DNA-TEMPLATED MACROCYCLE LIBRARY
20200399634 ยท 2020-12-24
Assignee
Inventors
- David R. Liu (Cambridge, MA)
- Dmitry L. Usanov (Cambridge, MA, US)
- Juan Pablo Maianti (Cambridge, MA, US)
- Alix I. Chan (Cambridge, MA, US)
Cpc classification
C12N15/1068
CHEMISTRY; METALLURGY
C07K7/56
CHEMISTRY; METALLURGY
A61K38/12
HUMAN NECESSITIES
International classification
C12N15/10
CHEMISTRY; METALLURGY
A61K38/12
HUMAN NECESSITIES
Abstract
The present invention provides nucleic acid templates (e.g., including orthogonal codon sets (e.g., codons from orthogonal codon sets depicted in Tables 5 or 7)) for DNA-templated methods of synthesizing, selecting, and amplifying compounds (e.g., polymers and/or small molecules) described herein. Also provided are novel macrocyclic compounds of Formula (I), and pharmaceutically acceptable salts, solvates, hydrates, polymorphs, co-crystals, tautomers, stereoisomers, isotopically labeled derivatives, prodrugs, libraries, and compositions thereof. Also provided are methods and kits involving the inventive compounds or compositions for treating and/or preventing a disease (e.g., a disease associated with aberrant enzyme activity (e.g., aberrant protease and/or kinase activity (e.g., aberrant IDE activity)), impaired insulin signaling, or insulin resistance in a subject (e.g., a subject having diabetes). Treatment of a subject with a proliferative disease using a compound or composition of the invention may inhibit aberrant protease activity (e.g., aberrant IDE activity).
Claims
1. A compound of Formula (I): ##STR00112## or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer, polymorph, tautomer, isotopically enriched form, or prodrug thereof, wherein: is a single or double CC bond, wherein when
is a double CC bond, then
indicates that the adjacent CC double bond is in a cis or trans configuration; L.sup.1 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene; L.sup.2 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene; L.sup.3 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene; X is OC((R.sup.3A)(R.sup.3B)).sub.s, C((R.sup.3A)(R.sup.3B)).sub.s, optionally substituted carbocyclylene, optionally substituted heterocyclylene, or optionally substituted arylene; R.sup.3A is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; R.sup.3B is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; or optionally R.sup.3A and R.sup.3B are joined together to form optionally substituted carbocyclyl or ##STR00113## each instance of R.sub.E, R.sub.F, R.sub.G, R.sub.H, and R.sub.L is independently hydrogen; halogen; substituted or unsubstituted acyl; a nitrogen protecting group; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted hydroxyl; substituted or unsubstituted thiol; substituted or unsubstituted amino; or optionally R.sub.G and one instance of R.sup.3A or R.sup.3B are joined together with the intervening atoms to form optionally substituted heterocyclyl; m1 is 0, 1, or 2; s is 0, 1, 2, 3, or 4; and y is 0 or 1.
2. The compound of claim 1, wherein L.sup.1 is substituted or unsubstituted C.sub.1-6 aliphatic, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene.
3. The compound of claim 1, wherein L.sup.2 is of the formula: ##STR00114## wherein: R.sub.1 is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; OR.sub.A; N(R.sub.A).sub.2; SR.sub.A; O; CN; NO.sub.2; SCN; SOR.sub.A; or SO.sub.2R.sub.A; wherein each occurrence of R.sub.A is independently hydrogen; a protecting group; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted acyl; substituted or unsubstituted aryl; or substituted or unsubstituted heteroaryl; R.sub.2 is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; OR.sub.B; N(R.sub.B).sub.2; SR.sub.B; O; CN; NO.sub.2; SCN; SOR.sub.B; or SO.sub.2R.sub.B; wherein each occurrence of R.sub.B independently hydrogen; a protecting group; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted acyl; substituted or unsubstituted aryl; or substituted or unsubstituted heteroaryl, or optionally R.sub.1 and R.sub.2 are joined together to form a spiro-linked, optionally substituted carbocyclyl, or optionally R.sub.H and one instance of R.sup.1 or R.sup.2 are joined together with the intervening atoms to form optionally substituted heterocyclyl; and x is 0, 1, 2, or 3.
4. The compound of claim 1, wherein L.sup.2 is of the formula: ##STR00115## wherein R.sub.5 is substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted amino; C(O)N(R.sub.J).sub.2; C(O)OR.sub.J; or C(O)SR.sub.J, or CH.sub.2C(O)N(R.sub.J).sub.2, wherein each occurrence of R.sub.J is independently hydrogen; a protecting group; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted acyl; substituted or unsubstituted aryl; or substituted or unsubstituted heteroaryl; or two R.sub.J groups are joined to form a substituted or unsubstituted heterocyclic group; optionally wherein R.sub.5 further comprises a label, resin, or therapeutic agent attached thereto.
5. The compound of claim 1, wherein L.sup.2 is of the formula: ##STR00116## wherein w is 0, 1, or 2; and x1 is 1 or 2.
6. The compound of claim 1, wherein L.sup.2 is of the formula: ##STR00117##
7. The compound of claim 1, wherein L.sup.2 is substituted or unsubstituted 5- to 7-membered carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted, 4- to 10-membered heterocyclylene.
8. The compound of claim 3, wherein R.sub.1 and R.sub.2 are joined together to form a spiro-linked, optionally substituted carbocyclyl.
9. The compound of claim 3, wherein R.sub.1 is substituted or unsubstituted aryl.
10. The compound of claim 3, wherein R.sub.2 is substituted or unsubstituted aryl.
11. The compound of any one of claims 1-10, wherein y is 1.
12. The compound of claim 1, wherein L.sup.3 is substituted or unsubstituted C.sub.1-6 aliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene.
13. The compound of claim 1, wherein L.sup.3 is of the formula: ##STR00118## wherein R.sup.4A is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; R.sup.4B is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; or optionally R.sub.F and one instance of R.sup.4A or R.sup.4B are joined together with the intervening atoms to form optionally substituted heterocyclyl, and r is 0, 1, or 2.
14. The compound of any one of claims 1-13, wherein R.sup.4A is hydrogen, substituted or unsubstituted C.sub.1-6 aliphatic, substituted or unsubstituted aryl, substituted or unsubstituted heterocyclyl, or substituted or unsubstituted heteroaryl.
15. The compound of claim 13, wherein R.sup.4B is hydrogen, substituted or unsubstituted C.sub.1-6 aliphatic, substituted or unsubstituted aryl, substituted or unsubstituted heterocyclyl, or substituted or unsubstituted heteroaryl.
16. The compound of claim 13, wherein R.sup.4A and R.sup.4B are joined together with the intervening atoms to form optionally substituted carbocyclyl, or optionally substituted heterocyclyl.
17. The compound of claim 13, wherein R.sub.F and one instance of R.sup.4A are joined together with the intervening atoms to form optionally substituted heterocyclyl.
18. The compound of any one of claims 1-17, wherein X is O(CH.sub.2).sub.2, C((R.sup.3A)(R.sup.3B)).sub.s, optionally substituted carbocyclylene, optionally substituted heterocyclylene, or optionally substituted arylene.
19. The compound of claim 18, wherein R.sup.3A is hydrogen; substituted or unsubstituted C.sub.1-6 aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; or substituted or unsubstituted acyl.
20. The compound of claim 18, wherein R.sup.3B is hydrogen; substituted or unsubstituted C.sub.1-6 aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; or substituted or unsubstituted acyl.
21. The compound of claim 18, wherein R.sup.3A and R.sup.3B are joined together to form optionally substituted carbocyclyl or ##STR00119##
22. The compound of claim 18, wherein R.sub.G and one instance of R.sup.3A or R.sup.3B are joined together with the intervening atoms to form optionally substituted heterocyclyl.
23. The compound of any one of claims 1-22, wherein the compound is of the formula: ##STR00120## or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer, polymorph, tautomer, isotopically enriched form, or prodrug thereof, wherein R is (CH.sub.2).sub.2O(CH.sub.2).sub.2NH.sub.2.
24. The compound of any one of claims 1-23, wherein the compound is synthesized using the scaffold depicted in
25. The compound of any one of claims 1-23, wherein the compound is synthesized using a template based on an orthogonal codon set depicted in Table 5.
26. The compound of any one of claims 1-23, wherein the compound is synthesized using a template with one or more anticodons and/or reagents depicted in Table 6.
27. The compound of any one of claims 1-23, wherein the compound is synthesized using a template based on an orthogonal codon set including one or more codons depicted in Table 7.
28. A method of synthesizing a DNA-templated compound library, wherein each compound is encoded by a covalently associated DNA tag, comprising: creating a template of a combination of orthogonal codons interspaced by constant regions wherein the template is based on codons from the orthogonal codon sets depicted in
29. The method of claim 28, wherein the template of the combination of orthogonal codons comprises: multiple-residue primer-binding sites; at least three building block codons that determine the identity of three building blocks; and at least a fourth building block codon that identifies a compound scaffold at the 5 end of the template.
30. The method of claim 28, wherein the method further comprises: capping unreacted templates by acetylation.
31. The method of claim 30, wherein the method further comprises: purifying the unreacted templates from the reacted templates.
32. The method of claim 31, wherein the purifying comprises capturing reacted templates with streptavidin-linked beads.
33. The method of claim 31, wherein the purifying comprises using a PAGE purification protocol depicted in
34. The method of claim 31, wherein the method further comprises: macrocyclizing DNA-templated products from the reacted templates.
35. The method of claim 28, wherein the template of the combination of orthogonal codons comprises: multiple-residue primer-binding sites; at least three building block codons that determine the identity of three macrocycle building blocks; and at least a fourth building block codon that identifies a bis-amino acid scaffold at the 5 end of the template.
36. The method of claim 35, wherein the fourth building block codon is a codon that determines the identity of a building block selected from the group consisting of 4A through 4ZZ depicted in
37. The method of claim 35, wherein a first one of the at least three building block codons is selected from the codons that determines the identity of building blocks 1A-1T depicted in
38. The method of claim 28, wherein the DNA-templated compound library is synthesized using a chaotropic buffer.
39. The method of claim 38, wherein synthesized template-linked macrocycles and/or intermediates of the DNA-templated compound library are isolated from dilute solution using a chaotropic buffer.
40. The method of any one of claim 28 or 38, wherein the chaotropic buffer comprises saturated aqueous guanidine hydrochloride (4:6 ratio with isopropanol).
41. A template for DNA-templated synthesis of compounds comprising: multiple-residue primer-binding sites; at least one building block codon that determines the identity of a compound building block; and at least a one building block codon that identifies a scaffold at the 5 end of the template, wherein the template comprises codons from the orthogonal codon sets depicted in
42. The template of claim 41, wherein the template comprises a combination of orthogonal codons interspaced by constant regions comprising: multiple-residue primer-binding sites; at least three building block codons that determine the identity of three compound building blocks; and at least a fourth building block codon that identifies a bis-amino acid scaffold at the 5 end of the template.
43. The template of claim 41, wherein the building block codons determine the identity of macrocycle building blocks.
44. The template of claim 41, wherein the template is an orthogonal codon set comprising: at least one codon selected from the group consisting of 1A-T, 2A-2T, 3A-3T, 4A-4ZZ, and 4A.sub.2 through 4P.sub.4 depicted in Table 5 or 7.
45. The template of claim 44, wherein the template is an orthogonal codon set comprising: a codon selected from the group consisting of 4A-4ZZ depicted in Table 5; a codon selected from the group consisting of 1A-1T depicted in Table 5; a codon selected from the group consisting of 2A-2T depicted in Table 5; and a codon selected from the group consisting of 3A-3T depicted in Table 5.
46. The template of claim 41, wherein the template is an orthogonal codon set comprising: a codon selected from the group consisting of 4A.sub.2 through 4P.sub.4 depicted in Table 7.
47. The template of claim 41, wherein the template is synthesized using one or more reagents 1, 2, or 3 depicted in Table 6.
48. The template of claim 41, wherein the template is synthesized using anticodons 1A-1T for DTS reagent 5-3 depicted in Table 6.
49. The template of claim 41, wherein the template is synthesized using anticodons 2A-2T for DTS reagent 5-3 depicted in Table 6.
50. The template of claim 41, wherein the template is synthesized using anticodons 3A-3T for DTS reagent 5-3 depicted in Table 6.
51. A pharmaceutical composition comprising a compound of any one of claims 1-27, and optionally a pharmaceutically acceptable excipient.
52. The pharmaceutical composition of claim 51 further comprising an additional pharmaceutical agent.
53. A method of treating a disease, impaired insulin signaling, or insulin resistance, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of claims 1-27.
54. The method of claim 53, wherein the disease is associated with aberrant protease activity.
55. The method of claim 54, wherein the aberrant protease activity is aberrant IDE activity.
56. The method of claim 53, wherein the compound is administered in an amount effective to reduce IDE activity in the subject to less than about 50% as compared to the IDE activity in the absence of the compound.
57. The method of claim 56, wherein the IDE activity is plasma IDE activity and/or pancreas IDE activity.
58. The method of claim 53, wherein the subject exhibits impaired insulin signaling or insulin resistance.
59. The method of claim 53, wherein the disease is diabetes.
60. The method of claim 53, wherein the disease is metabolic syndrome.
61. Use of a compound of any one of claims 1-27 or a pharmaceutical composition of claim 51 or 52 to treat a disease in a subject in need thereof.
