METHODS AND COMPOSITIONS FOR DIAGNOSING, TREATING, AND MONITORING TREATMENT OF SHANK3 DEFICIENCY ASSOCIATED DISORDERS
20200397762 ยท 2020-12-24
Inventors
Cpc classification
A61K45/06
HUMAN NECESSITIES
G01N2800/52
PHYSICS
G01N2333/912
PHYSICS
A61K38/30
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A61K38/185
HUMAN NECESSITIES
International classification
A61K38/30
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
Abstract
The invention provides novel methods and compositions for diagnosing, treating, and monitoring treatment of Shank3 (SH3 and multiple ankyrin repeat domains 3) deficiency associated disorders.
Claims
1. A method of treating Shank3 (SH3 and multiple ankyrin repeat domains 3) deficiency in a subject in need of treatment thereof, the method comprising: administering a therapeutically effective amount of an agent that selectively decreases Cdc2-like kinase 2 (CLK2) kinase activity to the subject.
2. The method of claim 1, wherein the method comprises the following steps: assaying CLK2 kinase activity in a sample obtained from the subject; determining that the subject's CLK2 kinase activity is higher than a reference CLK2 kinase activity; and administering a therapeutically effective amount of an agent that selectively decreases CLK2 kinase activity to the subject.
3. The method of claim 1, wherein the Shank3 deficiency is selected from Phelan-McDermid syndrome, autism spectrum disorder, intellectual disability, or schizophrenia.
4. The method of claim 1, the method further comprising administering a second agent that treats Shank3 deficiency to the subject.
5. The method of claim 4, wherein the second agent is risperidone.
6. The method of claim 1, wherein the agent that selectively decreases CLK2 kinase activity is TG003.
7. The method of claim 1, wherein the agent that selectively decreases CLK2 kinase activity is administered to the subject through an oral, intravenous, intracranial, or intranasal route.
8. The method of claim 2, wherein the reference CLK2 kinase activity is the level of CLK2 kinase activity in a sample obtained from a healthy subject.
9. The method of claim 2, wherein CLK2 kinase activity in a sample is determined by an assay selected from a kinase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF).
10. The method of claim 2, further comprising assaying the level or activity of a second protein in the sample.
11. The method of claim 2, wherein the sample is a cellular or tissue sample.
12. The method of claim 2, wherein the sample is a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, induced pluripotent stem cell (iPS)-derived neurons, or cerebrospinal fluid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
DETAILED DESCRIPTION
[0054] Provided herein are methods and compositions for diagnosing, treating, and monitoring treatment of Shank3 deficiency associated disorders, e.g., Phelan-McDermid syndrome, autism spectrum disorder, intellectual disability, or schizophrenia. The present invention is based, at least in part, on the discovery that Shank3 deficiency leads to impaired degradation of CLK2 (CDCl.sub.2-like kinase 2) protein, which phosphorylates the protein phosphatase 2A (PP2A) regulatory subunit B56 and results in recruitment of the PP2A catalytic subunit to protein kinase B (PKB or Akt) and dephosphorylation of Akt. The present invention demonstrated restoration of Akt activation, either directly or via CLK2 or PP2A inhibition, can rescue the reduced dendritic spine density and impaired frequency of synaptic transmission in Shank3-deficient neurons. Accordingly, provided herein are methods of treating Shank3 deficiency, e.g., Phelan-McDermid syndrome, autism spectrum disorder, intellectual disability, or schizophrenia, in a subject in need of treatment thereof, by administering to the subject a therapeutically effective amount of one or more of the following agents: an agent that selectively decreases CLK2 protein level or kinase activity, an agent that selectively increases Akt activity, and an agent that selectively decreases the activity of protein phosphatase 2 (PP2A) comprising B56 subunit (PP2A-B56). These methods can also include steps of assaying the level of CLK2 protein or kinase activity, Akt activity, or PP2A-B56 activity in a sample obtained from the subject; and selecting a subject who has higher CLK2 protein level or kinase activity, lower Akt activity, or higher PP2A-B56 activity, when compared to a reference level in a healthy subject, for treatment. Also provided herein are methods of monitoring a treatment of Shank3 deficiency in a subject by assaying and comparing the Akt activities in samples obtained from the subject before, during, or after the treatment. The present disclosure also provides compositions for use in treatment of Shank3 deficiency, e.g., Phelan-McDermid syndrome, autism spectrum disorder, intellectual disability, or schizophrenia.
[0055] Shank3 is a large scaffolding protein that plays a critical role in dendritic spine formation. Reduction of Shank3 expression results in loss of dendritic spine density in many model systems. SHANK3 haploinsufficiency, caused by chromosomal aberrations or SHANK3 locus deletions or point mutations, is regarded as causative for chromosome 22q13 deletion syndrome also known as Phelan-McDermid syndrome (PMDS). The symptoms may include delayed or absent speech, intellectual disability, and a high risk of autism spectrum disorders (ASD) (Guilmatre et al., 2014, Developmental neurobiology 74, 113-122; Jiang and Ehlers, 2013, Neuron 78: 8-27; Phelan and McDermid, 2012, Molecular syndromology 2, 186-201). De novo loss of function mutations in SHANK3 have also been associated with non-syndromic ASD and intellectual disability (Durand et al., 2007, Nat. Genet. 39 (1): 25-27; Gauthier et al., 2009, American journal of medical genetics Part B, Neuropsychiatric genetics: the official publication of the International Society of Psychiatric Genetics 150B, 421-424; Hamdan et al., 2011, American journal of human genetics 88, 306-316; Leblond et al., 2014, PLoS genetics 10, e1004580; Redin et al., 2014, Journal of medical genetics 51, 724-736), as well as Schizophrenia (Gauthier et al., 2010, Proceedings of the National Academy of Sciences of the United States of America 107, 7863-7868). Genetic ablation of Shank3 in mice yields ASD-like phenotypes including aberrant social and stereotyped behavior, learning and memory deficits, and impairments in synaptic plasticity and transmission (Bozdagi et al., 2010, Molecular Autism 1: 15; Kouser et al., 2013, The Journal of neuroscience 33: 18448-18468; Peca et al., 2011, Nature 472: 437-442; Wang et al., 2011, Human Molecular Genetics 20: 3093-3108; Yang et al., 2012, The Journal of neuroscience 32: 6525-6541). Synaptic dysfunction has also been observed in Shank3-deficient neurons from PMDS patients or following shRNA-mediated silencing (Shcheglovitov et al., 2013, Nature 503: 267-271; Verpelli et al., 2011, The Journal of Biological Chemistry 286: 34839-34850).
[0056] Pilot studies found that treatments of PMDS patients with either insulin or insulin-like growth factor-1 (IGF-1) were beneficial for associated motor, cognitive and social impairments (Kolevzon et al., 2014, Molecular Autism 5: 54; Schmidt et al., 2009, Journal of Medical Genetics 46: 217-222). IGF-1 also alleviated synaptic and motor deficits in Shank3 knock-out mice (Bozdagi et al., 2013, Molecular Autism 1: 15) and synaptic impairment in PMDS neurons (Shcheglovitov et al., 2013, Nature 503: 267-271). A major effector pathway common to both insulin and IGF-1 is PI3K-Akt-mTORC1. This highly conserved signaling module regulates cellular functions including growth, proliferation, survival, and, accordingly, impacts diverse neuronal functions. Deregulation of PI3K-Akt-mTORC1 signaling has frequently been linked to ASDs. Indeed, mutations in genes which antagonize this pathway, PTEN (Cowden Syndrome) or TSC1ITSC2 (Tuberous sclerosis), in humans yield monogenetic syndromes with high risk of autism (Goffin et al., 2001, American Journal of Medical Genetics 105, 521-524; Smalley et al., 1992, Journal of Autism and Developmental Disorders 22: 339-355). Moreover, other syndromic forms of ASD are associated with either hyperactivation (Fragile X syndrome) or attenuation (Rett and Angelman syndromes) of this pathway (Cao et al., 2013, PLoS biology 11, e1001478; Ricciardi et al., 2011, Human Molecular Genetics 20: 1182-1196; Sharma et al., 2010, The Journal of neuroscience 30: 694-702). Despite this, full mechanistic understanding at the molecular level of why these agents are therapeutic is still lacking.
[0057] Identification of Signaling Pathways Impaired by Shank3 Deficiency
[0058] The data presented herein showed that Shank3 deficiency impairs Akt phosphorylation and activity in neurons (
[0059] Akt plays an important role in mammalian cellular signaling and is involved in cellular survival pathways, protein synthesis pathways, and pathways that lead to skeletal muscle hypertrophy and general tissue growth. In the developing nervous system, PKB/Akt is a critical mediator of growth factor-induced neuronal survival. PKB/Akt can be phosphorylated by phosphatidylinositol 3-kinase (PI3K), or activated in a PI3K-independent manner. Attenuated Akt activity has previously been associated with other monogenetic models of syndromic ASD, in particular MCCP2 and Ube3A deficiency in Rett and Angelman syndromes, respectively (Cao et al., 2013, PLoS biology 11: e1001478; Ricciardi et al., 2011, Human molecular genetics 20: 1182-1196). The data presented herein show that Shank3 reduction, which is causative for PMDS, also leads to impaired Akt-activation. Thus, Akt appears to be an important node whose deregulation is common to certain forms of ASD and can represent an important therapeutic target.
[0060] Akt can be dephosphoryled and repressed by protein phosphatase, e.g., protein phosphatase 2 (PP2 or PP2A). PP2A is a heterotrimer that consists of a dimeric core enzyme composed of the structural A subunit and catalytic C subunit, and a regulatory B subunit. When the PP2A core enzyme associates with the regulatory B subunit, functional PP2A holoenzyme is assembled. The structural A subunit serves as the scaffold for the formation of the heterotrimeric complex. When the structural A subunit binds to the catalytic C subunit, it alters the enzymatic activity of the catalytic C subunit, even when the regulatory B subunit is absent. While the sequences of the C and A subunits show remarkable conservation throughout eukaryotes, the sequences of the regulatory B subunits are more heterogeneous and are believed to play key roles in controlling the localization and substrate specificity of different holoenzymes. Multicellular eukaryotes express four classes of regulatory subunits: B (PR55), B (B56 or PR61), B (PR72), and B (PR93/PR110), with at least 16 members in these subfamilies. In addition, accessory proteins and posttranslational modifications (such as methylation) control PP2A subunit associations and activities.
[0061] The finding that Shank3 deficiency leads to enhanced CLK2 expression provides new understanding of this signaling imbalance in PMDS. CLK2 belongs to a well conserved family of CLK kinases that phosphorylate SR (serine/arginine-rich) proteins. CLK kinases are dual-specificity kinases that phosphorylate both serine/threonine- and tyrosine-containing substrates (Nayler et al. (1997) Biochem. J. 326: 693; Ben-David et al. (1991) EMBO J. 10: 317; Howell et al. (1991) Mol. Cell. Biol. 11: 568). The amino-terminal domain of CLK2 is rich in serine and arginine, whereas the catalytic domain is very similar to CDCl.sub.2, a serine/threonine protein kinase (Ben-David et al., 1991, EMBO J. 10:317-325). CLK kinases are also known as STY or LAMMER kinases (the latter based on a signature motif EHLAMMERILG (SEQ ID NO: 13) conserved between the CLK family members).
[0062] The regulation of CLK2 protein expression is complex. While cellular CLK2 protein levels are normally repressed, growth-factor stimulation leads to its Akt-mediated stabilization. This is followed by activation loop autophosphorylation which amplifies stabilization and activation, thus obviating the requirement for continued Akt-dependent signals as CLK2 kinase activity becomes self-sustaining. CLK2 stabilization depends on the rapid reduction of its ubiquitination (Lee et al., 1996, The Journal of biological chemistry 271: 27299-27303; Nayler et al., 1998, The Journal of biological chemistry 273: 34341-34348; Rodgers et al., 2010, Cell metabolism 11: 23-34; Rodgers et al., 2011, Molecular cell 41: 471-479). In line with this, CLK2 ubiquitination was found reduced in Shank3 knock down neurons (
[0063] Cellular and behavioral impairments in Shank3 deficient mice, PMDS neurons, and PMDS patients, could be ameliorated with IGF-1 or insulin (Bozdagi et al., 2013, Molecular Autism 4: 9; Kolevzon et al., 2014, Molecular Autism 5: 54; Lee et al., 2011, Neuropharmacology 61, 867-879; Shcheglovitov et al., 2013, Nature 503: 267-271). Despite this progress, an understanding of the molecular mechanisms involved is conspicuously lacking. The finding that neurons from PMDS patients or following Shank3 knock down exhibit attenuated Akt activity, and are rescued from associated impairments by direct pharmacologic enhancement of Akt signaling, provides an important link to understanding signaling impairments associated with Shank3 deficiency. It may also explain why current exploratory therapeutics (e.g., IGF-1) appear to be beneficial.
