of detecting the precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on the BMP3 gene.

(53) For the colorectal cancer, the detection sensitivity of the BMP3 gene is 50.0 percent, and the specificity is 89.1 percent. The area under the receiver curve is 0.694.

(54) For the precancerous adenoma (polypus having a diameter more than or equal to 1 cm), the detection sensitivity of the BMP3 gene is 26.1 percent, and the specificity is 89.1 percent. The area under the receiver curve is 0.549.

(55) Results obtained by detecting the colorectal cancer and the precancerous adenoma based on the Septin9 gene are as shown in FIGS. 4A and 4B.

(56) FIG. 4A is an ROC curve of detecting the colorectal cancer based on the Septin9 gene, and FIG. 4B is an ROC curve of detecting the precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on the Septin9 gene.

(57) For the colorectal cancer, the detection sensitivity of the Septin9 gene is 82.6 percent, and the specificity is 63.0 percent. The area under the receiver curve is 0.737.

(58) For the precancerous adenoma (polypus having a diameter more than or equal to 1 cm), the detection sensitivity of the Septin9 gene is 13.0 percent, and the specificity is 97.8 percent. The area under the receiver curve is 0.534.

(59) The above-mentioned embodiments are only preferred implementation modes of the present invention, but not intended to limit the implementation modes of the present invention. Any other changes, modifications, replacements, combinations and simplifications that are made without departing from the spirit and theory of the present invention shall all fall within the scope of protection of the present invention.

(60) The above detailed description is made to the tumor molecular detection/diagnostic reagent provided by the present invention. In this text, specific cases are applied to describe the principle and implementation modes of the present invention, and descriptions of the above embodiments are only used for assisting in understanding the method of the present invention and its main idea.

(61) It should be noted that a person skilled in the art further can make a plurality of improvements and modifications to the present invention without departing from the theory of the present invention, and these improvements and modifications shall also fall within the scope of protection of claims of the present invention.