62. A kit comprising: a compound of any one of claims 1-27 or a pharmaceutical composition of claim 51 or 52; and instructions for administering to a subject or contacting a biological sample with the compound or pharmaceutical composition.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION
[0137] The present invention provides compounds of Formula (I). In certain embodiments, the compounds of Formula (I) are useful for the prevention and/or treatment of a disease in a subject and/or for use in research. In certain embodiments, provided herein are compounds of Formula (I), which inhibit the activity of a protease, for the prevention and/or treatment of a disease (e.g., a disease associated with aberrant enzyme activity (e.g., aberrant protease and/or kinase activity)(e.g., IDE activity)) in a subject. In certain embodiments, compounds of Formula (I) are prepared by DNA-templated synthesis and are part of a DNA-templated compound library. In certain embodiments, the DNA-templated synthesis methods, compounds, systems, kits, and compositions described herein are based on the DNA-templated synthesis methods, compounds, systems, kits, and compositions described in U.S. patent application U.S. Ser. No. 10/101,030, filed Mar. 19, 2002; U.S. Ser. No. 10/744,605, filed Dec. 23, 2003; U.S. Ser. No. 10/949,162, filed Sep. 24, 2004; U.S. Ser. No. 10/949,163, filed Sep. 24, 2004; U.S. Ser. No. 11/141,164, filed May 31, 2005; U.S. Ser. No. 11/141,542, filed May 31, 2005; U.S. Ser. No. 11/351,908, filed Feb. 10, 2006; U.S. Ser. No. 11/586,851, filed Oct. 24, 2006; U.S. Ser. No. 13/173,593, filed Jun. 30, 2011; and U.S. Ser. No. 14/497,976, filed Sep. 26, 2014; each of which is incorporated herein by reference.
[0138] In certain embodiments, compounds of Formula (I) are macrocyclic IDE inhibitors. In another aspect, the present invention provides methods of synthesizing a DNA-templated compound library, and templates for synthesizing a DNA-templated compound library which also act as an associated (e.g., covalently bound) DNA tag to encode each compound in the library. Also provided by the present disclosure are pharmaceutical compositions, kits, methods, and uses of a compound of Formula (I) as described herein.
Compounds
[0139] In certain embodiments, a compound described herein is a compound of any one of Formula (I), or a pharmaceutically acceptable salt, solvate, hydrate, polymorph, co-crystal, tautomer, stereoisomer, isotopically labeled derivative, or prodrug thereof.
[0140] In one aspect of the present invention, provided are compounds of Formula (I):
##STR00002##
or a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer, polymorph, tautomer, isotopically enriched form, or prodrug thereof,
wherein:
[0141] is a single or double CC bond, wherein when
is a double CC bond, then
indicates that the adjacent CC double bond is in a cis or trans configuration;
[0142] L.sup.1 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene;
[0143] L.sup.2 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene;
[0144] L.sup.3 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene;
[0145] X is OC((R.sup.3A)(R.sup.3B)).sub.s, C((R.sup.3A)(R.sup.3B)).sub.s, optionally substituted carbocyclylene, optionally substituted heterocyclylene, or optionally substituted arylene;
[0146] R.sup.3A is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl;
[0147] R.sup.3B is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; or optionally R.sup.3A and R.sup.3B are joined together to form optionally substituted carbocyclyl or
##STR00003##
[0148] each instance of R.sub.E, R.sub.F, R.sub.G, R.sub.H, and R.sub.L is independently hydrogen; halogen; substituted or unsubstituted acyl; a nitrogen protecting group; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted hydroxyl; substituted or unsubstituted thiol; substituted or unsubstituted amino; or optionally R.sub.G and one instance of R.sup.3A or R.sup.3B are joined together with the intervening atoms to form optionally substituted heterocyclyl;
[0149] m1 is 0, 1, or 2;
[0150] s is 0, 1, 2, 3, or 4; and
[0151] y is 0 or 1.
[0152] Compounds of Formula (I) include linker L. In certain embodiments, L is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene. In certain embodiments, L.sup.1 is substituted or unsubstituted C.sub.1-6 aliphatic, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene.
[0153] Compounds of Formula (I) include linker L.sup.2. In certain embodiments, L.sup.2 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene. In certain embodiments, L.sup.2 is of the formula:
##STR00004##
wherein: R.sub.1 is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; OR.sub.A; N(R.sub.A).sub.2; SR.sub.A; O; CN; NO.sub.2; SCN; SOR.sub.A; or SO.sub.2R.sub.A; wherein each occurrence of R.sub.A is independently hydrogen; a protecting group; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted acyl; substituted or unsubstituted aryl; or substituted or unsubstituted heteroaryl; R.sub.2 is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; OR.sub.B; N(R.sub.B).sub.2; SR.sub.B; O; CN; NO.sub.2; SCN; SOR.sub.B; or SO.sub.2R.sub.B; wherein each occurrence of R.sub.B independently hydrogen; a protecting group; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted acyl; substituted or unsubstituted aryl; or substituted or unsubstituted heteroaryl, or optionally R.sub.1 and R.sub.2 are joined together to form a spiro-linked, optionally substituted carbocyclyl, or optionally R.sub.H and one instance of R.sup.1 or R.sup.2 are joined together with the intervening atoms to form optionally substituted heterocyclyl; and x is 0, 1, 2, or 3. In certain embodiments, x is 0. In certain embodiments, x is 1. In certain embodiments, x is 2. In certain embodiments, x is 3. In certain embodiments, R.sub.1 and R.sub.2 are joined together to form a spiro-linked, optionally substituted carbocyclyl. In certain embodiments, R.sub.1 and R.sub.2 are joined together to form a spiro-linked, optionally substituted, 5- to 7-membered carbocyclyl. In certain embodiments, R.sub.1 is substituted or unsubstituted aryl (e.g., substituted or unsubstituted benzyl or substituted or unsubstituted phenyl). In certain embodiments, R.sub.2 is substituted or unsubstituted aryl (e.g., substituted or unsubstituted benzyl or substituted or unsubstituted phenyl).
[0154] In certain embodiments, L.sup.2 is of the formula:
##STR00005##
wherein R.sub.5 is substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted amino; C(O)N(R.sub.J).sub.2; C(O)OR.sub.J; or C(O)SR.sub.J, or CH.sub.2C(O)N(R.sub.J).sub.2, wherein each occurrence of R.sub.J is independently hydrogen; a protecting group; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted acyl; substituted or unsubstituted aryl; or substituted or unsubstituted heteroaryl; or two R.sub.J groups are joined to form a substituted or unsubstituted heterocyclic group; optionally wherein R.sub.5 further comprises a label, resin, or therapeutic agent attached thereto.
[0155] In certain embodiments, L.sup.2 is of the formula:
##STR00006##
wherein w is 0, 1, or 2; and x1 is 1 or 2. In certain embodiments, w is 0. In certain embodiments, w is 1. In certain embodiments, w is 2. In certain embodiments, x1 is 1. In certain embodiments, x1 is 2. In certain embodiments, L.sup.2 is of the formula:
##STR00007##
In certain embodiments, L.sup.2 is substituted or unsubstituted 5- to 7-membered carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted, 4- to 10-membered heterocyclylene. In certain embodiments, L.sup.2 is substituted or unsubstituted carbocyclyene (e.g., substituted or unsubstituted 5- to 7-membered carbocyclyene). In certain embodiments, L.sup.2 is substituted or unsubstituted arylene (e.g., substituted or unsubstituted phenylene or substituted or unsubstituted benzylene). In certain embodiments, L.sup.2 is substituted or unsubstituted heterocyclylene (e.g., substituted or unsubstituted, 5- to 10-membered monocyclic or bicyclic heterocyclylene, wherein one or two atoms in the heterocyclic ring are independently nitrogen, oxygen, or sulfur). In certain embodiments, L.sup.2 is substituted or unsubstituted, 4- to 10-membered monocyclic or bicyclic heterocyclylene, wherein one or two atoms in the heterocyclic ring are independently nitrogen, oxygen, or sulfur.
[0156] In certain embodiments, y is 0. In certain embodiments, y is 1.
[0157] Compounds of Formula (I) include linker L.sup.3. In certain embodiments, L.sup.3 is substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclyene, substituted or unsubstituted arylene, or substituted or unsubstituted heterocyclylene. In certain embodiments, L.sup.3 is substituted or unsubstituted C.sub.1-6 aliphatic. In certain embodiments, L.sup.3 is of the formula:
##STR00008##
wherein R.sup.4A is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; R.sup.4B is hydrogen; halogen; substituted or unsubstituted aliphatic; substituted or unsubstituted heteroaliphatic; substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl; substituted or unsubstituted acyl; or optionally R.sub.F and one instance of R.sup.4A or R.sup.4B are joined together with the intervening atoms to form optionally substituted heterocyclyl, and r is 0, 1, or 2. In certain embodiments, R.sup.4A is hydrogen, substituted or unsubstituted C.sub.1-6 aliphatic, substituted or unsubstituted aryl, substituted or unsubstituted heterocyclyl, or substituted or unsubstituted heteroaryl. In certain embodiments, R.sup.4A is hydrogen. In certain embodiments, R.sup.4A is substituted or unsubstituted C.sub.1-6 aliphatic. In certain embodiments, R.sup.4A is substituted or unsubstituted aryl. In certain embodiments, R.sup.4A is substituted or unsubstituted heterocyclyl. In certain embodiments, R.sup.4A is substituted or unsubstituted heteroaryl.
[0158] In certain embodiments, R.sup.4B is hydrogen, substituted or unsubstituted C.sub.1-6 aliphatic, substituted or unsubstituted aryl, substituted or unsubstituted heterocyclyl, or substituted or unsubstituted heteroaryl. In certain embodiments, R.sup.4B is hydrogen. In certain embodiments, R.sup.4B is substituted or unsubstituted C.sub.1-6 aliphatic. In certain embodiments, R.sup.4B is substituted or unsubstituted aryl. In certain embodiments, R.sup.4B is substituted or unsubstituted heterocyclyl. In certain embodiments, R.sup.4B is substituted or unsubstituted heteroaryl. In certain embodiments, R.sup.4A and R.sup.4B are joined together with the intervening atoms to form optionally substituted carbocyclyl, or optionally substituted heterocyclyl. In certain embodiments, R.sup.4A and R.sup.4B are joined together with the intervening atoms to form optionally substituted carbocyclyl. In certain embodiments, R.sup.4A and R.sup.4B are joined together with the intervening atoms to form optionally substituted heterocyclyl. In certain embodiments, R.sub.F and one instance of R.sup.4A are joined together with the intervening atoms to form optionally substituted heterocyclyl (e.g., substituted or unsubstituted, 5- to 10-membered monocyclic or bicyclic heterocyclyl ring, wherein one or two atoms in the heterocyclic ring are independently nitrogen, oxygen, or sulfur). In certain embodiments, R.sub.F and one instance of R.sup.4B are joined together with the intervening atoms to form optionally substituted heterocyclyl (e.g., substituted or unsubstituted, 5- to 10-membered monocyclic or bicyclic heterocyclyl ring, wherein one or two atoms in the heterocyclic ring are independently nitrogen, oxygen, or sulfur).
[0159] In certain embodiments, L.sup.3 is substituted or unsubstituted carbocyclyene (e.g., substituted or unsubstituted 5- to 7-membered carbocyclyene). In certain embodiments, L.sup.3 is substituted or unsubstituted arylene (e.g., substituted or unsubstituted phenylene or substituted or unsubstituted benzylene). In certain embodiments, L.sup.3 is substituted or unsubstituted heterocyclylene (e.g., substituted or unsubstituted, 5- to 10-membered monocyclic or bicyclic heterocyclylene, wherein one or two atoms in the heterocyclic ring are independently nitrogen, oxygen, or sulfur).
[0160] Compounds of Formula (I) include linker X. In certain embodiments, X is O(CH.sub.2).sub.2. In certain embodiments, X is C((R.sup.3A)(R.sup.3B)).sub.s, wherein s is 0, 1, 2, 3, or 4. In certain embodiments, X is optionally substituted carbocyclyene (e.g., substituted or unsubstituted 5- to 7-membered carbocyclyene). In certain embodiments, X is optionally substituted heterocyclylene (e.g., substituted or unsubstituted, 5- to 10-membered monocyclic or bicyclic heterocyclylene, wherein one or two atoms in the heterocyclic ring are independently nitrogen, oxygen, or sulfur). In certain embodiments, X is optionally substituted arylene (e.g., substituted or unsubstituted phenylene or substituted or unsubstituted benzylene). In certain embodiments, s is 0, 1, 2, 3, or 4. In certain embodiments, R.sup.3A is hydrogen. In certain embodiments, R.sup.3A is substituted or unsubstituted C.sub.1-6 aliphatic. In certain embodiments, R.sup.3A is substituted or unsubstituted heteroaliphatic. In certain embodiments, R.sup.3A is substituted or unsubstituted aryl (e.g., substituted or unsubstituted phenyl or substituted or unsubstituted benzyl). In certain embodiments, R.sup.3A is substituted or unsubstituted acyl (e.g., C(O)Me). In certain embodiments, R.sup.3B is hydrogen. In certain embodiments, R.sup.3B is substituted or unsubstituted C.sub.1-6 aliphatic. In certain embodiments, R.sup.3B is substituted or unsubstituted heteroaliphatic. In certain embodiments, R.sup.3B is substituted or unsubstituted aryl (e.g., substituted or unsubstituted phenyl or substituted or unsubstituted benzyl). In certain embodiments, R.sup.3B is substituted or unsubstituted acyl (e.g., C(O)Me). In certain embodiments, R.sup.3A and R.sup.3B are joined together to form optionally substituted carbocyclyl (e.g., substituted or unsubstituted 5- to 7-membered carbocyclyl). In certain embodiments, R.sup.3A and R.sup.3B are joined together to form
##STR00009##
In certain embodiments, R.sub.G and one instance of R.sup.3A or R.sup.3B are joined together with the intervening atoms to form optionally substituted heterocyclyl.