[0064] The data presented herein provide the first evidence of a role for CLK2 in the nervous system. Upregulated CLK2 protein in Shank3-deficient neurons enhances B56-dependent recruitment of PP2A catalytic subunit (PP2Ac) to Akt, leading to exaggerated Akt dephosphorylation and inactivation. IGF-1 treatment therefore conceivably restores balance in these neurons by boosting PI3K-dependent Akt phosphorylation to counteract exaggerated PP2A-mediated dephosphorylation. It is noteworthy that the Akt-activator SC79 was recently shown to restore habituation learning in an IGF-signaling impaired zebrafish model (Wolman et al., 2015, Neuron 85: 1200-1211). It is also compelling that a human chromosomal microdeletion encompassing PPP2R5B (B56) was associated with autistic traits (Mohrmann et al., 2011, European journal of medical genetics 54, e461-464). Furthermore, a genome-wide association study identified PP2A regulation as a risk pathway common to three physchiatric disorders (Network and Pathway Analysis Subgroup of Psychiatric Genomics, 2015, Nature neuroscience 18, 199-209), while a second PP2A regulatory subunit, PPP2R5D, and a scaffold subunit, PPP2RIA, were associated with severe, undiagnosed development delay (Deciphering Developmental Disorders, 2015, Nature 519, 223-228). This suggests an important role for PP2A regulation in psychiatric and neurodevelopmental disorders.
[0065] Taken together the data presented herein provide a new mechanistic understanding of deregulated signaling downstream of Shank3 deficiency and identify new targets for therapeutic development, e.g., CLK2, PP2A-B56, and/or Akt.
[0066] Methods of Diagnosing, Treating, and Monitoring Treatment of Shank3 Deficiency
[0067] Provided herein are methods of treating Shank3 deficiency, in a subject in need of treatment thereof, by restoring Akt activation, either directly or via CLK2 or PP2A inhibition. In some embodiments, such methods include administering a therapeutically effective amount of an agent that selectively decreases CLK2 protein level or kinase activity to the subject. In some embodiments, such methods include administering a therapeutically effective amount of an agent that selectively increases Akt activity to the subject. In some embodiments, such methods include administering a therapeutically effective amount of an agent that selectively decreases the activity of PP2A comprising B56 subunit (PP2A-B56) to the subject. In some embodiments, such methods also include administering a second agent that treats Shank3 deficiency, e.g., risperidone, to the subject. The Shank3 deficiency can be Phelan-McDermid syndrome, autism spectrum disorder, intellectual disability, or schizophrenia.
[0068] In some embodiments, the methods of treating Shank3 deficiency in a subject in need of treatment thereof include the following steps: (1) assaying CLK2 protein level or kinase activity in a sample obtained from the subject; (2) determining that the subject's CLK2 protein level or kinase activity is higher than a reference CLK2 protein level or kinase activity; and (3) administering a therapeutically effective amount of an agent that selectively decreases CLK2 protein level or kinase activity to the subject. The reference CLK2 protein level or kinase activity can be the CLK2 protein level or kinase activity in a sample obtained from a healthy subject. The level of CLK2 protein or kinase activity in the sample can be detected and quantified by any of the means well known to those of skill in the art. These can include electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, immunodiffusion (single or double), immunoelectrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, Western blotting, immunohistochemistry, homogeneous time resolved fluorescence (HTRF), or a kinase assay. In some embodiments, the level of CLK2 protein or kinase activity in a sample is determined by an assay selected from a kinase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF). In some embodiments, the sample is a cellular or tissue sample, e.g., a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, induced pluripotent stem cell (iPS)-derived neurons, or cerebrospinal fluid. In some embodiments, such methods further include assaying the level or activity of a second protein in the sample.
[0069] In some embodiments, the methods of treating Shank3 deficiency in a subject in need of treatment thereof include the following steps: (1) assaying Akt activity in a sample obtained from the subject; (2) determining that the subject's Akt activity is lower than a reference Akt activity; and (3) administering a therapeutically effective amount of an agent that selectively increases Akt activity to the subject. The reference Akt activity can be the level of Akt activity in a sample obtained from a healthy subject. The level of Akt activity can be determined by a kinase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), or enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF). In some embodiments, the sample is a cellular or tissue sample, e.g., a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, induced pluripotent stem cell (iPS)-derived neurons, or cerebrospinal fluid. In some embodiments, such methods further include assaying the level or activity of a second protein in the sample.
[0070] In some embodiments, the methods of treating Shank3 deficiency in a subject in need of treatment thereof include one or more of the following steps: (1) assaying PP2A-B56 activity in a sample obtained from the subject; (2) determining that the subject's PP2A-B56 activity is higher than a reference PP2A-B56 activity; and (3) administering a therapeutically effective amount of an agent that selectively decreases the activity of PP2A-B56 to the subject. The reference PP2A-B56 activity can be the level of PP2A-B56 activity in a sample obtained from a healthy subject. The level of PP2A-B56 activity can be determined by a phosphatase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF). In some embodiments, the sample is a cellular or tissue sample, e.g., a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, induced pluripotent stem cell (iPS)-derived neurons, or cerebrospinal fluid. In some embodiments, such methods further include assaying the level or activity of a second protein in the sample.
[0071] Also provided herein are methods of selecting a subject for treatment of Shank3 deficiency. In some embodiments, such methods include: (1) assaying CLK2 protein level or kinase activity in a sample obtained from a subject; and (2) selecting a subject whose CLK2 protein level or kinase activity is higher than a reference CLK2 level or kinase activity for the treatment of Shank3 deficiency. The reference CLK2 level or kinase activity can be the level of CLK2 protein or kinase activity in a sample obtained from a healthy subject. The level of CLK2 protein or kinase activity in the sample can be detected and quantified by any of the means discussed above. In some embodiments, the level of CLK2 protein or kinase activity in a sample is determined by an assay selected from an kinase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF). In some embodiments, the sample is a cellular or tissue sample, e.g., a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, iPS-derived neurons, or cerebrospinal fluid. In some embodiments, such methods further include assaying the level or activity of a second protein in the sample.
[0072] In some embodiments, the methods of selecting a subject for treatment of Shank3 deficiency include: (1) assaying the level of Akt activity in a sample obtained from the subject; and (2) selecting a subject whose Akt activity is lower than a reference Akt activity for the treatment of Shank3 deficiency. The reference Akt activity can be the level of Akt activity in a sample obtained from a healthy subject. The level of Akt activity in a sample can be determined by a kinase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF). In some embodiments, the sample is a cellular or tissue sample, e.g., a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, iPS-derived neurons, or cerebrospinal fluid. In some embodiments, such methods further include assaying the level or activity of a second protein in the sample.
[0073] In some embodiments, the methods of selecting a subject for treatment of Shank3 deficiency methods include: (1) assaying the level of PP2A activity in a sample obtained from the subject; (2) selecting a subject whose PP2A activity is higher than a reference PP2A activity for the treatment of Shank 3 deficiency. The reference PP2A activity can be the level of PP2A activity in a sample obtained from a healthy subject. The level of PP2A activity can be determined by a phosphatase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), or enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF). In some embodiments, the sample is a cellular or tissue sample, e.g., a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, iPS-derived neurons, or cerebrospinal fluid. In some embodiments, such methods further include assaying the level or activity of a second protein in the sample.
[0074] Also provided herein are methods of monitoring a treatment of Shank3 deficiency in a subject. The treatment of Shank3 deficiency can be selected from an agent that selectively decreases CLK2 protein level or kinase activity, an agent that selectively decreases PP2A-B56 activity, or an agent that selectively increases Akt activity. Such methods can include assaying and comparing the Akt activities in samples obtained from the subject before, during or after the treatment. Elevated Akt activities in samples obtained during or after the treatment when compared to the Akt activities in samples obtained before the treatment indicates that the subject responded to the treatment being evaluated. In some embodiments, such methods include (1) assaying the level of Akt activity in a first sample obtained from the subject before the treatment to obtain a first level of Akt activity; (2) assaying the level of Akt activity in a second sample obtained from the subject during or after the treatment to obtain a second level of Akt activity; and (3) comparing the first level with the second level. For example, a subject's response to an agent that selectively decreases CLK2 protein level or kinase activity can be evaluated by assaying and comparing the Akt activity in samples obtained from the subject before and after administering the agent. An increased Akt activity in a sample obtained after administering the agent when compared to the Akt activity in a sample obtained before administering the agent indicates that the subject responded to the agent that selectively decreases CLK2 protein level or kinase activity. The treatment efficacy can also be assessed based on the levels of Akt activity in samples obtained from the subject before and after administering the agent. Similarly, a subject's response to an agent that selectively decreases PP2A-B56 activity can be evaluated by assaying and comparing the Akt activity in samples obtained from the subject before and after administering the agent. An increased Akt activity in a sample obtained after administering the agent when compared to the Akt activity in a sample obtained before administering the agent indicates that the subject responded to the agent that selectively decreases PP2A-B56 activity. The treatment efficacy can also be assessed based on the levels of Akt activity in samples obtained from the subject before and after administering the agent.
[0075] Also provided herein are agents for use in the treatment of Shank3 (SH3 and multiple ankyrin repeat domains 3) deficiency in a subject wherein the treatment comprises administering a therapeutically effective amount of an agent that: (i) decreases Cdc2-like kinase 2 (CLK2) protein level or kinase activity; (ii) increases protein kinase B (PKB or Akt) activity; or (iii) decreases the activity of protein phosphatase 2 (PP2A) comprising B56 subunit (PP2A-B56). Shank3 deficiency includes Phelan-McDermid syndrome, autism spectrum disorder, intellectual disability, or schizophrenia. The treatment can further comprise administering a second agent that treats Shank3 deficiency, e.g., risperidone. The agent can be administered to the subject through an oral, intravenous, intracranial, or intranasal route.
[0076] Provided herein are agents for use in the treatment of Shank3 deficiency in a subject wherein the treatment comprises the steps of: (i) assaying CLK2 protein level or kinase activity in a sample obtained from the subject, determining that the subject's CLK2 protein level or kinase activity is higher than a reference CLK2 protein level or kinase activity, and administering a therapeutically effective amount of an agent that selectively decreases CLK2 protein level or kinase activity to the subject; (ii) assaying Akt activity in a sample obtained from the subject, determining that the subject's Akt activity is lower than a reference Akt activity, and administering a therapeutically effective amount of an agent that selectively increases Akt activity to the subject; or (iii) assaying PP2A-B56 activity in a sample obtained from the subject, determining that the subject's PP2A-B56 activity is higher than a reference PP2A-B56 activity, and administering a therapeutically effective amount of an agent that selectively decreases the activity of PP2A-B56 to the subject. The reference CLK2 protein level or kinase activity, the reference Akt activity or the reference PP2A-B56 activity can be the level or activity in a sample obtained from a healthy subject. The sample can be a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, induced pluripotent stem cell (iPS)-derived neurons or cerebral spinal fluid. The level or activity of a second protein in the sample can also be assayed. The CLK2 protein level or kinase activity, the Akt activity or the PP2A-B56 activity in a sample can be determined by an assay selected from a kinase assay or a phosphatase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF). The agent can be administered to the subject through an oral, intravenous, intracranial, or intranasal route. The treatment can further comprise administering a second agent that treats Shank3 deficiency, e.g., risperidone.
[0077] Provided herein are agents for use in the treatment of Shank3 deficiency in a subject wherein the subject is selected for treatment by: (i) assaying CLK2 protein level or kinase activity in a sample obtained from a subject, and selecting a subject whose CLK2 protein level or kinase activity is higher than a reference CLK2 level or kinase activity for the treatment of Shank3 deficiency; (ii) assaying the level of Akt activity in a sample obtained from the subject, and selecting a subject whose Akt activity is lower than a reference Akt activity for the treatment of Shank3 deficiency; or (iii) assaying PP2A-B56 activity in a sample obtained from the subject, and selecting a subject whose PP2A-B56 activity is higher than a reference PP2A-B56 activity for the treatment of Shank3 deficiency. The reference CLK2 protein level or kinase activity, the reference Akt activity or the reference PP2A-B56 activity can be the level or activity in a sample obtained from a healthy subject. The sample can be a cellular or tissue sample comprising olfactory neurons obtained through nasal biopsy, induced pluripotent stem cell (iPS)-derived neurons or cerebral spinal fluid. The level or activity of a second protein in the sample can also be assayed. The CLK2 protein level or kinase activity, the Akt activity or the PP2A-B56 activity in a sample can be determined by an assay selected from a kinase assay or a phosphatase assay, immunohistochemistry, Western blotting, immunofluorescent assay, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), or homogeneous time resolved fluorescence (HTRF).
