ANTI-ANNEXIN A2 MONOCLONAL ANTIBODIES
20200399353 ยท 2020-12-24
Inventors
- Simeon Cua (Singapore, SG)
- Andre Boon Hwa Choo (Singapore, SG)
- Heng Liang Tan (Singapore, SG)
- Wey Jia Fong (Singapore, SG)
- Vanessa Mei Yee Ding (Singapore, SG)
- Leonard Wen Yan Leong (Singapore, SG)
Cpc classification
C07K2319/33
CHEMISTRY; METALLURGY
C07K2319/30
CHEMISTRY; METALLURGY
C07K2317/732
CHEMISTRY; METALLURGY
C07K2317/73
CHEMISTRY; METALLURGY
A61K39/3955
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
C07K2317/40
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
C07K2317/90
CHEMISTRY; METALLURGY
A61K38/1774
HUMAN NECESSITIES
C07K2317/24
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
A61K47/6843
HUMAN NECESSITIES
International classification
A61K31/5377
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
A61K47/68
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C07K14/705
CHEMISTRY; METALLURGY
Abstract
The present invention relates to an antigen-binding protein, or an antigen-binding fragment thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GYSITSGYSWH; a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS and a VHCDR3 having the amino acid sequence GSNYGFDY; and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSNDQKNYLA, a VLCDR2 having the amino acid sequence WASIRES, and a VLCDR3 having the amino acid sequence QQYYIYPLT. The present invention also relates to an antigen-binding protein, or an antigen-binding fragment thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence VYSITSGYSWH; a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS, and a VHCDR3 having the amino acid sequence GTDNAVDY; and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSSNQKNYLA, a VLCDR2 having the amino acid sequence WAS SRES, and a VLCDR3 having the amino acid sequence QQYYIYPLT. Compositions comprising the antigen-binding protein, or antigen-binding fragment thereof, methods of use of the antigen-binding protein, or antigen-binding fragment thereof and kits comprising the antigen-binding protein, or antigen-binding fragment thereof are also provided.
Claims
1-62. (canceled)
63. A method of treating or preventing cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an antigen-binding protein or an antigen-binding fragment thereof, or a composition comprising a physiologically acceptable carrier and a therapeutically effective amount of an antigen-binding protein or an antigen-binding fragment thereof, wherein said antigen-binding protein or antigen-binding fragment thereof binds to an N-linked glycan on annexin A2 (ANXA2).
64. The method as claimed in claim 63, wherein the N-linked glycan is located at amino acid residue 62 of ANXA2.
65. The method of claim 63, wherein said antigen-binding protein or antigen-binding fragment thereof comprises: a) (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GYSITSGYSWH (SEQ ID NO: 9); a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS (SEQ ID NO: 10) and a VHCDR3 having the amino acid sequence GSNYGFDY (SEQ ID NO: 11); and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSNDQKNYLA (SEQ ID NO: 12), a VLCDR2 having the amino acid sequence WASIRES (SEQ ID NO: 13), and a VLCDR3 having the amino acid sequence QQYYIYPLT (SEQ ID NO: 14), or b) (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence VYSITSGYSWH (SEQ ID NO: 21); a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS (SEQ ID NO: 10), and a VHCDR3 having the amino acid sequence GTDNAVDY (SEQ ID NO: 22); and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSSNQKNYLA (SEQ ID NO: 23), a VLCDR2 having the amino acid sequence WASSRES (SEQ ID NO: 24), and a VLCDR3 having the amino acid sequence QQYYIYPLT (SEQ ID NO: 14), or c) (i) a heavy chain variable domain comprising a VHCDR1 having an amino acid sequence encoded by the nucleic acid sequence GCTACTCCATCACCAGTGGTTATAGCTGGCAC (SEQ ID NO: 15); a VHCDR2 having an amino acid sequence encoded by the nucleic acid sequence ACATACACTACAGTGGTAGCACTAAGTACAACCCATCTCTCAAAAGTC (SEQ ID NO: 16), and a VHCDR3 having an amino acid sequence encoded by the nucleic acid sequence GGAGTAACTACGGATTTGACTACT (SEQ ID NO: 17); and (ii) a light chain variable domain comprising a VLCDR1 having an amino acid sequence encoded by the nucleic acid sequence AGTCCAGTCAGAGCCTTTTATATAGTAACGATCAAAAGAACTACTTGGCCT (SEQ ID NO: 18), a VLCDR2 having an amino acid sequence encoded by the nucleic acid sequence GGGCATCTATTAGGGAATCTG (SEQ ID NO: 19), and a VLCDR3 having an amino acid sequence encoded by the nucleic acid sequence AGCAATATTATATCTATCCTCTCACGT (SEQ ID NO: 20), or d) (i) a heavy chain variable domain comprising a VHCDR1 having an amino acid sequence encoded by the nucleic acid sequence TCTACTCCATCACCAGTGGTTATAGCTGGCACT (SEQ ID NO: 25); a VHCDR2 having an amino acid sequence encoded by the nucleic acid sequence ACATACACTACAGTGGTAGTACTAAGTACAACCCATCTCTCAAAAGTC (SEQ ID NO: 26), and a VHCDR3 having an amino acid sequence encoded by the nucleic acid sequence GGACCGACAATGCTGTGGACTACT (SEQ ID NO: 27); and (ii) a light chain variable domain comprising a VLCDR1 having an amino acid sequence encoded by the nucleic acid sequence AGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAAAGAACTACTTGGCCT (SEQ ID NO: 28), a VLCDR2 having an amino acid sequence encoded by the nucleic acid sequence GGGCATCCAGTAGGGAATCTG (SEQ ID NO: 29), and a VLCDR3 having an amino acid sequence encoded by the nucleic acid sequence AGCAATATTATATCTATCCTCTCACGT (SEQ ID NO: 20).
66. The method as claimed in claim 63, wherein the heavy chain variable region of (a) comprises the amino acid sequence set forth in SEQ ID NO:1, or wherein the heavy chain variable region of (b) comprises the amino acid sequence set forth in SEQ ID NO:5.
67. The method as claimed in claim 63, wherein the light chain variable region of (a) comprises the amino acid sequence set forth in SEQ ID NO:2, or wherein the light chain variable region of (b) comprises the amino acid sequence set forth in SEQ ID NO: 6.
68. The method as claimed in claim 63, wherein the heavy chain variable region of (c) comprises the nucleic acid sequence set forth in SEQ ID NO:3, or wherein the heavy chain variable region of (d) comprises the nucleic acid sequence set forth in SEQ ID NO:7.
69. The method as claimed in claim 63, wherein the light chain variable region of (c) comprises the nucleic acid sequence set forth in SEQ ID NO:4, or wherein the light chain variable region of (d) comprises the nucleic acid sequence set forth in SEQ ID NO: 8.
70. The method as claimed in claim 63, wherein the antigen binding protein is selected from the group consisting of monoclonal, recombinant, polyclonal, chimeric, humanised, bispecific and heteroconjugate antibodies; a chimeric antigen receptor (CAR), a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, a single chain antibody, a univalent antibody lacking a hinge region, a minibody and diabodies; optionally wherein the binding protein is a monoclonal antibody; optionally wherein the monoclonal antibody is 2448 or C51; optionally wherein the monoclonal antibody is humanized; optionally wherein the monoclonal antibody is chimeric; optionally wherein the monoclonal antibody is defucosylated; optionally wherein the degree of fucosylation is less than 10%, preferably less than 5%, and more preferably is less than 1.5% relative to the wild-type antibody.