[0161] Exemplary compounds of Formula (I) include, but are not limited to:
##STR00010##
and pharmaceutically acceptable salts, solvates, hydrates, polymorphs, co-crystals, tautomers, stereoisomers, isotopically labeled derivatives, and prodrugs thereof,
[0162] wherein R is (CH.sub.2).sub.2O(CH.sub.2).sub.2NH.sub.2.
[0163] In certain embodiments, a compound of Formula (I) is a product synthesized using the scaffold and method depicted in
[0164] In some embodiments, the macrocyclic IDE inhibitors provided herein include a CC double bond in the macrocycle backbone. The position of this double bond is provided as in Formula (I). In some embodiments, the macrocycle backbone CC double bond is in the cis-configuration. The respective macrocycles are also referred to herein as cis-olefins. In some embodiments, the macrocycle backbone CC double bond is in the trans-olefin configuration. The respective macrocycles are also referred to herein as trans-olefins. In some embodiments, a macrocyclic IDE inhibitor described herein is provided as a cis-olefin, without any significant or any detectable amount of the respective trans-olefin isomer. In some embodiments, an IDE inhibitor described herein is provided as a trans-olefin, without any significant or any detectable amount of the respective cis-olefin isomer. In some embodiments, an IDE inhibitor described herein is provided as a mixture of cis-olefin and trans-olefin isomers.
[0165] In some embodiments, a macrocyclic IDE inhibitor as described herein comprises a tag or label. In some embodiments, the tag is a fluorescent tag, for example, a fluorescent molecule or moiety that is conjugated, for example, covalently via a linker, to the macrocycle. In some embodiments, the fluorescent tag is a fluorescent protein tag, for example, a GFP tag, a YFP tag, an RFP tag, a BFP tag, or a tag comprising an enhanced fluorescent protein, such as eGFP. Other fluorescent proteins and protein tags are well known to those of skill in the art. In some embodiments, the tag is a cyane dye, or CyDye tag, for example, a Cy3 or C5 tag. In some embodiments, the tag is a fluorescein tag. In some embodiments, the tag is conjugated to the macrocycle structure via a linker. Additional suitable fluorescent tags are known to those of skill in the art and the invention is not limited in this respect. In some embodiments, the tag comprises a binding agent. In some embodiments, the binding agent is an antibody or an antigen-binding antibody fragment, a nanobody, an ScFv, an aptamer, or an adnectin. In some embodiments, the binding agent is a ligand, for example, biotin, polyhistidine, or FK506. Other binding agents are known to those of skill in the art and the invention is not limited in this respect. In some embodiments, the binding agent specifically binds an antigen, for example, an antigen immobilized on a solid surface or a cellular antigen, e.g., a cell-surface antigen. In some embodiments, the tag comprising a binding agent specifically binds to a particular cell or cell type, for example, to a pancreatic cell. In some embodiments, such binding-agent-tagged macrocycles target a specific site characterized by expression of the antigen bound by the binding agent, for example, after administration to a subject harboring such a target site. Antigens useful for targeting specific cells, cell types, tissues, or organs, for example, malignant cells, cell types, tissues, or organs, are well known to those of skill in the art and the invention is not limited in this respect.
[0166] The disclosure also embraces pharmaceutically acceptable salts of the macrocyclic IDE inhibitor disclosed herein, whether conjugated to a tag or not, as well as pharmaceutical compositions comprising the IDE inhibitors disclosed herein, or a pharmaceutically acceptable salt thereof. The disclosure also embraces tagged forms of the IDE inhibitors described herein, for example, IDE inhibitors that are covalently associated (e.g., covalently linked) to a DNA tag.
Methods for Preparing and/or Identifying Compounds of Formula (I)
[0167] The present invention provides methods for preparing compounds of Formula (I) described herein. The present invention further provides methods for preparing macrocyclic IDE inhibitors of the present invention, e.g., following the synthetic steps depicted in
[0168] In certain embodiments, the chaotropic buffer is used in the synthesis step. In certain embodiments, the chaotropic buffer is used in the screening step. In certain embodiments, the synthesized DNA-templated compound library is isolated from dilute solution using a chaotropic buffer. In certain embodiments, synthesized template-linked macrocycles and/or intermediates of the DNA-templated compound library are isolated from dilute solution using a chaotropic buffer. In certain embodiments, the chaotropic buffer comprises saturated aqueous guanidine hydrochloride (4:6 ratio with isopropanol). In certain embodiments, the chaotropic buffer is aqueous guanidine hydrochloride (4:6 ratio with isopropanol). In certain embodiments, the pH of the chaotropic buffer is between 5.0 and 8.0. In certain embodiments, the pH of the chaotropic buffer is between 6.0 and 7.0. In certain embodiments, the pH of the chaotropic buffer is 6.4.
Codon Set
[0169] The present invention provides nucleic acid templates (e.g., codons from orthogonal codon sets depicted in Tables 5 and/or 7), which one or more nucleic acid templates optionally have a reactive unit associated therewith; and 2) contacting the one or more nucleic acid templates with one or more transfer units designed to have a first moiety, an anti-codon which hybridizes to a sequence of the nucleic acid, and is associated with a second moiety, a reactive unit, which includes specific functionality, a building block, reactant, etc. for the compound to be synthesized. In certain embodiments, the transfer unit comprises one moiety incorporating the hybridization capability of the anti-codon unit and the chemical functionality of the reaction unit. In certain embodiments, the templates comprise orthogonal codon sets depicted in Tables 5 and/or 7.
[0170] The nucleic acid templates used in the present invention are made of DNA, RNA, a hybrid of DNA and RNA, or a derivative of DNA and RNA, and may be single- or double-stranded. The sequence of the template is used in the inventive method to encode the synthesis of a chemical compound, preferably a compound that is not, or does not resemble, a nucleic acid or nucleic acid analog (e.g., an unnatural polymer or a small molecule). In certain embodiments, the method described herein does not encode the synthesis of peptides or proteins.
[0171] In the case of certain unnatural polymers, the nucleic acid template is used to align the monomer units in the sequence they will appear in the polymer and to bring them in close proximity with adjacent monomer units along the template so that they will react and become joined by a covalent bond. In the case of a small molecule, the template is used to bring particular reactants within proximity of the small molecule scaffold in order that they may modify the scaffold in a particular way. In certain other embodiments, the template can be utilized to generate non-natural polymers by PCR amplification of a synthetic DNA template library consisting of a random region of nucleotides. In certain embodiments, the templates may be used to synthesize one molecule at a time or may be used to synthesize thousands to millions of compounds using combinatorial methods.
[0172] In certain embodiments, the template is 10 to 10,000 bases long. In certain embodiments, the template is between 10 and 1,000 bases long. The length of the template will of course depend on the length of the codons, complexity of the library, length of the unnatural polymer to be synthesized, complexity of the small molecule to be synthesized, use of constant regions, etc. The nucleic acid sequence may be prepared using any method known in the art to prepare nucleic acid sequences. These methods include both in vivo and in vitro methods including PCR, plasmid preparation, endonuclease digestion, solid phase synthesis, in vitro transcription, strand separation, etc. In certain embodiments, the nucleic acid template is synthesized using an automated DNA synthesizer.
[0173] In certain embodiments, a compound is a product synthesized based on a template using the orthogonal codon set depicted in Table 5 and/or Table 7. In certain embodiments, a compound is a product synthesized based on a template using the codons from the orthogonal codon sets depicted in Table 5 and/or Table 7. In certain embodiments, a compound is a product synthesized based on a template using the codons from the orthogonal codon sets depicted in Table 5 and/or Table 7 and anticodons and/or reagents depicted in Table 6. In certain embodiments, a compound is a product synthesized based on a template using the orthogonal codon set depicted in Table 5. In certain embodiments, a compound of Formula (I) is a product synthesized based on a template using the orthogonal codon set depicted in Table 5. In certain embodiments, the codons are interspaced with constant regions. In certain embodiments, the codons are not interspaced with constant regions.
[0174] In certain embodiments, a compound of Formula (I) is a product synthesized based on a template using the following orthogonal codon set (SEQ ID NO: 1):
##STR00011##
TABLE-US-00001 leftprimer rightprimer (SEQID constant constant constant codon4 (SEQID NO:2) codon3 region3 codon2 region2 codon1 region1 (scaffold) NO:3) CCCTGTACAC NNNNNN AAGTT NNNNNN ATGAT NNNNNN CTA NNNN CATCCCACTC
[0175] In certain embodiments, the template comprises a fourth building block codon that identifies a scaffold at the 5 end of the template. In certain embodiments, the template comprises a fourth building block codon that identifies a bis-amino acid scaffold at the 5 end of the template. In certain embodiments, the fourth building block codon is a codon selected from the group consisting of 1A-1T, 2A-1T, 3A-1T, and 4A through 4ZZ depicted below. In certain embodiments, the fourth building block codon is a codon selected from the group consisting of 4A through 4ZZ depicted below. In certain embodiments, the fourth building block codon is not a codon in the group consisting of 4A through 4H depicted below.
[0176] In certain embodiments, the fourth building block codon is a codon selected from the group consisting of 4U through 4ZZ depicted below. See Table 5.
[0177] In certain embodiments, a compound of Formula (I) is synthesized based on a template using the orthogonal codon set depicted in Table 7. In certain embodiments, the template comprises a fourth building block codon that identifies a bis-amino acid scaffold at the 5 end of the template. In certain embodiments, the fourth building block codon is a codon selected from the group consisting of 4A.sub.2 through 4P.sub.4 depicted below. See Table 7.
[0178] In certain embodiments, a first one of the at least three building block codons is selected from the codons 1A-1T depicted below; a second one of the at least three building block codons is selected from the codons 2A-2T depicted below; and a third one of the at least three building block codons is selected from the codons 3A-3T depicted below. In certain embodiments, the first building block codon is a codon selected from the group consisting of 1A-1T, 2A-1T, 3A-1T, 4A through 4ZZ, and 4A.sub.2 through 4P.sub.4 depicted below. In certain embodiments, the second building block codon is a codon selected from the group consisting of 1A-1T, 2A-1T, 3A-1T, 4A through 4ZZ, and 4A.sub.2 through 4P.sub.4 depicted below. In certain embodiments, the third building block codon is a codon selected from the group consisting of 1A-1T, 2A-1T, 3A-1T, 4A through 4ZZ, and 4A.sub.2 through 4P.sub.4 depicted below. In certain embodiments, the fourth building block codon is a codon selected from the group consisting of 1A-1T, 2A-1T, 3A-1T, 4A through 4ZZ, and 4A.sub.2 through 4P.sub.4 depicted below.
TABLE-US-00002 codon 1A GGCTTT 1B AGGCTT 1C GCCAAA 1D AGGAAC 1E CGTATG 1F CATGAG 1G GAGACA 1H CTGTAG 11 TAGCTG 1J TCTCAG 1K AGAGCT 1L CGAACA 1M GCTCTT 1N TCTGCT 1O TCGATC 1P GACTGA IQ GCAGTA 1R GCGTAT 1S GGAATC 1T GCTTCA 2A GCTGAA 2B GTCGAT 2C GATTGC 2D GGACTT 2E ACGGAT 2F TCGAGT 26 GCAAGA 2H CTTGTG 21 GGCTAA 2J AGGACT 2K TCATGC 2L AGTCTG 2M CTGGAA 2N ATTGCC 2O TCTCGA 2P CCTTAG 2Q TAGCCT 2R CAGTGA 2S GAGCAA 2T GAAGCT 3A ATCGGA 3B TGTGCA 3C AGACTC 3D CTTCAG 3E AGTCGA 3F ATGACG 3G CAACCT 3H TCCGTA 31 GCTTAC 3J TCTACG 3K GTGTCA 3L CACTAC 3M CTGAAC 3N CTAGTC 3O CGGTTT 3P CCCATT 3Q CTCTCT 3R TTACCG 3S TGCTGT 3T CCTTGT 4A TCCA 4B GTTG 4C TTAA 4D TTGT 4E CTCA 4F GGAA 4G TATA 4H ATTT 41 GTAG 4J TAGA 4K GTTT 4L TTTT 4M TTTG 4N AGGT 4O AGGA 4P GTAA 4Q ATTA 4R GTTA 4S GATT 4T ATAG 4U ATCA 4V AAAA 4W AAAG 4X AATT 4Y GATA 4Z GGTT 4UU GTGA 4VV TGTG 4WW AATG 4XX AAGT 4YY AATA 4ZZ AAGA 4A.sub.2 AAAT 4B.sub.2 ACCA 4C.sub.2 AGCT 4D.sub.2 ACGA 4E.sub.2 ACGT 4F.sub.2 ACTA 4G.sub.2 ACTT 4H.sub.2 AGTA 4I.sub.2 AGTT 4J.sub.2 ATAA 4K.sub.2 ATAT 4L.sub.2 ATGA 4M.sub.2 ATGT 4N.sub.2 CACA 4O.sub.2 CAGA 4P.sub.2 CATA 4A.sub.3 CATT 4B.sub.3 CCAA 4C.sub.3 CCTA 4D.sub.3 CCTT 4E.sub.3 CGAA 4F.sub.3 CGTA 4G.sub.3 CGTT 4H.sub.3 CTGA 4I.sub.3 CTGT 4J.sub.3 CTTA 4K.sub.3 CTTT 4L.sub.3 GACA 4M.sub.3 GAGA 4N.sub.3 GCTA 4O.sub.3 GGTA 4P.sub.3 TAAA 4A.sub.4 TAAT 4B.sub.4 TATT 4C.sub.4 TCAA 4D.sub.4 TCCT 4E.sub.4 TCGA 4F.sub.4 TCGT 4G.sub.4 TCTA 4H.sub.4 TCTT 4I.sub.4 TGCA 4J.sub.4 TGGA 4K.sub.4 TGTA 4L.sub.4 TGTT 4M.sub.4 TTAT 4N.sub.4 TTCA 4O.sub.4 TTGA 4P.sub.4 TTTA
[0179] In certain embodiments, the template of the combination of orthogonal codons comprises: multiple-residue primer-binding sites; at least three building block codons that determine the identity of three building blocks; and at least a fourth building block codon that identifies a compound scaffold at the 5 end of the template. In certain embodiments, the template comprises two or more building block codons that determine the identity of two compound building blocks. In certain embodiments, the template comprises two building block codons that determine the identity of two macrocycle building blocks. In certain embodiments, the template comprises three building block codons that determine the identity of three compound building blocks. In certain embodiments, the template comprises three building block codons that determine the identity of three macrocycle building blocks. In certain embodiments, the template comprises a fourth building block codon that identifies a compound scaffold at the 5 end of the template. In certain embodiments, the template comprises a fourth building block codon that identifies a bis-amino acid scaffold at the 5 end of the template.
