PROCESSES FOR THE PRODUCTION OF HYDROXYCINNAMIC ACIDS USING POLYPEPTIDES HAVING TYROSINE AMMONIA LYASE ACTIVITY
20200399665 ยท 2020-12-24
Inventors
- Christian Bille Jendresen (Copenhagen, DK)
- Solvej Siedler (Kokkedal, DK)
- Steen Gustav Stahlhut (Frederiksberg, DK)
- Alex Toftgaard Nielsen (Rungsted Kyst, DK)
Cpc classification
International classification
Abstract
The present invention generally relates to the field of biotechnology as it applies to the production of hydroxycinnamic acids using polypeptides having tyrosine ammonia lyase activity. More particularly, the present invention pertains to polypeptides having tyrosine ammonia lyase activity and high substrate specificity towards tyrosine, which makes them particularly suitable in the production of p-coumaric acid and other hydroxycinnamic acids. The present invention thus provides processes for the production of p-coumaric acid and other hydroxycinnamic acids employing these polypeptides as well as recombinant host cells expressing same.
Claims
1. (canceled)
2. A method for producing a hydroxycinnamic acid of general formula I: ##STR00010## comprising: contacting a recombinant host cell which has been genetically modified to express a heterologous polypeptide with a medium comprising a fermentable carbon substrate and/or a compound of the general formula II: ##STR00011## to produce a hydroxycinnamic acid of general formula I; wherein said heterologous polypeptide is selected from: i) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 or 3; or ii) a polypeptide comprising an amino acid sequence which has at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or 3, wherein the polypeptide has tyrosine ammonia lyase activity; wherein each of R.sub.1, R.sub.3, and R.sub.4 is hydrogen (H), and R.sub.2 is hydroxyl (OH), or wherein R.sub.1 is methoxyl (OCH.sub.3) or hydroxyl (OH), R.sub.2 is hydroxyl (OH), and each of R.sub.3 and R.sub.4 is hydrogen (H); and wherein said recombinant host cell is a bacterium or yeast.
3. The method according to claim 2, wherein the recombinant host cell is a bacterium.
4. The method according to claim 3, wherein the bacterium is of the genus Bacillus, Lactococcus, Lactobacillus, Clostridium, Corynebacterium, Geobacillus, Streptococcus, Pseudomonas, Streptomyces, Escherichia, Shigella, Acinetobacter, Citrobacter, Salmonella, Klebsiella, Enterobacter, Erwinia, Kluyvera, Serratia, Cedecea, Morganella, Hafnia, Edwardsiella, Providencia, Proteus, or Yersinia.
5. The method according to claim 3, wherein the bacterium is of the genus Escherichia, Bacillus, Lactococcus, Lactobacillus, Corynebacterium, Streptomyces or Pseudomonas.
6. The method according to claim 3, wherein the bacterium is selected from the group consisting of Escherichia coli, Lactococcus lactis, Bacillus subtitlis, Bacillus amyloliquefaciens, Bacillus lichenformis, Bacillus mojavensis, Streptomyces lividans, Streptomyces griseus, Streptomyces coelicolor, Corynebacterium glutamicum, and Pseudomonas putida.
7. The method according to claim 3, wherein the bacterium is Escherichia coli, Lactococcus lactis or Bacillus subtitlis.
8. The method according to claim 3, wherein the bacterium is Escherichia coli.
9. The method according to claim 2, wherein the recombinant host cell is a yeast.
10. The method according to claim 3, wherein the yeast is of the genus Saccharomyces, Pichia, Schizosacharomyces, Zygosaccharomyces, Hansenula, Pachyosolen, Kluyveromyces, Debaryomyces, Yarrowia, Candida, Cryptococcus, Komagataella, Lipomyces, Rhodospiridium, Rhodotorula, or Trichosporon.
11. The method according to claim 3, wherein the yeast is of the genus Saccharomyces or Pichia.
12. The method according to claim 3, wherein the yeast is selected from the group consisting of Saccharomyces cerevisiae, Pichia pastoris, and Pichia kudriavzevii.
13. The method according to claim 3, wherein the yeast is Saccharomyces cerevisiae.
14. The method according to claim 2, wherein said recombinant host cell does not express a polypeptide having phenolic acid decarboxylase (PAD) activity.
15. The method according to claim 2, wherein the polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 2 or 3.
16. A method for producing a hydroxycinnamic acid of general formula I: ##STR00012## general formula I comprising: a) contacting a compound of general formula II: ##STR00013## with a polypeptide to produce a hydroxycinnamic acid of general formula I, wherein the polypeptide is selected from: i) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 or 3; or ii) a polypeptide comprising an amino acid sequence which has at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or 3, wherein the polypeptide has tyrosine ammonia lyase activity; and b) measuring the concentration of said hydroxycinnamic acid of general formula I or recovering said hydroxycinnamic acid of general formula I; wherein each of R.sub.1, R.sub.3, and R.sub.4 is hydrogen (H), and R.sub.2 is hydroxyl (OH), or wherein R.sub.1 is methoxyl (OCH.sub.3) or hydroxyl (OH), R.sub.2 is hydroxyl (OH), and each of R.sub.3 and R.sub.4 is hydrogen (H).
17. A method for producing a hydroxycinnamic acid of general formula I: ##STR00014## comprising: a) contacting a recombinant host cell which has been genetically modified to express a heterologous polypeptide with a medium comprising a fermentable carbon substrate and/or a compound of the general formula II: ##STR00015## to produce a hydroxycinnamic acid of general formula I; wherein said heterologous polypeptide is selected from: i) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 or 3; or ii) a polypeptide comprising an amino acid sequence which has at least 80% sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or 3, wherein the polypeptide has tyrosine ammonia lyase activity; and b) measuring the concentration of said hydroxycinnamic acid of general formula I or recovering said hydroxycinnamic acid of general formula I; wherein each of R.sub.1, R.sub.3, and R.sub.4 is hydrogen (H), and R.sub.2 is hydroxyl (OH), or wherein R.sub.1 is methoxyl (OCH.sub.3) or hydroxyl (OH), R.sub.2 is hydroxyl (OH), and each of R.sub.3 and R.sub.4 is hydrogen (H).
18. The method according to claim 17, wherein the recombinant host cell is a bacterium.
19. The method according to claim 18, wherein the bacterium is selected from the group consisting of Escherichia coli, Lactococcus lactis, Bacillus subtitlis, Bacillus amyloliquefaciens, Bacillus lichenformis, Bacillus mojavensis, Streptomyces lividans, Streptomyces griseus, Streptomyces coelicolor, Corynebacterium glutamicum, and Pseudomonas putida.
20. The method according to claim 18, wherein the bacterium is Escherichia coli.
21. The method according to claim 17, wherein the recombinant host cell is a yeast.
22. The method according to claim 21, wherein the yeast is selected from the group consisting of Saccharomyces cerevisiae, Pichia pastoris, and Pichia kudriavzevii.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
DETAILED DESCRIPTION OF THE INVENTION
[0031] Unless specifically defined herein, all technical and scientific terms used have the same meaning as commonly understood by a skilled artisan in the fields of biochemistry, genetics, and molecular biology.
[0032] All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will prevail. Further, the materials, methods, and examples are illustrative only and are not intended to be limiting, unless otherwise specified.
[0033] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Harries & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols. 154 and 155 (Wu et al. eds.) and Vol. 185, Gene Expression Technology (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
Polypeptides and Host Cells
[0034] As indicated above, the present invention provides and utilizes polypeptides having tyrosine ammonia lyase activity and high substrate specificity towards tyrosine. This makes them particularly suitable for the production of p-coumaric acid and other hydroxycinnamic acids.
[0035] Particularly, the polypeptides employed according to the invention are polypeptides selected from the group consisting of: [0036] i) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1); [0037] ii) a polypeptide comprising an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1); or [0038] iii) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1), wherein 1 or more, such as about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted, and/or inserted.
[0039] According to certain embodiments, a polypeptide according to the invention is a polypeptide according to i). Accordingly, a polypeptide according to the invention may be a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1). According to particular embodiments, a polypeptide according to i) comprises an amino acid sequence set forth in SEQ ID NO: 1. According other particular embodiments, a polypeptide according to i) comprises an amino acid sequence set forth in SEQ ID NO: 2. According to yet other particular embodiments, a polypeptide according to i) comprises an amino acid sequence set forth in SEQ ID NO: 3.
[0040] According to other certain embodiments, a polypeptide according to the invention is a polypeptide according to ii). Accordingly, a polypeptide according to the invention may be a polypeptide comprising an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1).
[0041] According to particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 80%, such as at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1). According to other particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 85%, such as at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1). According to other particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 90%, such as at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1). According to other particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 95%, such as at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1).
[0042] According to particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. According to more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 80%, such as at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. According to other more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 85%, such as at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. According to other more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 90%, such as at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. According to other more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 95%, such as at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1.
[0043] According to particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 2. According to more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 80%, such as at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 2. According to other more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 85%, such as at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 2. According to other more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 90%, such as at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 2. According to other more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 95%, such as at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 2.
[0044] According to particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 3. According to more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 80%, such as at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 3. According to other more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 85%, such as at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 3. According to other more particular embodiments, a polypeptide according to ii) comprises an amino acid sequence which has at least about 90%, such as at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 3. According to other more particular embodiments, a polypeptide according to the invention comprises an amino acid sequence which has at least about 95%, such as at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 3.
[0045] Preferably, a polypeptide according to ii) has tyrosine ammonia lyase activity. More preferably, a polypeptide according to ii) has a tyrosine ammonia lyase activity similar to that of the polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1).
[0046] According to certain embodiment, a polypeptide according to ii) has tyrosine ammonia lyase activity similar to that of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1. According to certain other embodiments, a polypeptide according to ii) has tyrosine ammonia lyase activity similar to that of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2. According to certain other embodiments, a polypeptide according to ii) has tyrosine ammonia lyase activity similar to that of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3. With similar tyrosine ammonia lyase activity it is meant that the polypeptide according to ii) has at least about 10%, such as at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 100%, at least about 200%, at least about 200%, at least about 400% or at least about 800%, of the ammonia lyase activity of the reference polypeptide (e.g., SEQ ID NO: 1).
[0047] The tyrosine ammonia lyase activity may for instance be determined in accordance to the following method: Enzymatic assays are performed in 200 L volumes in wells in a UV transparent 96-well plate, by following the increase in absorbance at 315 nm (pHCA) using spectrophotometry or HPLC with UV detection. The reaction mixtures contain 2 g of purified protein and are initiated by adding 1 mM tyrosine or 6 mM after equilibration to 30 C. The enzymatic activity is calculated as U/g, where U is defined as mol substrate converted per minute. Negative controls contain no purified protein. Kinetic constants Km and vmax are determined from assays containing 1.56 M to 200 M tyrosine. See also Kyndt et al. (2002).
[0048] As determined in accordance with Example 2, the values for K.sub.m (M), k.sub.cat (min.sup.1) and k.sub.cat/K.sub.m (mM.sup.1 s.sup.1) for the tyrosine ammonia lyase derived from Flavobacterium johnsoniae (SEQ ID NO: 1) using tyrosine as substrate are 5.7, 1.27 and 3.71, respectively. Each of these kinetic parameters may serve as reference parameter to determine the tyrosine ammonia lyase activity of the polypeptide according to ii), however, k.sub.cat/K.sub.m is preferred.
[0049] As determined in accordance with Example 2, the values for K.sub.m (M), k.sub.cat (min.sup.1) and k.sub.cat/K.sub.m (mM.sup.1 s.sup.1) for the tyrosine ammonia lyase derived from Herpetosiphon aurantiacus (SEQ ID NO: 2) using tyrosine as substrate are 16, 3.10 and 3.29, respectively. Each of these kinetic parameters may serve as reference parameter to determine the tyrosine ammonia lyase activity of the polypeptide according to ii), however, k.sub.cat/K.sub.m is preferred.
[0050] According to certain embodiments, a polypeptide according to ii) shows tyrosine ammonia lyase activity expressed as k.sub.cat/K.sub.m of at least about 3.2 mM.sup.1 s.sup.1, such as at least about 3.25 mM.sup.1 s, at least about 3.29 mM.sup.1 s.sup.1, at least about 3.5 mM.sup.1 s.sup.1, at least about 3.6 mM.sup.1 s.sup.1, at least about 3.65 mM.sup.1 s.sup.1 or at least about 3.7 mM.sup.1 s.sup.1.
[0051] According to certain embodiments, a polypeptide according to ii) has an affinity (K.sub.m) towards phenylalanine of at least about 4000 M, such as at least about 5000 M, at least about 6000 M or at least about 6500 M.
[0052] For improved substrate specificity towards tyrosine, a polypeptide according to ii) preferably comprises the amino acid sequence set forth in SEQ ID NO: 4 or 5. The sequence LIRSHSSG (SEQ ID NO: 4) defines the region within the tyrosine ammonia lyase derived from Flavobacterium johnsoniae (SEQ ID NO: 1) conferring the substrate specificity towards tyrosine, whereas the sequence AIWYHKTG (SEQ ID NO: 5) defines the region within the tyrosine ammonia lyases derived from Herpetosiphon aurantiacus (SEQ ID NO: 2 or 3) conferring the substrate specificity towards tyrosine. Therefore, according to certain embodiments, a polypeptide according to ii) comprises the amino acid sequence set forth in SEQ ID NO: 4. According to certain other embodiments, a polypeptide according to ii) comprises the amino acid sequence set forth in SEQ ID NO: 5.