71. The method as claimed in claim 63, wherein the antigen-binding protein, or antigen-binding fragment thereof further comprises a radioisotope or a cytotoxin conjugated thereto; optionally wherein the antibody is conjugated with a cytotoxin selected from the group consisting of monomethyl auristatin E (MMAE-1), mertansine (DM-1) and saporin; optionally wherein the antigen-binding protein, or an antigen-binding fragment is internalized into a cell upon binding to ANXA2; optionally wherein the antigen-binding protein, or an antigen-binding fragment thereof has a cytotoxic activity selected from one or more of the group consisting of complement dependent cytotoxic (CDC) activity, antibody dependent cellular cytotoxic (ADCC) activity and oncolytic activity.
72. The method as claimed in claim 63, wherein the composition comprises a further active pharmaceutical ingredient selected from the group consisting of bevacizumab, carboplatin, paclitaxel or gefitinib.
73. The method as claimed in claim 63, comprising administering the antigen-binding protein or antigen-binding fragment thereof or composition with a further active pharmaceutical ingredient or with chemotherapy.
74. The method as claimed in claim 73, comprising administering the further pharmaceutical agent or chemotherapy separately, simultaneously or sequentially.
75. The method as claimed in claim 63, wherein the cancer is selected from the group consisting of breast cancer, ovarian cancer and teratoma.
76. A method for detecting cancer in a subject or identifying a subject susceptible to cancer, comprising: obtaining a sample from the subject; contacting the sample with an antigen-binding protein, or an antigen-binding fragment thereof, wherein said antigen-binding protein or antigen-binding fragment thereof binds to an N-linked glycan on annexin A2 (ANXA2); detecting the binding of the antigen-binding protein or antigen-binding fragment thereof in the sample; correlating the binding with a level of binding in a control sample to determine the level of binding in the sample, wherein an increase in the level of binding in the sample relative to the control sample is indicative of cancer or identifies a subject susceptible to cancer.
77. The method as claimed in claim 76, wherein the N-linked glycan is located at amino acid residue 62 of ANXA2.
78. The method as claimed in claim 76, wherein said antigen-binding protein or antigen-binding fragment thereof comprises: a) (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GYSITSGYSWH (SEQ ID NO: 9); a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS (SEQ ID NO: 10) and a VHCDR3 having the amino acid sequence GSNYGFDY (SEQ ID NO: 11); and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSNDQKNYLA (SEQ ID NO: 12), a VLCDR2 having the amino acid sequence WASIRES (SEQ ID NO: 13), and a VLCDR3 having the amino acid sequence QQYYIYPLT (SEQ ID NO: 14), or b) (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence VYSITSGYSWH (SEQ ID NO: 21); a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS (SEQ ID NO: 10), and a VHCDR3 having the amino acid sequence GTDNAVDY (SEQ ID NO: 22); and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSSNQKNYLA (SEQ ID NO: 23), a VLCDR2 having the amino acid sequence WASSRES (SEQ ID NO: 24), and a VLCDR3 having the amino acid sequence QQYYIYPLT (SEQ ID NO: 14), or c) (i) a heavy chain variable domain comprising a VHCDR1 having an amino acid sequence encoded by the nucleic acid sequence GCTACTCCATCACCAGTGGTTATAGCTGGCAC (SEQ ID NO: 15); a VHCDR2 having an amino acid sequence encoded by the nucleic acid sequence ACATACACTACAGTGGTAGCACTAAGTACAACCCATCTCTCAAAAGTC (SEQ ID NO: 16), and a VHCDR3 having an amino acid sequence encoded by the nucleic acid sequence GGAGTAACTACGGATTTGACTACT (SEQ ID NO: 17); and (ii) a light chain variable domain comprising a VLCDR1 having an amino acid sequence encoded by the nucleic acid sequence AGTCCAGTCAGAGCCTTTTATATAGTAACGATCAAAAGAACTACTTGGCCT (SEQ ID NO: 18), a VLCDR2 having an amino acid sequence encoded by the nucleic acid sequence GGGCATCTATTAGGGAATCTG (SEQ ID NO: 19), and a VLCDR3 having an amino acid sequence encoded by the nucleic acid sequence AGCAATATTATATCTATCCTCTCACGT (SEQ ID NO: 20), or d) (i) a heavy chain variable domain comprising a VHCDR1 having an amino acid sequence encoded by the nucleic acid sequence TCTACTCCATCACCAGTGGTTATAGCTGGCACT (SEQ ID NO: 25); a VHCDR2 having an amino acid sequence encoded by the nucleic acid sequence ACATACACTACAGTGGTAGTACTAAGTACAACCCATCTCTCAAAAGTC (SEQ ID NO: 26), and a VHCDR3 having an amino acid sequence encoded by the nucleic acid sequence GGACCGACAATGCTGTGGACTACT (SEQ ID NO: 27); and (ii) a light chain variable domain comprising a VLCDR1 having an amino acid sequence encoded by the nucleic acid sequence AGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAAAGAACTACTTGGCCT (SEQ ID NO: 28), a VLCDR2 having an amino acid sequence encoded by the nucleic acid sequence GGGCATCCAGTAGGGAATCTG (SEQ ID NO: 29), and a VLCDR3 having an amino acid sequence encoded by the nucleic acid sequence AGCAATATTATATCTATCCTCTCACGT (SEQ ID NO: 20).
79. The method as claimed in claim 76, wherein the control sample is from the same subject or from a different subject.
80. The method as claimed in claim 76, wherein the antigen-binding protein, or antigen-binding fragment thereof, comprises a detectable label.
81. The method as claimed in claim 76, wherein the cancer is selected from the group consisting of breast cancer, liver cancer, kidney cancer, colorectal cancer, ovarian cancer and teratoma.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0043] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0077] In a first aspect, there is provided an antigen-binding protein, or an antigen-binding fragment thereof. The antigen-binding protein, or an antigen-binding fragment thereof comprises (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence GYSITSGYSWH (SEQ ID NO: 9); a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS (SEQ ID NO: 10) and a VHCDR3 having the amino acid sequence GSNYGFDY (SEQ ID NO: 11); and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSNDQKNYLA (SEQ ID NO: 12), a VLCDR2 having the amino acid sequence WASIRES (SEQ ID NO: 13), and a VLCDR3 having the amino acid sequence QQYYIYPLT (SEQ ID NO: 14).
[0078] The antigen-binding protein, or antigen-binding fragment thereof, may comprise heavy and light chain CDR regions that are about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the heavy and light chain CDR regions of (i) and (ii).
[0079] In one embodiment, the heavy chain variable region comprises the amino acid sequence set forth in SEQ ID NO:1. Alternatively, the heavy chain variable region may comprise an amino acid sequence having about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identity to the amino acid sequence set forth in SEQ ID NO:1.
[0080] In one embodiment, the light chain variable region may comprise the amino acid sequence set forth in SEQ ID NO:2. Alternatively, the light chain variable region may comprise an amino acid sequence having about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identity to the amino acid sequence set forth in SEQ ID NO:2.