[0078] An agent that selectively decreases CLK2 protein level or kinase activity can be any compound capable of selectively inhibiting the expression or kinase activity of CLK2, for example, a compound specifically inhibiting the transcription of the CLK2 gene, the maturation of CLK2 RNA, the translation of CLK2 mRNA, the posttranslational modification of the CLK2 protein, the kinase activity of the CLK2 protein, the interaction of CLK2 with a substrate, etc. An agent that selectively decreases CLK2 protein level can also refer to any agent that specifically inhibits or abrogates the normal cellular function of the CLK2 protein, either by selectively facilitating ubiquitination and degradation of the CLK2 protein, or by selective inhibition of the active kinase site, allosteric modulation of the protein structure, disruption of protein-protein interactions, or by inhibiting the transcription, translation, or stability of CLK2 protein. For example, an agent that selectively decreases CLK2 protein level or kinase activity can be a RNAi agent, an antisense oligonucleotide, a ribozyme, an aptamer, an antibody or derivative thereof, or a low molecular weight compound. In some embodiments, the CLK2 inhibitor is a low molecular weight compound, e.g., TG003.
[0079] An agent that selectively increases Akt activity refers to any compound capable of specifically activating the expression or activity of Akt (protein kinase B or PKB), for example, any compound activating the transcription of the gene, the maturation of RNA, the translation of mRNA, the posttranslational modification of the protein, the kinase activity of the protein, the interaction of Akt with a substrate, etc. An agent that selectively increases Akt activity also refers to any agent that specifically activates the normal cellular function of the Akt protein, e.g., by activation of the Akt kinase site. For example, an agent that selectively increases Akt activity can be a low molecular weight compound or an antibody or derivative thereof. In some embodiments, the Akt activator is a low molecular weight compound, e.g., SC79. Other known Akt activators include rapamycin, insulin-like growth factor-1 (IGF-1), insulin-like growth factor-2 (IGF-2), Brain-derived neurotrophic factor (BDNF), Epidermal growth factor (EGF), CCl-779, nicotine, Ro-31-8220, carbachol, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), adrenomedullin (AM) lysophosphatidic acid, platelet activating factor, macrophage simulating factor; sphingosine-1-phosphate, forskolin, chlorophenylthio-cAMP, prostaglandin-E1, and 8-bromo-cAMP, insulin, platelet derived growth factor, or granulocyte colony-stimulating factor (G-CSF).
[0080] An agent that selectively decreases PP2A-B56 activity refers to any compound capable of specifically inhibiting the expression or activity of PP2A-B56, for example, any compound inhibiting the transcription of the gene, the maturation of RNA, the translation of mRNA, the posttranslational modification of the protein, the phosphatase activity of the protein, the interaction of PP2A-B56 with a substrate, etc. An agent that selectively decreases PP2A-B56 activity also refers to any agent that specifically inhibits or abrogates the normal cellular function of the PP2A-B56 protein, either by inhibition of the active phosphatase site, allosteric modulation of the protein structure, disruption of protein-protein interactions, or by inhibiting the transcription, translation, or stability of PP2A-B56 protein. For example, a PP2A-B56 inhibitor can be a RNAi agent, an antisense oligonucleotide, a ribozyme, an aptamer, an antibody or derivative thereof, a low molecular weight compound, or a phosphorylation-deficient variant of B56 regulatory subunit. In some embodiments, the PP2A-B56 inhibitor is a low molecular weight compound, e.g., okadaic acid, calyculin A, cantharidic acid, or cantharidin.
[0081] Antibody
[0082] The present invention provides methods of treating Shank3 deficiency in a subject in need of treatment thereof by administering to the subject a therapeutically effective amount of one or more of the following agents: an agent that selectively decreases CLK2 protein level or kinase activity, an agent that selectively increases Akt activity, and an agent that selectively decreases the activity of PP2A-B56. One or more of those agents can be an antibody or derivative thereof. A naturally occurring antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system. An antibody can be a monoclonal antibody, human antibody, humanized antibody, camelised antibody, or chimeric antibody. The antibodies can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass.
[0083] Both the light and heavy chains are divided into regions of structural and functional homology. The terms constant and variable are used functionally. In this regard, it will be appreciated that the variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity. Conversely, the constant domains of the light chain (CL) and the heavy chain (CH1, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like. By convention, the numbering of the constant region domains increases as they become more distal from the antigen binding site or amino-terminus of the antibody. The N-terminus is a variable region and at the C-terminus is a constant region; the CH3 and CL domains actually comprise the carboxy-terminus of the heavy and light chain, respectively. In particular, the term antibody specifically includes an IgG-scFv format.
[0084] The term epitope binding domain or EBD refers to portions of a binding molecule (e.g., an antibody or epitope-binding fragment or derivative thereof), that specifically interacts with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) a binding site on a target epitope. EBD also refers to one or more fragments of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) a CLK2 or PP2A-B56 epitope and inhibit signal transduction. Examples of antibody fragments include, but are not limited to, an scFv, a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; a F(ab).sub.2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CH1 domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
[0085] The term epitope means a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
[0086] Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al., (1988) Science 242:423-426; and Huston et al., (1988) Proc. Nal. Acad. Sci. 85:5879-5883).
[0087] Such single chain antibodies are also intended to be encompassed within the terms fragment, epitope-binding fragment or antibody fragment. These fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
[0088] Antibody fragments can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al., (1995) Protein Eng. 8:1057-1062; and U.S. Pat. No. 5,641,870), and also include Fab fragments, F(ab) fragments, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above.
[0089] EBDs also include single domain antibodies, maxibodies, unibodies, minibodies, triabodies, tetrabodies, v-NAR and bis-scFv, as is known in the art (see, e.g., Hollinger and Hudson, (2005) Nature Biotechnology 23: 1126-1136), bispecific single chain diabodies, or single chain diabodies designed to bind two distinct epitopes. EBDs also include antibody-like molecules or antibody mimetics, which include, but not limited to minibodies, maxybodies, Fn3 based protein scaffolds, Ankrin repeats (also known as DARpins), VASP polypeptides, Avian pancreatic polypeptide (aPP), Tetranectin, Affililin, Knottins, SH3 domains, PDZ domains, Tendamistat, Neocarzinostatin, Protein A domains, Lipocalins, Transferrin, and Kunitz domains that specifically bind epitopes, which are within the scope of the invention. Antibody fragments can be grafted into scaffolds based on polypeptides such as Fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide monobodies).
[0090] An isolated antibody can be a monovalent antibody, bivalent antibody, multivalent antibody, bivalent antibody, biparatopic antibody, bispecific antibody, monoclonal antibody, human antibody, recombinant human antibody, or any other type of antibody or epitope-binding fragment or derivative thereof.
[0091] The phrase isolated antibody, as used herein, refers to antibody that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds CLK2 is substantially free of antibodies that specifically bind antigens other than CLK2). An isolated antibody that specifically binds a target molecule may, however, have cross-reactivity to the same antigens from other species, e.g., an isolated antibody that specifically binds CLK2 may bind CLK2 molecules from other species. Moreover, an isolated antibody may be substantially free of other cellular material and/or chemicals.
[0092] The term monovalent antibody as used herein, refers to an antibody that binds to a single epitope on a target molecule.
[0093] The term bivalent antibody as used herein, refers to an antibody that binds to two epitopes on at least two identical target molecules. The bivalent antibody may also crosslink the target molecules to one another. A bivalent antibody also refers to an antibody that binds to two different epitopes on at least two identical target molecules.
[0094] The term multivalent antibody refers to a single binding molecule with more than one valency, where valency is described as the number of antigen-binding moieties present per molecule of an antibody construct. As such, the single binding molecule can bind to more than one binding site on a target molecule. Examples of multivalent antibodies include, but are not limited to bivalent antibodies, trivalent antibodies, tetravalent antibodies, pentavalent antibodies, and the like, as well as bispecific antibodies and biparatopic antibodies. For example, for CLK2, the multivalent antibody (e.g., a CLK2 biparatopic antibody) has a binding moiety for two domains of CLK2, respectively.
[0095] The term multivalent antibody also refers to a single binding molecule that has more than one antigen-binding moiety for two separate target molecules. For example, an antibody that binds to CLK2 and a second target molecule that is not CLK2. In one embodiment, a multivalent antibody is a tetravalent antibody that has four epitope binding domains. A tetravalent molecule may be bispecific and bivalent for each binding site on that target molecule.
[0096] The term biparatopic antibody as used herein, refers to an antibody that binds to two different epitopes on a single target molecule. The term also includes an antibody, which binds to two domains of at least two target molecules, e.g., a tetravalent biparatopic antibody.
[0097] The term bispecific antibody as used herein, refers to an antibody that binds to two or more different epitopes on at least two different targets (e.g., CLK2 and a target that is not CLK2).
[0098] The phrases monoclonal antibody or monoclonal antibody composition as used herein refers to polypeptides, including antibodies, bispecific antibodies, etc., that have substantially identical amino acid sequence or are derived from the same genetic source. This term also includes preparations of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
[0099] The phrase human antibody, as used herein, includes antibodies having variable regions in which both the framework and CDR regions are derived from sequences of human origin. Furthermore, if the antibody contains a constant region, the constant region is also derived from such human sequences, e.g., human germline sequences, or mutated versions of human germline sequences or antibody containing consensus framework sequences derived from human framework sequences analysis, for example, as described in Knappik, et al. (2000. J Mol Biol 296, 57-86). The structures and locations of immunoglobulin variable domains, e.g., CDRs, may be defined using well known numbering schemes, e.g., the Kabat numbering scheme, the Chothia numbering scheme, or a combination of Kabat and Chothia (see, e.g., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services (1991), eds. Kabat et al.; Al Lazikani et al., (1997) J. Mol. Bio. 273:927 948); Kabat et al., (1991) Sequences of Proteins of Immunological Interest, 5th edit., NIH Publication no. 91-3242 U.S. Department of Health and Human Services; Chothia et al., (1987) J. Mol. Biol. 196:901-917; Chothia et al., (1989) Nature 342:877-883; and Al-Lazikani et al., (1997) J. Mal. Biol. 273:927-948.
[0100] The human antibodies of the invention may include amino acid residues not encoded by human sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo, or a conservative substitution to promote stability or manufacturing). However, the term human antibody as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
[0101] The phrase recombinant human antibody as used herein, includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene, sequences to other DNA sequences. Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
[0102] The term Fc region as used herein refers to a polypeptide comprising the CH3, CH2 and at least a portion of the hinge region of a constant domain of an antibody. Optionally, an Fc region may include a CH4 domain, present in some antibody classes. An Fc region, may comprise the entire hinge region of a constant domain of an antibody. In one embodiment, the invention comprises an Fc region and a CH1 region of an antibody. In one embodiment, the invention comprises an Fc region CH3 region of an antibody. In another embodiment, the invention comprises an Fc region, a CH1 region and a Ckappa/lambda region from the constant domain of an antibody. In one embodiment, a binding molecule of the invention comprises a constant region, e.g., a heavy chain constant region. In one embodiment, such a constant region is modified compared to a wild-type constant region. That is, the polypeptides of the invention disclosed herein may comprise alterations or modifications to one or more of the three heavy chain constant domains (CH1, CH2 or CH3) and/or to the light chain constant region domain (CL). Example modifications include additions, deletions or substitutions of one or more amino acids in one or more domains. Such changes may be included to optimize effector function, half-life, etc.
[0103] The term binding site as used herein comprises an area on a target molecule to which an antibody or antigen binding fragment selectively binds.
[0104] The term epitope as used herein refers to any determinant capable of binding with high affinity to an immunoglobulin. An epitope is a region of an antigen that is bound by an antibody that specifically targets that antigen, and when the antigen is a protein, includes specific amino acids that directly contact the antibody. Most often, epitopes reside on proteins, but in some instances, may reside on other kinds of molecules, such as nucleic acids. Epitope determinants may include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl or sulfonyl groups, and may have specific three dimensional structural characteristics, and/or specific charge characteristics.
[0105] Generally, antibodies specific for a particular target antigen will bind to an epitope on the target antigen in a complex mixture of proteins and/or macromolecules.
[0106] As used herein, the term affinity refers to the strength of interaction between antibody and antigen at single antigenic sites. Within each antigenic site, the variable region of the antibody arm interacts through weak non-covalent forces with the antigen at numerous sites; the more interactions, the stronger the affinity. As used herein, the term high affinity for an IgG antibody or fragment thereof (e.g., a Fab fragment) refers to an antibody having a knock down of 10.sup.8 M or less, 10.sup.9 M or less, or 10.sup.10 M, or 10.sup.11 M or less, or 10.sup.12 M or less, or 10.sup.13 M or less for a target antigen. However, high affinity binding can vary for other antibody isotypes. For example, high affinity binding for an IgM isotype refers to an antibody having a knock down of 10.sup.7 M or less, or 10.sup.8 M or less.