[0180] In certain embodiments, a compound of Formula (I) is a product synthesized based on a template using one or more anticodons and/or reagents depicted in Table 6. In certain embodiments, the template comprises reagents 1, 2, and 3 depicted below. In certain embodiments, the template comprises reagents 1, 2, and 3 depicted in Table 6. In certain embodiments, the template comprises reagents 1-3 depicted below. In certain embodiments, the template comprises reagents 1-3 depicted in Table 6. In certain embodiments, the template comprises anticodons 1A-1T for DTS reagent 5-3 depicted below. In certain embodiments, the template comprises anticodons 1A-1T for DTS reagent 5-3 depicted in Table 6. In certain embodiments, the template comprises anticodons 2A-2T for DTS reagent 5-3 depicted below. In certain embodiments, the template comprises anticodons 2A-2T for DTS reagent 5-3 depicted in Table 6. In certain embodiments, the template comprises anticodons 3A-3T for DTS reagent 5-3 depicted below. In certain embodiments, the template comprises anticodons 3A-3T for DTS reagent 5-3 depicted in Table 6.
TABLE-US-00003
[0181] The present invention provides templates for DNA-templated synthesis of products described herein comprising a combination of orthogonal codons interspaced by constant regions comprising: multiple-residue primer-binding sites; at least three building block codons that determine the identity of three building blocks; and at least a fourth building block codon that identifies a compound scaffold at the 5 end of the template. In certain embodiments, the templates for DNA-templated synthesis of products described herein comprise a combination of orthogonal codons interspaced by constant regions comprising: multiple-residue primer-binding sites; at least three building block codons that determine the identity of three macrocycle building blocks; and at least a fourth building block codon that identifies a bis-amino acid scaffold at the 5 end of the template.
[0182] In certain embodiments, the template of the combination of orthogonal codons comprises: multiple-residue primer-binding sites; at least three building block codons that determine the identity of three macrocycle building blocks; and at least a fourth building block codon that identifies a bis-amino acid scaffold at the 5-end of the template. In certain embodiments, the template of the combination of orthogonal codons comprises 10-mer to 100-mer primer-binding sites. In certain embodiments, the template of the combination of orthogonal codons comprises 50-mer, 40-mer, 30-mer, 25-mer, 20-mer, 15-mer, or 10-mer primer-binding sites. In certain embodiments, the template of the combination of orthogonal codons comprises 10-mer primer-binding sites. In certain embodiments, the template comprises three building block codons that determine the identity of three macrocycle building blocks. In certain embodiments, the template comprises a fourth building block codon that identifies a bis-amino acid scaffold at the 5 end of the template. In certain embodiments, the fourth building block codon is a codon that determines the identity of a building block selected from the group consisting of 4A through 4ZZ depicted in
[0183] In certain embodiments, the fourth building block codon is not a codon in the group that determines the identity of a building block selected from the group consisting of 4A through 4H depicted in
[0184] In certain embodiments, a first one of the at least three building block codons is selected from the codons that determine the identity of building blocks 1A-1T depicted in
[0185] In certain embodiments, the template of the combination of orthogonal codons comprises: 10-mer primer-binding sites; three building block codons that determine the identity of three macrocycle building blocks; and a fourth building block codon that identifies a bis-amino acid scaffold at the 5 end of the template.
[0186] In certain embodiments, the template is an orthogonal codon set depicted in Table 5. In certain embodiments, the template is synthesized using one or more anticodons and/or reagents depicted in Table 6. In certain embodiments, the template is synthesized using one or more anticodons attached to reagents depicted in Table 6. In certain embodiments, the template is an orthogonal codon set including one or more codons depicted in Table 7. In certain embodiments, the template is an orthogonal codon set including one or more codons depicted in Tables 5 and/or 7. In certain embodiments, the template is an orthogonal codon set including one or more codons and/or anticodons depicted in Tables 5, 6, and/or 7.
Methods of Using Compounds of Formula (I)
[0187] In one aspect, this invention provides methods of using compounds described herein. In one aspect, this invention provides methods of using compounds described herein (e.g., compounds of Formula (I)). In another aspect, this invention provides methods of treating a disease (e.g., a disease associated with aberrant enzyme activity (e.g., aberrant protease and/or kinase activity (e.g., aberrant activity of an insulin degrading enzyme (IDE)), impaired insulin signaling, or insulin resistance, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound described herein. In certain embodiments, the aberrant protease activity is aberrant IDE activity. In another aspect, this invention provides in vitro or in vivo methods of inhibiting the activity of an insulin degrading enzyme (IDE). Such methods are useful for inhibiting IDE, for example, in cell culture or in a subject. In some embodiments, inhibition of IDE results in a stabilization (e.g., greater half-life) of insulin and in improved (e.g., increased) insulin signaling. Accordingly, the in vivo methods of using the macrocyclic IDE inhibitors provided herein are useful in improving insulin signaling in subjects having a disease associated with IDE activity, or impaired insulin signaling, for example, in patients exhibiting metabolic syndrome or diabetes (e.g., Type I or Type II diabetes). In certain embodiments, the subject exhibits impaired insulin signaling or insulin resistance. In some embodiments, the disease treated is diabetes. In some embodiments, the disease treated is metabolic syndrome.
[0188] In some embodiments, the in vitro or in vivo methods of inhibiting the activity of IDE comprise contacting an IDE with an IDE inhibitor provided herein in an amount effective to inhibit the activity of the IDE. In some embodiments, an amount of an IDE inhibitor effective to inhibit the activity of IDE comprises an amount that effects a significant decrease, for example, a statistically significant decrease, in IDE activity as compared to IDE activity in the absence of the IDE inhibitor. In some embodiments, an amount of an IDE inhibitor effective to inhibit the activity of IDE comprises an amount that results in an inhibition of IDE activity to less than about 50%, less than about 25%, less than about 20%, less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.1%, less than about 0.01%, or less than about 0.001% of the IDE activity as compared to the activity in the absence of the compound. In some embodiments, an amount of an IDE inhibitor effective to inhibit the activity of IDE comprises an amount that results in an inhibition of IDE activity to less than about 50% of the IDE activity as compared to the activity in the absence of the compound.
[0189] In some embodiments, an IDE inhibitory macrocyclic compound provided herein is used to inhibit IDE activity in vivo. In such embodiments, the IDE inhibitor is administered to a subject, for example, in the form of a pharmaceutically acceptable salt or as part of a pharmaceutical composition. In some embodiments, the subject is human. In some embodiments, the subject is an animal, for example, an experimental animal, e.g., an animal model of diabetes. In some embodiments, the animal is a mammal, for example, a rodent (e.g., a mouse, a rat, a hamster), a dog, a cat, a cattle, a goat, a sheep, or a horse.
[0190] In some embodiments, an in vivo method of inhibiting IDE is provided that comprises administering an IDE inhibitor provided herein, or a pharmaceutically acceptable composition thereof, to a subject in an amount effective to reduce IDE activity in the subject to less than about 75%, less than about 50%, less than about 25%, less than about 20%, less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.1%, less than about 0.01%, or less than about 0.001% of the IDE activity as compared to the IDE activity in the absence of the compound.
[0191] The present disclosure also provides pharmaceutical compositions comprising a compound described herein and optionally a pharmaceutically acceptable excipient. In certain embodiments, a compound described herein is a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.
[0192] Other aspects of this invention provide methods of using a macrocyclic IDE inhibitor as described herein in the production of pharmaceutical compositions, or in the manufacture of a medicament, for the reduction of IDE activity. Some aspects of this invention provide methods of using a macrocyclic IDE inhibitor as described herein in the production of a pharmaceutical composition, or in the manufacture of a medicament, for the treatment, prophylaxis, and/or amelioration of a disease or disorder associated with aberrant IDE activity, impaired insulin signaling, or insulin resistance, for example, diabetes, or metabolic syndrome. In some embodiments, the pharmaceutical composition or the medicament is for the treatment, prophylaxis, and/or amelioration of a disease or disorder associated with aberrant IDE activity, impaired insulin signaling, or insulin resistance, for example, diabetes, or metabolic syndrome, wherein the disease or disorder is exhibited by a subject also exhibiting one or more symptoms of a neurological disease (e.g., Alzheimer's disease). Some aspects of this invention relate to the use of a macrocyclic IDE inhibitor as described herein for the production of pharmaceutical compositions which can be used for treating, preventing, or ameliorating diseases responsive to the inhibition of IDE activity, for example, diabetes or metabolic syndrome.
[0193] The amount of a macrocyclic IDE inhibitor as described herein that is required for effective inhibition of IDE in a subject or in vitro, or for the treatment or amelioration of a disease associated with IDE activity will vary from subject to subject, depending on a variety of factors, including, for example, the disorder being treated and the severity of the disorder, or the level of IDE activity in the subject, the activity of the specific macrocyclic IDE inhibitor administered, the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts. The macrocyclic IDE inhibitor described herein are preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood that in some embodiments involving administration of a macrocyclic IDE inhibitor described herein to a human patient, the total daily dose may be determined by the attending physician based on sound medical judgment.
[0194] In some embodiments, a macrocyclic IDE inhibitor described herein is formulated into a pharmaceutically acceptable composition comprising the IDE inhibitor, or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier. In some embodiments, after formulation with an appropriate pharmaceutically acceptable carrier of a desired dosage, the pharmaceutical composition can be administered to a subject, for example, a human subject via any suitable route, for example, orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (as by powders, ointments, or drops), bucally, as an oral or nasal spray, or the like.
[0195] In certain embodiments, a macrocyclic IDE inhibitor described herein, for example, in Formula (I), is administered to a subject, for example, orally or parenterally, at a dosage level of about 0.001 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, from about 0.1 mg/kg to about 40 mg/kg, from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, and from about 1 mg/kg to about 25 mg/kg of the subject's body weight per day, one or more times a day, to obtain the desired therapeutic effect or the desired level of IDE inhibition. In some embodiments, the daily dosage is delivered in three separate doses per day, two separate doses per day, or in a single dose per day. In other embodiments, a macrocyclic IDE inhibitor described herein is administered every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage is delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, or more than ten administrations).
[0196] Liquid dosage forms of the macrocyclic IDE inhibitor described herein, for example, for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. In certain embodiments for parenteral administration, the compounds of the invention are mixed with solubilizing agents such polyethoxylated castor oil, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and combinations thereof.
[0197] Injectable preparations of the macrocyclic IDE inhibitor described herein, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.
[0198] The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
[0199] In order to prolong the effect of a drug, it is often desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as poly(lactide-co-glycolide). Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues.
[0200] Compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the macrocyclic IDE inhibitor described herein with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.
[0201] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, a macrocyclic IDE inhibitor described herein is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosage form may also comprise buffering agents.
[0202] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.
[0203] The macrocyclic IDE inhibitor described herein can also be in micro-encapsulated form with one or more excipients as noted above. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. In such solid dosage forms the active protein may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes.
[0204] Formulations of the a macrocyclic IDE inhibitor described herein suitable for topical administration include liquid or semi-liquid preparations such as liniments, lotions, gels, applicants, oil-in-water or water-in-oil emulsions such as creams, ointments, or pastes; or solutions or suspensions such as drops. Formulations for topical administration to the skin surface can be prepared by dispersing the drug with a dermatologically acceptable carrier such as a lotion, cream, ointment, or soap. Useful carriers are capable of forming a film or layer over the skin to localize application and inhibit removal. For topical administration to internal tissue surfaces, the agent can be dispersed in a liquid tissue adhesive or other substance known to enhance adsorption to a tissue surface. For example, hydroxypropylcellulose or fibrinogen/thrombin solutions can be used to advantage. Alternatively, tissue-coating solutions such as pectin-containing formulations can be used. Ophthalmic formulation, ear drops, and eye drops are also contemplated as being within the scope of this invention. Additionally, the present invention contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms can be made by dissolving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.
[0205] Additionally, the carrier for a topical formulation can be in the form of a hydroalcoholic system (e.g., liquids and gels), an anhydrous oil or silicone based system, or an emulsion system, including, but not limited to, oil-in-water, water-in-oil, water-in-oil-in-water, and oil-in-water-in-silicone emulsions. The emulsions can cover a broad range of consistencies including thin lotions (which can also be suitable for spray or aerosol delivery), creamy lotions, light creams, heavy creams, and the like. The emulsions can also include microemulsion systems. Other suitable topical carriers include anhydrous solids and semisolids (such as gels and sticks); and aqueous based mousse systems.