[0081] In another aspect, there is provided an antigen-binding protein, or an antigen-binding fragment thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the nucleic acid sequence GCTACTCCATCACCAGTGGTTATAGCTGGCAC (SEQ ID NO: 15); a VHCDR2 having the nucleic acid sequence ACATACACTACAGTGGTAGCACTAAGTACAACCCATCTCTCAAAAGTC (SEQ ID NO: 16), and a VHCDR3 having the nucleic acid sequence GGAGTAACTACGGATTTGACTACT (SEQ ID NO: 17); and (ii) a light chain variable domain comprising a VLCDR1 having the nucleic acid sequence AGTCCAGTCAGAGCCTTTTATATAGTAACGATCAAAAGAACTACTTGGCCT (SEQ ID NO: 18), a VLCDR2 having the nucleic acid sequence GGGCATCTATTAGGGAATCTG (SEQ ID NO: 19), and a VLCDR3 having the nucleic acid sequence AGCAATATTATATCTATCCTCTCACGT (SEQ ID NO: 20).
[0082] In one embodiment, the antigen-binding protein, or antigen-binding fragment thereof, may comprise heavy and light chain CDR regions that are about 60%, 65%, 70%, 75%, 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the heavy and light chain CDR regions of (i) and (ii).
[0083] In one embodiment, the heavy chain variable region may comprise the nucleic acid sequence set forth in SEQ ID NO:3. Alternatively, the antigen-binding protein, or antigen-binding fragment thereof, may comprise a heavy chain variable region which comprises a nucleic acid sequence having about 60%, 65%, 70%, 75%, 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identity to the nucleic acid sequence set forth in SEQ ID NO:3.
[0084] In one embodiment, the light chain variable region may comprise the nucleic acid sequence set forth in SEQ ID NO:4. Alternatively, the antigen-binding protein, or antigen-binding fragment thereof, may comprise a light chain variable region which comprises a nucleic acid sequence having about 60%, 65%, 70%, 75%, 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identity to the amino acid sequence set forth in SEQ ID NO:4.
[0085] In one embodiment the antigen-binding protein, or antigen-binding fragment thereof, may be selected from the group consisting of monoclonal, recombinant, polyclonal, chimeric, humanised, bispecific and heteroconjugate antibodies; a chimeric antigen receptor (CAR), a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, a single chain antibody, a univalent antibody lacking a hinge region, a minibody, diabodies, and Tandabs.
[0086] In one embodiment, the binding protein may be a monoclonal antibody. The monoclonal antibody may be 2448. In one embodiment, the monoclonal antibody may be humanised. Alternatively, the monoclonal antibody may be chimeric.
[0087] The monoclonal antibody may be defucosylated. The degree of fucosylation is may be less than 10%, less than 5%, or less than 1.5% relative to the wild-type antibody.
[0088] In another aspect there is provided an antigen-binding protein, or an antigen-binding fragment thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the amino acid sequence VYSITSGYSWH (SEQ ID NO: 21); a VHCDR2 having the amino acid sequence YIHYSGSTKYNPSLKS (SEQ ID NO: 10), and a VHCDR3 having the amino acid sequence GTDNAVDY (SEQ ID NO: 22); and (ii) a light chain variable domain comprising a VLCDR1 having the amino acid sequence KSSQSLLYSSNQKNYLA (SEQ ID NO: 23), a VLCDR2 having the amino acid sequence WASSRES (SEQ ID NO: 24), and a VLCDR3 having the amino acid sequence QQYYIYPLT (SEQ ID NO: 14).
[0089] In one embodiment, the antigen-binding protein, or antigen-binding fragment thereof, may comprise heavy and light chain CDR regions that are about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the heavy and light chain CDR regions of (i) and (ii).
[0090] In one embodiment, the heavy chain variable region may comprise the amino acid sequence set forth in SEQ ID NO:5. Alternatively, the heavy chain variable region may comprise an amino acid sequence having about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identity to the amino acid sequence set forth in SEQ ID NO:5.
[0091] In one embodiment, the light chain variable region may comprise the amino acid sequence set forth in SEQ ID NO:6. Alternatively, the antigen-binding protein, or antigen-binding fragment thereof, may comprise a light chain variable region which comprises an amino acid sequence having about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identity to the amino acid sequence set forth in SEQ ID NO:6.
[0092] In another aspect, there is provided an antigen-binding protein, or an antigen-binding fragment thereof, comprising (i) a heavy chain variable domain comprising a VHCDR1 having the nucleic acid sequence TCTACTCCATCACCAGTGGTTATAGCTGGCACT (SEQ ID NO: 25); a VHCDR2 having the nucleic acid sequence ACATACACTACAGTGGTAGTACTAAGTACAACCCATCTCTCAAAAGTC (SEQ ID NO: 26), and a VHCDR3 having the nucleic acid sequence GGACCGACAATGCTGTGGACTACT (SEQ ID NO: 27); and (ii) a light chain variable domain comprising a VLCDR1 having the nucleic acid sequence AGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAAAGAACTACTTGGCCT (SEQ ID NO: 28), a VLCDR2 having the nucleic acid sequence GGGCATCCAGTAGGGAATCTG (SEQ ID NO: 29), and a VLCDR3 having the nucleic acid sequence AGCAATATTATATCTATCCTCTCACGT (SEQ ID NO: 20).
[0093] The antigen-binding protein, or antigen-binding fragment thereof, may comprise heavy and light chain CDR regions that are about 60%, 65%, 70%, 75%, 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the heavy and light chain CDR regions of (i) and (ii).
[0094] The heavy chain variable region may comprise the nucleic acid sequence set forth in SEQ ID NO:7. The heavy chain variable region may comprise a nucleic acid sequence having about 60%, 65%, 70%, 75%, 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identity to the nucleic acid sequence set forth in SEQ ID NO:7.
[0095] The light chain variable region may comprise the nucleic acid sequence set forth in SEQ ID NO:8. The antigen-binding protein, or antigen-binding fragment thereof, may comprise a light chain variable region which comprises a nucleic acid sequence having about 60%, 65%, 70%, 75%, 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% identity to the amino acid sequence set forth in SEQ ID NO:8.
[0096] In one embodiment, the antigen binding protein may be selected from the group consisting of monoclonal, recombinant, polyclonal, chimeric, humanised, bispecific and heteroconjugate antibodies; a chimeric antigen receptor (CAR), a single variable domain, a domain antibody, antigen binding fragments, immunologically effective fragments, single chain Fv, a single chain antibody, a univalent antibody lacking a hinge region, a minibody, diabodies, and Tandabs.
[0097] In one embodiment, the binding protein may be a monoclonal antibody. The monoclonal antibody may be C51. The monoclonal antibody may be humanised. Alternatively, the monoclonal antibody may be chimeric.
[0098] In one embodiment, the antigen-binding protein, or antigen-binding fragment thereof, as described herein, may bind to ANXA2. In one embodiment, the antigen-binding protein, or antigen-binding fragment thereof, as described herein, may bind to a glycan on ANXA2. The antigen-binding protein, or an antigen-binding fragment thereof, as described herein, may bind to an N-linked glycan on ANXA2. The N-linked glycan may be located at amino acid residue 62 of ANXA2.