[0107] As used herein, the term avidity refers to an informative measure of the overall stability or strength of the antibody-antigen complex. It is controlled by three major factors: antibody epitope affinity; the valence of both the antigen and antibody; and the structural arrangement of the interacting parts. Ultimately these factors define the specificity of the antibody, that is, the likelihood that the particular antibody is binding to a precise antigen epitope.
[0108] Regions of a given polypeptide that include an epitope can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, N.J. For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Pat. No. 4,708,871; Geysen et al., (1984) Proc. Nal. Acad. Sci. USA 8:3998-4002; Geysen et al., (1985) Proc. Nal. Acad. Sci. USA 82:78-182; Geysen et al., (1986) Mol. Immunol. 23:709-715. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and two-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra. Antigenic regions of proteins can also be identified using standard antigenicity and hydropathy plots, such as those calculated using, e.g., the Omiga version 1.0 software program available from the Oxford Molecular Group. This computer program employs the Hopp/Woods method, Hopp et al., (1981) Proc. Natl. Acad. Sci USA 78:3824-3828; for determining antigenicity profiles, and the Kyte-Doolittle technique, Kyte et al., (1982) J. Mol. Biol. 157:105-132; for hydropathy plots.
[0109] RNAi Agent
[0110] The present invention provides methods of treating Shank3 deficiency in a subject in need of treatment thereof by administering to the subject a therapeutically effective amount of an agent that selectively decreases CLK2 protein level or kinase activity, or an agent that selectively decreases the activity of PP2A-B56, wherein one or both of those agents are RNAi agents. A RNAi agent can be an siRNA (short inhibitory RNA), shRNA (short or small hairpin RNA), iRNA (interference RNA) agent, RNAi (RNA interference) agent, dsRNA (double-stranded RNA), microRNA, and the like, which specifically binds to a target gene, and which mediates the targeted cleavage of another RNA transcript via an RNA-induced silencing complex (RISC) pathway. In some embodiments, the RNAi agent is an oligonucleotide composition that activates the RISC complex/pathway. In some embodiments, the RNAi agent comprises an antisense strand sequence (antisense oligonucleotide). In some embodiments, the RNAi comprises a single strand. his single-stranded RNAi agent oligonucleotide or polynucleotide can comprise the sense or antisense strand, as described by Sioud 2005 J. Mol. Bio. 348:1079-1090, and references therein. Thus the disclosure encompasses RNAi agents with a single strand comprising either the sense or the antisense strand of an RNAi agent described herein. The use of the RNAi agent to a target gene results in a decrease of target activity, level and/or expression, e.g., a knock-down or knock-out of the target gene or target sequence.
[0111] Exemplary CLK2 shRNAs are described in Example 4, e.g., shRNA having a target sequence of any of SEQ ID NOs: 5-9. As shown in
[0112] RNA interference is a post-transcriptional, targeted gene-silencing technique that, usually, uses double-stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA. The process of RNAi occurs naturally when ribonuclease III (Dicer) cleaves longer dsRNA into shorter fragments called siRNAs. Naturally-occurring siRNAs (small interfering RNAs) are typically about 21 to 23 nucleotides long and comprise about 19 base pair duplexes. The smaller RNA segments then mediate the degradation of the target mRNA. Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control. Hutvagner et al. 2001, Science, 293, 834. The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded mRNA complementary to the antisense strand of the siRNA. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex.
[0113] RNAi (RNA interference) has been studied in a variety of systems. Early work in Drosophila embryonic lysates (Elbashir et al. 2001 EMBO J. 20: 6877 and Tuschl et al. International PCT Publication No. WO 01/75164) revealed certain parameters for siRNA length, structure, chemical composition, and sequence that are beneficial to mediate efficient RNAi activity. These studies have shown that 21-nucleotide siRNA duplexes are most active when containing 3-terminal dinucleotide overhangs. Substitution of the 3-terminal siRNA overhang nucleotides with 2-deoxy nucleotides (2-H) was tolerated. In addition, a 5-phosphate on the target-complementary strand of a siRNA duplex is usually required for siRNA activity. Later work showed that a 3-terminal dinucleotide overhang can be replaced by a 3 end cap, provided that the 3 end cap still allows the molecule to mediate RNA interference; the 3 end cap also reduces sensitivity of the molecule to nucleases. See, for example, U.S. Pat. Nos. 8,097,716; 8,084,600; 8,404,831; 8,404,832; and 8,344,128. Additional later work on artificial RNAi agents showed that the strand length could be shortened, or a single-stranded nick could be introduced into the sense strand. In addition, mismatches can be introduced between the sense and anti-sense strands and a variety of modifications can be used. Any of these and various other formats for RNAi agents known in the art can be used to produce RNAi agents to CLK2 or RNAi agents to PP2A-B56.
[0114] In some embodiments, the RNAi agent is ligated to one or more diagnostic compound, reporter group, cross-linking agent, nuclease-resistance conferring moiety, natural or unusual nucleobase, lipophilic molecule, cholesterol, lipid, lectin, steroid, uvaol, hecigenin, diosgenin, terpene, triterpene, sarsasapogenin, Friedelin, epifriedelanol-derivatized lithocholic acid, vitamin, carbohydrate, dextran, pullulan, chitin, chitosan, synthetic carbohydrate, oligo lactate 15-mer, natural polymer, low- or medium-molecular weight polymer, inulin, cyclodextrin, hyaluronic acid, protein, protein-binding agent, integrin-targeting molecule, polycationic, peptide, polyamine, peptide mimic, and/or transferrin.
[0115] Kits for RNAi synthesis are commercially available, e.g., from New England Biolabs and Ambion.
[0116] A suitable RNAi agent can be selected by any process known in the art or conceivable by one of ordinary skill in the art. For example, the selection criteria can include one or more of the following steps: initial analysis of the gene sequence and design of RNAi agents; this design can take into consideration sequence similarity across species (human, cynomolgus, mouse, etc.) and dissimilarity to other genes; screening of RNAi agents in vitro (e.g., at 10 nM in cells); determination of EC50 in HeLa cells; determination of viability of various cells treated with RNAi agents, wherein it is desired that the RNAi agent to a target molecule does not inhibit the viability of these cells; testing with human PBMC (peripheral blood mononuclear cells), e.g., to test levels of TNF-alpha to estimate immunogenicity, wherein immunostimulatory sequences are less desired; testing in human whole blood assay, wherein fresh human blood is treated with an RNAi agent and cytokine/chemokine levels are determined [e.g., TNF-alpha (tumor necrosis factor-alpha) and/or MCP1 (monocyte chemotactic protein 1)], wherein immunostimulatory sequences are less desired; determination of gene knock down in vivo using subcutaneous tumors in test animals; target gene modulation analysis, e.g., using a pharmacodynamic (PD) marker, and optimization of specific modifications of the RNAi agents.
[0117] RNAi agents can be delivered or introduced (e.g., to a cell in vitro or to a patient) by any means known in the art. Introducing into a cell, when referring to an iRNA, means facilitating or effecting uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; an iRNA may also be introduced into a cell, wherein the cell is part of a living organism. In such an instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be achieved by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781 which are hereby incorporated by reference in their entirety. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described below or known in the art.
[0118] Delivery of RNAi agent to tissue can be a problem because the material must reach the target organ and must also enter the cytoplasm of target cells. RNA cannot penetrate cellular membranes, so systemic delivery of naked RNAi agent is unlikely to be successful. RNA is quickly degraded by RNAse activity in serum. For these reasons, other mechanisms to deliver RNAi agent to target cells has been devised. Methods known in the art include but are not limited to: viral delivery (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC) or nanoparticles (cationic polymer, PE1), bacterial delivery (tkRNAi), and also chemical modification (LNA) of siRNA to improve stability. Xia et al. 2002 Nat. Biotechnol. 20 and Devroe et al. 2002. BMC Biotechnol. 21: 15, disclose incorporation of siRNA into a viral vector. Other systems for delivery of RNAi agents are contemplated, and the RNAi agents of the present invention can be delivered by various methods yet to be found and/or approved by the FDA or other regulatory authorities.
[0119] Liposomes have been used previously for drug delivery (e.g., delivery of a chemotherapeutic). Liposomes (e.g., cationic liposomes) are described in PCT publications WO02/100435A1, WO03/015757A, and WO04029213A2; U.S. Pat. Nos. 5,962,016; 5,030,453; and 6,680,068; and U.S. Patent Application 2004/0208921. A process of making liposomes is also described in WO04/002453A1. Furthermore, neutral lipids have been incorporated into cationic liposomes (e.g., Farhood et al. 1995). Cationic liposomes have been used to deliver RNAi agent to various cell types (Sioud and Sorensen 2003; U.S. Patent Application 2004/0204377; Duxbury et al., 2004; Donze and Picard, 2002). Use of neutral liposomes disclosed in Miller et al. 1998, and U.S. Publ. 2003/0012812.
[0120] As used herein, the term SNALP refers to a stable nucleic acid-lipid particle. A SNALP represents a vesicle of lipids coating a reduced aqueous interior comprising a nucleic acid such as an iRNA or a plasmid from which an iRNA is transcribed. SNALPs are described, e.g., in U.S. Patent Application Publication Nos. 20060240093, 20070135372, and in International Application No. WO 2009082817. These applications are incorporated herein by reference in their entirety.
[0121] Chemical transfection using lipid-based, amine-based and polymer-based techniques, is disclosed in products from Ambion Inc., Austin, Tex.; and Novagen, EMD Biosciences, Inc., an Affiliate of Merck KGaA, Darmstadt, Germany); Ovcharenko D (2003) Efficient delivery of siRNAs to human primary cells. Ambion TechNotes 10 (5): 15-16). Additionally, Song et al. (Nat Med. published online (Fete 10, 2003) doi: 10.1038/nm828) and others [Caplen et al. 2001 Proc. Nal. Acad. Sci. (USA), 98: 9742-9747; and McCaffrey et al. Nature 414: 34-39] disclose that liver cells can be efficiently transfected by injection of the siRNA into a mammal's circulatory system.
[0122] A variety of molecules have been used for cell-specific RNAi agent delivery. For example, the nucleic acid-condensing property of protamine has been combined with specific antibodies to deliver siRNAs. Song et al. 2005 Nat Biotch. 23: 709-717. The self-assembly PEGylated polycation polyethylenimine has also been used to condense and protect siRNAs. Schiffelers et al., 2004 Nucl. Acids Res. 32: 49, 141-110.
[0123] The siRNA-containing nanoparticles were then successfully delivered to integrin overexpressing tumor neovasculature. Hu-Lieskovan et al., 2005 Cancer Res. 65: 8984-8992.
[0124] The RNAi agents of the present invention can be delivered via, for example, Lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles; double-stranded RNA binding motifs (dsRBMs); or via modification of the RNAi agent (e.g., covalent attachment to the dsRNA).
[0125] Lipid nanoparticles (LNP) are self-assembling cationic lipid based systems. These can comprise, for example, a neutral lipid (the liposome base); a cationic lipid (for siRNA loading); cholesterol (for stabilizing the liposomes); and PEG-lipid (for stabilizing the formulation, charge shielding and extended circulation in the bloodstream). The cationic lipid can comprise, for example, a headgroup, a linker, a tail and a cholesterol tail. The LNP can have, for example, good tumor delivery, extended circulation in the blood, small particles (e.g., less than 100 nm), and stability in the tumor microenvironment (which has low pH and is hypoxic). Neutral liposomes (NL) are non-cationic lipid based particles. Polymer nanoparticles are self-assembling polymer-based particles. Double-stranded RNA binding motifs (dsRBMs) are self-assembling RNA binding proteins, which will need modifications.
[0126] Ribozymes
[0127] Provided herein are methods of treating Shank3 deficiency in a subject in need of treatment thereof by administering to the subject a therapeutically effective amount of an agent that selectively decreases CLK2 protein level or kinase activity, or an agent that selectively decreases the activity of PP2A-B56, wherein one or both of those agents are ribozymes. Ribozymes are catalytic RNA molecules capable of cleaving RNA substrates. Ribozyme specificity is dependent on complementary RNA-RNA interactions (for a review, see Cech and Bass, Annu. Rev. Biochem. 1986; 55: 599-629). Two types of ribozymes, hammerhead and hairpin, have been described. Each has a structurally distinct catalytic center. Ribozyme technology is described further in Intracellular Ribozyme Applications: Principals and Protocols, Rossi and Couture ed., Horizon Scientific Press, 1999. Ribozymes can be designed to induce catalytic cleavage of the mRNA of CLK2 or PP2A-B56, thereby inhibiting expression of CLK2 or PP2A-B56, respectively.