[0206] It will also be appreciated that the macrocyclic IDE inhibitors described herein and pharmaceutical compositions thereof can be employed in combination therapies, that is, the IDE inhibitors and pharmaceutical compositions provided herein can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. For example, in the context of metabolic syndrome or diabetes, a patient may receive a macrocyclic IDE inhibitor described herein and, additionally, a drug or pharmaceutical composition approved for the treatment of or commonly used to ameliorate a symptom associated with metabolic syndrome or diabetes. Similarly, if an IDE inhibitor or a pharmaceutical composition as provided herein is administered to a subject suffering from another disease, for example, from a neurological disease (e.g., Alzheimer's Disease), the subject may receive a macrocyclic IDE inhibitor described herein and, additionally, a drug or pharmaceutical composition approved for the treatment of or commonly used to ameliorate a symptom associated with a neurological disease (e.g., Alzheimer's disease). The particular combination of therapies (therapeutics or procedures) to employ in a combination regimen will take into account compatibility of the desired therapeutics and/or procedures and the desired therapeutic effect to be achieved. It will also be appreciated that the therapies employed may achieve a desired effect for the same disorder (for example, a macrocyclic IDE inhibitor may be administered concurrently with another agent), or they may achieve different effects (e.g., control of any adverse effects).
[0207] In still another aspect, the present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more macrocyclic IDE inhibitor described herein, salts thereof, or with a pharmaceutical composition comprising a macrocyclic IDE inhibitor described herein. In certain embodiments, the pack or kit may also include an additional approved therapeutic agent for use as a combination therapy. Pharmaceutical agents include therapeutically active agents. Pharmaceutical agents also include prophylactically active agents. Pharmaceutical agents include small organic molecules such as drug compounds (e.g., compounds approved for human or veterinary use by the U.S. Food and Drug Administration as provided in the Code of Federal Regulations (CFR)), peptides, proteins, carbohydrates, monosaccharides, oligosaccharides, polysaccharides, nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides or proteins, small molecules linked to proteins, glycoproteins, steroids, nucleic acids, DNAs, RNAs, nucleotides, nucleosides, oligonucleotides, antisense oligonucleotides, lipids, hormones, vitamins, and cells. In certain embodiments, the additional pharmaceutical agent is a pharmaceutical agent useful for treating and/or preventing a disease (e.g., a disease associated with aberrant enzyme activity (e.g., aberrant protease and/or kinase activity (e.g., aberrant IDE activity)). Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceutical products, which notice reflects approval by the agency of manufacture, use, or sale for human or veterinary administration. Provided herein are kits comprising the compounds described herein, or a pharmaceutical composition thereof, and instructions for administering to a subject or contacting a biological sample with the compound or pharmaceutical composition.
[0208] The present invention also provides uses of the compounds described herein, or a pharmaceutical composition thereof, for treating a disease in a subject in need thereof (e.g., a disease (e.g., a disease associated with aberrant enzyme activity (e.g., aberrant protease and/or kinase activity (e.g., aberrant IDE activity)).
[0209] The function and advantage of these and other embodiments of the present invention will be more fully understood from the Examples below. The following Examples are intended to illustrate the benefits of the present invention and to describe particular embodiments, but are not intended to exemplify the full scope of the invention. Accordingly, it will be understood that the Examples are not meant to limit the scope of the invention.
EXAMPLES
[0210] In order that the present disclosure may be more fully understood, the following examples are set forth. The synthetic and biological examples described in this application are offered to illustrate the compounds, pharmaceutical compositions, and methods provided herein and are not to be construed in any way as limiting their scope.
Example 1
[0211] DNA-encoded libraries have emerged as a widely used resource for discovery of bioactive small molecules and offer substantial advantages compared to conventional small-molecule libraries, including their ability to be evaluated en masse in a single experiment and the minute amounts of library and biological target required for their use. Unfortunately, few research groups have access to these resources and the vast majority of DNA-encoded libraries remain in the private sector. Here, multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology was developed and streamlined, including computational identification and experimental validation of a 20202080 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. These improvements together enable much more robust, scalable, high-yielding, streamlined, and cost-effective preparation of DNA-encoded libraries. These improved methods were integrated to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme (IDE) affinity resulted in novel IDE inhibitors including one of unusual potency and novel macrocycle stereochemistry (IC.sub.50=40 nM), demonstrating the ability of this library to support the discovery of inhibitors of proteins of biomedical interest. These developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, cost-effective, and convenient tools for bioactive small-molecule discovery.
Results
General Design of the DNA-Templated Library Architecture
[0212] The DNA-templated library synthesis is summarized in
Identification of an Orthogonal Codon Set
[0213] One factor that limits the size of DNA-templated libraries is this requirement of codon orthogonality. A DTS reagent's anticodon must efficiently anneal only with the corresponding complimentary codon of the template. Moreover, the template requires a certain degree of secondary structure in order for the hybridized reacting groups to experience optimal effective molarity.sup.44. To design the codon set for the second-generation DNA-templated macrocycle library, a set of 303030 putatively orthogonal codons was used that was previously derived.sup.38 computationally to impart template folding energies in the range found to be optimal for DNA-templated synthesis.sup.44. The Visual OMP platform (DNA Software, Inc.) was used to identify a set of 30 scaffold codon candidates out of 256 possible sequences of the form NNNN that avoided hairpin formation with the adjacent codons and minimized predicted off-target hybridization to reagent anticodons (
[0214] 90 DNA-linked phenylalanine model reagents were synthesized and purified, each containing one of the 90 different anticodon oligonucleotides (1a . . . 1z, 1ww . . . 1zz, 2a . . . 2z, 2ww . . . 2zz, and 3a . . . 3z, 3ww . . . 3zz), and 30 DNA templates (3a-2a-1a-4a . . . 3zz-2zz-1zz-4zz) that collectively contain codons for all 90 reagents in order to validate all possible codon-anticodon combinations for their ability to support efficient and sequence-specific DTS. 2,700 individual DNA-templated amine acylation reactions were performed between each of the 90 DNA-linked model reagents and each of the 30 test templates that collectively contain all 90 possible building block codons and all 30 possible scaffold codons. Based on previous work.sup.38, a threshold of 7% or greater conversion of non-complementary reagent and template was chosen as being unacceptable. The DTS reactivity tables for codons 1 and 2 obtained at the previously used temperature regimes (25 C. for steps 1 and 2, and 37 C. for step 3).sup.38 resulted in prohibitively high levels of mismatched cross-reactivity, with 31% of mismatched step 1 reagent-template combinations and 22% of mismatched step 2 combinations yielding apparent DTS conversions above the 7% threshold at 25 C. (
[0215] Therefore, the set of reactions was repeated at elevated temperatures (30 C. for steps 1 and 2), resulting in a substantial reduction in cross-reactive mismatched reagent-template combinations for DTS steps 1 and 2 (23% and 16%, respectively) (
[0216] Mismatched product formation likely arises from a single problematic codon:anticodon combination, and thus some codons in excluded templates were likely innocent bystanders that did not contribute to mismatched product formation. It was sought to identify the smallest possible set of problematic codons that, once removed from the codon pool, would enable all remaining reagent-template combinations to satisfy the above orthogonality criteria. To identify the problematic codons, a model in which each template behaves as a chain of four independent codons was assumed (
[0217] The most promiscuous codons were excluded by inspection from further consideration, resulting in the removal of 7, 5, and 1 codons from reactions 1, 2, and 3, respectively. The least promiscuous codons (12, 15, and 6 codons from reactions 1, 2, and 3, respectively, and all 30 scaffold codons), showing no mismatched reactivity were directly included into the final orthogonal codon set. The remaining 44 grey-area codons (
[0218] To validate the final orthogonal codon set, the results of 4,068 DNA-templated reactions were re-analyzed, performed at the optimized temperatures collectively involving all of these codons and it was tested if the empirical conversion data matched the result predicted by the final annealing factor table. The predicted apparent conversions of only 178 of the 3,929 mismatched reactions (4.5%) were substantially (>50%) different from the observed experimental values, out of which only 108 (2.7%) corresponded to selected codons, suggesting the validity of the codon set and the codon derivation methodology (
Expanding the Diversity of Macrocycle Scaffolds
[0219] It was sought to expand the functional and stereochemical diversity of simple bis-amino acid scaffolds.sup.38, which were previously chosen based on the commercial availability of Fmoc- and trityl-protected derivatives suitable for on-bead DNA conjugation. Previously, Boc-protected bis-amino acids could not be used as scaffolds due to DNA-incompatible deprotection conditions. It was found that DNA-coupled Boc-functionalized scaffolds could be successfully deprotected on-beads upon 1-minute exposure to 50% trifluoroacetic acid in dichloromethane; analysis of the purified products showed no significant decomposition or detectable depurination of DNA (
Selection of Building Blocks to Improve Cell Permeability
[0220] Lipinski and coworkers developed guidelines commonly known as the rule of 5, which postulates that a molecule is more likely to be orally active (and, by inference, cell-permeable) if molecular weight, octanol/water partition coefficient (LogP), numbers of hydrogen bond donors, and number of hydrogen bond acceptors lie within the ranges listed in Table 1A..sup.45 Additional limitations for the number of rotatable bonds and polar surface area were subsequently introduced.sup.46. Multiple examples of orally bioavailable molecules violating rule-of-5 principles, especially including macrocycles.sup.33,47-51, have led researchers including Kihlberg and co-workers to develop alternative, expanded guidelines (MW1,000 Da, # of H-bond donors below 6; # of H-bond acceptors below 15, cLogP from 2 to 10, # of rotatable bonds below 20, polar surface area below 250 .sup.2) that are especially relevant to macrocyclic molecules such as those in our DNA-templated libraries.sup.30-54 (Table 1A).
TABLE-US-00004 TABLE 1A Desirable chemical spaces described by Lipinski.sup.45 and Kihlberg.sup.52, 54. Parameter Lipinski Kihlberg molecular weight <500 Da <1000 Da cLogP 0 < x < 5 2 < x < 10 # hydrogen bond donors <5 <6 # hydrogen bond acceptors <10 <15 # rotatable bonds <10 <20 polar surface area <140 .sup.2 <250 .sup.2
[0221] Building blocks were chosen for the second-generation library such that the resulting macrocycles are consistent with Kihlberg rules.sup.52 in order to increase the likelihood of compatibility with cell-based assays and to facilitate subsequent hit-to-lead optimization. A method was developed to calculate the influence of any building block candidate on the predicted Kihlberg conformity of the resulting library using widely available chemistry software (ChemBioOffice from CambridgeSoft). Code was designed for the VBA platform (an integrated part of Microsoft Office) that generates SDF files, a widely used structure-data file format, containing the building block connectivities of all 256,000 macrocycles. ChemBioDraw was programmed to recognize the letter codes of a given selection of building block candidates and used this software to convert SDF files into drawn chemical structures. A VBA program then exported the resulting files into ChemFinder, which calculated the Kihlberg parameters. The set of building blocks were iteratively optimized to comply with Kihlberg's guidelines through minimization of the number of highly polar functional groups and hydrogen bond donors, as well as liberal use of N-alkylated amino acids (
[0222] In order to access underexplored macrocycle chemical space, sterically and conformationally challenged structures were also introduced, including fused alicyclic (10, 1R, 1S, 2K, 2N, 2P, 3B, 3C, 3D, 3F, 3G, 3J, 3K, 3M), fused aromatic (1J, 1L, 1M, 1N, 1T, 3E, 3H, 3L, 3R) and spirogenic (1I, 2E, 2Q, 2S, 3N, 3O, 3Q) building blocks. Amino acids with less nucleophilic nitrogen centers were mostly used in reaction 3, since the corresponding amide bond is not formed through DNA-templated amine acylations requiring nucleophilic amines (
[0223] To maximize the quality of the resulting library, all candidate building blocks not previously tested were validated in model single-macrocycle DNA-templated syntheses and only those that provided at least 30% yield of coupling product (typically 50-80%) and at least 45% yield of cyclization (typically 80-90%) were considered further. The final sets of selected scaffolds and building blocks are shown in
[0224] The resulting final macrocyclic products were calculated to possess bioavailability-correlated parameters that are greatly improved compared to our first-generation DNA-templated macrocycle library (
Novel DNA Template Assembly Methodology
[0225] The previously established strategy of assembling the library of DNA templates used split-pool oligonucleotide synthesis of phosphorylated 3 fragments, followed by enzymatic splint-assisted ligation with chemically modified 5 fragments.sup.38. Applying the same approach to the preparation of a 256,000-membered library would require many more oligonucleotide syntheses and split-pool events; for example, 1,280 vs. 192 oligonucleotide syntheses alone would be required for the preparation of the 3 fragment (
[0226] For a 32202020 library this route would involve separate primer extensions of thirty-two 8,000-membered libraries with different scaffold codons. To avoid synthesizing multiple initial libraries, the ability of deoxyinosine to pair in vitro with all four natural nucleobases.sup.55 was exploited. It was reasoned that a 256,000-membered template library could be generated from a single universal 8,000-membered starting library (tetradeoxyinosine library or I.sub.4 library,
Improved Synthesis and Recovery of DNA-Templated Libraries
[0227] A solution-phase alternative to the on-bead macrocyclization of immobilized DTS intermediates was developed
[0228] To isolate template-linked macrocycles or intermediates from dilute solutions with minimal losses a simple chaotropic buffer (4 vol. saturated aqueous guanidine hydrochloride+6 vol. isopropanol) was developed that efficiently promotes the association of DNA-linked species with commercially available silica membranes such as Omega HiBind or Qiagen Qiaquick columns. For example, 99% recovery and 50-fold concentration of 4.8 nmol of single-stranded 55-mer oligonucleotide from a dilute (120 nM) solution was achieved. This methodology has proven instrumental for DTS, which requires multiple isolations of dilute short oligonucleotide-linked products that were previously recovered by less reliable alcohol precipitation.sup.38. Importantly, this approach also enables efficient recycling of DNA-templated libraries from in vitro selections, as the vast majority of library members (both target binders and non-binders) end up in dilute flowthrough and wash solutions, from which they can be salvaged using the chaotropic buffer and silica membranes. For example, 867 pmol (51%) of the final DNA-templated macrocycle library described below was recovered from the combined flowthrough volumes of 98 selections (averaging 17 pmol library each). The quality of the recovered material as evaluated by PAGE was very similar to that of freshly made library, and selections for target protein binding described below yielded similar selection results using freshly synthesized or recovered library (
DNA-Templated Synthesis of a Library of 256,000 Macrocycles
[0229] To confirm that the second-generation DNA-templated library synthesis methodology and materials generate compounds consistent with the target macrocycles, 20111 and a 11201 template subsets of the library were subjected to the DNA-templated library synthesis methodology, followed by removal of DNA templates with S1 nuclease to afford macrocycles made conjugates to a guanine nucleotide. MALDI mass spectrometry revealed product masses consistent with the presence of 32/40 expected macrocycles (
[0230] The second-generation DTS library of macrocycles was prepared by integrating the above methodologies. The DNA template library was generated by two sequential series of 32 primer extensions/PAGE purifications (
[0231] High-throughput DNA sequencing of the final library revealed the presence of 255,954 (>99%) library member templates. A distribution of DNA sequences were observed in the final library that was consistent with the anticipated reactivities of individual building blocks and the expected efficiency of macrocyclization. For example, large and flexible scaffolds, which are expected to result in the most facile cyclizations (-Lys, 4H, 4X) were more highly represented than structures expected to macrocyclize less efficiently (-Dap, 4E, 4U; aminoprolines 4O, 4P, 4YY, 4ZZ). Likewise, N-alkylated amino acids and other building blocks predicted to be less reactive also were found in lower representation of the library (
In Vitro Selection and Validation of the Library of 256,000 Macrocycles
[0232] Insulin-degrading enzyme (IDE) was chosen as a protein target for library selection and validation. From our first-generation DNA-encoded macrocycle library.sup.38, macrocycles 6b and 5b were previously identified containing D-4-benzoylphenylalanine and L-3-cyclohexylalanine as potent ligands and inhibitors of IDE (
[0233] The initial raw IDE selection results revealed several building blocks (1J, 1L, 1M, 1N, 1T, 3E, 3H, 3L, 3R) that consistently demonstrated unusually high enrichments across all amounts of library tested (
[0234] To test if these new hits from the in vitro selection of the 256,000-membered library represent bona fide IDE inhibitors, several of the corresponding cis- and trans-macrocycles (DJPR, DJPM, DJPI, DJIR, CODVV) were synthesized in a DNA-free format and assayed their ability to inhibit IDE activity. All tested hits demonstrated inhibition of IDE over a range of concentrations using a fluorogenic decapeptide cleavage assay (
[0235] Interestingly, whereas trans-isomers of all previously screened IDE inhibitors.sup.42 were much more potent than their cis-analogs, CODVV and DJ*R families demonstrated the opposite stereochemistry-activity relationship. For the DJIR compounds, changing L-alanine in position 3 to 2-trifluoromethyl-D-phenylalanine preserved the feature of superior inhibitory activity of the cis-isomer but greatly increased potency: in contrast to weakly active trans-DJIR (IC.sub.50=20 M), cis-DJIR (IC.sub.50=40 nM) was found to be at least as potent that 6bK and thereby serves as the first example of a highly potent macrocyclic IDE inhibitor containing a backbone alkene with cis configuration. Together these results validate the new library and demonstrated the ability of the DTS library of macrocycles to identify new ligands for targets of biomedical interest, as well as to provide new structure-activity insights that facilitate medicinal chemistry efforts.