[0053] According to other certain embodiments, a polypeptide according to the invention is a polypeptide according to iii). Accordingly, a polypeptide according to the invention may be a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1), wherein 1 or more, such as 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, or 150 or more, amino acid residues are substituted, deleted, and/or inserted. According to particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1), wherein about 1 to about 150, such as about 1 to about 140, about 1 to about 130, about 1 to about 120, about 1 to about 110, about 1 to about 100, about 1 to about 90, about 1 to about 80, about 1 to about 70, about 1 to about 60, about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1), wherein about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to other more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1), wherein about 1 to about 30, such as about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to other more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1), wherein about 1 to about 25, such as about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted.
[0054] According to particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 1, wherein about 1 to about 150, such as about 1 to about 140, about 1 to about 130, about 1 to about 120, about 1 to about 110, about 1 to about 100, about 1 to about 90, about 1 to about 80, about 1 to about 70, about 1 to about 60, about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about to about 3, amino acid residues are substituted, deleted and/or inserted. According to more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 1, wherein about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to other more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 1, wherein about 1 to about 30, such as about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to other more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 1, wherein about 1 to about 25, such as about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted.
[0055] According to other particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 2, wherein about 1 to about 150, such as about 1 to about 140, about 1 to about 130, about 1 to about 120, about 1 to about 110, about 1 to about 100, about 1 to about 90, about 1 to about 80, about 1 to about 70, about 1 to about 60, about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 2, wherein about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to other more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 2, wherein about 1 to about 30, such as about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to other more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 2, wherein about 1 to about 25, such as about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted.
[0056] According to particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 3, wherein about 1 to about 150, such as about 1 to about 140, about 1 to about 130, about 1 to about 120, about 1 to about 110, about 1 to about 100, about 1 to about 90, about 1 to about 80, about 1 to about 70, about 1 to about 60, about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 3, wherein about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to other more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 3, wherein about 1 to about 30, such as about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted. According to other more particular embodiments, a polypeptide according to iii) comprises an amino acid sequence set forth in SEQ ID NO: 3, wherein about 1 to about 25, such as about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted.
[0057] It is understood that the foregoing values generally define the total number of alterations to the reference polypeptide (i.e. SEQ ID NO: 1, 2 or 3). The alterations may solely be amino acid substitutions, be it conserved or non-conserved substitutions, or both. They may solely be amino acid deletions. They may solely be amino acid insertions. The alterations may be a mix of these specific alterations, such as amino acid substitutions and amino acid insertions.
[0058] Preferably, a polypeptide according to iii) has tyrosine ammonia lyase activity. More preferably, a polypeptide according to iii) has a tyrosine ammonia lyase activity similar to that of the polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1). According to certain embodiment, a polypeptide according to iii) has tyrosine ammonia lyase activity similar to that of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1. According to certain other embodiments, a polypeptide according to iii) has tyrosine ammonia lyase activity similar to that of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2. According to certain other embodiments, a polypeptide according to iii) has tyrosine ammonia lyase activity similar to that of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3. With similar tyrosine ammonia lyase activity it is meant that the polypeptide according to iii) has at least about 10%, such as at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 100%, at least about 200%, at least about 200%, at least about 400% or at least about 800%, of the ammonia lyase activity of the reference polypeptide (i.e. SEQ ID NO: 1, 2 or 3).
[0059] The tyrosine ammonia lyase activity may for instance be determined in accordance to the following method: Enzymatic assays are performed in 200 L volumes in wells in a UV transparent 96-well plate, by following the increase in absorbance at 315 nm (pHCA) using spectrophotometry or HPLC with UV detection. The reaction mixtures contain 2 g of purified protein and are initiated by adding 1 mM tyrosine or 6 mM after equilibration to 30 C. The enzymatic activity is calculated as U/g, where U is defined as mol substrate converted per minute. Negative controls contain no purified protein. Kinetic constants K.sub.m and vmax are determined from assays containing 1.56 M to 200 M tyrosine. See also Kyndt et al. (2002).
[0060] As shown in Example 2, the values for K.sub.m (M), k.sub.cat (min.sup.1) and k.sub.cat/K.sub.m (mM.sup.1 s.sup.1) for the tyrosine ammonia lyase derived from Flavobacterium johnsoniae (SEQ ID NO: 1) using tyrosine as substrate are 5.7, 1.27 and 3.71, respectively. Each of these kinetic parameters may serve as reference parameter to determine the tyrosine ammonia lyase activity of the polypeptide according to iii), however, k.sub.cat/K.sub.m is preferred.
[0061] As shown in Example 2, the values for K.sub.m (M), k.sub.cat (min.sup.1) and k.sub.cat/K.sub.m (mM.sup.1 s.sup.1) for the tyrosine ammonia lyase derived from Herpetosiphon aurantiacus (SEQ ID NO: 2) using tyrosine as substrate are 16, 3.10 and 3.29, respectively. Each of these kinetic parameters may serve as reference parameter to determine the tyrosine ammonia lyase activity of the polypeptide according to iii), however, k.sub.cat/K.sub.m is preferred.
[0062] According to certain embodiments, a polypeptide according to iii) shows tyrosine ammonia lyase activity expressed as k.sub.cat/K.sub.m of at least about 3.2 mM.sup.1 s.sup.1, such as at least about 3.25 mM.sup.1 s.sup.1, at least about 3.29 mM.sup.1 s.sup.1, at least about 3.5 mM.sup.1 s.sup.1, at least about 3.6 mM.sup.1 s.sup.1, at least about 3.65 mM.sup.1 s.sup.1 or at least about 3.7 mM.sup.1 s.sup.1.
[0063] According to certain embodiments, a polypeptide according to iii) has an affinity (K.sub.m) towards phenylalanine of at least about 4000 M, such as at least about 5000 M, at least about 6000 M or at least about 6500 M.
[0064] For improved substrate specificity towards tyrosine, a polypeptide according to iii) preferably comprises the amino acid sequence set forth in SEQ ID NO: 4 or 5. The sequence LIRSHSSG (SEQ ID NO: 4) defines the region within the tyrosine ammonia lyase derived from Flavobacterium johnsoniae (SEQ ID NO: 1) conferring the substrate specificity towards tyrosine, whereas the sequence AIWYHKTG (SEQ ID NO: 5) defines the region within the tyrosine ammonia lyase derived from Herpetosiphon aurantiacus (SEQ ID NO: 2 or 3) conferring the substrate specificity towards tyrosine. Therefore, according to certain embodiments, a polypeptide according to iii) comprises the amino acid sequence set forth in SEQ ID NO: 4. According to certain other embodiments, a polypeptide according to iii) comprises the amino acid sequence set forth in SEQ ID NO: 5.
[0065] The polypeptide may be employed in accordance with the invention in isolated form, such as in purified form. The polypeptide may for instance be expressed by a recombinant host cell, and then purified. Techniques and means for the purification of polypeptides produced by a recombinant host cell are well know in the art. For example, in order to facilitate purification, an amino acid motif comprising several histidine residues, such as at least 6, may be inserted at the C- or N-terminal end of the polypeptide. A non-limiting example of such amino acid motif is provided in SEQ ID NO: 11. Various purification kits for histidine-tagged polypeptides are available from commercial sources such as Qiagen, Hilden, Germany; Clontech, Mountain View, Calif., USA; Bio-Rad, Hercules, Calif., USA and others.
[0066] Alternatively, The polypeptide may be chemically synthezised. Techniques for chemical peptide synthesis are well know and include Liquid-phase synthesis and Solid-phase synthesis.
[0067] The polypeptide can also be employed in accordance with the invention as part of a recombinant host cell. Such recombinant host cells are described in more details below.
[0068] It is understood that the details given herein with respect to a polypeptide apply to all aspects of the invention.
[0069] The present invention also provides a recombinant host cell comprising (e.g. expressing) a polypeptide as detailed herein. Generally, the polypeptide according to the invention will be heterologous to the host cell, which means that the polypeptide is normally not found in or made (i.e. expressed) by the host cell, but derived from a different species. Therefore, the present invention provides a recombinant host cell according to the present invention comprises a heterologous polypeptide selected from the group consisting of: [0070] i) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1); [0071] ii) a polypeptide comprising an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1); or [0072] iii) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1), wherein 1 or more, such as about 1 to about 50, about 1 to about 40, about 1 to about 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, amino acid residues are substituted, deleted and/or inserted.
[0073] Recombinant host cells in accordance with the invention can be produced from any suitable host organism, including single-celled or multicellular microorganisms such as bacteria, yeast, fungi, algae and plant, and higher eukaryotic organisms including nematodes, insects, reptiles, birds, amphibians and mammals.
[0074] Bacterial host cells are selected from Gram-positive and Gram-negative bacteria. Non-limiting examples for Gram-negative bacterial host cells include species from the genera Escherichia, Erwinia, Klebsiella and Citrobacter. Non-limiting examples of Gram-positive bacterial host cells include species from the genera Bacillus, Lactococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Streptococcus, and Cellulomonas.
[0075] According to certain embodiments, the recombinant host cell is a bacterium, which may be a bacterium of the genus Bacillus, Lactococcus, Lactobacillus, Clostridium, Corynebacterium, Geobacillus, Streptococcus, Pseudomonas, Streptomyces, Escherichia, Shigella, Acinetobacter, Citrobacter, Salmonella, Klebsiella, Enterobacter, Erwinia, Kluyvera, Serratia, Cedecea, Morganella, Hafnia, Edwardsiella, Providencia, Proteus, or Yersinia.
[0076] According to particular embodiments, the recombinant host cell is a bacterium of the genus Bacillus. Non-limiting examples of a bacteria of the genus Bacillus are Bacillus subtitlis, Bacillus amyloliquefaciens, Bacillus licheniformis, and Bacillus mojavensis. According to more particular embodiments, the recombinant host cell is Bacillus subtitlis. According to other more particular embodiments, the recombinant host cell is Bacillus licheniformis.
[0077] According to other particular embodiments, the recombinant host cell is a bacterium of the genus Lactococcus. A non-limiting example of a bacterium of the genus Lactococcus is Lactococcus lactis. According to more particular embodiments, the recombinant host cell is Lactococcus lactis.
[0078] According to other particular embodiments, the recombinant host cell is a bacterium of the genus Corynebacterium. A non-limiting example of a bacterium of the genus Corynebacterium is Corynebacterium glutamicum. According to more particular embodiments, the recombinant host cell is Corynebacterium glutamicum.
[0079] According to other particular embodiments, the recombinant host cell is a bacterium of the genus Streptomyces. A non-limiting examples of a bacterium of the genus Streptomyces are Streptornyces lividans, Streptomyces coelicolor, or Streptomyces griseus. According to more particular embodiments, the recombinant host cell is Streptomyces lividans. According to other more particular embodiments, the recombinant host cell is Streptomyces coelicolor. According to other more particular embodiments, the recombinant host cell is Streptomyces griseus.
[0080] According to other particular embodiments, the recombinant host cell is a bacterium of the genus Pseudomonas. A non-limiting example of a bacterium of the genus Pseudomonas is Pseudomonas putida. According to more particular embodiments, the recombinant host cell is Pseudomonas putida.
[0081] According to other particular embodiments, the recombinant host cell is a bacterium of the genus Escherichia. A non-limiting example of a bacterium of the genus Escherichia is Escherichia coli. According to more particular embodiments, the recombinant host cell is Escherichia coli.
[0082] Yeast host cells may be derived from e.g., Saccharomyces, Pichia, Schizosacharomyces, Zygosaccharomyces, Hansenula, Pachyosolen, Kluyveromyces, Debaryomyces, Yarrowia, Candida, Cryptococcus, Komagataella, Lipomyces, Rhodospiridium, Rhodotorula, or Trichosporon.
[0083] According to certain embodiments, the recombinant host cell is a yeast, which may be a yeast is of the genus Saccharomyces, Pichia, Schizosacharomyces, Zygosaccharomyces, Hansenula, Pachyosolen, Kluyveromyces, Debaryomyces, Yarrowia, Candida, Cryptococcus, Komagataella, Lipomyces, Rhodospiridium, Rhodotorula, or Trichosporon.
[0084] According to particular embodiments, the recombinant host cell is a yeast of the genus Saccharomyces. A non-limiting example of a yeast of the genus Saccharomyces is Saccharomyces cerevisiae. According to more particular embodiments, the recombinant host cell is Saccharomyces cerevisiae.
[0085] According to particular embodiments, the recombinant host cell is a yeast of the genus Pichia. Non-limiting example of a yeast of the genus Pichia are Pichia pastoris and pichia kudriavzevii. According to more particular embodiments, the recombinant host cell is Pichia pastoris. According to other more particular embodiments, the recombinant host cell is pichia kudriavzevii.
[0086] Fungi host cells may be derived from, e.g., Aspergillus.
[0087] According to certain embodiments, the recombinant host cell is a fungus, such as a fungi of the genus Aspergillus. Non-limiting examples of a fungus of the genus Aspergillus are Aspergillus Oryzae, Aspergillus niger or Aspergillus awamsii. According to more particular embodiments, the recombinant host cell is Aspergillus Oryzae. According to other more particular embodiments, the recombinant host cell is Aspergillus niger. According to other more particular embodiments, the recombinant host cell is Aspergillus awamsii.