[0128] Antisense Oligonucleotides
[0129] The present invention provides methods of treating Shank3 deficiency in a subject in need of treatment thereof by administering to the subject a therapeutically effective amount of one or more of the following agents: an agent that selectively decreases CLK2 protein level or kinase activity, an agent that selectively increases Akt activity, and an agent that selectively decreases the activity of PP2A-B56. One or more of those agents can be an antisense oligonucleotide. Antisense oligonucleotides can be DNA, RNA, a DNA-RNA chimera, or a derivative thereof. Upon hybridizing with complementary bases in an RNA or DNA molecule of interest, antisense oligonucleotides can interfere with the transcription or translation of the target gene, e.g., by inhibiting or enhancing mRNA transcription, mRNA splicing, mRNA transport, or mRNA translation or by decreasing mRNA stability. As presently used, antisense broadly includes RNA-RNA interactions, RNA-DNA interactions, and RNaseH mediated arrest Antisense nucleic acid molecules can be encoded by a recombinant gene for expression in a cell (see, e.g., U.S. Pat. Nos. 5,814,500 and 5,811,234), or alternatively they can be prepared synthetically (see, e.g., U.S. Pat. No. 5,780,607).
[0130] Aptamers
[0131] Provided herein are methods of treating Shank3 deficiency in a subject in need of treatment thereof by administering to the subject a therapeutically effective amount of an agent that selectively decreases CLK2 protein level or kinase activity, or an agent that selectively decreases the activity of PP2A-B56, wherein one or both of those agents are aptamers. Aptamers are usually created by selection of a large random sequence pool, but natural aptamers also exist. Inhibition of the target molecule by an aptamer may occur by binding to the target, by catalytically altering the target, by reacting with the target in a way that modifies/alters the target or the functional activity of the target, by covalently attaching to the target as a suicide inhibitor, by facilitating the reaction between the target and another inhibitory molecule. Oligonucleotide aptamers may be comprised of multiple ribonucleotide units, deoxyribonucleotide units, or a mixture of those units. Oligonucleotide aptamers may further comprise one or more modified bases, sugars, phosphate backbone units. Peptide aptamers are small, highly stable proteins that provide a high affinity binding surface for a specific target protein. They usually consist of a protein scaffold with variable peptide loops attached at both ends. The variable loop is typically composed of ten to twenty amino acids, and the scaffold can be any protein that has good solubility and compacity properties. his double structural constraint greatly increases the binding affinity of the peptide aptamer to its target protein. Aptamers can be designed to target CLK2 or PP2A-B56 protein.
[0132] Low Molecular Weight Compounds
[0133] The present invention provides methods of treating Shank3 deficiency in a subject in need of treatment thereof by administering to the subject a therapeutically effective amount of an agent that selectively decreases CLK2 protein level or kinase activity, an agent that selectively increases Akt activity, and/or an agent that selectively decreases the activity of PP2A-B56, wherein one or more of those agents are low molecular weight compounds, e.g., a compound with a molecular weight of less than or equal to 2000 Da. For example, a low molecular weight compound that selectively activates Akt activity, e.g., SC79, or a low molecular weight compound that selectively decreases CLK2 protein level or kinase activity, e.g., TG003, can be used to treat Shank3 deficiency in any of the methods described herein.
[0134] In some embodiments, methods of treating Shank3 deficiency described herein comprise administering a therapeutically effective amount of a low molecular weight CLK2 inhibitor that selectively decreases CLK2 protein level or kinase activity. Suitable CLK2 inhibitors include TG003 ((Z)-1-(3-ethyl-5-methoxy-2,3-dihydrobenzothiazol-2-ylidene)propan-2-one) and other selective CLK2 inhibitors known in the art.
[0135] CRISPR that Inhibits CLK2 or PP2A-B56
[0136] Clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems can be used to selectively descrease CLK2 or PP2A-B56 expression in neurons of patients with Shank3 deficiency. For example, a CRISPR-Cas system can be used to selectively edit CLK2 or PP2A-B56 gene. Such a system can include a Cas9 nuclease from S. pyogenes and an engineered single guide RNA, which includes both a crRNA (CRISPR RNA) that binds to the CLK2 or PP2A-B56 genomic DNA by base-pairing and a tracrRNA (transactivating CRISPR RNA), to direct the Cas9 nuclease to CLK2 or PP2A-B56 genomic DNA immediately 5 to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG, so that Cas9 can cleave and/or introduce mutations into the CLK2 or PP2A-B56 gene. (Sander and Joung, Nat. Biotechnol. 32(4): 347-355, 2014; Jiang et al., Nat Biotechnol 31, 233-239, 2013; Jinek et al., Elife 2, e00471, 2013; Hwang et al., Nat Biotechnol 31, 227-229, 2013; Cong et al., Science 339, 819-823, 2013; Mali et al., Science 339, 823-826, 2013c; Cho et al., Nat Biotechnol 31, 230-232, 2013; Jinek et al., Science 337, 816-821, 2012). The CRISPR-Cas system can also include a promoter to express the guide RNA, e.g., the RNA polymerase III-dependent U6 promoter or the T7 promoter. The CRISPR-Cas system can be introduced into neurons by electroporation, nucleofection, lipofectamine-mediated transfection of plasmids that express Cas9 and guide RNA, or by engineered viruses e.g., lentivirus, adenovirus, or adeno-associated viruses. The present disclosure provides use of a CRISPR/Cas system to selectively descrease CLK2 or PP2A-B56 expression for the manufacture of a medicament for treating Shank3 deficiency.
[0137] The CRISPR/Cas system has been modified for use in gene editing (silencing, enhancing or changing specific genes) in vitro (Jinek et al., Science 337, 816-821, 2012), in bacteria (Wiedenheft et al., Nature 482, 331-338, 2012; Jiang et al., Nat Biotechnol 31, 233-239, 2013) and in human cells (Cong et al., Science 339, 819-823, 2013), as well as in vivo in whole organisms such as fruit flies, zebrafish and mice (Wang et al., Cell 153, 910-918, 2013; Shen et al., Cell Res, 2013; Dicarlo et al., Nucleic Acids Res, 2013; Jiang et al., Nat Biotechnol 31, 233-239, 2013; Jinek et al., Elife 2, e00471, 2013; Hwang et al., Nat Biotechnol 31, 227-229, 2013; Cong et al., Science 339, 819-823, 2013; Mali et al., Science 339, 823-826, 2013c; Cho et al., Nat Biotechnol 31, 230-232, 2013; Gratz et al., Genetics 194(4):1029-35, 2013).
[0138] The exact arrangements of the CRISPR and structure, function and number of Cas genes and their product differ from species to species. Haft et al. 2005 PLoS Comput. Biol. 1: e60; Kunin et al. 2007. Genome Biol. 8: R61; Mojica et al. 2005. J. Mol. Evol. 60: 174-182; Bolotin et al. 2005. Microbiol. 151: 2551-2561; Pourcel et al. 2005. Microbiol. 151: 653-663; and Stem et al. 2010. Trends. Genet. 28: 335-340. For example, the Cse (Cas subtype, E. coli) proteins (e.g., CasA) form a functional complex, Cascade, that processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains. Brouns et al. 2008. Science 321: 960-964. In other prokaryotes, Cas6 processes the CRISPR transcript. The CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Cas1 or Cas2. The Cmr (Cas RAMP module) proteins in Pyrococcus fuiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs. A simpler CRISPR system relies on the protein Cas9, which is a nuclease with two active cutting sites, one for each strand of the double helix. Combining Cas9 and modified CRISPR locus RNA can be used in a system for gene editing. Pennisi 2013. Science 341: 833-836. One skilled in the art could design the CRISPR/Cas system to target CLK2 or PP2A-B56 using components of any known CRISPR/Cas systems.
[0139] The CRISPR/Cas system can thus be used to selectively edit a target gene such as CLK2 or PP2A-B56 (adding or deleting a basepair), e.g., introducing a premature stop and decreases expression of overexpressed CLK2 or PP2A-B56. The CRISPR/Cas system can alternatively be used like RNA interference, turning off the target gene in a reversible fashion. In a mammalian cell, for example, the RNA can guide the Cas protein to the target promoter, sterically blocking RNA polymerases.
[0140] Artificial CRISPR/Cas systems that decrease CLK2 or PP2A-B56 expression can be generated using technology known in the art, e.g., those described in U.S. Pat. Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,889,418; 8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233; 8,999,641; 9,023,649; and U.S. Patent Publication Nos. 2015/0152398, 2014/0377868, 2014/0302563, 2014/0295557, 2014/0068797, 2013/0130248, 2011/0223638.
[0141] TALEN that Inhibits CLK2 or PP2A-B56
[0142] TALENs are transcription activator-like effector nucleases that can be used to selectively descrease CLK2 or PP2A-B56 expression in neurons of patients with Shank3 deficiency. This disclosure provides use of a CLK2 or PP2A-B56 TALEN for the manufacture of a medicament for treating Shank3 deficiency.
[0143] TALENs can be artificially produced by fusing a TAL effector DNA binding domain to a DNA cleavage domain, e.g., a wild-type or mutated FokI endonuclease. Transcription activator-like effectors (TALEs) can be engineered to bind any desired DNA sequence, including a portion of a target gene such as CLK2 or PP2A-B56. By combining an engineered TALE with a DNA cleavage domain, a restriction enzyme can be produced which is specific to any desired DNA sequence, including a target gene such as CLK2 or PP2A-B56. These can then be introduced into a cell, wherein they can be used for genome editing. Boch 2011 Nature Biotech. 29: 135-6; and Boch et al. 2009 Science 326: 1509-12; Moscou et al. 2009 Science 326: 3501.
[0144] The RVDs (repeat variable diresidues) of TALE correspond to the nucleotides in their target sites in a direct, linear fashion, one RVD to one nucleotide, with some degeneracy and no apparent context dependence. In some embodiments, the RVD can comprise one or more of: HA for recognizing C; ND for recognizing C; HI for recognizing C; HN for recognizing G; NA for recognizing G; SN for recognizing G or A; YG for recognizing T; and NK for recognizing G, and one or more of: HD for recognizing C; NG for recognizing T; NI for recognizing A; NN for recognizing G or A; NS for recognizing A or C or G or T; N* for recognizing C or T, wherein * represents a gap in the second position of the RVD; HG for recognizing T; H* for recognizing T, wherein * represents a gap in the second position of the RVD; and IG for recognizing T.
[0145] Several TALENs with modified FokI have been made with improved cleavage specificity or activity. Cermak et al. 2011 Nucl. Acids Res. 39: e82; Miller et al. 2011 Nature Biotech. 29: 143-8; Hockemeyer et al. 2011 Nature Biotech. 29: 731-734; Wood et al. 2011 Science 333: 307; Doyon et al. 2010 Nature Methods 8: 74-79; Szczepek et al. 2007 Nature Biotech. 25: 786-793; and Guo et al. 2010 J. Mol. Biol. 200: 96.
[0146] A TALEN can be used inside a cell to produce a double-stranded break (DSB). A mutation can be introduced at the break site if the repair mechanisms improperly repair the break via non-homologous end joining. For example, improper repair may introduce a frame shift mutation. Alternatively, foreign DNA can be introduced into the cell along with the TALEN; depending on the sequences of the foreign DNA and chromosomal sequence, this process can be used to correct a defect in the target gene or introduce such a defect into a wild type target gene, thus decreasing expression of a target gene such as CLK2 or PP2A-B56.
[0147] TALENs specific to sequences in CLK2 or PP2A-B56 can be constructed using any method known in the art, e.g., the fast ligation-based automatable solid-phase high-throughput (FLASH) system described in Reyon et al., Nature Biotechnology 30,460-465 (2012); the methods described in Bogdanove & Voytas, Science 333, 1843-1846 (2011); Bogdanove et al., Curr Opin Plant Biol 13, 394-401 (2010); Scholze & Boch, J. Curr Opin Microbiol (2011); Boch et al., Science 326, 1509-1512 (2009); Moscou & Bogdanove, Science 326, 1501 (2009); Miller et al., Nat Biotechnol 29, 143-148 (2011); Morbitzer et al., T. Proc Nal Acad Sci USA 107, 21617-21622 (2010); Morbitzer et al., Nucleic Acids Res 39, 5790-5799 (2011); Zhang et al., Nat Biotechnol 29, 149-153 (2011); Geissler et al., PLoS ONE 6, e19509 (2011); Weber et al., PLoS ONE 6, e19722 (2011); Christian et al., Genetics 186, 757-761 (2010); Li et al., Nucleic Acids Res 39, 359-372 (2011); Mahfouz et al., Proc Nal Acad Sci USA 108, 2623-2628 (2011); Mussolino et al., Nucleic Acids Res (2011); Li et al., Nucleic Acids Res 39, 6315-6325 (2011); Cermak et al., Nucleic Acids Res 39, e82 (2011); Wood et al., Science 333, 307 (2011); Hockemeye et al. Nat Biotechnol 29, 731-734 (2011); Tesson et al., Nat Biotechnol 29, 695-696 (2011); Sander et al., Nat Biotechnol 29, 697-698 (2011); Huang et al., Nat Biotechnol 29, 699-700 (2011); and methods using modular components as described in Zhang et al., Nat Biotechnol 29, 149-153 (2011). The TALENs can be introduced into neurons by electroporation, nucleofection, lipofectamine-mediated transfection of plasmids that express the TALENs, or by engineered viruses e.g., lentivirus, adenovirus, or adeno-associated viruses.