[0099] In another embodiment, the antigen-binding protein, or antigen-binding fragment thereof, as described herein, may comprise a radioisotope or a cytotoxin conjugated thereto. The antibody may be conjugated with a cytotoxin selected from the group consisting of monomethyl auristatin E (MMAE-1), mertansine (DM-1) and saporin.
[0100] In one embodiment, the antigen-binding protein, or an antigen-binding fragment, as described herein, may be internalized into a cell upon binding to ANXA2.
[0101] In one embodiment, the antigen-binding protein, or an antigen-binding fragment thereof, as described herein, may have a cytotoxic activity selected from one or more of the group consisting of complement dependent cytotoxic (CDC) activity, antibody dependent cellular cytotoxic (ADCC) activity and oncolytic activity.
[0102] In another aspect, there is provided a composition comprising a physiologically acceptable carrier and a therapeutically effective amount of the antigen-binding protein, or an antigen-binding fragment thereof, as described herein.
[0103] In one embodiment, the composition may comprise a further active pharmaceutical ingredient selected from the group consisting of bevacizumab, carboplatin, paclitaxel or gefitinib.
[0104] The percentage of the antigen-binding protein, or an antigen-binding fragment thereof, as described herein, in pharmaceutical compositions and preparations may, of course, be varied and, for example, may conveniently range from about 2% to about 90%, about 5% to about 80%, about 10% to about 75%, about 15% to about 65%; about 20% to about 60%, about 25% to about 50%, about 30% to about 45%, or about 35% to about 45%, of the weight of the dosage unit. The amount of compound in therapeutically useful compositions is such that a suitable dosage will be obtained.
[0105] The language physiologically acceptable carrier is intended to include solvents, dispersion media, coatings, anti-bacterial and anti-fungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the compound, use thereof in the therapeutic compositions and methods of treatment and prophylaxis is contemplated. Supplementary active compounds may also be incorporated into the compositions according to the present invention. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the individual to be treated; each unit containing a predetermined quantity of compound(s) is calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The compound(s) may be formulated for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in an acceptable dosage unit. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.
[0106] The composition may be conveniently administered by injection, for example, subcutaneous, intravenous, and the like. The composition may also be administered parenterally or intraperitoneally. In one embodiment, the compound may be administered by injection. In the case of injectable solutions, the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by including various anti-bacterial and/or anti-fungal agents. Suitable agents are well known to those skilled in the art and include, for example, parabens, chlorobutanol, phenol, benzyl alcohol, ascorbic acid, thimerosal, and the like. In many cases, it may be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminium monostearate and gelatin.
[0107] Sterile injectable solutions can be prepared by incorporating the analogue in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilisation. Generally, dispersions are prepared by incorporating the analogue into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
[0108] Under ordinary conditions of storage and use, pharmaceutical preparations may contain a preservative to prevent the growth of microorganisms. Preferably, the pharmaceutical composition may further include a suitable buffer to minimise acid hydrolysis. Suitable buffer agent agents are well known to those skilled in the art and include, but are not limited to, phosphates, citrates, carbonates and mixtures thereof.
[0109] Single or multiple administrations of the pharmaceutical compositions according to the invention may be carried out. One skilled in the art would be able, by routine experimentation, to determine effective, non-toxic dosage levels of the compound and/or composition of the invention and an administration pattern which would be suitable for treating the diseases and/or infections to which the compounds and compositions are applicable.
[0110] Further, it will be apparent to one of ordinary skill in the art that the optimal course of treatment, such as the number of doses of the compound or composition of the invention given per day for a defined number of days, can be ascertained using convention course of treatment determination tests.
[0111] Generally, an effective dosage per 24 hours may be in the range of about 0.0001 mg to about 1000 mg per kg body weight; suitably, about 0.001 mg to about 750 mg per kg body weight; about 0.01 mg to about 500 mg per kg body weight; about 0.1 mg to about 500 mg per kg body weight; about 0.1 mg to about 250 mg per kg body weight; or about 1.0 mg to about 250 mg per kg body weight. More suitably, an effective dosage per 24 hours may be in the range of about 1.0 mg to about 200 mg per kg body weight; about 1.0 mg to about 100 mg per kg body weight; about 1.0 mg to about 50 mg per kg body weight; about 1.0 mg to about 25 mg per kg body weight; about 5.0 mg to about 50 mg per kg body weight; about 5.0 mg to about 20 mg per kg body weight; or about 5.0 mg to about 15 mg per kg body weight.
[0112] Alternatively, an effective dosage may be up to about 500 mg/m.sup.2. For example, generally, an effective dosage is expected to be in the range of about 25 to about 500 mg/m.sup.2, about 25 to about 350 mg/m.sup.2, about 25 to about 300 mg/m.sup.2, about 25 to about 250 mg/m.sup.2, about 50 to about 250 mg/m.sup.2, and about 75 to about 150 mg/m.sup.2.
[0113] In another aspect, there is provided use of an antigen-binding protein, or an antigen-binding fragment thereof, as described herein, in the manufacture of a medicament for treating or preventing cancer.
[0114] In one embodiment, the cancer may be selected from the group consisting of breast cancer, liver cancer, kidney cancer, colorectal cancer, ovarian cancer and teratoma.
[0115] In some embodiments the medicament may be administered with a further active pharmaceutical ingredient. Alternatively, the medicament may be administered with chemotherapy. The further pharmaceutical agent or chemotherapy may be administered separately, simultaneously or sequentially.
[0116] In another aspect, there is provided a method for detecting cancer in a subject, the method comprising: contacting a sample obtained from the subject with an antigen-binding protein, or an antigen-binding fragment thereof as described herein in vitro; detecting the binding of the antigen-binding protein, or an antigen-binding fragment thereof in the sample; correlating the binding with a level of binding in a control sample to determine the level of binding in the sample, wherein an increase in the level of binding in the sample relative to the control sample is indicative of cancer.
[0117] In another aspect, there is provided a method for identifying a subject susceptible to cancer the method comprising: contacting a sample obtained from the subject with an antigen-binding protein, or an antigen-binding fragment thereof as described herein in vitro; detecting the binding of the antigen-binding protein, or an antigen-binding fragment thereof in the sample; correlating the binding with a level of binding in a control sample to determine the level of binding in the sample, wherein an increase in the level of binding in the sample relative to the control sample indicates that the subject is susceptible to cancer.
[0118] In one embodiment, the control sample may be from the same subject. Alternatively, the control sample may be from a different subject.
[0119] In one embodiment, the antigen-binding protein, or antigen-binding fragment thereof as described herein may comprise a detectable label. The detectable label may be selected from the group consisting of a fluorescent label, a chemiluminescent label, an enzymatic label and a radionuclide label. In one embodiment, the detectable label is selected from the group consisting of biotin, alkaline phosphatase, horseradish peroxidase, FITC, PE and Cy Dyes. The detectable label may be detected in an assay selected from flow cytometry, tissue section, immunofluorescence, immunocytochemistry or immunohistochemistry.
[0120] In one aspect, there is provided a kit when used in the method as described herein, comprising an antigen-binding protein, or antigen-binding fragment thereof as described herein, together with instructions for use.
Examples
[0121] Non-limiting examples of the invention, including the best mode, and a comparative example will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the invention.