[0088] Algae host cells may be derived from, e.g., Chlamydomonas, Haematococcus, Phaedactylum, Volvox or Dunaliella.
[0089] According to certain embodiments, the recombinant host cell is an alga, which may be an algae of the genus Chlamydomonas, Haematococcus, Phaedactylum, Volvox or Dunaliella.
[0090] According to particular embodiments, the recombinant host cell is an alga cell of the genus Chlamydomonas. A non-limiting example of an alga of the genus Chlamydomonas is Chlamydomonas reinhardtii.
[0091] According to particular embodiments, the recombinant host cell is an alga cell of the genus Haematococcus. A non-limiting example of an alga of the genus Haematococcus is Haematococcus pluvialis.
[0092] According to other particular embodiments, the recombinant host cell is an alga cell of the genus Phaedactylum. A non-limiting example of an alga of the genus Phaedactylum is Phaedactylum tricornatum.
[0093] A plant host cell may be derived from, e.g., soybean, rapeseed, sunflower, cotton, corn, tobacco, alfalfa, wheat, barley, oats, sorghum, lettuce, rice, broccoli, cauliflower, cabbage, parsnips, melons, carrots, celery, parsley, tomatoes, potatoes, strawberries, peanuts, grapes, grass seed crops, sugar beets, sugar cane, beans, peas, rye, flax, hardwood trees, softwood trees, and forage grasses.
[0094] According to certain embodiments, the recombinant host cell is a plant cell, such as a plant cell selected from the group consisting of soybean, rapeseed, sunflower, cotton, corn, tobacco, alfalfa, wheat, barley, oats, sorghum, lettuce, rice, broccoli, cauliflower, cabbage, parsnips, melons, carrots, celery, parsley, tomatoes, potatoes, strawberries, peanuts, grapes, grass seed crops, sugar beets, sugar cane, beans, peas, rye, flax, hardwood trees, softwood trees, and forage grasses.
[0095] Generally, a recombinant host cell according to the invention has been genetically modified to express a polypeptide as detailed herein, which means that an exogenous nucleic acid molecule, such as a DNA molecule, which comprises a nucleotide sequence encoding said polypeptide has been introduced in the host cell. Techniques for introducing exogenous nucleic acid molecule, such as a DNA molecule, into the various host cells are well-known to those of skill in the art, and include transformation (e.g., heat shock or natural transformation), transfection, conjugation, electroporation and microinjection.
[0096] Accordingly, a host cell according to the invention comprises an exogenous nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide as detailed herein.
[0097] In order to facilitate expression of the polypeptide in the host cell, the exogenous nucleic acid molecule may comprise suitable regulatory elements such as a promoter that is functional in the host cell to cause the production of an mRNA molecule and that is operably linked to the nucleotide sequence encoding said polypeptide.
[0098] Promoters useful in accordance with the invention are any known promoters that are functional in a given host cell to cause the production of an mRNA molecule. Many such promoters are known to the skilled person. Such promoters include promoters normally associated with other genes, and/or promoters isolated from any bacteria, yeast, fungi, alga or plant cell. The use of promoters for protein expression is generally known to those of skilled in the art of moleculer biology, for example, see Sambrook et al., Molecular cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989. The promoter employed may be inducible. The term inducible used in the context of a promoter means that the promoter only directs transcription of an operably linked nucleotide sequence if a stimulus is present, such as a change in temperature or the presence of a chemical substance (chemical inducer). As used herein, chemical induction according to the present invention refers to the physical application of a exogenous or endogenous substance (incl. macromolecules, e.g., proteins or nucleic acids) to a host cell. This has the effect of causing the target promoter present in the host cell to increase the rate of transcription. Alternatively, the promoter employed may be constitutive. The term constitutive used in the context of a promoter means that the promoter is capable of directing transcription of an operably linked nucleotide sequence in the absence of stimulus (such as heat shock, chemicals etc.).
[0099] Non-limiting examples of promoters functional in bacteria, such as Bacillus subtilis, Lactococcus lactis or Escherichia coli, include both constitutive and inducible promoters such as T7 promoter, the beta-lactamase and lactose promoter systems; alkaline phosphatase (phoA) promoter, a tryptophan (trp) promoter system, tetracycline promoter, lambda-phage promoter, ribosomal protein promoters; and hybrid promoters such as the tac promoter. Other bacterial and synthetic promoters are also suitable.
[0100] Non-limiting examples of promoters functional in yeast, such as Saccharomyces cerevisiae, include xylose promoter, GAL and GAL10 promoters, TEF promoter, and pgk1 promoter.
[0101] Non-limiting examples of promoters functional in fungi, such as Aspergillus Oryzae or Aspergillus niger, include promotors derived from the gene encoding Aspergillus oryzae TAKA amylase, Aspergillus niger neutral -amylase, Aspergillus niger acid stable -amylase, Aspergillus niger or Aspergillus awamsii glucoamylase (gluA), Aspergillus niger acetamidase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphatase isomerase, Rhizopus meihei aspartic proteinase, and Rhizopus meiheilipase.
[0102] Non-limiting examples of promoters functional in alga, such as Haematococcus pluvialis, include the CaMV35S promoter, the SV40 promoter, and promoter of the Chlamydomonas reinhardtii RBCS2 gene and the promoter of the Volvox carteri ARS gene.
[0103] Non-limiting examples of promoters functional in plant cells include the Lactuca sative psbA promoter, the tabacco psbA promoter, the tobacco rrn16 PEP+NEP promoter, the CaMV 35S promoter, the 19S promoter, the tomate E8 promoter, the nos promoter, the Mac promoter, and the pet E promoter or the ACT1 promoter.
[0104] Besides a promoter, the exogenous nucleic acid molecule may further comprise at least one regulatory element selected from a 5 untranslated region (5UTR) and 3 untranslated region (3 UTR). Many such 5 UTRs and 3 UTRs derived from prokaryotes and eukaryotes are well known to the skilled person. Such regulatory elements include 5 UTRs and 3 UTRs normally associated with other genes, and/or 5 UTRs and 3 UTRs isolated from any bacteria, yeast, fungi, alga or plant cell.
[0105] If the host cell is a prokaryotic organism, the 5 UTR usually contains a ribosome binding site (RBS), also known as the Shine Dalgarno sequence which is usually 3-10 base pairs upstream from the initiation codon. Meanwhile, if the host cell is an eukaryotic organism the 5 UTR usually contains the Kozak consensus sequence. An eukaryotic 5 UTR may also contain cis-acting regulatory elements.
[0106] The exogenous nucleic acid molecule may be a vector or part of a vector, such as an expression vector. Normally, such a vector remains extrachromosomal within the host cell which means that it is found outside of the nucleus or nucleoid region of the host cell.
[0107] It is also contemplated by the present invention that the exogenous nucleic acid molecule is stably integrated into the genome of the host cell. Means for stable integration into the genome of a host cell, e.g., by homologous recombination, are well known to the skilled person.
[0108] In order to prevent degradation of the hydroxycinnamic acids produced by a method of the present invention involving the use of recombinant host cells, a recombinant host cell, especially a recombinant bacterial host cell such as Bacillus subtilis or Lactococcus lactis, may further be genetically modified by inactivating a gene or gene cluster encoding a polypeptide having phenolic acid decarboxylase (PAD) activity. By inactivating or inactivation of a gene or gene cluster it is intended that the gene or cluster of interest (e.g. the gene cluster encoding a polypeptide having phenolic acid decarboxylase (PAD) activity) is not expressed in a functional protein form. Techniques for inactivating a gene or gene cluster are well-known to those of skill in the art, and include random mutagenesis, site specific mutagenesis, recombination, integration and others.
[0109] According to certain embodiments, the recombinant host cell does not express a polypeptide having phenolic acid decarboxylase (PAD) activity.
[0110] According to cartain embodiments, the recombinant host cell has been genetically modified to inactivate a gene or gene cluster encoding a polypeptide having phenolic acid decarboxylase (PAD) activity.
[0111] According to particular embodiments, the recombinant host cell is a bacterium of the genus bacillus, such as bacillus subtiltis, or lactococcus, such as Lactococcus lactis, which has been genetically modified to inactivate the padC (or padA) gene.
[0112] According to other particular embodiments, the recombinant host cell is a yeast of the genus Saccharomyces, such as Saccharomyces cerevisiae, which has been genetically modified to inactivate the padi gene.
[0113] According to other certain embodiments, the recombinant host cell does not contain within its genome a gene or gene cluster encoding a polypeptide having phenolic acid decarboxylase (PAD) activity.
[0114] It is understood that the details given herein with respect to a recombinant host cell apply to other aspects of the invention, in particular to the methods and uses according to the invention, which are described in more detail below.
Methods and Uses
[0115] The present invention provides methods and uses for producing hydroxycinnamic acids. Particularly, a method for producing a hydroxycinnamic acid of general formula I
##STR00003##
the method comprises deaminating a compound of general formula II
##STR00004##
using a polypeptide as detailed herein, which may be selected from the group consisting of:
[0116] i) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g., SEQ ID NO: 1);
[0117] ii) a polypeptide comprising an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g. SEQ ID NO: 1); or
[0118] iii) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3 (e.g. SEQ ID NO: 1), wherein 1 or more, such as about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted;
[0119] wherein R.sub.1, R.sub.2 and R.sub.3 independently are selected from the group consisting of hydrogen (H), hydroxyl (OH), C.sub.1-6-alkyl and C.sub.1-6-Alkoxy, provided that at least one of R.sub.1, R.sub.2 and R.sub.3 is hydroxyl (OH); and R.sub.4 is selected from the group consisting of hydrogen (H) and C.sub.1-6-alkyl.
[0120] Deamination or deaminating as used herein means that the amine group on the alpha carbon atom in the compound according to general formula II is removed.
[0121] Within the context of the present invention, R.sub.1 may be hydrogen, hydroxyl, C.sub.1-6-alkyl or C.sub.1-6-Alkoxy. According to certain embodiments, R.sub.1 is hydrogen. According to other certain embodiments, R.sub.1 is hydroxyl. According to other certain embodiments, R.sub.1 is C.sub.1-6-alkyl, such as methyl or ethyl. According to other certain embodiments, R.sub.1 is C.sub.1-6-Alkoxy, such as methoxyl (OCH.sub.3).
[0122] Within the context of the present invention, R.sub.2 may be hydrogen, hydroxyl, C.sub.1-6-alkyl or C.sub.1-6-Alkoxy. According to certain embodiments, R.sub.2 is hydrogen. According to other certain embodiments, R.sub.2 is hydroxyl. According to other certain embodiments, R.sub.2 is C.sub.1-6-alkyl, such as methyl or ethyl. According to other certain embodiments, R.sub.2 is C.sub.1-6-Alkoxy, such as methoxyl (OCH.sub.3).
[0123] Within the context of the present invention, R.sub.3 may be hydrogen, hydroxyl, C.sub.1-6-alkyl or C.sub.1-6-Alkoxy. According to certain embodiments, R.sub.3 is hydrogen. According to other certain embodiments, R.sub.3 is hydroxyl. According to other certain embodiments, R.sub.3 is C.sub.1-6-alkyl, such as methyl or ethyl. According to other certain embodiments, R.sub.3 is C.sub.1-6-Alkoxy, such as methoxyl (OCH.sub.3).
[0124] Within the context of the present invention, R.sub.4 may be hydrogen or C.sub.1-6-alkyl. According to certain embodiments, R.sub.4 is hydrogen. According to other certain embodiments, R.sub.4 is C.sub.1-6-alkyl, such as methyl (CH.sub.3) or ethyl (CH.sub.2CH.sub.3).
[0125] According to particular embodiments, the method is for producing p-coumaric acid (R.sub.1H, R.sub.2OH, R.sub.3H, R.sub.4H), caffeic acid (R.sub.1H, R.sub.2OH, R.sub.3OH, R.sub.4H), ferulic acid (R.sub.1OCH.sub.3, R.sub.2OH, R.sub.3H, R.sub.4H) or sinapic acid (R.sub.1OCH.sub.3, R.sub.2OH, R.sub.3OCH.sub.3, R.sub.4H). According to more particular embodiments, the method is for producing p-coumaric acid (R.sub.1H, R.sub.2OH, R.sub.3H, R.sub.4H). According to other more particular embodiments, the method is for producing of caffeic acid (R.sub.1H, R.sub.2OH, R.sub.3OH, R.sub.4H). According to other more particular embodiments, the method is for producing ferulic acid (R.sub.1OCH.sub.3, R.sub.2OH, R.sub.3H, R.sub.4H). According to other more particular embodiments, the method is for producing sinapic acid (R.sub.1OCH.sub.3, R.sub.2OH, R.sub.3OCH.sub.3, R.sub.4H).
[0126] Suitable conditions for the deamination reaction are well known to the skilled person. Typically, the deamination reaction takes place at a temperature ranging from about 23 to about 60 C., such as from about 25 to about 40 C., such as at about 37 C. The deamination reaction may take place at a pH ranging from pH 4.0 to pH 14.0, such as from about pH 6 to about pH 11, or from about pH 7 to about pH 9.5, e.g. at pH 6.0, pH pH 7.0, pH. 7.5, pH 8.0, pH 8.5, pH 9.0, pH 9.5, pH 10.0, pH 10.5 or pH 11.0.