[0148] Zinc Finger Nuclease that Inhibits CLK2 or PP2A-B56B
[0149] ZFNs are zinc finger nucleases that can be used to selectively descrease CLK2 or PP2A-B56 expression in neurons of patients with Shank3 deficiency. This disclosure provides use of a CLK2 or PP2A-B56 ZFN for the manufacture of a medicament for treating Shank3 deficiency.
[0150] ZFNs can comprise a FokI nuclease domain (or derivative thereof) fused to a DNA-binding domain that comprises one or more zinc fingers. See Carroll et al. 2011. Genetics Society of America 188: 773-782; and Kim et al. Proc. Nal. Acad. Sci. USA 93: 1156-1160. A pair of ZFNs are required to target non-palindromic DNA sites. The two individual ZFNs must bind opposite strands of the DNA with their nucleases properly spaced apart. Bitinaite et al. 1998 Proc. Natl. Acad. Sci. USA 95: 10570-5.
[0151] Like a TALEN, a ZFN can create a double-stranded break in the DNA, which can create a frame-shift mutation if improperly repaired, leading to a decrease in the expression and amount of a target gene such as CLK2 or PP2A-B56 in a cell. ZFNs can also be used with homologous recombination to mutate, or repair defects, in a target gene such as CLK2 or PP2A-B56.
[0152] ZFNs specific to sequences in CLK2 or PP2A-B56 can be constructed using any method known in the art, e.g., by combinatorial selection-based methods described in Maeder et al., 2008, Mol. Cell, 31:294-301; Joung et al., 2010, Nat. Methods, 7:91-92; Isalan et al., 2001, Nat. Biotechnol., 19:656-660; methods described in Cathomen et al. Mol. Ter. 16: 1200-7; Guo et al. 2010. J. Mol. Biol. 400: 96; WO 2011/017293; WO 2004/099366; U.S. Pat. Nos. 6,511,808; 6,013,453; 6,007,988; 6,503,717; U.S. 2002/0160940; Segal et al., 2003, Biochemistry, 42:2137-48; Beerli et al., 2002, Nat. Biotechnol., 20:135-141; Mandell et al., 2006, Nucleic Acids Res., 34:W516-523; Carroll et al., 2006, Nat. Protoc. 1:1329-41; Liu et al., 2002, J. Biol. Chem., 277:3850-56; Bae et al., 2003, Nat. Biotechnol., 21:275-280; and Wright et al., 2006, Nat. Protoc., 1:1637-52. The ZFNs can be introduced into neurons by electroporation, nucleofection, lipofectamine-mediated transfection of plasmids that express the ZNFs, or by engineered viruses e.g., lentivirus, adenovirus, or adeno-associated viruses.
[0153] Combination Therapies
[0154] The various treatments for Shank 3 deficiency described above can be combined. For example, an agent that selectively decreases CLK2 protein level or kinase activity can be combined with an agent that selectively increases Akt activity, or an agent that selectively decreases PP2A-B56 activity. The treatment of Shank3 deficiency presented herein can be combined with other treatment partners such as the current standards of care for Shank3 deficiency, as well as potential future drugs that might be approved for Shank3 deficiency.
[0155] The term combination refers to either a fixed combination in one dosage unit form, or a combined administration where a compound of the present invention and a combination partner (e.g. another drug as explained below, also referred to as therapeutic agent or co-agent) may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect. The single components may be packaged in a kit or separately. One or both of the components (e.g., powders or liquids) may be reconstituted or diluted to a desired dose prior to administration. The terms co-administration or combined administration or the like as utilized herein are meant to encompass administration of the selected combination partner to a single subject in need thereof (e.g. a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration or at the same time. The term pharmaceutical combination as used herein means a product that results from the mixing or combining of more than one therapeutic agent and includes both fixed and non-fixed combinations of the therapeutic agents. The term fixed combination means that the therapeutic agents, e.g. a compound of the present invention and a combination partner, are both administered to a patient simultaneously in the form of a single entity or dosage. The term non-fixed combination means that the therapeutic agents, e.g., a compound of the present invention and a combination partner, are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of three or more therapeutic agent.
[0156] The term pharmaceutical combination as used herein refers to either a fixed combination in one dosage unit form, or non-fixed combination or a kit of parts for the combined administration where two or more therapeutic agents may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect.
[0157] The term combination therapy refers to the administration of two or more therapeutic agents to treat a therapeutic condition or disorder described in the present disclosure. Such administration encompasses co-administration of these therapeutic agents in a substantially simultaneous manner, such as in a single capsule having a fixed ratio of active ingredients. Alternatively, such administration encompasses co-administration in multiple, or in separate containers (e.g., tablets, capsules, powders, and liquids) for each active ingredient. Powders and/or liquids may be reconstituted or diluted to a desired dose prior to administration. In addition, such administration also encompasses use of each type of therapeutic agent in a sequential manner, either at approximately the same time or at different times. In either case, the treatment regimen will provide beneficial effects of the drug combination in treating the conditions or disorders described herein.
[0158] Sample Preparation
[0159] Cellular or tissue samples used in the methods described herein can be obtained from a subject using any of the methods known in the art, e.g., by biopsy or surgery. For example, a cellular or tissue sample comprising olfactory neurons can be obtained through nasal biopsy or surgical resection, and a sample comprising cerebrospinal fluid can be obtained by lumbar puncture. In needle aspiration biopsy, a fine needle attached to a syringe is inserted through the skin and into the tissue of interest. The needle is typically guided to the region of interest using ultrasound or computed tomography (CT) imaging. Once the needle is inserted into the tissue, a vacuum is created with the syringe such that cells or fluid may be sucked through the needle and collected in the syringe. A tissue or cellular sample can also be removed by incisional or core biopsy. For this, a cone, a cylinder, or a tiny bit of tissue is removed from the region of interest. CT imaging, ultrasound, or an endoscope is generally used to guide this type of biopsy.
[0160] The tissue or cellular sample, may be flash frozen and stored at 80 C. for later use. The tissue or cellular sample may also be fixed with a fixative, such as formaldehyde, paraformaldehyde, or acetic acid/ethanol. The fixed tissue sample may be embedded in wax (paraffin) or a plastic resin. The embedded tissue sample (or frozen tissue sample) may be cut into thin sections. RNA or protein may also be extracted from a frozen or fixed tissue or cellular sample.
[0161] Cellular or tissue samples used in the methods described herein can contain induced pluripotent stem (iPS) cells. Dermal fibroblasts can be obtained from a subject by skin biopsy and reprogrammed into pluripotency using a CytoTune-iPS reprogramming kit (Life Technologies, Carlsbad, Calif.) according to the standard protocol. Colonies with hallmark of pluripotent morphology can be picked and subcloned multiple times on plates coated with Matrigel (BD Biosciences, San Jose, Calif.). Pluripotency can be assessed and controlled by FACS analyses using appropriate pluripotency markers, e.g., Oct3/4, Sox2, Nanog, SSEA-3 and Tra1-81 in human, and differentiation markers, e.g., SSEA-1 in human. Karyotype analyses can be performed by full-genome SNP analyses. Neuronal progenitor cells (NPCs) can be obtained by differentiating iPS cells using a modified dual SMAD inhibition as previously described (Chambers et al., 2009; Pecho-Vrieseling et al., 2014).
[0162] Pharmaceutical Compositions, Dosage, and Methods of Administration
[0163] Also provided herein are compositions, e.g., pharmaceutical compositions, for use in treatment of Shank3 deficiency. Such compositions can include one or more of the following: an agent that selectively decreases CLK2 protein level or kinase activity, an agent that selectively increases Akt activity, and an agent that selectively decreases PP2A activity. Such compositions can further include another agent that treats Shank3 deficiency, e.g., risperidone. The Shank3 deficiency can be Phelan-McDermid syndrome, autism spectrum disorder, intellectual disability, or schizophrenia.
[0164] Pharmaceutical compositions typically include a pharmaceutically acceptable carrier. As used herein the language pharmaceutically acceptable carrier includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, oral, intracranial, or intranasal (e.g., inhalation), intradermal, subcutaneous, transmucosal administration.
[0165] Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy. 21st ed., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, N.Y.). For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0166] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders, for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0167] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
[0168] Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0169] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0170] For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressured container or dispenser that contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No. 6,468,798. Systemic administration of a therapeutic compound as described herein can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
[0171] In one embodiment, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
[0172] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
[0173] In non-limiting examples, the pharmaceutical composition containing at least one pharmaceutical agent is formulated as a liquid (e.g., a thermosetting liquid), as a component of a solid (e.g., a powder or a biodegradable biocompatible polymer (e.g., a cationic biodegradable biocompatible polymer)), or as a component of a gel (e.g., a biodegradable biocompatible polymer). In some embodiments, the at least composition containing at least one pharmaceutical agent is formulated as a gel selected from the group of an alginate gel (e.g., sodium alginate), a cellulose-based gel (e.g., carboxymethyl cellulose or carboxyethyl cellulose), or a chitosan-based gel (e.g., chitosan glycerophosphate). Additional, non-limiting examples of drug-eluting polymers that can be used to formulate any of the pharmaceutical compositions described herein include, carrageenan, carboxymethylcellulose, hydroxypropylcellulose, dextran in combination with polyvinyl alcohol, dextran in combination with polyacrylic acid, polygalacturonic acid, galacturonic polysaccharide, polysalactic acid, polyglycolic acid, tamarind gum, xanthum gum, cellulose gum, guar gum (carboxymethyl guar), pectin, polyacrylic acid, polymethacrylic acid, N-isopropylpolyacrylomide, polyoxyethylene, polyoxypropylene, pluronic acid, polylactic acid, cyclodextrin, cycloamylose, resilin, polybutadiene, N-(2-Hydroxypropyl)methacrylamide (HP MA) copolymer, maleic anhydrate-alkyl vinyl ether, polydepsipeptide, polyhydroxybutyrate, polycaprolactone, polydioxanone, polyethylene glycol, polyorganophosphazene, polyortho ester, polyvinylpyrrolidone, polylactic-co-glycolic acid (PLGA), polyanhydrides, polysilamine, poly N-vinyl caprolactam, and gellan.
[0174] An effective amount is an amount sufficient to effect beneficial or desired results. For example, a therapeutic amount is one that achieves the desired therapeutic effect. This amount can be the same or different from a prophylactically effective amount, which is an amount necessary to prevent onset of disease or disease symptoms. An effective amount can be administered in one or more administrations, applications or dosages. A therapeutically effective amount of a therapeutic compound (i.e., an effective dosage) depends on the therapeutic compounds selected. The compositions can be administered one from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the therapeutic compounds described herein can include a single treatment or a series of treatments.
[0175] Dosage, toxicity and therapeutic efficacy of the therapeutic compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
[0176] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
[0177] Kits
[0178] Also provided herein are kits including one or more of the compositions provided herein and instructions for use. Instructions for use can include instructions for diagnosis or treatment of Shank3 deficiency. Kits as provided herein can be used in accordance with any of the methods described above, e.g., diagnosing or treating Shank3 deficiency. Those skilled in the art will be aware of other suitable uses for kits provided herein, and will be able to employ the kits for such uses. Kits as provided herein can also include a mailer (e.g., a postage paid envelope or mailing pack) that can be used to return the sample for analysis, e.g., to a laboratory. The kit can include one or more containers for the sample, or the sample can be in a standard blood collection vial. The kit can also include one or more of an informed consent form, a test requisition form, and instructions on how to use the kit in a method described herein. Methods for using such kits are also included herein. One or more of the forms (e.g., the test requisition form) and the container holding the sample can be coded, for example, with a bar code for identifying the subject who provided the sample.
[0179] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described.
EXAMPLES
[0180] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Example 1: Shank3 Loss of Function Impairs Akt Activity in Rat Primary Cortical Neurons and PMDS Patient Neurons
[0181] Materials and Methods
[0182] Antibodies and Reagents
[0183] The following antibodies were purchased from Cell Signaling Technology: Akt, P-Akt (T308), P-Akt (S473), Erk1/2, P-Erk1/2 (T202/Y204), PLC, P-PLC, PP2Ac subunit, P-rpS6 (S240/244), rpS6, P-TrkB (Y706/707), TrkB, and polyubiquitin K48-linkage. Shank3 antibody was obtained from Santa Cruz Biotechnology. HA-tag (rabbit) and CLK2 antibodies were from Abcam. HA-tag (HA.11, mouse) was from Covance. FLAG-tag (M2) antibody was from Sigma. GFP antibody was from Aves Labs. TG003, Akti (Akt-VIII), and Okadaic acid were from Sigma-Aldrich. SC79 was from Millipore. MG132 was from Cell Signaling Technology. BDNF was from Bioworld.