DISCUSSION
[0236] A second-generation DNA-templated and DNA-encoded library of 256,000 macrocycles suitable for in vitro selection and high-throughput DNA sequencing was developed and synthesized. During the course of this library's synthesis, many fundamental aspects of DNA-encoded and DNA-templated library technology were developed and extensively optimized. These advances include: (1) A new model for identifying orthogonal codons for DTS library syntheses was proposed and experimentally validated, which resulted in a 20202080 codon set sufficient to support up to 640,000 membered libraries. (2) New chemical tools were developed that substantially expand scaffold and building block diversity of DNA-templated macrocycles. (3) Programs were developed to generate in silico databases of compound libraries and to select building blocks that enhance the predicted bioavailability of the resulting molecules. (4) New isolation and purification methods were developed for DNA-linked small molecules that allow more reliable, scalable, high-yielding, and cost-effective preparation of DTS libraries and also enable the recovery and recycling of libraries after selection. (5) New polymerase-assisted methods were developed to synthesize libraries of DNA templates with 5 chemical modifications. These methods provide more precise control of the library quality, eliminate the necessity of conducting reactions with oligonucleotide mixtures, and minimize material losses through unreliable immobilization on streptavidin-linked beads and poor recovery from standard precipitation methods. (6) Finally, the new library synthesis protocols were validated by in vitro selection against insulin-degrading enzyme (IDE), resulting in the discovery of macrocycle trans-DJPM, which is equipotent to the previously optimized IDE inhibitor 6bK (IC.sub.50=50 nM), and the discovery of cis-DJIR (IC.sub.50=40 nM), an unexpectedly potent IDE inhibitor of cis macrocycle backbone configuration that represents a new class of macrocycles that bind IDE.
[0237] The successful application of DNA-encoded libraries and the development of macrocycles emerging from our first-generation library has already resulted in highly potent and selective macrocycles that modulate the activity of a variety of targets of biomedical interest, in some cases with activity in mammalian cells and in mice.sup.40-42. It is anticipated that this second-generation macrocycle library will prove a fertile source of new bioactive small molecules. An extensive selection campaign against biomedically important targets is underway, and the results will be reported in due course as separate studies focused on the corresponding biological investigations. In addition, it is believed that the comprehensively improved methodology of DNA-templated libraries reported in this work will stimulate the use of this unique, accessible, and convenient tool for molecular discovery.
General Methods
[0238]
TABLE-US-00005 TABLE 30 Acronyms acronym definition acronym definition AMA 1:1 mixture of 28% aq. NH.sub.3 and HTS high-throughput sequencing 40% aq. MeNH.sub.2 Boc tert-butyloxycarbonyl IDE insulin-degrading enzyme BSA bovine serum albumin IPA isopropanol BSOCOES bis(2-(succinimidooxy- MES 2-(N-morpholino)ethanesulfonic carbonyloxy)ethyl)sulfone acid CPG controlled-pore glass Mmt 4-methoxytrityl Cy3 Cyanine 3 Ms methanesulfonyl Dab diaminobutyric acid Mtt 4-methyltrityl Dap diaminopropionic acid NEB New England Biolabs (Ipswich, MA) DCC N,N-Dicyclohexylcarbodiimide Oxyma ethyl (hydroxyimino)cyanoacetate Pure 3849-21-6 DCI 4,5-dicyanoimidazole PAGE polyacrylamide gel electrophoresis DEL DNA-encoded library PBST 50 mM sodium phosphate pH 8.0, 300 mM NaCl, 0.01% Tween-20, 5 mM DTT DIPEA N,N-diisopropylethylamine PCR polymerase chain reaction DMF N,N-dimethylformamide PEG polyethylene glycol DMT 4,4-dimethoxytrityl qPCR quantitative polymerase chain reaction dNTP deoxynucleotide triphosphate SIA succinimidyl iodoacetate DTL DNA-templated library sNHS N-hydroxysulfosuccinimide sodium salt DTS DNA-templated synthesis SPPS solid-phase peptide synthesis DTT 1,4-dithiothreitol TBE Tris/Borate/EDTA buffer EDC N-(3-Dimethylaminopropyl)-N- TBST 50 mM Tris-HCl pH 8, 150 mM ethylcarbodiimide NaCl, hydrochloride, 25952-53-8 0.05% Tween-20, 5 mM DTT Fmoc fluorenylmethyloxycarbonyl TCA trichloroacetic acid GuHCl Guanidinium chloride, TCEP tris(2-carboxyethyl)phosphine guanidine hydrochloride HATU O-(7-azabenzotriazol-1-yl)- TEAA triethylammonium acetate N,N,N,N-tetramethyluronium hexafluorophosphate, 148893- 10-1 HBTU 2-(1H-benzotriazole-1-yl)- TFA trifluoroacetic acid 1,1,3,3-tetramethyluronium hexafluorophosphate, 94790-37- 1 HEPES 4-(2-hydroxyethyl)-1- Tris tris(hydroxymethyl)aminomethane piperazineethanesulfonic acid
General Techniques and Conventions
[0239] Throughout this work the use of common equipment was avoided for any sample containing templates with both primer binding sites to avoid cross-contamination of DNA capable of PCR amplification. A number of procedures described below were designed with this principle in mind.
[0240] All DNA sequences are provided in 5 to 3 representation unless otherwise noted. MilliQ-grade water was used in all experiments. Oxyma Pure (26426) was obtained from Chem-Impex. HBTU (2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate) was purchased from EMD Millipore (8510060100). BSOCOES (bis[2-(succinimidooxycarbonyloxy)ethyl] sulfone) was purchased from Toronto Research Chemicals (B585000) or G-Biosciences (BC01). EDC (N-(3-Dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride) was obtained from Sigma-Aldrich (E1769-10G, BioXtra). sNHS (N-hydroxysulfosuccinimide Sodium Salt) was obtained from Toronto Research Chemicals (H954000). 2 M TEAA pH 7 solution was prepared from acetic acid and triethylamine (see below).
[0241] Functionalized oligonucleotides were purified on an xBridge prep C18 5 m column (10250 mm) in the gradient of acetonitrile in 0.1 M triethylammonium acetate pH 7 buffer using an Agilent Technologies 1200 Series HPLC purification system with an automatic fraction collector. Purified fractions were desalted using Nap-5, Nap-10, or Nap-25 size-exclusion columns (GE Life Sciences), frozen at 78 C. and lyophilized on a Labconco FreeZone Cascade Console Freeze Dry System. Mass spectrometry analysis of all modified and unmodified oligonucleotides was conducted on a Waters Q-Tof Premier LC-MS mass spectrometer (10-20 pmol injection, ESI, negative mode, 6 mM triethylammonium bicarbonate pH 8.5/acetonitrile).
Spin-Column Isolation of Nucleic Acids
[0242] Buffer UM: 1 volume of the DNA solution is combined with a mixture of 4 volumes of aqueous guanidinium chloride solution (saturated at room temperature, natural pH 6.4) and 6 volumes of isopropanol. The buffer enables isolation of at least 55-mer (and longer) single- and double-stranded oligonucleotides from very dilute solutions with minimal losses. For instance, 99% recovery of 4.8 nmol of a single-stranded 55-mer oligonucleotide was achieved from 40 mL of 120 nM solution (400 mL of Buffer UM was used, Omega HiBind Midi column). Guanidinium chloride solution should be mixed with isopropanol immediately before addition to the sample. Prolonged storage (months) of saturated solution of guanidinium chloride should be avoided due to a slight decrease of oligonucleotide recovery efficiency. Retention of single-stranded oligonucleotides shorter than 55-mers decreases with oligonucleotide length (to 5% for a 10-mer).
[0243] Experimentally determined capacities of commercially available silica membrane spin columns: QIAquick (Qiagen): 800 pmol of a single-stranded 85-mer; HiBind DNA Midi columns (Omega): 4.5 nmol of a double-stranded 55-mer or 10 nmol of single-stranded 48-mer; HiBind DNA Maxi columns (Omega): 40 nmol of single-stranded 48-mer.
Oligonucleotide Synthesis
[0244] Oligonucleotides were synthesized on Expedite 8909 DNA synthesizers with helium as a working gas. All synthesis supplies were purchased from Glen Research (Sterling, Va.). Modified methods with prolonged capping times were used and special modifiers were double-coupled (30-min overall exposure to the beads). DNA syntheses were carried out on 1000 CPG beads except for the preparation of DTS reagents 3, where only 500 CPG beads can be used (3-Amino-Modifier C7 CPG 500, 20-2957-10, discontinued, special order from Glen Research). Standard tetrazole was used as the activator, and Ac-dC-CE (10-1015-1C), dT-CE (10-1030-1C), dG-CE (10-1020-1C)/dmf-dG-CE (10-1029-1C), dA-CE (10-1000-1C), and dI-CE (10-1040-90) were used as monomers. 100 mol modifiers were dissolved in 1.8 mL of dry acetonitrile: 5 amino modifier 5 (10-1905-90), spacer-18 (10-1918-90), Cyanine 3 (10-5913-95), and chemical phosphorylation reagent II (10-1901-90). For split-pool synthesis of the heavy strand the following modifications were introduced: DCI was used instead of tetrazole, def-dA-CE (10-1504-10), and 2000 CPG beads.
[0245] Cleavage of oligonucleotides off CPG beads was conducted by heating 1 mol of the beads with 0.4 mL of AMA solution (1:1 mixture of 28% aqueous ammonia and 40% aqueous methylamine) at 65 C. for 15-20 min in sealed 1.5 mL microcentrifuge tubes. The samples were used directly in Glen-Pak cartridge purification (diluted 1:1 with 100 mg/mL NaCl solution for loading) or concentrated on a speedvac until removal of volatile material (20 min at room temperature) for HPLC purification. In the latter case, samples were diluted with 0.1 M TEAA pH 7 buffer and filtered using EMD Ultrafree-MC GV 0.22 m filter units prior to HPLC.