[0127] Moreover, the present invention provides a method for producing a hydroxcinnamic acid of general formula I as defined above, the method comprises the step of: [0128] a) contacting a recombinant host cell as detailed herein with a medium comprising a fermentable carbon substrate and/or a compound of the general formula II as defined above.
[0129] The medium employed may be any conventional medium suitable for culturing the host cell in question, and may be composed according to the principles of the prior art. The medium will usually contain all nutrients necessary for the growth and survival of the respective host cell, such as carbon and nitrogen sources and other inorganic salts. Suitable media, e.g. minimal or complex media, are available from commercial suppliers, or may be prepared according to published receipts, e.g. the American Type Culture Collection (ATCC) Catalogue of strains. Non-limiting standard medium well known to the skilled person include Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth, MS broth, Yeast Peptone Dextrose, BMMY, GMMY, or Yeast Malt Extract (YM) broth, which are all commercially available. A non-limiting example of suitable media for culturing bacterial cells, such as B. subtilis, L. lactis or E. coli cells, including minimal media and rich media such as Luria Broth (LB), M9 media, M17 media, SA media, MOPS media, Terrific Broth, YT and others. Suitable media for culturing eukaryotic cells, such as yeast cells, are RPMI 1640, MEM, DMEM, all of which may be supplemented with serum and/or growth factors as required by the particular host cell being cultured. The medium for culturing eukaryotic cells may also be any kind of minimal media such as Yeast minimal media.
[0130] The fermentable carbon substrate may be any suitable carbon substrate know in the art, and in particularly any carbon substrate commonly used in the cultivation of microorganisms and/or fermentation. Non-limiting examples of suitable fermentable carbon substates include carbohydrates (e.g., C5 sugars such as arabinose or xylose, or C6 sugars such as glucose), glycerol, glycerine, acetate, dihydroxyacetone, one-carbon source, methanol, methane, oils, animal fats, animal oils, plant oils, fatty acids, lipids, phospholipids, glycerolipids, monoglycerides, diglycerides, triglycerides, renewable carbon sources, polypeptides (e.g., a microbial or plant protein or peptide), yeast extract, component from a yeast extract, peptone, casaminoacids or any combination of two or more of the foregoing.
[0131] According to certain embodiments, the carbon substate is selected from the group consisting of C5 sugars (such as arabinose or xylose), C6 sugars (such as glucose or fructose), lactose, sucrose, glycerol, glycerine, acetate, yeast extract, component from a yeast extract, peptone, casaminoacids or combinations thereof.
[0132] According to certain embodiments, the medium comprises glucose.
[0133] According to certain other embodiments, the medium comprises glycerol.
[0134] According to certain other embodiments, the medium comprises acetate.
[0135] It is also contemplated to use starch as a carbon substrate. Depending on the microorganism used, the metabolization of starch may require the supplementation of beta-glucosidase, such as the beta-glucosidase from Neurospora crassa, to the medium. Alternatively, a recombination host cell according to the invention may be further genetically modified to express a beta-glucosidase, such as the beta-glucosidase from Neurospora crassa.
[0136] When a fermentable carbon substrate is employed it is thus possible that the recombinant host cell produces the hydroxycinnamic acid according to the invention directly from such primary carbon substrate.
[0137] Therefore, according to certain embodiments, the method for producing a hydroxcinnamic acid of general formula I as defined above comprises the step of: [0138] a) contacting a recombinant host cell as detailed herein with a medium comprising a fermentable carbon substrate.
[0139] According to certain other embodiments, the method for producing a hydroxcinnamic acid of general formula I as defined above comprises the step of: [0140] a) contacting a recombinant host cell as detailed herein with a medium comprising a compound of the general formula II as defined above.
[0141] According to certain other embodiments, the method for producing a hydroxcinnamic acid of general formula I as defined above comprises the step of: [0142] a) contacting a recombinant host cell as detailed herein with a medium comprising a fermentable carbon substrate and a compound of the general formula II as defined above.
[0143] The addition of exogenous tyrosine to the medium has shown to increase the production yield of the hydroxcinnamic acid (notably p-coumaric acid). See Table 4 below.
[0144] The method may further comprise step b) culturing the recombinant host cell under suitable conditions for the production of the hydroxcinnamic acid.
[0145] Suitable conditions for culturing the respective host cell are well known to the skilled person. Typically, the recombinant host cell is cultured at a temperature ranging from about 23 to about 60 C., such as from about 25 to about 40 C., such as at about 37 C. The pH of the medium may range from pH 4.0 to pH 14.0, such as from about pH 6 to about pH 11, or from about pH 7 to about pH 9.5, e.g. at pH 6.0, pH pH 7.0, pH. 7.5, pH 8.0, pH 8.5, pH 9.0, pH 9.5, pH 10.0, pH 10.5 or pH 11.0.
[0146] The method may further comprise step c) recovering the hydroxcinnamic acid. The hydroxcinnamic acid may be recovered by conventional method for isolation and purification chemical compounds from a medium. Well-known purification procedures include centrifugation or filtration, precipitation, and chromatographic methods such as e.g. ion exchange chromatography, gel filtration chromatography, etc.
[0147] The present invention further provides the use of a polypeptide as detailed herein in the production of a hydroxycinnamic acid, and particularly in the production of a hydroxycinnamic acid is of the general formula I. According to more particular embodiments, the present invention provides the use a polypeptide as detailed herein in the production of p-coumaric acid.
Certain Definitions
[0148] Tyrosine ammonia lyase activity as used herein refers to the ability of a polypeptide to catalysed the conversion of L-tyrosine into p-coumaric acid.
[0149] Polypeptide, and protein are used interchangeably herein to denote a polymer of at least two amino acids covalently linked by an amide bond, regardless of length or post-transiational modification (e.g., glycosylation, phosphorylation, lipidation, myristilation, ubiquitination, etc.). Included within this definition are D- and L-amino acids, and mixtures of D- and L-amino acids.
[0150] Nucleic acid or polynucleotide are used interchangeably herein to denote a polymer of at least two nucleic acid monomer units or bases (e.g., adenine, cytosine, guanine, thymine) covalently linked by a phosphodiester bond, regardless of length or base modification.
[0151] Recombinant or non-naturally occurring when used with reference to, e.g., a host cell, nucleic acid, or polypeptide, refers to a material, or a material corresponding to the natural or native form of the material, that has been modified in a manner that would not otherwise exist in nature, or is identical thereto but produced or derived from synthetic materials and/or by manipulation using recombinant techniques. Non-limiting examples include, among others, recombinant host cells expressing genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise expressed at a different level.
[0152] Substitution or substituted refers to modification of the polypeptide by replacing one amino acid residue with another, for instance the replacement of an Arginine residue with a Glutamine residue in a polypeptide sequence is an amino acid substitution.
[0153] Conservative substitution refers to a substitution of an amino acid residue with a different residue having a similar side chain, and thus typically involves substitution of the amino acid in the polypeptide with amino acids within the same or similar class of amino acids. By way of example and not limitation, an amino acid with an aliphatic side chain may be substituted with another aliphatic amino acid, e.g., alanine, valine, leucine, and isoleucine; an amino acid with hydroxyl side chain is substituted with another amino acid with a hydroxyl side chain, e.g., serine and threonine; an amino acid having an aromatic side chain is substituted with another amino acid having an aromatic side chain, e.g., phenylalanine, tyrosine, tryptophan, and histidine; an amino acid with a basic side chain is substituted with another amino acid with a basic side chain, e.g., lysine and arginine; an amino acid with an acidic side chain is substituted with another amino acid with an acidic side chain, e.g., aspartic acid or glutamic acid; and a hydrophobic or hydrophilic amino acid is replaced with another hydrophobic or hydrophilic amino acid, respectively.
[0154] Non-conservative substitution refers to substitution of an amino acid in a polypeptide with an amino acid with significantly differing side chain properties. Non-conservative substitutions may use amino acids between, rather than within, the defined groups and affects (a) the structure of the peptide backbone in the area of the substitution (e.g., proline for glycine) (b) the charge or hydrophobicity, or (c) the bulk of the side chain. By way of example and not limitation, an exemplary non-conservative substitution can be an acidic amino acid substituted with a basic or aliphatic amino acid; an aromatic amino acid substituted with a small amino acid; and a hydrophilic amino acid substituted with a hydrophobic amino acid.
[0155] Deletion or deleted refers to modification of the polypeptide by removal of one or more amino acids in the reference polypeptide. Deletions can comprise removal of 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids, up to 10% of the total number of amino acids, or up to 20% of the total number of amino acids making up the polypeptide while retaining enzymatic activity and/or retaining the improved properties of an engineered enzyme. Deletions can be directed to the internal portions and/or terminal portions of the polypeptide, in various embodiments, the deletion can comprise a continuous segment or can be discontinuous.
[0156] Insertion or inserted refers to modification of the polypeptide by addition of one or more amino acids to the reference polypeptide. Insertions can comprise addition of 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids. Insertions can be in the internal portions of the polypeptide, or to the carboxy or amino terminus. The insertion can be a contiguous segment of amino acids or separated by one or more of the amino acids in the reference polypeptide.
[0157] Host cell as used herein refers to a living cell or microorganism that is capable of reproducing its genetic material and along with it recombinant genetic material that has been introduced into ite.g., via heterologous transformation.
[0158] Expression includes any step involved in the production of a polypeptide (e.g., encoded enzyme) including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0159] As used herein, vector refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it has been linked. One type of vector is a plasmid, which refers to a circular double stranded nucleic acid loop into which additional nucleic acid segments can be ligated. Certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as expression vectors. Certain other vectors are capable of facilitating the insertion of a exogenous nucleic acid molecule into a genome of a host cell. Such vectors are referred to herein as transformation vectors. In general, vectors of utility in recombinant nucleic acid techniques are often in the form of plasmids. In the present specification, plasmid and vector can be used interchangeably as the plasmid is the most commonly used form of a vector. Large numbers of suitable vectors are known to those of skill in the art and commercially available.
[0160] As used herein, promoter refers to a sequence of DNA, usually upstream (5) of the coding region of a structural gene, which controls the expression of the coding region by providing recognition and binding sites for RNA polymerase and other factors which may be required for initiation of transcription. The selection of the promoter will depend upon the nucleic acid sequence of interest. A promoter functional in a host cell refers to a promoter which is capable of supporting the initiation of transcription in said cell, causing the production of an mRNA molecule.
[0161] As used herein, operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence operably linked to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequence. A promoter sequence is operably-linked to a gene when it is in sufficient proximity to the transcription start site of a gene to regulate transcription of the gene.
[0162] Percentage of sequence identity, % sequence identity and percent identity are used herein to refer to comparisons between an amino acid sequence and a reference amino acid sequence. The % sequence identify, as used herein, is calculated from the two amino acid sequences as follows: The sequences are aligned using Version 9 of the Genetic Computing Group's GAP (global alignment program), using the default BLOSUM62 matrix (see below) with a gap open penalty of 12 (for the first null of a gap) and a gap extension penalty of 4 (for each additional null in the gap). After alignment, percentage identity is calculated by expressing the number of matches as a percentage of the number of amino acids in the reference amino acid sequence.
[0163] The following BLOSUM62 matrix is used:
TABLE-US-00001 Ala 4 Arg 1 5 Asn 2 0 Asp 2 2 1
Cys 0 3 3 3 9 Gln 1 1 0 0 3
Glu 1 0 0 2 4 2
Gly
2 0 1 3 2 2 6 His 2 0 1 1 3 0 0 2 8 Ile 1 3 3 3 1 3 3 4 3 4 Leu 1 2 3 4 1 2 3 4 3 2 Lys 1 2 0 1 3 1 1 2 1 3 Met 1 1 2 3 1 0 2 3 2 1 Phe 2 3 3 3 2 3 3 3 1 0 Pro 1 2 2 1 3 1 1 2 2 3 Ser 1 1 1 0 1 0 0 0 1
Thr 0 1 0 1 1 1 1 2 2 1 Trp 3
4 4 2 2 3 2 2 3 Tyr 2 2 2 3 2 1 2 3 2 1 Val 0 3 3 3 1 2 2 3 3 3 Ala Arg Asn Asp Cys Gln Glu Gly His Ile Ala Arg Asn Asp Cys Gln Glu Gly His Ile Leu 4 Lys 2 5 Met 2 1
Phe 0 3 0
Pro 3 1 2 4 7 Ser 2 0 1 2 1 4 Thr 1 1 1 2 1 1 5 Trp 2 3 1 1 4 3 2 11 Tyr 1 2 1 3 3 2 2 2 7 Val 1 2 1 1 2 2 0 3 1
Leu Lys Met Phe Pro Ser Thr Trp Tyr Val
indicates data missing or illegible when filed
[0164] Reference sequence or reference amino acid sequence refers to a defined sequence to which another sequence is compared. In the context of the present invention a reference amino acid sequence may be an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3.