[0122] Materials and Methods
[0123] Antibody Generation and Purification
[0124] Monoclonals 2448 and C51 were generated by whole-cell immunization of human embryonic stem cells (HES-3) using mouse hybridoma technology as reported in Choo et al. (Choo A B, Tan H L, Ang S N, Fong W J, Chin A, Lo J, et al. Selection against undifferentiated human embryonic stem cells by a cytotoxic antibody recognizing podocalyxin-like protein-1. Stem Cells Dayt Ohio. 2008; 26:1454-63). Hybridomas were maintained in ClonaCell-HY Medium E (Stem Cells Technologies) at 37 C. in a humidified incubator with 5% CO.sub.2. Chimeric (including afucosylated) antibodies were expressed in DG44-CHO cells and maintained in BTI's proprietary serum-free media. Chimerisation was done by the Animal Cell Technology group at the Bioprocessing Technology Institute (Ho S C L, Bardor M, Feng H, Mariati null, Tong Y W, Song Z, et al. IRES-mediated Tricistronic vectors for enhancing generation of high monoclonal antibody expressing CHO cell lines. J Biotechnol. 2012; 157:130-9).
[0125] Purification was done using the AKTA Explorer 100 (GE Healthcare) system. Cultured supernatants were subjected to Protein A chromatography (Tosoh; Toyopearl AF-rProtein A-650F) and ion exchange chromatography (Biorad; UNOsphere Q). Purified products were evaluated on a Superdex200 PC 3.2/30 column (GE Healthcare) using a high performance liquid chromatography system (Shimadzu). Antibodies were additionally analyzed by SDS-PAGE, and protein concentrations were determined by absorbance at A.sub.280 using Nanodrop 1000 (Thermo Fisher Scientific). For in vivo studies, endotoxin was measured to ensure levels were below 0.1 EU/mL using the Endosafe Endotoxin Testing System (Charles River).
[0126] Flow Cytometry and Analysis
[0127] Cells were harvested as single-cell suspensions using trypsin (Thermo Fisher Scientific). Each sample of 1-210.sup.5 cells was thoroughly washed in 1% bovine serum albumin (BSA; Sigma Aldrich) in phosphate buffered saline (PBS) buffer (Thermo Fisher Scientific) Samples were incubated with primary antibody at 4 C. for 45 min, washed and then incubated with the appropriate fluorophore-conjugated secondary antibody (fluorescein isothiocyanate (FITC)-labeled goat anti-human kappa light chain mAbs (Sigma Aldrich) or FITC-labeled goat anti-mouse Ig polyclonal (Dako), for 15 min at 4 C. After incubation, cells were washed and sample data acquisition was done by on a BD FACSCalibur (BD Biosciences) or Guava easyCyte (Millipore). Data analysis was done using FlowJo software v7.6.3 (Tree Star). Percentage of binding was determined using M-gating set at the 97th-98th-percentile based on the negative control.
[0128] Immunocytochemistry
[0129] Cell cultures were fixed with 4% paraformaldehyde for 20 min. For permeabilized cells, 0.1% Triton X-100/PBS (Bio-Rad) was added for 35 min, and finally blocked with either 10% goat serum/PBS (DAKO) for 1 h at room temperature. Cells were incubated at 4 C. with 2448 conjugated with DyLight 488 NHS Ester (Thermo Fisher Scientific). DNA was counterstained with DAPI (1:1000, Thermo Fisher Scientific). Images were taken using a Zeiss Axiovert 200 inverted microscope.
[0130] Gel Electrophoresis and Western Blot Analysis
[0131] Cells were harvested by manual scraping and as required, enriched for membrane proteins via the Membrane Protein Extraction Kit (BioVision) as per the manufacturer's instructions. Briefly, cells were re-suspended in homogenization buffer and centrifuged at 700 g for 10 min at 4 C. Supernatant was then aspirated and centrifuged at 10,000 g for 30 min at 4 C. Cell pellet of total membrane proteins was collected and lysed. Buffer for lysis contained 2% Triton X-100 (Bio-Rad) in PBS which was supplemented with protease inhibitors (Calbiochem) as needed. Total protein concentration was determined using the DC Protein Assay (Bio-Rad).
[0132] For gel electrophoresis, samples were prepared with loading dye at a final concentration of 50 mM Tris-HCl, 2% SDS, 10% glycerol, 0.02% bromophenol blue and for reducing conditions, 2-5% beta-mercaptoethanol. Samples along with SeeBlue Plus2 or Page2 protein standards (Thermo Fisher Scientific) were subjugated to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using a 4-12% Bis-Tris gradient gel (Thermo Fisher Scientific) and 1MOPS buffer (Thermo Fisher Scientific). If needed, Gels were stained using Coomasie Brilliant Blue or SilverQuest Silver Staining Kit)
[0133] For Western blot, products from gel run were transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad) and blocked with 5% non-fat milk or Odyssey Blocking Buffer (LI-COR) for 1 h. Incubation with primary mAb (mouse anti-annexin A2 mAb (BD Biosciences); mouse anti-annexin A2 mAb (Invitrogen); rabbit anti-annexin A2 pAb (Santa Cruz); mouse anti-E-Cadherin mAb (BD Biosciences); mouse monoclonal anti-Vimentin (Dako); mouse anti-human Fc-specific antibody (Sigma)) or biotinylated lectin (Aleuria Aurantia Lectin (Vector Labs)) was done overnight at 4 C. The blot was incubated for 1-2 h with an appropriate detection antibody (horseradish peroxidase (HRP)-conjugated goat anti-mouse Ig pAb, Dako) or streptavidin conjugated to horseradish peroxidase (Dako), and visualized upon addition of chemiluminescence substrate (GE Healthcare). Images were captured either on Medical X-ray Processor 2000 (Kodak) or the ChemiDoc Imaging System (Bio-Rad). Densitometry was done using Image Lab 5.2 software (BioRad) and normalized to beta-actin expression levels (Cell Signaling Technology).
[0134] Transient Knockdown of Annexin A2 (ANXA2)
[0135] IGROV1 cells were seeded on 6-well plates at 310.sup.5 cells or T175 flasks at 110.sup.6 cells and grown to 30 to 50% confluency. Transfection of a validated set of human annexin A2-specific siRNA (Thermo Fisher Scientific) and scramble siRNA control (Thermo Fisher Scientific) respectively both at concentration of 30 pM using Lipofectamine RNAiMAX (Thermo Fisher Scientific) in serum-free media. Post 5 h incubation at 37 C., transfection media was removed and replaced with fresh media containing 10% serum. Cells were harvested within 72 h for western blot analysis. Densitometry was done using IMageJ software (National Institutes of Health) and normalized using beta-actin (Cell Signaling Technology) expression levels.
[0136] Periodate Treatment
[0137] Lysate from IGROV1 cells was separated by SDS-PAGE and transferred to PVDF membranes (Bio-Rad). Subsequently, blots were washed twice with sodium acetate buffer (100 mM at pH 4.5; Merck Millipore), and incubated with sodium meta-periodate (100 mM, Sigma-Aldrich) for 30 min in the dark. Blots were subsequently washed four times with sodium acetate buffer, a PBS wash and quenched with 0.5 M of sodium borohydride (Sigma) for 30 min. Prior to incubation with primary antibodies, blots were blocked with Odyssey Blocking Buffer (LI-COR) for 30 min. Control blots were similarly incubated with buffers but without the addition of sodium meta-periodate. Samples were analyzed using primary antibodies 2448, C51 and anti-beta-actin as a negative control.