[0246] 5-phosphorylated oligonucleotides were prepared with CPRII modifier (Glen Research, 10-1901-90). Lyophilized Glen-Pak cartridge-purified products were dissolved in 0.5 mL of 28% aqueous ammonia, left at room temperature for 2.5 h, loaded on Nap-5 columns equilibrated in water (GE Life Sciences) and eluted with 1 mL of water to afford deprotected oligonucleotides ready for enzymatic ligations.
Analytical and Preparative Polyacrylamide Gel Electrophoresis (PAGE)
[0247] PAGE gels for Criterion cells were purchased from Bio-Rad Laboratories and were typically run in 0.5 TBE buffer at 200V. Unless otherwise noted, samples were loaded as 1:1 mixture with formamide solution of Qiagen GelPilot 5 loading dye (50 L of dye per 1 mL of formamide; Orange G+bromophenol blue+xylene cyanol dyes, less than recommended 5). Gels requiring 55 C. temperature were pre-run in the oven for 30 minutes before loading the samples with adjustable Viaflo electronic pipettes.
[0248] Gel extraction. DNA bands were visualized either with a UV lamp or using a transilluminator after exposure to SYBR Gold. In a typical protocol, the bands are excised and placed in 0.5-mL Eppendorf tubes with an orifice at the bottom made with a 27-gauge needle. The tube is placed into a 2-mL centrifuge tube and centrifuged at 20,000 rcf to homogenize the gel. The gel is then subject to three dry ice freeze/thaw cycles followed by the addition of the extraction buffer (usually 1 TE pH 7.5). The tubes are rotated on a rotary wheel at 4 C. overnight, then centrifuged at 20,000 rcf. The supernatant is manually removed and the residue is washed with additional amounts of the buffer. For fast extraction of sequencing amplicons the process is conducted in Eppendorf LoBind tubes (022431021) at 40 C. using Eppendorf Thermomixer (2,000 rpm).
On-Bead Chemical Functionalization of Oligonucleotides
[0249] Chemical functionalization of CPG beads was conducted in eppendorf tubes. Washing of the beads in between reactions was achieved by the following sequence (1-mL disposable pipette tips used): 1) air is pumped into the mixture until the pipette tip reaches the bottom of the tube; 2) The tip is held tightly next to the tube bottom; gentle swirling/suction enables removal of most of the solution; 3) the tube is placed on a rack and a second pipette is used to wash down the beads on the outside of the pipette tip with a fresh portion of the solution. After vortexing, the beads can be concentrated at the bottom of the tube by repeated washing/centrifugation.
[0250] Standard peptide coupling reaction vessels with nitrogen bubbling can also be used, however, they are impractical for small loadings (1-4 mol) of CPG beads. If the reaction sequence has to be interrupted, the beads can be washed with acetonitrile and left in the freezer in eppendorf tubes overnight without any adverse effect on the downstream reactions.
Preparation of Auxiliary Chemical Reagents.
[0251] 2M TEAA pH 7 buffer.
[0252] Acetic acid (458 mL) and water (2.427 L) were mixed in a 4-L bottle with a rod-shaped stir bar (8 cm). Triethylamine (1.115 L) was added at 1 drop/s with vigorous stirring over 8-12 h. pH of the resulting solution was adjusted to 7.0 by the addition of acetic acid in 1-mL portions and the resulting buffer was diluted with water to the 4-L rim. The buffer was kept at 4 C. and was freshly diluted to 0.1 M concentration for the use in HPLC purifications. It is recommended to desalt lyophilized HPLC-purified DTS components since residual acetic acid can largely affect the yields of DNA-templated reactions. Triethylammonium bicarbonate-based buffer can be considered as an alternative to TEAA.
(2R,3R)-2,3-diacetoxy-4-(benzylamino)-4-oxobutanoic acid (S1).SUP.38
[0253] ##STR00014##
[0254] 10 g (46.2 mmol) of (+)-O,O-Diacetyl-L-tartaric anhydride was dissolved in 125 mL of dichloromethane in a 250 mL flask sealed with a sleeve stopper and equipped with a powerful stir bar and a balloon as a pressure compensator. 5.05 mL (4.95 g, 46.2 mmol) of benzylamine was added dropwise on stirring (cooling with an ice bath was useful during the addition). The reaction was left at room temperature overnight, the precipitate was filtered, washed three times with 25 mL of dichloromethane and dried to give the pure product as white crystals (12.1 g, 81%). The compound is indefinitely stable at 20 C. and should be stored at this temperature. .sup.1H NMR (500 MHz, DMSO-d.sub.6) 8.77 (t, J=6.1 Hz, 1H), 7.35-7.28 (m, 2H), 7.28-7.17 (m, 3H), 5.54 (qd, J=2.6, 0.9 Hz, 2H), 4.39 (dd, J=15.2, 6.5 Hz, 1H), 4.22 (dd, J=15.2, 5.6 Hz, 1H), 2.50 (q, J=1.9 Hz, 1H), 2.12 (d, J=1.0 Hz, 3H), 2.00 (d, J=1.0 Hz, 3H). .sup.13C NMR (126 MHz, DMSO-d.sub.6) 170.03, 169.81, 168.10, 165.79, 139.49, 128.71, 127.35, 127.30, 72.24, 71.67, 42.48, 21.10, 20.66.
Succinimidyl Iodoacetate (S2).SUP.57
[0255] ##STR00015##
[0256] The compound is available from ThermoFisher (22349).
[0257] A 100-mL flask sealed with a sleeve stopper was charged with N-hydroxysuccinimide (1.15 g, 10 mmol) and iodoacetic acid (1.86 g, 10 mmol). 50 mL of ethyl acetate was added and diisopropylcarbodiimide (1.55 mL, 10 mmol) was added dropwise. The reaction was left stirring at room temperature for 24 h. The mixture was then filtered, the precipitate was washed with a minimum amount of ethyl acetate and dried in vacuo. The solids were dissolved in 50 mL of boiling isopropanol and the solution was transferred into a beaker to initiate crystallization. The crystals were filtered, washed with isopropanol and dried in vacuo to give 1.72 g (60%) of pure product as white crystals. The compound is indefinitely stable at 20 C. and should be stored at this temperature. .sup.1H NMR (500 MHz, CDCl.sub.3) 4.02 (s, 2H), 2.95-2.85 (m, 4H).
(E)-4-(allyloxy)-4-oxobut-2-enoic acid/monoallyl fumarate (S3)
[0258] ##STR00016##
[0259] Maleic anhydride (20 g, 0.2 mol) and allyl alcohol (13.8 mL, 0.2 mol) were mixed in a 500-mL flask and were heated on intensive stirring for 2 h. Then ethyl acetate (200 mL), thiourea (1.24 g, 0.016 mol) and methanesulfonic acid (0.92 mL, 0.014 mol) were added and the mixture was stirred under reflux for 2 h. The mixture was cooled, washed with brine, dried over anhydrous sodium sulfate and concentrated to dryness on a rotovap. Most part of the residue was dissolved in boiling hexanes and the insoluble solid was filtered off. The solvent of the filtrate was removed on a rotovap. The residue was dissolved in a minimum amount of boiling hexanes (50 mL), the solution was cooled down to room temperature and left to crystallize for 1.5 h. The crystals were filtered off, washed with hexanes and dried in vacuo. 11 g of the pure product was isolated, which was sufficient for the downstream applications. The compound should be stored at 20 C. (freezer). .sup.1H NMR (500 MHz, DMSO-d.sub.6) 6.72 (d, J=0.5 Hz, 2H), 5.95 (ddtd, J=17.2, 10.5, 5.5, 0.5 Hz, 1H), 5.35 (dqd, J=17.2, 1.6, 0.5 Hz, 1H), 5.25 (dqd, J=10.6, 1.4, 0.5 Hz, 1H), 4.71-4.65 (m, 2H). .sup.13C NMR (126 MHz, DMSO-d.sub.6) 166.09, 164.66, 135.32, 132.75, 132.56, 118.72, 65.74, 40.45, 40.28, 40.12, 39.95, 39.78, 39.62, 39.45.
Identification of the Orthogonal Codon Set
[0260] The architecture of the model templates was simplified with respect to the actual library assembly: no scaffold amino acid or tartaramide groups were installed on the 5 amino 5 linker; the amino group of the linker was itself reacting in DTS (compare
[0261] Table 2A). All the model DTS reagents contained D-phenylalanine attached to the 3 amino modification of the oligonucleotide via BSOCOES linker. The reactions were carried out under the conditions identical to those of the actual DTS library assembly with the exception of prolonged reaction times for higher assay stringency (8 hours). The reactions were analyzed by polyacrylamide gel electrophoresis (PAGE, ethidium bromide in the linear range).
[0262] Importantly, for each matched template-anticodon pair, three out of four annealing factors are naturally screened by efficient DNA-templated interaction of matched sequences. In order to obtain the missing data, 30 additional templates were prepared and 270 extra reactions were conducted (
[0263] As a general rule of the proposed refinement procedure, each cell of the integral affinity table contains the minimum DTS reaction conversion value among all the DTS reactions conducted between the corresponding DTS reagent (anticodon) and all the templates containing the corresponding codon.
[0264] In order to enable alignment of the scaffold space of the 1.sup.st generation DTS library (8 scaffolds) with the new codon set, two additional scaffold codons (4UU, 4VV) were validated, thus bringing the number of available scaffolds to 32.
TABLE-US-00006 TABLE2A Initiallycalculatedsetusedforexperimentalidentificationoftheorthogonalcodon set.(SEQIDNO:1)
TABLE-US-00007 TABLE3A Synthesizedtemplatesusedfortheidentificationofanorthogonalcodonset.(SEQ IDNO:1)
TABLE-US-00008 TABLE 1B New codon designations and the list of removed codons. old new 3c 3A 3d 3B 3e 3C 3f 3D 3g 3E 3h 3F 3j 3G 3k 3H 3l 3I 3m 3J 3o 3K 3s 3L 3u 3M 3v 3N 3x 3O 3y 3P 3ww 3Q 3xx 3R 3yy 3S 3zz 3T 2a 2A 2c 2B 2d 2C 2e 2D 2f 2E 2h 2F 2i 2G 2j 2H 2k 2I 2m 2J 2n 2K 2o 2L 2q 2M 2r 2N 2t 2O 2u 2P 2v 2Q 2xx 2R 2yy 2S 2zz 2T 1a 1A 1b 1B 1c 1C 1d 1D 1e 1E 1f 1F 1i 1G 1j 1H 1l 1I 1m 1J 1n 1K 1o 1L 1p 1M 1q 1N 1s 1O 1t 1P 1z 1Q 1ww 1R 1xx 1S 1yy 1T Removed codons: 1g, 1h, 1k, 1r, 1u, 1v, 1w, 1x, 1y, 1zz, 2b, 2g, 2l, 2p, 2s, 2w, 2x, 2y, 2z, 2ww, 3a, 3b, 3i, 3n, 3p, 3q, 3r, 3t, 3w, 3z
[0265] Final Orthogonal Codon Set
TABLE-US-00009 TABLE2B Theorthogonalcodonsetfora256,000-memberedDTSlibrary(SEQIDNO:1).
TABLE-US-00010 TABLE3B Anticodons/reagentsfortheorthogonalcodonset.
TABLE-US-00011 TABLE 4 Additional calculated scaffold codons The suggested macrocycle nomenclature for larger libraries is ABCD1, ABCD2 etc. The number defines the group of scaffold codons (which determines the other 60 building blocks) codon 4A.sub.2 AAAT 4B.sub.2 ACCA 4C.sub.2 ACCT 4D.sub.2 ACGA 4E.sub.2 ACGT 4F.sub.2 ACTA 4G.sub.2 ACTT 4H.sub.2 AGTA 4I.sub.2 AGTT 4J.sub.2 ATAA 4K.sub.2 ATAT 4L.sub.2 ATGA 4M.sub.2 ATGT 4N.sub.2 CACA 4O.sub.2 CAGA 4P.sub.2 CATA 4A.sub.3 CATT 4B.sub.3 CCAA 4C.sub.3 CCTA 4D.sub.3 CCTT 4E.sub.3 CGAA 4F.sub.3 CGTA 4G.sub.3 CGTT 4H.sub.3 CTGA 4I.sub.3 CTGT 4J.sub.3 CTTA 4K.sub.3 CTTT 4L.sub.3 GACA 4M.sub.3 GAGA 4N.sub.3 GCTA 4O.sub.3 GGTA 4P.sub.3 TAAA 4A.sub.4 TAAT 4B.sub.4 TATT 4C.sub.4 TCAA 4D.sub.4 TCCT 4E.sub.4 TCGA 4F.sub.4 TCGT 4G.sub.4 TCTA 4H.sub.4 TCTT 4I.sub.4 TGCA 4J.sub.4 TGGA 4K.sub.4 TGTA 4L.sub.4 TGTT 4M.sub.4 TTAT 4N.sub.4 TTCA 4O.sub.4 TTGA 4P.sub.4 TTTA
Building Blocks Selected for the Second-Generation Library of Macrocycles
[0266]
TABLE-US-00012 TABLE 5 Scaffolds for the second-generation DNA-templated libraries of macrocycles
TABLE-US-00013 TABLE 6 Building blocks 1-3 for the second-generation DNA-templated library of macrocycles
Preparation of DNA-Tagged Library Components
Preparation of DTS Reagents, Groups 1 and 2
[0267] ##STR00109##
Oligonucleotides were synthesized trityl-on and purified on Glen-pak cartridges (Glen Research) according to the standard procedure for amino-modified oligonucleotides (4% TFA, vide supra). 100 L of 2 mM DNA solution in water was mixed with 100 L of 100 mM amino acid solution (see
Table 4) in 1 M sodium phosphate pH 7 buffer (for hydrophilic acids-250 mM: 1B, 1F, 1K, 1M, 1N, 1Q, 2B, 2C, 2E, 2F, 2H, 2L, 2M, 2Q, 2S, 2T). 50 L of 100 mg/mL BSOCOES (G-Biosciences, Pierce or Toronto Research Chemicals) solution in DMF was added. The mixtures were sonicated until clear (1D, 1E, 1G, 1J, 2D, 2F, 2, 2J never cleared, and reactions with them were carried out in a heterogeneous mode) and were agitated at room temperature for 1 h. Each mixture was loaded on a Nap-5 column (GE Life Sciences) equilibrated in 0.1 M triethylammonium acetate (TEAA) pH 7, equilibrated with 250 L of 0.1M TEAA and eluted with 700 L of the same buffer. The eluate was filtered using EMD Ultrafree-MC GV 0.22 m filter units and purified by HPLC (3-30 min: 5-32% acetonitrile in 0.1 M TEAA, pH 7). Lyophilized fractions were redissolved in 500 L of 5 mM phosphate buffer pH 7 and used for DTS reactions.