[0165] Alkyl, alkyl radical or group as used herein means saturated, linear or branched hydrocarbons, which can be unsubstituted or mono- or polysubstituted. Thus, unsaturated alkyl is understood to encompass alkenyl and alkinyl groups, like e.g. CHCHCH.sub.3 or CCCH.sub.3, while saturated alkyl encompasses e.g. CH.sub.3 and CH.sub.2CH.sub.3. C.sub.1-6-alkyl includes C.sub.1-2-alkyl, C.sub.1-3-alkyl, C.sub.1-4-alkyl, and C.sub.1-5-alkyl, as well as C.sub.2-3-alkyl, C.sub.2-4-alkyl, C.sub.2-5-alkyl, C.sub.3-4-alkyl, C.sub.3-5-alkyl, and C.sub.4-5-alkyl. In these radicals, C.sub.1-2-alkyl represents Cr or C.sub.2-alkyl, C.sub.1-3-alkyl represents C.sub.1-, C.sub.2- or C.sub.3-alkyl, C.sub.1-4-alkyl represents Cr, C.sub.2-, C.sub.3- or C.sub.4-alkyl, C.sub.1-5-alkyl represents C.sub.1-, C.sub.2-, C.sub.3-, C.sub.4-, or C.sub.5-alkyl, C.sub.1-alkyl represents Cr, C.sub.2-, C.sub.3-, C.sub.4-, C.sub.5- or C-alkyl. The alkyl radicals may be methyl, ethyl, vinyl (ethenyl), propyl, allyl (2-propenyl), 1-propinyl, methylethyl, butyl, 1-methylpropyl, 2-methylpropyl, 1,1-dimethylethyl, pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, hexyl, 1-methylpentyl, if substituted also CHF.sub.2, CF.sub.3 or CH.sub.2OH etc.
[0166] Alkoxy, alkoxy radical or group as used herein means an alkyl singular bonded to oxygen. C.sub.1-alkoxy includes C.sub.1-2-alkoxy, C.sub.1-3-alkoxy, C.sub.1-4-alkoxy, and C.sub.1-5-alkoxy, as well as C.sub.2-3-alkoxy, C.sub.2-4-alkoxy, C.sub.2-5-alkoxy, C.sub.3-4-alkoxy, C.sub.3-5-alkoxy, and C.sub.4-5-alkoxy. In these radicals, C.sub.1-2-alkoxy represents C1- or C2-alkoxy, C.sub.1-3-alkoxy represents C.sub.1-, C.sub.2- or C.sub.3-alkoxy, C.sub.1-4-alkyl represents C.sub.1-, C.sub.2-, C.sub.3- or C.sub.4-alkoxy, C.sub.1-5-alkoxy represents C.sub.1-, C.sub.2-, C.sub.3-, C4-, or C.sub.5-alkoxy, C1-alkoxy represents C.sub.1-, C.sub.2-, C.sub.3-, C.sub.4-, C.sub.5- or C.sub.6-alkoxy. The alkoxy radicals may be methoxy, ethoxy, propoxy, butoxy, pentyloxy or hexyloxy.
[0167] Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and sub ranges within a numerical limit or range are specifically included as if explicitly written out.
[0168] Having generally described this invention, a further understanding can be obtained by reference to certain specific examples, which are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwise specified.
EXAMPLES
[0169] As demonstared in the following examples, the polypeptides according to the invention show higher TAL activity compared to previously characterized enzymes, in particularly when expressed in a commonly used production yeast, as well as in selected industrially relevant bacteria. They are active in Gram-positive bacteria, Gram-negative bacteria as wells as in eukaryotic microorganisms. The improved activities have also been shown in in vitro biochemical assays.
[0170] As further demonstrated below, the polypeptides according to the invention have very specific TAL activity over PAL activity. The polypeptides according to the invention thus allow the enhanced biologically production of hydroxycinnamic acids such as pHCA. Furthermore, the production can be enhanced by the disruption of degradation pathways and the addition of tyrosine either extracellularly.
Example 1Expression of TAL and PAL Enzymes in E. coli
[0171] A number of previously described and newly identified enzymes were expressed in the Gram negative bacterium E. coli for the comparison of enzymatic activities.
[0172] A number of genes encoding aromatic amino acid lyases were codon optimized using standard algorithms for expression in E. coli available by GeneArt (Life Technologies). The enzymes are listed in table 1. RsTAL, RmXAL, SeSam8, TcXAL, PcXAL, and RtXAL have previously been described. FjXAL, HaXAL1 and HaXAL2 have not been described before.
TABLE-US-00002 TABLE 1 Overview of enzymes Len SEQ Name Organism Protein GI (aa) ID NO FjXAL Flavobacterium johnsoniae 146298870 506 1 HaXAL1 Herpetosiphon aurantiacus 159898407 552 2 HaXAL2 Herpetosiphon aurantiacus 159898927 552 3 RsTAL Rhodobacter sphaeroides 126464011 523 RmXAL Rhodotorula mucilaginosa/ 129592 713 Thodotorula rubra SeSam8 Saccharothrix espanaensis 433607630 510 RtXAL Rhodosporidium toruloides/ 129593 716 Rhodotorula glutinis TcXAL Trichosporon cutaneum 77375521 689 PcXAL Phanerochaete chrysosporium 259279291 737
[0173] Each of the genes were amplified by polymerase chain reaction (PCR) using the primers indicated in Table 6. The final PCR products were inserted inthe pCDFDuet-1 vector (Novagen/Life Technologies), which had been digested by NdeI and BgIII using Gibson reaction (New England Biolabs) (selected plasmids are shown in
[0174] Plasmids carrying the genes were transformed into electrocompetent E. coli BL21(DE3)pLysS cells (Life Technologies) and selected on LBplates containing 50 ug/mL streptomycin. The strains were grown in M9 minimal media containing glucose as a carbon source, and expression was induced by adding 1 mM IPTG at an optical density at 600 nm of 0.6. After three hours of growth at 30 C. the cultures were supplemented with 2 mM tyrosine, phenylalanine or histidine. After further 24 hours, samples were withdrawn for determination of the optical density at 600 nm and for the isolation of the supernatant.
[0175] The concentration of pHCA and CA in the supernatant was quantified by high performance (HPLC) and compared to chemical standards. HPLC was done on a Thermo setup using a HS-F5 column and mobile phases: 5 mM ammonium formate pH 4.0 (A) and acetonitrile (B) at 1.5 mL min-1, using a gradient elution starting at 5% B. From 0.5 min after injection to 7 min, the fraction of B increased linearly from 5% to 60%, and between 9.5 min and 9.6 the fraction of B decreased back to 5%, and remaining there until 12m pHCA and CA were quantified by measuring absorbance at 333 nm and 277 nm, respectively. The production was tested without addition of precursors or the addition of either phenylalanine or tyrosine to the growth medium.
[0176] Table 2 shows the specific production of pHCA and CA in the various media. The specific production was calculated as micromolar (M) concentration per unit of optical density of the culture at 600 nm, and standard deviations were calculated based on triplicate experiments. HaXAL1, HaXAL2 and FjXAL are the most specific enzymes and those that reach the highest yields.
TABLE-US-00003 TABLE 2 Specific production of pHCA and CA in Escherichia coli (M OD600-1 +/ standard deviation). M9 + Tyr M9 + Tyr M9 + Phe M9 + Phe M9 + His M9 + His pHCA CA pHCA CA pHCA CA No enzyme 0 0 0 0 0 0 0 0 0 0 0 0 RmXAL 330 9.7 30 14 9.9 0.3 450 89 27 3.8 35 1 TcXAL 730 23 11 13 22 0.8 510 92 PcXAL 180 21 2.8 2.7 18 4.9 170 7.7 RtXAL 170 10 5.9 6.1 7.2 1.3 180 16 RsTAL 91 13 <0.05 24 5 4.7 0.4 26 3 0 0 SeSam8 540 50 0 0 76 6 18 5.9 110 26 0 0 FjXAL 440 100 0 0 76 29 0.5 0.4 91 20 0 0 HaXAL1 130 26 0 0 36 14 1.1 0.2 HaXAL2 .sup.61 9.7 0 0 20 4.4 0.4 0.02
[0177] pHCA may be formed from the natural metabolism of E. coli, but the production is enhanced by the addition of exogenous tyrosine.
Example 2Enzymatic Characterization of Enzymes
[0178] Four of the enzymes were further purified by His-tag purification as follows. A DNA linker (5 phosphorylated oligonucleotides CBJP559 and CBJP560, Table 5) was inserted in place of the sequence between the NdeI and BgIII site in plasmid pCDFDuet-1. This would result in the addition of the amino acids MAHHHHHHENLYFQ (SEQ ID NO: 11) to the N-terminal end of the polypeptides. The resulting plasmid was amplified with primers CBJP575 and CBJP576 (table 5) and the genes were amplified and combined using the Gibson reaction (New England Biolabs). The PCR amplification used the same reverse primers as in example 1, but the forward primers matching the His-tag site of the linker (Table 5). Plasmids carrying the genes (e.g. FjXAL,
[0179] Strains expressing His-tagged versions of the enzymes were grown in LB media overnight at 37 C. and diluted into fresh LB media with 1 mM IPTG and growth was propagated overnight (approximately 18 h) at 30 C. Cells were harvested by centrifugation at 8000 rpm for 8 minutes, and disrupted by shearing into a buffer (50 mM Tris-HCl, 10 mM imidazole, 500 mM NaCl, 10% glycerol, pH 7.5). The homogenate was clarified by centrifugation at 10000 g for 10 min at 4 C., and the supernatant was loaded onto Ni2+-NTA resin column on an kta Pure system connected to a F9-C fraction collector (GE). Finally the fractions containing the purified polypeptide was dialyzed overnight against a buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl and 10% glycerol, flash-frozen in liquid nitrogen and stored at 80 C.
[0180] Enzymatic assays were performed in 200 L volumes in wells in a UV transparent 96-well plate, by following the increase in absorbance at 315 nm (pHCA) or 295 nm (CA). The reaction mixtures contained 2 g of purified protein and were initiated by adding 1 mM tyrosine or 6 mM after equilibration to 30 C. The enzymatic activity was calculated as U/g, where U is defined as mol substrate converted per minute. No conversion was observed in the absence of enzymes under any conditions. Kinetic constants K.sub.m and vmax were determined from assays containing 1.56 M to 200 M tyrosine or 193 M to 25 mM phenylalanine.
[0181] As table 3 shows, HaXAL1 and FjXAL had the highest catalytic efficiencies (k.sub.cat/K.sub.m (mM1 s1)) towards tyrosine. They also had a very low affinity towards phenylalanine. The most specific enzyme was FjXAL.
TABLE-US-00004 TABLE 3 In vitro kinetics of selected TAL enzymes. Km Kcat Kcat/Km Enzyme Substrate (M) (min1) (mM1 s1) TAL/PAL RsTAL Tyr 5.6 10.4 3.10 125 Rhodobacter Phe 2400 3.58 0.0246 sphaeroides SeSam8 Tyr 4.8 0.84 2.93 730 Saccharothrix Phe 2200 0.53 0.00403 espanaensis HaXAL1 Tyr 16 3.10 3.29 540 Herpetosiphon Phe 22000 7.68 0.00610 auranticus FjXAL Tyr 5.7 1.27 3.71 3000 Flavobacterium Phe 6600 0.49 0.00123 johnsoniae
Example 3Expression of TAL Enzymes in S. Cerevisiae
[0182] A number of the previously characterized enzymes were characterized when expressed in Saccharomyces cerevisiae. Genes encoding HaXAL1 and FjXAL were synthesized with codon optimization for S. cerevisiae available by GeneArt (Life Technologies), and were named HaXAL1 Sc and FjXALSc. Genes were amplified using the oligonucleotide (refer to specific name) shown in Table 6, and inserted by uracil-excision into the vector pCfB132 together with the PPGK1 promoter amplified by primers PPGK1_fw and PPGK1_rv (Jensen et al., 2014). The finished plasmids were transformed into Saccharomyces cerevisiae CEN.PK102-5B (MAT a ura3-52 his31 leu2-3/112 MAL2-8c SUC2) using a standard lithium acetate transformation protocol and selected for on synthetic drop-out media plates lacking uracil.
[0183] Cells were grown in SC medium without uracil, and diluted into Delft medium or Feed-In-Time (FIT) medium (m2p-labs) supplemented with leucine and histidine. 10 mM tyrosine was added to some cultures as indicated in Table 4. After 72 h of incubation at 30 C. with shaking, samples were taken for the analysis of optical density at 600 nm and for clarification of the supernatant, which was analyzed by HPLC as described in example 1. The specific production was calculated as micromolar (M) concentration per unit of optical density of the culture at 600 nm and is shown in Table 4.
[0184] It was evident that HaXAL and FjXAI are the superior enzymes for catalyzing the TAL reaction, while not having background PAL reaction, even when tyrosine is added exogenously.
[0185] As demonstrated in Table 4, pHCA may be formed from the natural metabolism of S. cerevisiae, but the production may be enhanced by the addition of exogenous tyrosine.