[0184] Primary Rat Cortical Neuron Culture, Lentivirus, and Plasmid Production
[0185] E18 primary rat cortical neurons were dissected, cultured and infected 6 days after plating (DIV6) with indicated lentiviruses at MOI 10, as previously described (Proenca et al., 2013). Lentiviruses were produced by calcium phosphate transfection of HEK293T cells with packaging plasmids (Life Technologies) and transfer plasmid in 10 cm dishes. Cells were transferred to fresh medium 6 hrs. post-transfection. Four days post-transfection, the cell medium was collected and pooled from several dishes, cleared of cellular debris by 0.45 m filtration, and concentrated 100 by centrifugation at 19,000 g for 90 min in a Beckman Ultracentrifuge using a SW28/SW32 rotor. Pellets were suspended in PBS/0.5% BSA and viral titer was determined by ELISA quantification of viral p24 antigen (Zeptometrix Corp, USA). For shRNA plasmid generation, oligonucleotides were annealed and ligated into lentiviral transfer plasmid pLKO.1-GFP vector at the AgeI/EcoRI sites. The target sequences of shRNAs that target rat and mouse Shank3 (5-3) are: CCACGTCACTCACAAGTITCT (SEQ ID NO: 1), GGTITGGAGTCTGGACTAAGC (SEQ ID NO: 2), and GGAAGTCACCAGAGGACAAGA (SEQ ID NO: 3). The latter was previously reported (Verpelli et al., 2011). A luciferase-targeting sequence was used as an shRNA control: AACTTACGCTGAGTACTTCGA (SEQ ID NO: 4).
[0186] Immunoprecipitation and Western Blotting
[0187] For immunoprecipitation (IP) of HA-tagged Akt, neurons were lysed in IP buffer (20 mM Tris-HCl pH 7.4, 3 mM EDTA, 3 mM EGTA, 150 mM NaCl, 0.5% NP-40, and protease/phosphatase inhibitor cocktails (Roche)). Lysates were cleared by centrifugation at 13,000 rpm for 10 min and lysates normalized for protein abundance were immunoprecipitated with rabbit HA-tag antibody for 1 h at 4 C. Immuno-complexes were then captured by incubation for an additional 1 hr with Protein A agarose beads (Roche). Beads were washed three times with IP buffer and bound proteins were eluted with 2 SDS-PAGE sample buffer, then boiled for 5 min. For IP and analysis of ubiquitinated Myc-Clk2, neurons were lysed in Ubiquitin IP buffer (20 mM Tris-HCl pH 7.4, 3 mM EDTA, 3 mM EGTA, 150 mM NaCl, 1% Triton X-100, protease/phosphatase inhibitor cocktails (Roche), 5 mM N-ethylmaleimide, and 3 mM iodoacetamide) containing 1% SDS. Lysates were boiled for 20 min to denature proteins and then centrifuged for 10 min at 13, 000 rpm. Lysates were subsequently diluted to 0.1% SDS with Ubiquitin IP buffer and immunoprecipitated with Myc antibody for 1 h. Complexes were then captured by addition of Protein G agarose (Roche) and additional 1 h incubation. Beads were washed 3 and eluted with 2 SDS-PAGE sample buffer, then boiled for 5 min. Samples prepared for SDS-PAGE were then resolved on 4-12% Novex gels (Life Technologies), transferred to PVDF membranes, blocked in 5% low-fat milk in TBS/0.1% Tween-20, and incubated overnight with primary antibodies. After washing and 1 h incubation with secondary antibodies, proteins were visualized by Chemiluminescent detection (Amersham-GE Healthcare Life Sciences). For cell lysates prepared in RIPA buffer, as indicated in figure legends, SDS-PAGE and Western blotting was performed as above.
[0188] Genomic Real-Time PCR
[0189] Real-Time PCR analysis was conducted to detect possible Shank3 breakpoint mutations in Phelan-McDermid syndrome patient lines according to the procedure described in Bonaglia et al. The analysis was performed using the QuantStudio 12K Flex System (Life Technologies) and the Power SYBR Green PCR Master Mix (Life Technologies). Thermal cycling conditions were 95t for 10 min, followed by 40 cycles of 95t for 15 s and 60 C. for 1 min. Samples were processed in triplicate using seven couples of primers (namely 22-1 to 22-7) designed to amplify the non-repeated portions of the SHANK3 gene. For each assay, the detected Ct values were normalized using the MAPK endogenous control to obtain Ct values. Ct values for the patient samples (PMDS1, PMDS2) were further normalized to that of the wild-type SHANK3 positive control sample (CTRL 1) to calculate Ct values (according to Applied Biosystems guidelines, Part Number 4387787 Rev. B). These Ct results were displayed as 2{circumflex over ()}-Ct along with their standard deviations.
[0190] Cell Reprogramming and Differentiation
[0191] Primary human dermal fibroblasts from neonatal (Invitrogen, Carlsbad, Calif.) and adults (University of Milano, Dr. Sala) were taken for reprogramming using the CytoTune-iPS reprogramming kit (Life Technologies, Carlsbad, Calif.) according to the standard protocol. Colonies with hallmark of pluripotent morphology were readily visible between days 17 and 20 after transduction. These were picked and subcloned multiple times on plates coated with Matrigel (BD Biosciences, San Jose, Calif.) in mTeSR medium until Sendai virus RNA could no longer be detected and the morphology looked stable. Pluripotency was controlled by FACS analyses with the Human Pluripotent Stem Cell Sorting and Analysis Kit (BD Biosciences) using Oct3/4, Sox2, Nanog, SSEA-3 and Tra1-81 as pluripotency markers and SSEA-1 as differentiation marker following the protocols suggested by the provider. Karyotype analyses was performed by full-genome SNP analyses by Life&Brain Gmbh (Bonn). All lines showed a normal karyotoype. Neuronal precursors were differentiated from iPS cells by using a modified dual SMAD inhibition as described earlier (Chambers et al., 2009; Pecho-Vrieseling et al., 2014). Briefly, 105 undifferentiated hiPSC were seeded in an ULA 96-well in 0.1 ml neural induction medium (20% knockout-serum replacement (Invitrogen), 0.1 mM MEM non-essential amino acids (Invitrogen), 0.1 mM 2-mercaptoethanol (Invitrogen), 75% DMEM/F11/GlutaMAX (Invitrogen Gibco); Pen/Strep, 10 ng ml-1 bhFGF (1:1,000, Invitrogen), 10 M SB 431542 (1:1,000) (Tocris, Bristol, UK) and 1 M LDN 193189 (1:10,000) (Stemgent) with 10 M Rock inhibitor to prevent apoptosis (Calbiochem, Darmstadt, Germany). Two days later 0.1 ml of fresh induction media was added to the old one. The next day 30 embryoid bodies (EB) were transferred to a 35 mm matrigel dish with induction media. At day 10 EB's were cleaned to have only neuronal rosettes left. Then the plate was trypsinized and plated on a new 35 mm matrigel plate in proliferation medium (DMEM/F12 with B27 and N2 supplements (Invitrogen) with 10 ng ml-1 bhFGF and 10 ng/ml hEGF) supplemented with 10 M Rock inhibitor (Calbiochem). As soon as the plate was highly confluent neuronal progenitor cells (NPCs) were split by trypsinization either on matrigel plates for further amplification or frozen with 10% DMSO (vol/vol) at a concentration of 106 cells per vial and stored in liquid nitrogen. Quality control of the NPC culture was performed by using CD24, CD184 and CD44 of the Human Neural Cell Sorting Kit (BD Biosciences) according to the suggested protocol of the provider.
[0192] Statistical Analysis
[0193] All data are expressed as meanSEM. Statistical analysis was performed by a Student's t Test (Excel, Microsoft, USA) or ANOVA, as indicated. The significance level was set at p<0.05.
[0194] Results
[0195] To determine whether Shank3 deficiency impacts the PI3K-Akt-mTOR signaling pathway (
[0196] Western blot analysis indicated a two-fold reduction of Akt phosphorylation at the PDK1-dependent activation loop site, T308, in the basal state (
[0197] T308 phosphorylation of Akt was also reduced in human iPS-derived neurons from two PMDS patients who harbor short intragenic deletions within the Shank3 locus (
[0198] Taken together, these data demonstrate that reduced Shank3 expression impairs Akt phosphorylation and activity.
Example 2: Reduced Akt Activity in Shank3 Deficient Neurons is Associated with PP2A Activity
[0199] Materials and Methods
[0200] TiO2 Phosphopeptide Enrichment and LC-MS/MS Analysis
[0201] Primary cortical rat neuron cells were harvested in lysis buffer (200 mM ammonium bicarbonate pH 7.5, 8 M Urea, PhosSTOP from Roche) reduced, alkylated and digested overnight with trypsin after dilution to 2M urea. The peptides were acidified to 1% TFA, desalted on SepPak C18 cartridges and eluted with 60% acetonitrile, 0.1% TFA. Phosphopeptides were enriched from peptide mixtures using a titanium dioxide (TiO2) column. The chromatographic microcolumns were packed with TiO2 as described (Thingholm et al., 2006). Lyophilized peptides were dissolved in 80% acetonitrile, 2.5% TFA and 1M Glycolic Acid. After loading the peptide mixtures to the column, the non-phosphorylated peptides were removed with 80% acetonitrile, 2.5% TFA, 1M Glycolic Acid and 80% acetonitrile, 2.5% TFA then the phosphorylated peptides retained on the column were eluted with alkaline solution pH10.5 (20 l of 25% ammonia solution in 300 l acetonitrile and 680 l ultra-high quality water). For LC-MS/MS, the purified phosphopeptides were resuspended in 10% formic acid and analyzed with two technical replicated each, using an EASY-nano LC system (Proxeon Biosystems, Odense, Denmark) coupled online with an LTQ-Orbitrap mass spectrometer (Thermo Scientific, Waltham, Mass.). Each sample was loaded onto a 15 cm packed in house ReproSil-Pur C18 3 M column (75 m inner diameter). Buffer A consisted of H2O with 0.1% formic acid and Buffer B of 100% acetonitrile with 0.1% formic acid. Peptides were separated using a gradient from 2% to 30% buffer B for 175 min, from 30% to 50% buffer B for 20 min and from 50% to 80% buffer B for 5 min (a total of 220 min at 250 nL/min). Data acquisition was done using a Top 15 method, where every full MS scan was followed by 15 data-dependent scans on the 15 most intense ions from the parent scan. Full scans were performed in the Orbitrap at 120000 resolution with target values of 1E6 ions and 500 ms injection time, while MS/MS scans were done in the ion trap with 1E4 ions and 200 ms. Database searches were performed with Mascot Server using Uniprot database (version 3.87). Mass tolerances were set at 10 ppm for the full MS scans and at 0.8 Da for MS/MS. Label free quantification was performed on technical duplicate LC-MS runs for each sample using Progenesis LC-MS (Nonlinear Dynamics Software). The peptide intensities were normalized across all LS/MS runs by Progenesis software and normalized peptide intensities were summed for each unique phosphorylated peptide with mascot score exceeding 20. These intensities were then used to calculate the log 2 fold change ratios of each unique phosphopeptide. In case of ambiguous phosphorylation site assignments, spectra were manually interpreted for confirmation localization of the phosphorylation site using Scaffold (Proteome software).
[0202] Results
[0203] To understand the mechanistic basis for the impaired Akt activation caused by reduced Shank 3 expression, an unbiased Mass Spectrometry-based phosphoproteomic analysis was deployed to identify imbalanced signaling regulating Akt activity as described above. Specifically, phosphopeptide abundance was compared between Shank3 knock down and control neurons (
[0204] Further validation was provided by incubating neurons with the PP2A phosphatase inhibitor, okadaic acid. Cortical neurons, transduced with shRNA-expressing lentiviruses on DIV 6, were treated with 50 ng/ml BDNF or okadaic acid (100 nM) on DIV 16 and cell lysates were resolved by SDS-PAGE, followed by Western blotting. As anticipated, okadaic acid treatment, either alone or in combination with BDNF, enhanced Akt T308 phosphorylation in both control and Shank3 knock down neurons. However, the increase of Akt T308 phosphorylation in Shank3 knock down neurons was two-fold greater than the increase in non-treated control neurons, indicating an enhanced activity of PP2A in these neurons (
Example 3: Aberrant CLK2 Expression and Activation in Shank3 Deficient Neurons
[0205] What causes enhanced B56 phosphorylation in Shank3 knock down neurons? B56 is directly phosphorylated by CLK2 (Rodgers et al., 2011, Molecular Cell 41: 471-479), an event that precipitates PP2A recruitment to, and desphosphorylation of, Akt (
[0206] DIV6 neurons were co-transduced with shRNA and Myc-CLK2 lentiviruses. Cell lysates were prepared in IP buffer on DIV 16 and immunoprecipitated with anti-Myc antibody followed by Western blotting with a polyubiquitin antibody specific for the proteasome-targeting K48-linkage. Immunoprecipitation of overexpressed Myc-CLK2 revealed a marked decrease in ubiquitination of CLK2 in Shank3 knock down neurons (
[0207] As a whole, these results indicate that upregulated CLK2 in Shank3-deficient neurons results from its impaired ubiquitination, thereby causing aberrant steady-state expression and activation.