[0138] Release of Glycans by PNGase-F and Beta-Elimination
[0139] For PNGase-F treatment, membrane protein enriched lysate (10 g) was first denatured using 1 l of 10 glycoprotein denaturing buffer (5% SDS without DTT) and water to make up a 10 l reaction volume. Glycoproteins were heated to 100 C. for 5 min. A total reaction volume of 20 l was prepared with the denatured glycoproteins by adding 2 l of 10G7 reaction buffer, 2 l of 10% NP40, and 1 l of PNGase F, and 5 l of water. Samples were incubated in the reaction buffer for 1 h at 37 C. After incubation, samples were subjected to SDS-PAGE and western blot analysis. For alkaline beta-elimination treatment, western blots were incubated in 0.1 M sodium hydroxide solution at 60 C. overnight. The following day blots were subjected to western blot analysis.
[0140] Inhibition of Glycosylation by Tunicamycin
[0141] Inhibition of glycosylation was done in cell culture using tunicamycin, a nucleoside antibiotic that targets GlcNAc transferases. At high concentrations, tunicamycin can induce apoptosis in cancer cells however at lower concentrations, it can be used to inhibit synthesis of N-glycan in (eukaryotic) cells (127-129). IGROV1 cells at 60-70% confluency were treated with tunicamycin (Sigma-Aldrich) at a final concentration of 0.25 g/mL. After 24 h incubation, cells harvested and analyzed by flow cytometry and western blot analysis.
[0142] Competitive Inhibition Assay
[0143] IGROV1 cells were incubated at saturating concentrations of a single antibody (2448 or ch2448) added alone, both antibodies added simultaneously and one mAb added after the other. Incubations were done for at least 15 min each at 4 C. and washed in 1% BSA/PBS. Secondary incubation was done using fluorophore conjugated secondary antibodies (Alexa fluor 647-conjugated anti-human pAb (Thermo Fisher Scientific) and Alexa Fluor 488-conjugated anti-mouse pAb (Thermo Fisher Scientific)). Binding was analyzed on a BD FACSCalibur flow cytometer (BD Biosciences) or Guava easyCyte (Millipore).
[0144] Real-Time Monitoring of 2448-Saporin Cytotoxicity on Cell Growth
[0145] Cell growth was continuously cells was determined when cells treated at the lowest concentration were reaching a monitored over time by cell impedance measurements using the xCelligence real-time cell analyzer (Roche) (130). Briefly, cell culture media was first loaded onto the 96-well E-plate to measure background impedance. IGROV1, IOSE523 and Sfilm.
[0146] V3 cells were plated at 1,000 cells per well and allowed to grow overnight in normal cell culture conditions. Cells were treated with antibody (ch2448) or antibody conjugates (ch2448-saporin or human IgG-saporin) at the beginning of the log phase of cell growth. Control wells were treated with buffer alone. All experiments were done in at least 5 wells per treatment condition. The outermost wells of the plate were not used. For dose response curves, IGROV1 were treated with dilutions of ch2448-saporin. The cells were monitored for growth until cells reached a death phase. Cell indices of wells were normalized after antibody treatment. The IC50 value on IGROV1 stationary phase of cell growth. The IC50 value was calculated using the accompanying real-time cell analysis software (Roche).
[0147] Antibody Drug Conjugate (ADC) Assay with Secondary Saporin Conjugates
[0148] Cells were seeded in 96-well culture plates (Corning) at 1000 or 2000 cells per well as determined by growth curve. Primary antibody (2448, C51, ch2448 or chC51) at 10 g/ml were complexed with appropriate secondary saporin conjugates: mAb-ZAP, Anti-M-ZAP, HUM-ZAP (Advanced Targeting Systems), at a 1:3 molar ratio for 15 min at room temperature. The pre-mixed complexes, the primary mAb, the secondary conjugate and buffer control were added to wells 24 h post-seeding. At 72 h post-treatment, viable (metabolically active) cells were measured based on the presence of ATP, using the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega). Data are expressed as the viability of treated cells as the percentage of the control cells treated with buffer alone.
[0149] Antibody Drug Conjugate (ADC) Assay with Ch2448-Saporin Conjugate
[0150] Direct conjugation of saporin to antibodies was outsourced to Advanced Targeting Systems (ATS). Drug to antibody molar ratios of ch2448-saporin, chTNA2-saporin and human Ig-saporin were 2.5, 2.9 and 3.1, respectively. Evaluation of the binding specificity was carried out by flow cytometry analysis as previously described.
[0151] Cytotoxicity of ch2448-saporin was evaluated on IGROV1, SKOV3 and IOSE523 cell lines. Cells were seeded in 96-well plates (Corning) at 1000 cells per well in 90 l of media. The following day, ch2448-saporin and chTNA2-saporin were serially diluted and 10 l of each dilution was added to wells. As a control, free saporin and ch2448 were added in a separate set of plates. Post 72 h incubation, the cell viability was measured using the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega) according to the manufacturer's instructions. Data are expressed as the % control, measuring the viability of treated cells with that of untreated cells. Dose response curves and IC.sub.50 values were calculated using GraphPad Prism 6 (GraphPad).
[0152] Antibody-Dependent Cell-Mediated Cytotoxicity (ADCC) Assay
[0153] ADCC activity was measured using the ADCC Reporter Bioassay reporter bioassay (Promega) according to the manufacturer's protocol. Briefly, cells were seeded at 5,000 cells per well in a 96-well clear bottom black tissue culture plates (Corning) in low 4% IgG-serum (Promega) media. Serial dilutions of primary antibody were incubated in triplicate wells for approximately 15 min at 37 C., 5% CO2. Following incubation, engineered effector cells were added to the wells at approximately 150,000 cells per well. After 5 to 16 h (as indicated in results), Bio-Glo Luciferase Assay Substrate (Promega) was added to the wells and luminescence was measured using the Infinite 200 microplate reader (Tecan). Estimated EC.sub.50 values were calculated by on-linear regression on log-transformed data using GraphPad Prism 6 (GraphPad).
[0154] Tumor Xenograft Mouse Model
[0155] Four- to six-week-old female BALB/c nude mice (Invivos) were used in this study. On day 0, mice were inoculated with a total of 510.sup.6 IGROV1 cells in 100 l of cell media and high concentration matrigel (BD biosciences) at a 1:1 dilution volume. At 24 h post-inoculation, antibodies were injected intraperitoneally at 100 l volumes of 1 mg per dose in 50 mM HEPES, 150 mM NaCl buffer. Subsequent administration was done weekly as indicated in results for 5 weeks. Size of the primary tumor was measured weekly by digital calipers. Tumor volumes (TV) were calculated based on the formula: TV=((LLW)/2), where W (width) and L (length) are the short and long diameter, respectively. A student's t-test was used to assess the statistical significance treated and untreated animals. For collection of tumors, animals were euthanized and immediately harvested for tumors. Samples were washed with PBS and either snap-frozen in liquid nitrogen or placed in paraformaldehyde (Merk) for 24 h which was subsequently replaced with 100% ethanol (Merk). Mice were euthanized when tumor size was >2000 mm.sup.3 or when persistent side effects (e.g. swollen lymph nodes or drastic body weight loss) were observed over a period of more than two weeks. Euthanization was done by CO.sub.2 inhalation followed by cervical dislocation. Animals were handled according to Biopolis IACUC Protocol No.: 151001 in accordance with the National Advisory Committee For Laboratory Animal Research (NACLAR) Guidelines.