TABLE-US-00005 TABLE 4 Specific production of pHCA and CA in Saccharomyces cerevisiae (M OD600-1 +/ standard deviation). Delft Delft + Tyr FIT FIT + Tyr Enzyme pHCA CA pHCA CA pHCA CA pHCA CA PcXAL 46 5.1 17 4.5 200 29 16 5.8 150 65 75 24 200 37 32 14 RtXAL 20 0.8 18 0.9 89 13 21 1.9 .sup.67 4.3 88 2 110 8.8 57 4.1 SeSam8 3.1 0.2 0 0 6.9 0.8 0 0 .sup.17 1.9 0 0 5.6 1.3 0 0 HaXAL1 31 3.2 0 0 110 15 0 0 140 13 0 0 120 10 0 0 HaXAL1 Sc 33 2.6 0 0 140 6.3 0 0 92 16 0 0 160 35 0 0 HaXAL2 22 5.2 0 0 .sup.20 6.3 0 0 30 16 0 0 26 11 0 0 FjXAL 30 3.5 0 0 120 16 0 0 130 16 0 0 120 19 0 0 FjXALSc 41 1.6 0 0 150 18 0 0 130 9.7 0 0 200 18 0 0
TABLE-US-00006 TABLE 5 Oligonucleotides used for amplification and synthetic double-stranded DNA Name Target Usage direction CBJP483 RsTAL Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP484 RsTAL Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP487 RmXAL Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP488 RmXAL Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP535 SeSam8 Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP536 SeSam8 Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP553 HaXAL1 Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP554 HAXAL1 Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP555 FjXAL Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP556 FjXAL Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP559 Linker for Restriction Ligation forward His6 in NdeI + BglII CBJP560 Linker for Restriction Ligation reverse His6 in NdeI + BglII CBJP561 His-RsTAL Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2::His6 NdeI CBJP564 His-SeSam8 Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2::His6 NdeI CBJP573 His-HaXAL1 Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2::His6 NdeI CBJP574 His-FjXAL Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2::His6 NdeI CBJP575 pCDFDuet-1 Gibson assembly, Forward Expression in E. coli CBJP576 pCDFDuet-1 Gibson assembly, Reverse modified Expression in E. coli with His-tag linker PPGK1_rv PGK1 Uracil Excision, PG2R promoter Expression in S. cerevisiae PPGK1_fw PGK1 Uracil Excision, PV2F promoter Expression in S. cerevisiae CBJP637 SeSam8 Uracil Excision, GP2F Expression in S. cerevisiae CBJP638 SeSam8 Uracil Excision, GV2R Expression in S. cerevisiae CBJP645 HaXAL1 Uracil Excision, GP2F Expression in S. cerevisiae CBJP646 HaXAL1 Uracil Excision, GV2R Expression in S. cerevisiae CBJP647 FjXAL Uracil Excision, GP2F Expression in S. cerevisiae CBJP648 FjXAL Uracil Excision, GV2R Expression in S. cerevisiae CBJP649 HaXAL1Sc Uracil Excision, GP2F Expression in S. cerevisiae CBJP650 HaXAL1Sc Uracil Excision, GV2R Expression in S. cerevisiae CBJP651 FjXALSc Uracil Excision, GP2F Expression in S. cerevisiae CBJP652 FjXALSc Uracil Excision, GV2R Expression in S. cerevisiae CBJP741 RtXAL Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP742 RtXAL Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP743 TcXAL Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP744 TcXAL Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP752 HaXAL2 Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP753 HaXAL2 Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP754 RtXAL Uracil Excision, GP2F Expression in S. cerevisiae CBJP755 RtXAL Uracil Excision, GV2R Expression in S. cerevisiae CBJP762 HaXAL2 Uracil Excision, GP2F Expression in S. cerevisiae CBJP763 HaXAL2 Uracil Excision, GV2R Expression in S. cerevisiae CBJP812 PcXAL Gibson assembly, forward Gibson Duet Expression in E. coli vector MCS2 NdeI CBJP813 PcXAL Gibson assembly, reverse Gibson Duet Expression in E. coli vector MCS2 BglII CBJP815 PcXAL Uracil Excision, forward Expression in S. cerevisiae CBJP816 PcXAL Uracil Excision, reverse Expression in S. cerevisiae
TABLE-US-00007 TABLE 6 Overview of primer pairs used in the Examples For E. coli For His tag For S. cerevisiae Name Example 1 Example 2 Example 3 FjXAL CBJP555 CBJP574 CBJP647 CBJP556 CBJP556 CBJP648 HaXAL1 CBJP553 CBJP573 CBJP645 CBJP554 CBJP554 CBJP646 HaXAL2 CBJP752 CBJP762 CBJP753 CBJP763 RsTAL CBJP483 CBJP561 CBJP484 CBJP484 RmXAL CBJP487 CBJP488 SeSam8 CBJP535 CBJP564 CBJP637 CBJP536 CBJP536 CBJP638 RtXAL CBJP741 CBJP754 CBJP742 CBJP755 TcXAL CBJP743 CBJP744 PcXAL CBJP812 CBJP815 CBJP813 CBJP816 HaXAL1Sc CBJP649 CBJP650 FjXALSc CBJP651 CBJP652
Example 4Expression of TAL Enzymes in Lactococcus lactis
[0186] We have shown that selected TAL enzymes leads to production of p-coumaric acid when expressed in L. lactis.
[0187] The synthetic RsXA.sub.LI (protein GI 129592) and RmXA.sub.LI (protein GI 126464011) genes, codon optimized for Lactococcus lactis (GeneArt), were cloned into the nisin inducible expression vector pNZ8048 (Kuipers et al., 1998) as follows: RsXA.sub.LI (SEQ ID NO: 56) and RmXA.sub.LI (SEQ ID NO: 57) genes and the vector were PCR amplified using the primers listed in Table 7, and were assembled in a single-tube isothermal reaction using the Gibson Assembly Master Mix (New England Biolabs). Reaction products were ethanol-precipitated and suspended in double distilled water before transformation into L. lactis by electroporation as described by Holo and Nes (1995). The synthetic genes encoding SeSam8, R_XAL, HaXAL1 and FjXAL described in a previous example above were amplified by PCR using the primer pairs listed in Table 1, digested with specific restriction enzymes, and cloned in-between the NcoI and XbaI restriction sites of pNZ8048. The plasmids were obtained and maintained in L. lactis NZ9000 (Kuipers et al., 1998) and the gene sequences of the different constructs were verified by sequencing.
[0188] To assess pHCA production, TAL-expression vectors were transformed into a strain derived from NZ9000, but with deletion of the genes Idh and dhB (NZ9000ldhldhB). A control strain was also constructed by transformation of NZ9000ldhldhB with empty expression vector pNZ8048.
[0189] For molecular biology procedures, L. lactis strains were cultivated as batch cultures (flasks) without aeration in M17 medium (Difco, USA) supplemented with 0.5% glucose (w/v) at 30 C. To assess pHCA production, strains were grown as static cultures in chemically defined medium (CDM; Poolman and Konings, 1988) containing 1% glucose (wt/vol) without pH control (initial pH 6.5 or 7.0) and supplemented with 1.7 or 3.7 mM L-tyrosine. Plasmid selection was achieved by addition of 5 g mL.sup.1 chloramphenicol to the growth medium. Growth was monitored by measuring OD.sub.600. For heterologous expression of cloned tyrosine ammonia lyases, L. lactis strains were grown in CDM and nisin (1.5 g L.sup.1) was added at an OD.sub.600 of 0.3-0.4. Samples (1 mL) of cultures were collected at different points during growth; centrifuged (16,100g, 10 min, 4 C.) and the supernatants stored at 20 C. until analysis by HPLC as described in a previous example above.
[0190] Even though the genes encoding RXA.sub.LI and RmXA.sub.LI had been specifically codon optimized for L. lactis, FjXAL showed by far the highest specific production of pHCA (15 M OD.sub.600.sup.1). This corresponds to a five-fold increase in specific production over RmXA.sub.LI, the second-best enzyme. The productivities were lower than those achieved in E. coli, and the specific productivity of pHCA could be increased (24 MD.sub.600.sup.1) when the concentration of tyrosine in the media was increased (from 1.7 mM to 3.7 mM) and/or the pH of the medium was increased (from 6.5 to 7.0). RmXAL.sub.LI was the only enzyme resulting in production of CA.
[0191] Conclusively, the presented TAL enzymes result in specific production of pHCA when expressed in L. lactis. Furthermore, the production can be enhanced by manipulation of the supply of the precursor tyrosine and by manipulation of the pH of the growth medium.
TABLE-US-00008 TABLE7 Restric- Oligo- tion nucleotide Gene Direction Sequence site.sup.a LL-Pnis_1 GGTGAGTGCCTCCTTATAAT TTATTTTG (SEQIDNO:58) LL-Pnis_2 AAGCTTTCTTTGAACCAAAA TTAGAAAACC (SEQIDNO:59) LL-RsXAL-Fw RsTAL.sub.LI Forward CAAAATAAATTATAAGGAGG CACTCACCATGCTTGCTATG TCACCACCAAAACC (SEQIDNO:60) LL-RsXAL-Rv RsTAL.sub.LI Reverse GGTTTTCTAATTTTGGTTCA AAGAAAGCTTTTAAACTGGT GATTGTTGTAATAAATG (SEQIDNO:61) LL-RmXAL-Fw RmXAL.sub.LI Forward CAAAATAAATTATAAGGAGG CACTCACCATGGCTCCATCA GTTGATTCAATTGC (SEQIDNO:62) LL-RmXAL-Rv RmXAL.sub.LI Reverse GGTTTTCTAATTTTGGTTCA AAGAAAGCTTTTAAGCCATC ATTTTAACTAAAACTGG (SEQIDNO:63) LL-SeSam8-Fw SeSam8 Forward CATGTCATGACCCAGGTTGT BspHI TGAACG (SEQIDNO:64) LL-SeSam8-Rv SeSam8 Reverse GCTCTAGATTAGCCAAAATC Xbal TTTACCATC (SEQIDNO:65) LL-R_XAL-Fw R_XAL Forward GCGGTCTCCCATGCGTAGCG Bsal AACAGCTGAC (SEQIDNO:66) LL-R_XAL-Rv R_XAL Reverse GCTCTAGATTAGGCCAGCAG Xbal TTCAATCAG (SEQIDNO:67) LL-HaXAL1-Fw HaXAL1 Forward GCGGTCTCCCATGAGCACCA Bsal CCCTGATTCTG (SEQIDNO:68) LL-HaXAL1-Rv HaXAL1 Reverse GCTCTAGATTAGCGAAACAG Xbal AATAATACTACG (SEQIDNO:69) LL-FjXAL-Fw FjXAL Forward CATGTCATGAACACCATCAA BspHI CGAATATC (SEQIDNO:70) LL-FjXAL-Rv FjXAL Reverse GCTCTAGATTAATTGTTAAT Xbal CAGGTGGTC (SEQIDNO:71) .sup.aUnderlined sequences indicate the respective restriction site.
Example 5Production of p-Coumaric Acid in Bacillus subtilis
[0192] We have shown that expressing genes encoding tyrosine ammonia-lyases in Bacillus subtilis enables production of p-coumaric acid, and that the productivity is enhanced when the gene padC, encoding a phenolic acid decarboxylase, which is a p-coumaric acid degradative enzyme that results in the formation of 4-vinylphenol, is disrupted.
[0193] Genes encoding the tyrosine ammonia-lyases SeSam8 and FjXAL were expressed chromosomally in Bacillus subtilis as follows. Table 8 lists oligonucleotides used as primers in PCR reactions. A part (pel end) of the pel gen, the region downstream, an erythromycin resistance gene and the constitutive promoter Pcons from Bacillus subtilis strain AN214 (U.S. Pat. No. 8,535,911) were PCR amplified using primers CBJP680 and CBJP666. Another part of pel and the region upstream was amplified using primers CBJP667 and CBJP682 (pel front). SeSam8 was amplified using primers CBJP689 and CBJP690 and FjXAL was amplified using primers CBJP691 and CBJP692. PCR fragments were combined using splicing by overhang extension PCR (SOE-PCR), with pel end, pel front and either SeSam8 or FjXAL. The two resulting SOE-PCR products were individually integrated into a non-sporulating Bacillus subtilis 168 spoIIC deletion strain (Novozymes, US 2011/0306139 A1), selecting for resistance to 5 g mL.sup.1 erythromycin, resulting in strains CBJ1007 and CBJ1008.
[0194] The padC gene of these strains was furthermore disrupted (inactivated) by integration of a chloramphenicol resistance gene as follows. The chloramphenicol resistance gene of plasmid pC194 (Horinouchi and Weisblum, 1982) was amplified using primers CBJP835 and CBJP836. Regions surrounding padC was amplified using primer pair CBJP837/CBJP838 and CBJP839/CBJP840, respectively. The three fragments were purified from an agarose gel and combined by SOE-PCR. The SOE-PCR product was transformed into CBJ1007 and CBJ1008, and transformants were selected on LB agar plates with 0.2% glucose, 5 g mL.sup.1 erythromycin and 3 g mL.sup.1 chloramphenicol, resulting in strains CBJ1011 and CBJ1012.
[0195] To access the productivity, the strains 168 spoIIAC, CBJ1007, CBJ1008, CBJ1011 and CBJ1012 were grown in various media. Colonies were used to inoculate growth tubes with 5 mL LB media with 5 g mL.sup.1 erythromycin and 5 g mL.sup.1 chloramphenicol, which were placed shaking at 250 rpm at 37 C. overnight before being removed. Samples were withdrawn for HPLC analysis as described in example 1. 10 L of the cultures in LB media were used to inoculate growth tubes with 5 mL M9 media supplemented with 0.2% glucose and 50 mg L-tryptophan with or without 2 mM tyrosine. The tubes were aerated by shaking at 250 rpm at 37 C. overnight. Samples were withdrawn for HPLC analysis. p-coumaric acid was measured at 333 nm and 4-vinylphenol was measured at 277 nm.
[0196] Table 9 shows the productivity as M pHCA and 4-vinylphenol formed per cell measured at the optical density at 600 nm in a 1-cm light path for three replicates of each experiment. It is evident that the background strain does not produce p-coumaric acid and that the productivity reached is higher for the strain expressing FjXAL than SeSam8. Furthermore the productivity is increased in the strains were padC is disrupted (inactivated).