Example 4: Akt-Activation or CLK2-Inhibition Rescues Synaptic Deficits in Shank3 Deficient and PMDS Neurons
[0208] Materials and Methods
[0209] Mice and Organotypic Slice Cultures
[0210] Wilde type (C57Bl/6) mice were housed in a temperature-controlled room and maintained on a 12 hr light/dark cycle. Food and water were available ad libitum and experiments were carried out in accordance with the local authorization guidelines for the care and use of laboratory animals. Slice cultures were established according to the procedure described by Stoppini and colleagues (Galimberti et al., 2006; Stoppini et al., 1991). Finally, slices were selected, placed on Millicel (Millipore, PICM03050) and cultured in 6-well dishes at 35 C. and 5% C02 in 1 ml of culture medium. For organotypic slice cultures, brains of P6-P9 transgenic mice were dissected in cold MEM (GIBCO) medium, and hippocampal coronal sections of 400 m were obtained with a tissue chopper (McIlwain). Slices were selected, placed on Millicell (Millipore, PICM03050) and cultured in 6-well dishes at 35 C. and 5% C02 in the presence of 1 ml of medium. The entire slice isolation procedure took about 30 min. The culture medium was exchanged every third day. Treatments were performed in fresh culture medium for the indicated time periods.
[0211] Biolistic Transfection
[0212] Brain slices were transfected with plasmids encoding shCont, and shShank3 using helios gene gun system (Bio-Rad Laboratories, #165-2431) as previously described (Proenca et al., 2013). Subsequently, slices were fixed, stained, mounted, and analyzed following the protocols described below in the immunohistochemistry and microscopy paragraphs.
[0213] Immunohistochemistry
[0214] Slices were fixed for 10 minutes in 4% PFA, washed in PBS and blocked for 4 hr at room temperature in 0.3% Triton X-100 20% Horse Serum/PBS (blocking solution). GFP primary antibody was incubated for 24 hr at 4 C. in the blocking solution. Afterwards, slices were washed in PBS, incubated for 2 hr in 0.3% Triton X-100/PBS with Alexa Fluor 488 Donkey anti-chicken secondary antibody (Life technologies). Finally, slices were washed in PBS, incubated 10 minutes with DAPI (Life technologies) and mounted on glass slides using ProLong mountant (Life technologies).
[0215] Electrophysiology
[0216] Organotypice slices and cell cultures were transferred from growth medium to an interface chamber containing ACSF equilibrated with 95% O2/5% CO2 containing the following (in mM): 124 NaCl, 2.7 KCl, 2 CaCl2), 1.3 MgCl2, 26 NaHCO.sub.3, 0.4 NaH2PO4, 18 glucose, 4 ascorbate. Recordings were performed with ACSF in a recording chamber at a temperature of 35 C. at a perfusion rate of 1-2 ml/min. Neurons were visually identified with infrared video microscopy using an upright microscope equipped with a 40 objective (Olympus, Tokyo, Japan). Patch electrodes (3-5 M) were pulled from borosilicate glass tubing. For voltage clamp experiments to record miniature inhibitory post-synaptic currents (mIPSCs), patch electrodes were filled with a solution containing the following (in mM): 110 CsCl, 30 K-gluconate, 1.1 EGTA, 10 HEPES, 0.1 CaCl2), 4 Mg-ATP, 0.3 Na-GTP (pH adjusted to 7.3 with CsOH, 280 mOsm) and 4 N-(2,6-Dimethylphenylcarbamoylmethyl)triethylammonium bromide (QX-314; Tocris-Cookson, Ellisville, Mo.). To exclude GABAergic inputs, picrotoxin (100 M) was added to the ACSF. Confirmation of AMPA receptor-mediated inputs was performed by adding CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, 10 M: AMPA receptor antagonist) to the ACSF. To exclude action potential dependent IPSCs in the organotypic slices, tetrodotoxin (TTX, 1 M) was added to the ACSF.
[0217] Whole cell patch-clamp recordings were excluded if the access resistance exceeded 13 M and changed more than 20% during the recordings. Data were recorded with a MultiClamp 700B (Molecular Devices) amplifier, filtered at 0.2 kHz, and digitised at 10 kHz. Data were acquired and analysed with Clampex 10.0, Clampfit 10.0 (Molecular Devices) and the Mini Analysis Program (Synaptosoft, Decatur, Ga.). All reagents for the internal and external solutions were purchased from Fluka/Sigma (Buchs, Switzerland). Glutamatergic blockers were purchased from Tocris Bioscience (Bristol, UK). TTX was from Latoxan (Valence, France).
[0218] Microscopy and Quantification
[0219] High resolution images were acquired on an upright Zeiss LSM700 confocal microscope, using a Plan-Neofluar 100/1.3 oil immersion objective. For the analysis of dendritic spine density, confocal 3D stacks were acquired in CA1 region for each experiment. To quantify spine density, a stretch of approximately 30 m was selected on secondary dendrites originating at the branch point from the primary dendrite. Only secondary dendrites were considered to reduce variability. Dendritic length was measured using the ImageJ plugin, Simple Neurite tracer, and spine density manually counted using the Cell Counter plugin.
[0220] Results
[0221] The above findings implicate CLK2 overexpression as a specific anomaly that is causative for attenuated Akt activity in neurons deficient for Shank3. Consequently, inhibiting CLK2 activity or directly activating Akt would restore neuronal impairments associated with Shank3 loss of function. First, a small-molecule Akt-activator, SC79, was tested for its ability to restore Akt phosphorylation (
[0222]
[0223]
TABLE-US-00001 TABLE1 CLK2shRNAs shRNA TargetSequence SEQIDNO shCLK2-1 GCATCATCTTTGAGTACTACG 5 shCLK2-2 CTTCTCGGATGATCAGAAAGA 6 shCLK2-3 GAATATGTGGAATAGTGTAAA 7 shCLK2-4 GAATAGTGTAAATATGACAGA 8 shCLK2-5 ACATGTATATACTACTATTTA 9
[0224] Given that SC79 and TG003 were able to recover spine numbers in Shank3 knock down neurons, the reinstatement of synaptic transmission was examined next. First, miniature excitatory postsynaptic currents (mEPSCs) were recorded from shRNA-expressing CA1 neurons in hippocampal organotypic slice cultures. Knock-down of Shank3 yielded a pronounced reduction of mEPSC frequency without impacting amplitude, an outcome that has previously been described in several Shank3 loss of function models (Peca et al., 2011, Nature 472: 437-442; Shcheglovitov et al., 2013, Nature 503: 267-271; Verpelli et al., 2011, The Journal of Biological Chemistry 286, 34839-34850) and by inhibition of insulin signaling to Akt (Lee et al., 2011, Neuropharmacology 61: 867-879). Similar to the effect on spine density, overnight treatment of Shank3 knock down neurons with 4 g/ml SC79 completely restored mEPSC frequency to control levels (
[0225] Taken together, these results strongly suggest that Akt activity is impaired in Shank3 knock down or PMDS neurons and thereby insufficient for sustained neuronal function, specifically dendritic spine formation and synaptic transmission. As shown above, direct restoration of Akt activity, or by way of CLK2 inhibition, is sufficient to reverse these impairments Shank3 deficient or PMDS neurons.
Example 5: CLK2-Inhibition Rescues Deficits in Social Behavior Caused by Shank3 Deficiency
[0226] Generation of Shank3.sup.C/C Mice
[0227] To determine whether the above findings extend to autism spectrum disorder (ASD)-like behaviors, a Shank3-deficient mouse model was generated by ablation of Shank3 exon 21 (
[0228] The major Shank3 isoforms were absent in the homozygous mice (Shank3.sup.C/C), while faster-migrating, truncated fragments were detected (
[0229] Behavioral Testing
[0230] The three-chamber social interaction task was performed in a three-chambered arena with transparent walls and retractable doorways to allow mice access to flanking chambers (
[0231] To monitor spontaneous self-grooming, mice were placed in a clean cage (identical to the home cage), with minimal bedding to discourage digging, which was then placed in the sound-proof box for video monitoring. Animals were habituated in the new cage for 10 minutes before self-grooming was monitored during another 10 minutes. Cumulative grooming time was reported for this second 10 minute period.
[0232] To assess motor coordination on the rotarod device, mice were initially given a training session for 300 seconds at a constant rotation corresponding to the starting test speed. Mice were then tested over three trials in which the rotarod accelerated from either 5 to 50 revolutions per minute (Basel cohort) or from 4 to 40 revolutions per minute (Cambridge cohort) up to a maximum of 300 seconds per session or whenever the mouse falls from the rod.
[0233] To measure locomotor activity in the open-field, Omnitech Accuscan locomotor activity boxes measuring 40 cm40 cm were used. Animals' locomotor performance was measured by beam breaks. Mice were acclimated to the testing room for a minimum of 30 minutes before testing, and then placed into the chambers for 120 minutes. The total distance traveled was measured. Assessment of anxiety was determined from the time spent in the center of the arena.
[0234] To measure anxiety, an elevated zero maze was used. his apparatus measures 52 cm wide by 50 cm high and is comprised of a ring walkway divided into four quadrants, two of which have open sides and two that are enclosed by high walls. The open arms are illuminated by high light levels (600-700 lux) which in pilot testing yields around 20% time spent in open arms in 8 week old C58B/6J mice. Mice are acclimated to the testing room for a minimum of 60 minutes before testing, and are then placed onto the maze for a 5 minute testing session. The % time spent on open arms and the total distance traveled are measured.
[0235] To assess avoidance behavior by marble burying, 20 black marbles were evenly distributed in rows in a novel home cage on top of 5 cm of fresh bedding and mice were left undisturbed for 30 minutes in the cage. The number of marbles to at least 2/3 depth were then recorded.
[0236] Results
[0237]
Example 6: IGF-1 Treatment Restores Dendritic Spine Density to Shank3 Knockdown Neurons, in an Akt-Dependent Manner
[0238] Cellular and behavioral impairments attributed to Shank3 loss of function have been corrected with IGF-1 treatment (Shcheglovitov et al., Nature 503, 267-271, 2013; Kolevzon et al., Molecular autism 5, 54, 2014; Bozdagi et al., Molecular autism 4, 9, 2013). Hippocampal organotypic slice culture was established as described in Example 4. Hippocampal organotypic slice culture neurons were transfected with shRNA vectors, and slices were treated for 24 h with 1 g/ml IGF-1, or 1 g/ml IGF-1 and 10 M Akti, prior to fixation on DIV 14. IGF-1 treatment restored normal dendritic spine density to Shank3 knockdown neurons, in an Akt-dependent manner (
[0239] Unless defined otherwise, the technical and scientific terms used herein have the same meaning as they usually understood by a specialist familiar with the field to which the disclosure belongs.
[0240] Unless indicated otherwise, all methods, steps, techniques and manipulations that are not specifically described in detail can be performed and have been performed in a manner known per se, as will be clear to the skilled person. Reference is for example again made to the standard handbooks and the general background art mentioned herein and to the further references cited therein. Unless indicated otherwise, each of the references cited herein is incorporated in its entirety by reference.
[0241] Claims to the invention are non-limiting and are provided below.
[0242] Although particular aspects and claims have been disclosed herein in detail, this has been done by way of example for purposes of illustration only, and is not intended to be limiting with respect to the scope of the appended claims, or the scope of subject matter of claims of any corresponding future application. In particular, it is contemplated by the inventors that various substitutions, alterations, and modifications may be made to the disclosure without departing from the spirit and scope of the disclosure as defined by the claims. The choice of nucleic acid starting material, clone of interest, or library type is believed to be a matter of routine for a person of ordinary skill in the art with knowledge of the aspects described herein. Other aspects, advantages, and modifications considered to be within the scope of the following claims. Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, many equivalents of the specific aspects of the invention described herein. Such equivalents are intended to be encompassed by the following claims. Redrafting of claim scope in later filed corresponding applications may be due to limitations by the patent laws of various countries and should not be interpreted as giving up subject matter of the claims.