[0156] Biodistribution Study
[0157] Female BALB/c nude mice were inoculated with a total of 510.sup.6 IGROV1 cells in 100 l of cell media and high concentration matrigel (BD biosciences) at a 1:1 dilution volume. When tumors reached 300-400 mm.sup.3 (on week 10), dye-conjugated ch2448 and control conjugate chTNB1 were administered by i.p. injection at 100 g per 100 l of buffer (50 mM HEPES, 150 mM NaCl) per mouse. At 72 h and 94 h post injection, mice were anesthetized with 2-3% isoflurane and imaged using the IVIS Spectrum imaging system (Caliper Life Sciences). Data was analyzed using the Living Image software 3.2 (Caliper Life Sciences).
[0158] Antibodies ch2448 and IgG control (Southern Biotech) were labelled with a near infrared fluorescent (NIR) dye CF750 using the XenoLight CF750 rapid antibody-labelling kit (Caliper Life Sciences) as per the manufacturer's instructions. Mice were handled according to Biopolis IACUC Protocol No.: 151001 in accordance with the National Advisory Committee For Laboratory Animal Research (NACLAR) Guidelines.
[0159] CAR Design and Vectors
[0160] CAR(2448) was designed in silico, and manufactured by GenScript. The CAR construct contained the GMCSFRa signal sequence, the anti-Annexin A2 V.sub.L and V.sub.H domains of the 2448 antibody connected via a Whitlow linker, the IgG4 Fc linker region, the CD28 transmembrane and intracellular co-stimulatory domain, and the CD3 signalling domain. The CAR fragment was synthesised into the pcDNA3.1(+) plasmid, using HindIll and EcoRI restriction sites.
[0161] mRNA Production
[0162] mRNA of the CAR constructs was in vitro transcribed utilising the HiScribe T7 ARCA mRNA Kit (with tailing) (New England BioLabs), according to the manufacturer's instructions. Briefly, CAR sequence plasmids were linearised utilising the XbaI restriction site, purified, and in vitro transcribed with ARCA capping. A subsequent poly(A) tailing reaction was conducted, before purification with lithium chloride. The final mRNA constructs were reconstituted in nuclease-free water, and stored at 80 C. in single-use aliquots.
[0163] Nucleofection of T Cells
[0164] T cells were isolated from human PBMCs using an EasySep human T cell isolation kit (StemCell Technologies). T cells were activated with Human T-Activator CD3/CD28 Dynabeads (Life Technologies) at a 1:1 bead:cell ratio. RPMI 1640, supplemented with 10% foetal calf serum (R10), and IL-7(20 U/mL), IL-15(10 U/mL), and IL-21(0.04 U/mL) was utilised as the T cell culture medium.
[0165] Prior to nucleofection, activating Dynabeads were removed, and T cells were resuspended in P3 Primary Cell Nucleofector Solution (Lonza) at 510.sup.4 cells/L. CAR mRNA (61 pg/L) was added to the T cells, before nucleofection using program EO-115 of the 4D Nucleofector device. Cells were allowed to recover in R10 media at 37 C., 5% CO.sub.2, with or without additional cytokine supplementation, depending on downstream application.
[0166] Cytotoxicity Assays
[0167] CAR-T cell cytotoxicity was assayed using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega), according to the manufacturer's instructions. Briefly, target IGROV-1 cells (110.sup.4 cells/well) were co-incubated with effector CAR-T cells at varying effector:target ratios for 4 hours at 37 C., 5% CO.sub.2. LDH release from lysed cells was detected using the kit solutions, and readout using an Infinite M200 (TECAN).
[0168] For the cell growth assay, target IGROV-1 cells were seeded onto an E-plate 96 (ACEA Biosciences) at 110.sup.4 cells per well. Cell growth was measured using the xCELLigence RCPA MP Instrument (ACEA Biosciences). After 24 hours, freshly nucleofected CAR-T cells were added into each well at 1:1, 2:1, 4:1, and 8:1 effector:target ratios. Cell growth was monitored for an additional 72 hours. No effector and no target cell wells were used as controls.
[0169] Cytokine Release Assay
[0170] CAR-T cells were incubated with target IGROV-1 cell at a 10:1 ratio for 6 hours at 37 C., 5% CO.sub.2, without additional cytokine supplementation, before cytokine detection with the MACSPlex Cytokine 12 Kit (Miltenyi Biotec), according to the manufacturer's instructions. Briefly, cell supernatants were centrifuged and collected, before the addition of MPx Cytokine 12 Capture Beads. After a 2 hour incubation period at room temperature, capture beads were washed twice, and MPx Cytokine 12 Detection Reagent was added to detect bound cytokines. The beads were incubated for an additional hour at room temperature, before cytokine detection on the MACSQuant Analyzer 10 flow cytometer (Miltenyi Biotec).
[0171] Results
[0172] Antibody (Ab) heavy and light chain sequences and isotype of monoclonal antibody (mAb) C51 is an IgM-kappa.
[0173] Heavy and light chain gene sequences of mAb C51 were cloned from hybridoma cells by reverse transcription polymerase chain reaction (RT-PCR) and sequenced with complementarity-determining regions (CDRs) as underlined (
[0174] mAb C51 demonstrates reactivity to various cancers. mAb C51 binds to an epithelial phenotype according to a classification based on the Epithelial-Mesenchymal Transition (EMT).
[0175] High-throughput screening of mAb C51 was done on live cells by flow cytometry (
[0176] Annexin A2 is the antigen target of mAb C51.
[0177] To validate ANXA2 as the antigen target of mAb C51, a forward and reverse-immunoprecipitation (IP) was carried out using a commercial anti-ANXA2 mAb. IP products were immunoblotted against mAb C51 and the commercial antibody (
[0178] mAb C51 targets an N-glycan epitope.
[0179] The binding of C51 was abolished when N-linked glycans were removed. This was demonstrated by both enzymatic digest of proteins with PNGase F treatment (
[0180] mAb C51 induces cell death via oncosis.
[0181] Ovarian and breast cancer cells incubated with C51 had a significant and rapid increase in PI uptake, indicating a loss of membrane integrity (
[0182] mAb C51 as an antibody-drug conjugate (ADC) kills cancer cells.
[0183] Ovarian and breast cancer cells were incubated in culture with mAb C51 and secondary antibody conjugated to saporin (MZAP). After 72 h of incubation, relative cell viability was measured by the percentage of live cells in the treatment group compared to the buffer-treated control (
[0184] mAb C51 induces complement-dependent cytotoxicity (CDC).
[0185] mAb C51 demonstrated detectable levels of cell lysis in the presence of human complement (
[0186] Chimeric mAb chC51 as an antibody-drug conjugate (ADC) kills cancer cells.