TABLE-US-00009 TABLE8 OligonucleotidesusedforPCRreactions CBJP666 CATGTTTCCTCTCCCTCTCA TTTTC (SEQIDNO:72) CBJP667 TAAGGTAATAAAAAAACACC TCC (SEQIDNO:73) CBJP680 TCATACCATTTTTCACAGGG (SEQIDNO:74) CBJP682 GTCTCACTTCCTTACTGCGT (SEQIDNO:75) CBJP689 GAAAATGAGAGGGAGAGGAA ACATGACCCAGGTTGTTGAA CG (SEQIDNO:76) CBJP690 GGAGGTGTTTTTTTATTACC TTATCAGCCAAAATCTTTAC CATCTGC (SEQIDNO:77) CBJP691 GAAAATGAGAGGGAGAGGAA ACATGAACACCATCAACGAA TATCTG (SEQIDNO:78) CBJP692 GGAGGTGTTTTTTTATTACC TTATCAATTGTTAATCAGGT GGTCTTTTACTTTCTG (SEQIDNO:79) CBJP835 CCCGCGCGAATATCGTCTGT CCTTCTTCAACTAACGGGGC AG (SEQIDNO:80) CBJP836 GAAGTACAGTAAAAGACTAA GGTTATGTTACAGTAATATT GAC (SEQIDNO:81) CBJP837 GACGGTTAACTCTGTCACAA GCG (SEQIDNO:82) CBJP838 CCTTAGTCTTTTACTGTACT TC (SEQIDNO:83) CBJP839 CGGAATCCAATATAGAAGAA TGG (SEQIDNO:84) CBJP840 GACAGACGATATTCGCGCGG G (SEQIDNO:85)
TABLE-US-00010 TABLE 9 Productivity of p-coumaric acid (pHCA) and 4-vinylphenol (4VP) in Bacillus subtilis strains grown in LB media and in M9 medium with 0.2% glucose (M9) or M9 with 2 mM tyrosine. LB M9 M9 with tyrosine Genotype pHCA 4VP pHCA 4VP pHCA 4VP spollAC 0 0 0 0 0 0 0 0 0 0 0 0 spollAC 8.7 0.71 0 0 0 0 0.25 0.021 0 0 0 0 pel:SeSam8 spollAC 170 23 1400 200 0 0 65 2.3 36 11 380 37 pel:FjXAL spollAC .sup.13 9.1 0 0 0.37 0.047 0 0 2.3 0.44 0 0 pel:SeSam8 padC spollAC 1000 380 0 0 51 11 0 0 310 26 0 0 pel:FjXAL padC
[0197] Conclusively, p-coumaric acid can be produced in Bacillus subtilis when expressing a gene encoding a tyrosine ammonia-lyase such as SeSam8 or FjXAL. FjXAL is more efficient in catalyzing this production than SeSam8. A disruption of the gene padC, and thereby a degradative pathway, furthermore enhances the productivity and eliminates 4-vinylphenol as a byproduct.
Example 6Production of Hydroxycinnamic Acids Other than p-Coumaric Acid
[0198] TAL enzymes have activity toward several aromatic compounds beyond tyrosine. Specifically, we here show that the tyrosine derivatives L-dopa (3,4-dihydroxyphenylalanine or (2S)-2-Amino-3-(3,4-dihydroxyphenyl)propanoic acid) and 3-O-methyldopa (L-3-Methoxytyrosine or 2-Amino-3-(4-hydroxy-3-methoxyphenyl)propanoic acid) are deaminated to caffeic acid and ferulic acid, respectively, by cells expressing selected genes encoding TAL enzymes.
[0199] E. coli strains described in Example 1 were used. M9 medium with 0.2% glucose and 0.5 mM IPTG also containing either tyrosine (204 M), L-dopa (194 M) or 3-O-methyldopa (262 M) was transferred as 3-mL aliquots into a 24-well deep-well plate (Enzyscreen). Aliquots were taken for HPLC before the wells were inoculated with 200 L of overnight cultures of the strains. The plates were placed at 37 C. with shaking for 16 hours. Samples of the supernatant were withdrawn after two rounds of centrifugation. The samples were subjected to HPLC along with chemical standards as described in Example 1. p-coumaric acid, caffeic acid and ferulic acid was measured by absorbance at 333 nm. Tyrosine, L-dopa and 3-O-methyldopa were measured by fluorescence (excitation at 274 nm, emission at 303 nm).
[0200] Table 10 shows the concentrations measured from the culture supernatants from duplicate experiments. There was no measurable product in the medium before inoculation.
TABLE-US-00011 TABLE 10 Titers (M) of p-coumaric acid, L-dopa and 3-O-methyldopa in supernatants of E. coli cultures expressing different TAL homologs. Cultures were grown in M9 medium with 0.2% glucose (M9) with different additions of substrates as indicated. Medium M9 + tyrosine M9 + L-dopa M9 + 3-O-methyldopa Product p-coumaric acid Caffeic acid Ferulic acid No Enzyme 0 0 0 0 0 0 SeSam8 102 7.8 5.3 1.1 0.5 0.2 HaXAL1 81 1.2 6.9 1.3 0.6 0.0 FjXAL 215 11.1 5.7 1.0 1.1 0.3
[0201] Conclusively, the enzymes HaXAL1 and FjXAL not only catalyze the deamination of tyrosine, but also catalyze the deamination of derivatives thereof. As an example hereof, the enzymes HaXAL1 and FjXAL are shown to use L-dopa and 3-O-methydopa, which for these particular substrates result in the formation of caffeic acid and ferulic acid. Thus, these enzymes may be used to produce hydroxycinnamic acids using tyrosine or derivatives thereof as substrate.
LIST OF REFERENCES CITED IN THE DESCRIPTION
[0202] Appert C., Logemann E., Hahlbrock K., Schmid J., and Amrhein N. (1994) Structural and catalytic properties of the four phenylalanine ammonia-lyase isoenzymes from parsley (petroselinum crispum nym.). Eur J Biochem 225: 491-499. [0203] Bartsch S., and Bornscheuer U. T. (2009) A single residue influences the reaction mechanism of ammonia lyases and mutases. Angew Chem Int Ed Engl 48: 3362-3365. [0204] Bartsch S., Wybenga G. G., Jansen M., Heberling M. M., Wu B., Dijkstra B. W., and Janssen D. B. (2013) Redesign of a phenylalanine aminomutase into a phenylalanine ammonia lyase. Chemcatchem 5:1797-1802. [0205] Berner M., Krug D., Bihlmaier C., Vente A., Muller R., and Bechthold A. (2006) Genes and enzymes involved in caffeic acid biosynthesis in the actinomycete saccharothrix espanaensis. J Bacteriol 188: 2666-2673. [0206] Chesters C., Wilding M., Goodall M., and Micklefield J. (2012) Thermal bifunctionality of bacterial phenylalanine aminomutase and ammonia lyase enzymes. Angew Chem Int Ed Engl 51: 4344-4348. [0207] Christenson S. D., Liu W., Toney M. D., and Shen B. (2003a) A novel 4-methylideneimidazole-5-one-containing tyrosine aminomutase in enediyne antitumor antibiotic C-1027 biosynthesis. J Am Chem Soc 125: 6062-6063. [0208] Christenson S. D., Wu W., Spies M. A., Shen B., and Toney M. D. (2003b) Kinetic analysis of the 4-methylideneimidazole-5-one-containing tyrosine aminomutase in enediyne antitumor antibiotic C-1027 biosynthesis. Biochemistry 42: 12708-12718. [0209] Holo H, and Nes I F. 1995. Transformation of Lactococcus by electroporation. Methods Mol. Biol. 47:195-199. [0210] Horinouchi S., and Weisblum B. (1982) Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible chloramphenicol resistance. J Bacteriol 150: 815-825. [0211] Jensen N. B., Strucko T., Kildegaard K. R., David F., Maury J., Mortensen U. H., Forster J., Nielsen J., Borodina I. (2014) EasyClone: method for iterative chromosomal integration of multiple genes in Saccharomyces cerevisiae. FEMS Yeast Res. 14(2):238-48 Jin M., Fischbach M. A., and Clardy J. (2006) A biosynthetic gene cluster for the acetyl-CoA carboxylase inhibitor andrimid. J Am Chem Soc 128: 10660-10661. [0212] Kyndt J. A., Meyer T. E., Cusanovich M. A., and Van Beeumen J. J. (2002) Characterization of a bacterial tyrosine ammonia lyase, a biosynthetic enzyme for the photoactive yellow protein. FEBS Lett 512: 240-244. [0213] Kuipers O P, de Ruyter P G G A, Kleerebezem M, and de Vos W M. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. J. Biotechnol. 64:15-21.
[0214] Poolman B, and Konings W N. 1988. Relation of growth of Streptococcus lactis and Streptococcus cremoris to amino acid transport. J. Bacteriol. 170:700-707. [0215] Rosler J., Krekel F., Amrhein N., and Schmid J. (1997) Maize phenylalanine ammonia-lyase has tyrosine ammonia-lyase activity. Plant Physiol 113: 175-179. [0216] Schroeder A. C., Kumaran S., Hicks L. M., Cahoon R. E., Halls C., Yu O., and Jez J. M. (2008) Contributions of conserved serine and tyrosine residues to catalysis, ligand binding, and cofactor processing in the active site of tyrosine ammonia lyase. Phytochemistry 69: 1496-1506. [0217] Strobel T., Al-Dilaimi A., Blom J., Gessner A., Kalinowski J., Luzhetska M., et al. (2012) Complete genome sequence of saccharothrix espanaensis DSM 44229(T) and comparison to the other completely sequenced pseudonocardiaceae. BMC Genomics 13: 465-2164-13-465. [0218] Walker K. D., Klettke K., Akiyama T., and Croteau R. (2004) Cloning, heterologous expression, and characterization of a phenylalanine aminomutase involved in taxol biosynthesis. J Biol Chem 279: 53947-53954. [0219] Williams J. S., Thomas M., and Clarke D. J. (2005) The gene stlA encodes a phenylalanine ammonia-lyase that is involved in the production of a stilbene antibiotic in photorhabdus luminescens TT01. Microbiology 151: 2543-2550. [0220] Xiang L., and Moore B. S. (2002) Inactivation, complementation, and heterologous expression of encP, a novel bacterial phenylalanine ammonia-lyase gene. J Biol Chem 277: 32505-32509. [0221] Zhu L., Cui W., Fang Y., Liu Y., Gao X., and Zhou Z. (2013) Cloning, expression and characterization of phenylalanine ammonia-lyase from rhodotorula glutinis. Biotechnol Lett 35:751-756. [0222] Zhu Y., Liao S., Ye J., and Zhang H. (2012) Cloning and characterization of a novel tyrosine ammonia lyase-encoding gene involved in bagremycins biosynthesis in streptomyces sp. Biotechnol Lett 34: 269-274.