[0187] Ovarian and breast cancer cells were incubated in culture with chimeric C51 mAb (chC51) and secondary anti-human conjugated to saporin (HZAP). After 72 h of incubation, relative cell viability was measured by the percentage of live cells in the treatment group compared to the buffer-treated control (
[0188] mAb chC51 induces antibody-dependent cell-mediated cytotoxicity (ADCC).
[0189] The chimeric mAb chC51 induced ADCC against MCF7 breast cancer cells (
[0190] Ab heavy and light chain sequences and isotype of mAb 2448 is IgG1-kappa.
[0191] Heavy and light chain gene sequences of mAb 2448 were cloned from hybridoma cells by reverse transcription polymerase chain reaction (RT-PCR) and sequenced with complementarity-determining regions (CDRs) underlined (
[0192] mAb 2448 demonstrates reactivity to various cancers. mAb 2448 binds to an epithelial phenotype according to a classification based on the Epithelial-Mesenchymal
[0193] Transition (EMT).
[0194] High-throughput screening of mAb 2448 was done on live cells by flow cytometry (
[0195] Annexin A2 is identified as the antigen target of mAb 2448 in an ovarian cancer cell line.
[0196] Immunoprecipitation (IP) was carried out on IGROV1 ovarian cancer cells to enrich for the antigen of mAb 2448. IP product was immunoblotted with 2448 (
[0197] Annexin A2 is identified as the antigen target of mAb 2448 in hESC and a breast cancer cell line.
[0198] Immunoprecipitation (IP) was carried out on hESC and T47D breast cancer cells to enrich for the antigen of mAb 2448. IP product was immunoblotted with mAb 2448 (
[0199] Annexin A2 is validated as the antigen target of mAb 2448 in human embryonic stem cells (hESC) and a breast cancer cell line.
[0200] To validate ANXA2 as the antigen target of mAb 2448, a forward and reverse-immunoprecipitation (IP) was carried out using a commercial anti-ANXA2 mAb. IP products were immunoblotted against mAb 2448 and the commercial antibody (
[0201] Only mAb 2448 binds to cell surface Annexin A2.
[0202] mAb 2448 was evaluated for binding on cancer cells. Strong cell surface binding was demonstrated for mAb 2448 unlike commercial anti-ANXA2 antibodies (
[0203] mAb 2448 targets an N-glycan epitope.
[0204] mAb 2448 binding was loss after periodate treatment (
[0205] mAb 2448 internalizes into cancer cells.
[0206] mAb 2448 was conjugated to CypHER5E (
[0207] mAb 2448 and chimeric mAb ch2448 kill target cancer cells as antibody drug conjugates (ADCs).
[0208] To demonstrate either 2448 or ch2448 as a potential ADC, mAbs were evaluated with secondary conjugates of the plant-derived toxin, saporin. Ovarian and breast cancer cells were incubated with primary mAb (2448 or ch2448), secondary saporin conjugate (mAb-ZAP or HUM-ZAP) or complexes of primary mAb and secondary conjugates (
[0209] The complexes of primary mAb and secondary conjugates delivered saporin into cells and induced cytotoxicity. Overall, results indicated that both 2448 and ch2448 were viable targeting agents for development as an ADC.
[0210] Chimeric mAb ch2448 as an antibody-drug conjugate (ADC) kills target cancer cells in a dose-dependent manner.
[0211] Chimeric mAb 2448 was conjugated to a plant-derived toxin (saporin) to create an antibody drug conjugate (ADC). As an ADC, ch2448 killed IGROV1 target ovarian cancer cells but not IOSE523 normal ovarian cells (
[0212] Chimeric mAb ch2448 induces antibody-dependent cell-mediated cytotoxicity (ADCC).
[0213] Chimeric mAb ch2448 was co-incubated with target cancer cell lines and effector cells. Dose dependent activation of the ADCC NFAT pathway was measured by luciferase readout. Chimeric mAb ch2448 can be used to activate ADCC activity against ovarian cancer cells (
[0214] Chimeric mAb 2448 delays tumor growth in vivo.
[0215] Chimeric mAb ch2448 delayed tumor growth in an IGROV1 ovarian cancer xenograft mouse model (
[0216] (
[0217] Chimeric mAb ch2448 delays tumor growth in vivo via ADCC.
[0218] A F(ab)2 of ch2448 was generated (
[0219] Afucosylation enhances the ability of ch2448 to induce antibody-dependent cell-mediated cytotoxicity (ADCC).
[0220] Afucosylated ch2448 retained similar binding to wildtype chimeric mAb ch2448 (
[0221] mAb ch2448 binds strongly to undifferentiated hESC and prevents teratoma formation in vivo.
[0222] mAb 2448 binds specifically to undifferentiated hESC but not to differentiated embryoid bodies (EBs) (
[0223] ch2448 internalizes into hESC and kills undifferentiated hESC as an ADC.
[0224] ch2448 was conjugated to pHRodo dye and internalization of ch2448 was observed over 24 hrs (
[0225] mAb 2448 as a F(ab)2-ADC prevents or delays teratoma formation in vivo.
[0226] Single-cell suspension of human embryonic stem cells (510.sup.6 cells per animal) were pre-incubated with either buffer or mAb 2448 a F(ab)2-ADC at 4 C. for 20 minutes and then injected into the right hind leg muscle of SCID mice. The F(ab)2-ADC was able to prevent tumor formation compared to the control group (
[0227] Prevention or delayed teratoma formation by 2448-F(ab)2-ADC in SCID mouse was observed compared to the control group (
[0228] CAR(2448) was constructed using the CD28 co-stimulatory domain, and an IgG4 Fc region linker domain. A T2A element and eGFP were inserted downstream in the same open reading frame as the CAR construct.
[0229] A second generation CAR utilising the V.sub.H and V.sub.L regions of mAb 2448 was constructed to determine the utility of the antibody in a CAR format. An eGFP element was utilised as a reporter for CAR expression (
[0230] Key cytokines associated with T cell activation are upregulated upon co-incubation of CAR(2448) T cells with complement antigen-expressing target cells.
[0231] A significant increase in T cell cytokines by CAR(2448) T cells was observed upon exposure to IGROV-1 cells that express the target Annexin A2 (
[0232] After T cells were co-incubated with target IGROV1 cells, multiple cytokines show a significant increase in cytokine production compared to a non-target specific CAR control.
[0233] The upregulation of multiple cytokines (GM-CSF, IFN-, IL-2, IL-4, IL-5, IL-6, IL-10, IL-17A, and TNF-) by CAR(2448) T cells incubated with IGROV-1 suggested that multiple T cell subsets were activated, indicating the capability of the CAR(2448) construct in activating a broad range of T cell subsets (
[0234] CAR(2448) mediates T cell cytotoxicity against target cells compared to non-specific CAR control.
[0235] CAR(2448) T cells mediated cytotoxicity against target IGROV-1 cells in a dose-dependent manner (
[0236] CAR(2448) T cells mediates growth inhibition of target cells.
[0237] Target IGROV-1 cells were co-incubated with CAR-T cells. All dose levels of CAR(2448) T cells showed inhibition of target cell growth compared to a non-target specific CAR control (
[0238] CAR(2448) T cells mediated their cytotoxic effect on IGROV1 target cells over the course of several hours.