Embodiments of the Invention
[0223] 1. Method for producing a hydroxycinnamic acid of general formula I
##STR00005## [0224] the method comprises deaminating a compound of general formula II
##STR00006## [0225] using a polypeptide selected from the group consisting of: [0226] i) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3; [0227] ii) a polypeptide comprising an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3; or [0228] iii) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3, wherein 1 or more, such as about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted; [0229] wherein R.sub.1, R.sub.2 and R.sub.3 independently are selected from the group consisting of hydrogen (H), hydroxyl (OH), C.sub.1-6-alkyl and C.sub.1-6-Alkoxy, provided that at least one of R.sub.1, R.sub.2 and R.sub.3 is hydroxyl (OH); and R.sub.4 is selected from the group consisting of hydrogen (H) and C.sub.1-6-alkyl. [0230] 2. The method according to item 1, wherein R.sub.2 is hydroxyl. [0231] 3. The method according to item 1 or 2, wherein R.sub.4 is hydrogen. [0232] 4. The method according to any one of items 1 to 3, wherein R.sub.1 is hydrogen. [0233] 5. The method according any one of items 1 to 4, wherein R.sub.3 is hydrogen or hydroxyl. [0234] 6. The method according to any one of items 1 to 5, wherein each of R.sub.1, R.sub.3 and R.sub.4 is hydrogen, and R.sub.2 is hydroxyl. [0235] 7. The method according to any one of items 1 to 5, wherein R.sub.1 is hydrogen, R.sub.2 is hydroxyl, R.sub.3 is hydroxyl and R.sub.4 is hydrogen. [0236] 8. The method according to any one of items 1 to 7, wherein the polypeptide according to ii) or iii) has tyrosine ammonia lyase activity. [0237] 9. The method according to any one of items 1 to 8, wherein the polypeptide according to ii) or iii) comprises the amino acid sequence set forth in SEQ ID NO: 4 or 5. [0238] 10. The method according to any one of items 1 to 9, wherein the polypeptide is in isolated form. [0239] 11. The method according to item 10, wherein the polypeptide is in purified form. [0240] 12. The method according to any one of items 1 to 9, wherein the polypeptide is expressed by a recombinant host cell. [0241] 13. The method according to item 12, wherein the recombinant host cell is a microorganism genetically modified to express the polypeptide. [0242] 14. The method according to item 12 or 13, wherein the recombinant host cell is selected from the group consisting of bacteria, yeasts, fungi, algae and plant cells. [0243] 15. The method according to item 12 or 13, wherein the recombinant host cell is a bacterium. [0244] 16. The method according to item 15, wherein the bacterium is a bacterium of the genus Bacillus, Lactococcus, Lactobacillus, Clostridium, Corynebacterium, Geobacillus, Streptococcus, Pseudomonas, Streptomyces, Escherichia, Shigella, Acinetobacter, Citrobacter, Salmonella, Klebsiella, Enterobacter, Erwinia, Kluyvera, Serratia, Cedecea, Morganella, Hafnia, Edwardsiella, Providencia, Proteus, or Yersinia. [0245] 17. The method according to item 15 or 16, wherein the bacterium is a bacterium of the genus Bacillus, Lactococcus, Pseudomonas or Corynebacterium. [0246] 18. The method according to item 15 or 16, wherein the bacterium is a bacterium of the genus Bacillus. [0247] 19. The method according to item 18, wherein the bacterium is Bacillus subtilis. [0248] 20. The method according to item 15 or 16, wherein the bacterium is a bacterium of the genus Lactococcus. [0249] 21. The method according to item 20, wherein the bacterium is Lactococcus lactis. [0250] 22. The method according to item 15 or 16, wherein the bacterium is a bacterium of the genus Pseudomonas. [0251] 23. The method according to item 22, wherein the bacterium is Pseudomonas putida. [0252] 24. The method according to item 15 or 16, wherein the bacterium is a bacterium of the genus Corynebacterium. [0253] 25. The method according to item 24, wherein the bacterium is Corynebacterium glutamicum. [0254] 26. The method according to item 15 or 16, wherein the bacterium is a bacterium of the genus Escherichia. [0255] 27. The method according to item 26, wherein the bacterium is Escherichia coli. [0256] 28. The method according to item 12 or 13, wherein the recombinant host cell is a yeast. [0257] 29. The method according to item 28, wherein the yeast is of the genus Saccharomyces, Pichia, Schizosacharomyces, Zygosaccharomyces, Hansenula, Pachyosolen, Kluyveromyces, Debaryomyces, Yarrowia, Candida, Cryptococcus, Komagataella, Lipomyces, Rhodospiridium, Rhodotorula, or Trichosporon. [0258] 30. The method according to item 28 or 29, wherein the yeast is a yeast of the genus Saccharomyces, or Pichia. [0259] 31. The method according to any one of items 28 to 30, wherein the yeast is selected from the group consisting of Saccharomyces cerevisiae, Pichia pastoris, and pichia kudriavzevii. [0260] 32. The method according to any one of items 28 to 31, wherein the yeast is Saccharomyces cerevisiae. [0261] 33. The method according to any one of items 28 to 31, wherein the yeast is Pichia pastoris. [0262] 34. The method according to item 12 or 13, wherein the recombinant host cell is a fungus. [0263] 35. The method according to item 34, wherein the fungus is a fungus of the genus Aspergillus. [0264] 36. The method according to item 34 or 35, wherein the fungus is Aspergillus Oryzae or Aspergillus niger. [0265] 37. The method according to item 12 or 13, wherein the recombinant host cell is an algae cell. [0266] 38. The method according to item 37, wherein the algae cells is an algae cell of the genus Haematococcus, Phaedactylum, Volvox or Dunaliella. [0267] 39. The method according to item 12 or 13, wherein the recombinant host cell is a plant cell. [0268] 40. The method according to item 39, wherein the plant cell is selected from the group consisting of soybean, rapeseed, sunflower, cotton, corn, tobacco, alfalfa, wheat, barley, oats, sorghum, lettuce, rice, broccoli, cauliflower, cabbage, parsnips, melons, carrots, celery, parsley, tomatoes, potatoes, strawberries, peanuts, grapes, grass seed crops, sugar beets, sugar cane, beans, peas, rye, flax, hardwood trees, softwood trees, and forage grasses. [0269] 41. The method according to any one of items 12 to 40, wherein said recombinant host cell does not express a polypeptide having phenolic acid decarboxylase (PAD) activity. [0270] 42. The method according to any one of items 12 to 41, wherein a gene or gene cluster encoding a polypeptide having phenolic acid decarboxylase (PAD) activity has been inactivated. [0271] 43. The method according to any one of items 12 to 41, wherein said recombinant host cell does not contain within its genome a gene or gene cluster encoding a polypeptide having phenolic acid decarboxylase (PAD) activity. [0272] 44. A recombinant host cell comprising a heterologous polypeptide selected from the group consisting of: [0273] i) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3; [0274] ii) a polypeptide comprising an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3; or [0275] iii) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3, wherein 1 to 50, such as 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, amino acid residues are substituted, deleted and/or inserted. [0276] 45. The method according to item 44, wherein the polypeptide according to ii) or iii) has tyrosine ammonia lyase activity. [0277] 46. The method according to item 44 or 45, wherein the polypeptide according to ii) or iii) comprises the amino acid sequence set forth in SEQ ID NO: 4 or 5. [0278] 47. The recombinant host cell according to any one of items 44 to 46, the host cell comprises an exogenous nucleic acid molecule comprising a nucleotide sequence encoding said polypeptide. [0279] 48. The recombinant host cell according to item 47, the exogenous nucleic acid molecule further comprises a promoter that is functional in the host cell to cause the production of an mRNA molecule and that is operably linked to the nucleotide sequence encoding said polypeptide. [0280] 49. The recombinant host cell according to item 48, the exogenous nucleic acid molecule further comprises at least one regulatory element selected from a 5 untranslated region (5UTR) and 3 untranslated region (3 UTR). [0281] 50. The recombinant host cell according to any one of items 47 to 49, wherein the exogenous nucleic acid molecule is a vector. [0282] 51. The recombinant host cell according to any one of items 47 to 49, wherein the exogenous nucleic acid molecule is stably integrated into the genome of the host cell. [0283] 52. The recombinant host cell according to any one of items 44 to 51, wherein the recombinant host cell is selected from the group consisting of bacteria, yeasts, fungi, algae and plant cells. [0284] 53. The recombinant host cell according to any one of items 44 to 52, wherein the recombinant host cell is a bacterium. [0285] 54. The recombinant host cell according to item 53, wherein the bacterium is a bacterium of the genus Bacillus, Lactococcus, Lactobacillus, Clostridium, Corynebacterium, Geobacillus, Streptococcus, Pseudomonas, Streptomyces, Escherichia, Shigella, Acinetobacter, Citrobacter, Salmonella, Klebsiella, Enterobacter, Erwinia, Kluyvera, Serratia, Cedecea, Morganella, Hafnia, Edwardsiella, Providencia, Proteus, or Yersinia. [0286] 55. The recombinant host cell according to item 53, wherein the bacterium is a bacterium of the genus Bacillus. [0287] 56. The recombinant host cell according to item 55, wherein the bacterium is Bacillus subtilis. [0288] 57. The recombinant host cell according to item 53, wherein the bacterium is a bacterium of the genus Lactococcus. [0289] 58. The recombinant host cell according to item 57, wherein the bacterium is Lactococcus lactis. [0290] 59. The recombinant host cell according to item 53, wherein the bacterium is a bacterium of the genus Pseudomonas. [0291] 60. The recombinant host cell according to item 59, wherein the bacterium is Pseudomonas putida. [0292] 61. The recombinant host cell according to item 53, wherein the bacterium is a bacterium of the genus Corynebacterium. [0293] 62. The recombinant host cell according to item 61, wherein the bacterium is Corynebacteriumg lutamicum. [0294] 63. The recombinant host cell according to item 53, wherein the bacterium is a bacterium of the genus Escherichia. [0295] 64. The recombinant host cell according to item 63, wherein the bacterium is Escherichia coli. [0296] 65. The recombinant host cell according to any one of items 44 to 52, wherein the recombinant host cell is a yeast. [0297] 66. The recombinant host cell according to item 65, wherein the yeast is of the genus Saccharomyces, Pichia, Schizosacharomyces, Zygosaccharomyces, Hansenula, Pachyosolen, Kluyveromyces, Debaryomyces, Yarrowia, Candida, Cryptococcus, Komagataella, Lipomyces, Rhodospiridium, Rhodotorula, or Trichosporon. [0298] 67. The recombinant host cell according to item 65 or 66, wherein the yeast is a yeast of the genus Saccharomyces or Pichia. [0299] 68. The recombinant host cell according to any one of items 65 to 67, wherein the yeast is selected from the group consisting of Saccharomyces cerevisiae, Pichia pastoris, and Pichia kudriavzevii. [0300] 69. The recombinant host cell according to any one of items 65 to 67, wherein the yeast is Saccharomyces cerevisiae. [0301] 70. The recombinant host cell according to any one of items 64 to 67, wherein the yeast is Pichia pastoris. [0302] 71. The recombinant host cell according to any one of items 44 to 52, wherein the recombinant host cell is a fungus. [0303] 72. The recombinant host cell according to item 71, wherein the fungus is a fungus of the genus Aspergillus. [0304] 73. The recombinant host cell according to item 71 or 72, wherein the fungus is Aspergillus Oryzae or Aspergillus niger. [0305] 74. The recombinant host cell according to any one of items 44 to 52, wherein the recombinant host cell is an algae cell. [0306] 75. The recombinant host cell according to item 74, wherein the algae cells is an algae cell of the genus Haematococcus, Phaedactylum, Volvox or Dunaliella. [0307] 76. The recombinant host cell according to any one of items 44 to 52, wherein the recombinant host cell is a plant cell. [0308] 77. The recombinant host cell according to item 76, wherein the plant cell is selected from the group consisting of soybean, rapeseed, sunflower, cotton, corn, tobacco, alfalfa, wheat, barley, oats, sorghum, lettuce, rice, broccoli, cauliflower, cabbage, parsnips, melons, carrots, celery, parsley, tomatoes, potatoes, strawberries, peanuts, grapes, grass seed crops, sugar beets, sugar cane, beans, peas, rye, flax, hardwood trees, softwood trees, and forage grasses. [0309] 78. The recombinant host cell according to any one of items 44 to 77, wherein said recombinant host cell does not express a polypeptide having phenolic acid decarboxylase (PAD) activity. [0310] 79. The recombinant host cell according to any one of items 44 to 78, wherein a gene or gene cluster encoding a polypeptide having phenolic acid decarboxylase (PAD) activity has been inactivated. [0311] 80. The recombinant host cell according to any one of items 44 to 78, wherein said recombinant host cell does not contain within its genome a gene or gene cluster encoding a polypeptide having phenolic acid decarboxylase (PAD) activity. [0312] 81. A method for producing a hydroxycinnamic acid of general formula I
##STR00007## [0313] the method comprises the step of: [0314] a) contacting a recombinant host cell according to any one of items 44 to 80 with a medium comprising a fermentable carbon substrate and/or a compound of the general formula II
##STR00008## [0315] wherein R.sub.1, R.sub.2 and R.sub.3 independently are selected from the group consisting of hydrogen (H), hydroxyl (OH), C.sub.1-6-alkyl and C.sub.1-6-Alkoxy, provided that at least one of R.sub.1, R.sub.2 and R.sub.3 is hydroxyl (OH); and R.sub.4 is selected from the group consisting of hydrogen (H) and C.sub.1-6-alkyl. [0316] 82. The method according to item 81, wherein R.sub.2 is hydroxyl. [0317] 83. The method according to item 81 or 82, wherein R.sub.4 is hydrogen. [0318] 84. The method according to any one of items 81 to 83, wherein R.sub.1 is hydrogen. [0319] 85. The method according any one of items 81 to 84, wherein R.sub.3 is hydrogen or hydroxyl. [0320] 86. The method according to any one of items 81 to 85, wherein each of R.sub.1, R.sub.3 and R.sub.4 is hydrogen, and R.sub.2 is hydroxyl. [0321] 87. The method according to any one of items 81 to 86, wherein R.sub.1 is hydrogen, R.sub.2 is hydroxyl, R.sub.3 is hydroxyl and R.sub.4 is hydrogen. [0322] 88 The method according to any one of items 81 to 87, further comprising the step of: [0323] b) culturing the recombinant host cell under suitable conditions for the production of the hydroxcinnamic acid. [0324] 89. The method according to any one of items 81 to 88, further comprising the step of: [0325] c) recovering the hydroxcinnamic acid. [0326] 90. Use of a polypeptide in the production of a hydroxycinnamic acid, said polypeptide being selected from the group consisting of: [0327] i) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3; [0328] ii) a polypeptide comprising an amino acid sequence which has at least about 70%, such as at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2 or 3; or [0329] iii) a polypeptide comprising an amino acid sequence set forth in SEQ ID NO: 1, 2 or 3, wherein 1 or more, such as about 1 to about 50, about 1 to about 40, about 1 to about 35, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, or about 1 to about 3, amino acid residues are substituted, deleted and/or inserted; [0330] 91. The use according to item 90, wherein the hydroxycinnamic acid is of the general formula I
##STR00009## [0331] wherein R.sub.1, R.sub.2 and R.sub.3 independently are selected from the group consisting of hydrogen (H), hydroxyl (OH), C.sub.1-6-alkyl and C.sub.1-6-Alkoxy, provided that at least one of R.sub.1, R.sub.2 and R.sub.3 is hydroxyl (OH); and R.sub.4 is selected from the group consisting of hydrogen (H) and C.sub.1-6-alkyl. [0332] 92. The use according to item 90 or 91, wherein the hydroxycinnamic acid is p-coumaric acid (R.sub.1H, R.sub.2OH, R.sub.3H, R.sub.4H).