TABLE-US-00014 TABLE 4 Chemical building blocks (1) used for the second-generation library CAS parent amino acid number commercial source 1A hexanoic acid, 3-amino-5- 22818-43-5 Astatech 52006 methyl-,(3S)- 1B N-methyl-D-alanine (HCl) 29475-64-7 Chem-Impex 04405 1C D-beta-homophenylalanine (HCl) 131270-08- Peptech BD733-1 1 1D D-4-benzoylphenylalanine 201466-03- Chem-Impex 05111 7 1E 2-cyclohexyl-D-glycine 14328-52-0 Oakwood 040199-1g 1F D-cyclopropylglycine 49607-01-4 Chem-Impex 16797 1G 1-methyl-L-tryptophan 21339-55-9 Sigma 447439-1G 1H L-neopentylglycine 57224-50-7 Chem-Impex 06234 1I gabapentin 60142-96-3 Chem-Impex 16983 1J 2-aminomethylphenylacetic Acid 40851-65-8 TCI America A2199 1K N-methyl-L-serine (HCl) 2480-26-4 Chem-Impex 06357 1L 4-(aminomethyl)benzeneacetic 1200-05-1 Astatech 75935 acid 1M 2-[(methylamino)methyl]benzoic 527705-23- Matrix Scientific acid 3 077672 1N 4-[(methylamino)methyl]benzoic 96084-38-7 Matrix Scientific acid 065416 1O L-beta-Proline 72580-53-1 Alfa Aesar H57895 1P 3-(2-pyridyl)-D-alanine 37535-52-7 Peptech AD185-1 1Q glycine 56-40-6 Sigma-Aldrich 1R tranexamic acid 1197-18-8 Chem-Impex 06911 1S (1R,2R)-boc-2-aminocyclo- 245115-25- Chem-Impex 14468 pentane carboxylic acid 7 1T 3-aminomethylbenzoic acid 2393-20-6 Chem-Impex 28733
TABLE-US-00015 TABLE 8 Chemical building blocks (2) used for the second-generation library parent amino acid CAS number commercial source 2A D-isoglutamine (HCl) 19522-40-8 Chem-Impex 05966 2B O-methyl-L-serine 32620-11-4 Astatech F10843 2C 4-(methylamino)butanoic acid 1119-48-8 Astatech AB7427 2D D-2-carbamoylphenylalanine 1217613-52-9 Chem-Impex 16773 2E 1-(aminomethyl)cyclopropanecarboxylic acid 139126-45-7 AldrichCPR CDS015451-100MG 2F N-methyl-D-phenylalanine 56564-52-4 Alfa Aesar H65675 2G L-aspartic acid -methyl ester 17812-32-7 Chem-Impex 02695 2H (2-methylamino-ethoxy)-acetic acid 98137-58-7 Oakwood 095219-1g 2I D-3-cyclobutylalanine 174266-00-3 Astatech 59421 2J 3-cyclohexyl-L-alanine 27527-05-5 Chem-Impex 02560 2K D-proline 344-25-2 Sigma-Aldrich 858919 2L N-methyl-L-threonine (HCl) 2812-28-4 Chem-Impex 09616 2M N-methyl-D-Valine (HCl) 88930-14-7 Chem-Impex 04461 2N (1R,3S)-3-aminocyclopentane carboxylic acid 71830-08-5 Chem-Impex 15488 2O L-2-furylalanine 121786-31-0 Chem-Impex 07442 2P trans-L-4-hydroxyproline 51-35-4 Chem-Impex 00185 2Q 1-aminocyclobutanecarboxylic acid 22264-50-2 Oakwood 066472-1g 2R 5-amino-4-oxopentanoic acid 106-60-5 Astatech 27973 2S 1-aminocyclopropane-1-carboxylic acid 22059-21-8 Chem-Impex 07075 2T N-methylglycine 107-97-1 Chem-Impex 01319
TABLE-US-00016 TABLE9 AnalyticaldataofDTSreagents1. sequence5-3 HPLCret. calc. found (SEQIDNOs:4-23) time yield formula (z=3) (z=3) 1A TAGAAAGCCATAGGG7 17.9min 12% C.sub.168H.sub.220N.sub.67O.sub.96P.sub.15S 1735.0 1735.2 1B TAGAAGCCTATAGGG7 12.3min 15% C.sub.165H.sub.215N.sub.64O.sub.98P.sub.15S 1718.0 1718.2 1C TAGTTTGGCATAGGG7 18.5min 15% C.sub.172H.sub.221N.sub.60O.sub.102P.sub.15S 1750.7 1750.8 1D TAGGTTCCTATAGGG7 22.5min 12% C.sub.177H.sub.223N.sub.58O.sub.103P.sub.15S 1767.3 1767.5 1E TAGCATACGATAGGG7 18.8min 12% C.sub.169H.sub.221N.sub.64O.sub.98P.sub.15S 1736.0 1736.2 1F TAGCTCATGATAGGG7 14.9min 14% C.sub.166H.sub.216N.sub.61O.sub.100P.sub.15S 1719.0 1719.2 1G TAGTGTCTCATAGGG7 20.2min 13% C.sub.173H.sub.222N.sub.59O.sub.102P.sub.15S 1750.3 1750.5 1H TAGCTACAGATAGGG7 18.6min 17% C.sub.168H.sub.221N.sub.64O.sub.98P.sub.15S 1732.0 1732.2 1I TAGCAGCTAATAGGG7 19min 16% C.sub.170H.sub.223N.sub.64O.sub.98P.sub.15S 1740.7 1740.9 1J TAGCTGAGAATAGGG7 16.8min 15% C.sub.171H.sub.217N.sub.66O.sub.98P.sub.15S 1752.0 1752.2 1K TAGAGCTCTATAGGG7 13.4min 15% C.sub.165H.sub.216N.sub.61O.sub.101P.sub.15S 1720.3 1720.6 1L TAGTGTTCGATAGGG7 15.9min 7% C.sub.171H.sub.219N.sub.60O.sub.102P.sub.15S 1746.0 1746.2 1M TAGAAGAGCATAGGG7 16.8min 17% C.sub.171H.sub.216N.sub.69O.sub.96P.sub.15S 1755.0 1755.2 1N TAGAGCAGAATAGGG7 16.3min 17% C.sub.171H.sub.216N.sub.69O.sub.96P.sub.15S 1755.0 1755.2 1O TAGGATCGAATAGGG7 14.1min 8% C.sub.167H.sub.215N.sub.66O.sub.98P.sub.15S 1735.3 1735.6 1P TAGTCAGTCATAGGG7 15.3min 17% C.sub.169H.sub.217N.sub.62O.sub.100P.sub.15S 1736.0 1736.3 1Q TAGTACTGCATAGGG7 13.7min 9% C.sub.163H.sub.212N.sub.61O.sub.100P.sub.15S 1705.6 1705.9 1R TAGATACGCATAGGG7 15.5min 16% C.sub.169H.sub.221N.sub.64O.sub.98P.sub.15S 1736.0 1736.2 1S TAGGATTCCATAGGG7 15.15min 14% C.sub.167H.sub.218N.sub.61O.sub.100P.sub.15S 1723.6 1723.9 1T TAGTGAAGCATAGGG7 15.9min 13% C.sub.170H.sub.215N.sub.66O.sub.98P.sub.15S 1747.3 1747.6
TABLE-US-00017 TABLE10 AnalyticaldataofDTSreagents2 sequence5-3 HPLCret. calc. found (SEQIDNOs:24-43) time yield formula (z=2) (z=2) 2A CATTTCAGCAAAGGG7 12.9min 16% C.sub.165H.sub.216N.sub.63O.sub.99P.sub.15S 1719.0 1719.2 2B CATATCGACAAAGGG7 13.8min 11% C.sub.164H.sub.214N.sub.65O.sub.97P.sub.15S 1713.0 1713.3 2C CATGCAATCAAAGGG7 14.4min 23% C.sub.165H.sub.216N.sub.65O.sub.96P.sub.15S 1712.3 1712.6 2D CATAAGTCCAAAGGG7 15.2min 11% C.sub.170H.sub.217N.sub.66O.sub.97P.sub.15S 1742.7 1742.9 2E CATATCCGTAAAGGG7 14.6min 7% C.sub.165H.sub.215N.sub.62O.sub.98P.sub.15S 1708.6 1708.9 2F CATACTCGAAAAGGG7 18.7min 13% C.sub.170H.sub.218N.sub.65O.sub.96P.sub.15S 1733.0 1733.2 2G CATTCTTGCAAAGGG7 14.2min 11% C.sub.165H.sub.216N.sub.59O.sub.102P.sub.15S 1716.3 1716.6 2H CATCACAAGAAAGGG7 14.1min 10% C.sub.165H.sub.215N.sub.68O.sub.95P.sub.15S 1720.7 1720.9 2I CATTTAGCCAAAGGG7 17.8min 16% C.sub.167H.sub.219N.sub.62O.sub.98P.sub.15S 1718.0 1718.2 2J CATAGTCCTAAAGGG7 21.0min 12% C.sub.169H.sub.223N.sub.62O.sub.98P.sub.15S 1727.3 1727.6 2K CATGCATGAAAAGGG7 13.9min 16% C.sub.166H.sub.214N.sub.67O.sub.96P.sub.15S 1725.0 1725.2 2L CATCAGACTAAAGGG7 13.5min 12% C.sub.165H.sub.216N.sub.65O.sub.97P.sub.15S 1717.7 1717.9 (middle peak) 2M CATTTCCAGAAAGGG7 16.5min 3% C.sub.166H.sub.219N.sub.62O.sub.98P.sub.15S 1714.0 1714.3 2N CATGGCAATAAAGGG7 14.5min 14% C.sub.167H.sub.216N.sub.67O.sub.96P.sub.15S 1729.7 1729.9 2O CATTCGAGAAAAGGG7 16.1min 16% C.sub.168H.sub.214N.sub.67O.sub.97P.sub.15S 1738.3 1738.6 2P CATCTAAGGAAAGGG7 12.8min 15% C.sub.166H.sub.214N.sub.67O.sub.97P.sub.15S 1730.3 1730.6 2Q CATAGGCTAAAAGGG7 14.7min 22% C.sub.166H.sub.214N.sub.67O.sub.96P.sub.15S 1725.0 1725.2 2R CATTCACTGAAAGGG7 13.7min 15% C.sub.165H.sub.215N.sub.62O.sub.99P.sub.15S 1714.0 1714.2 2S CATTTGCTCAAAGGG7 14min 19% C.sub.164H.sub.214N.sub.59O.sub.100P.sub.15S 1701.0 1701.2 2T CATAGCTTCAAAGGG7 13.7min 9% C.sub.163H.sub.213N.sub.62O.sub.98P.sub.15S 1700.0 1700.2
Preparation of DTS Reagents 3
[0268] Each product was prepared from 2 mol of CPG-bound oligonucleotide. Importantly, only 500 3 amino C7 CPG beads can be used (Glen Research cat. no. 20-2957-10, discontinued item, custom order needed), very low yields were observed with a 1000 analog. The products are prone to oxidation, and the corresponding solutions should be immediately frozen on dry ice until needed.
##STR00110##
Final Orthogonal Codon Set
[0269] After 5-detritylation on the DNA synthesizer, CPG beads were washed with 20% piperidine in DMF (31 mL, 5 minutes agitation on a rotary each time), then 20.7 mL of DMF and 20.7 mL of MeCN.
[0270] 4-(diphenylphosphino)benzoic acid (61 mg, 200 mol), dicyclohexylcarbodiimide (41 mg, 200 mol) and Oxyma Pure (28 mg, 200 mol) were dissolved in 0.8 mL of dry DMF and 35 L (200 mol) of diisopropylethylamine was added. The mixture was left at room temperature without agitation for 2 h. The crystals were filtered off using EMD Ultrafree-MC GV 0.22 m filter units and the solution was added to CPG beads in a 1.5 mL eppendorf tube. The reaction was agitated on a rotary for 3 h. The liquid phase was removed and the beads were washed with 30.7 mL of DMF and 20.7 mL of MeCN. 400 L of AMA solution containing 1 mg of TCEP was added and the mixture was heated to 65 C. for precisely 10 min. The samples were concentrated for 10-15 min using a speedvac to remove ammonia and methylamine and were diluted with 0.1 M TEAA pH 7 to the 600 L mark. The beads were filtered off using EMD Ultrafree-MC GV 0.22 m filter units and the filtrate was immediately frozen on dry ice. The samples were stored at 20 C. until HPLC purification in 0.1 M TEAA pH 7/acetonitrile (0-3 min: 5% MeCN; 3-25 min: 5-40%; 25-25.5 min: 40-100%; 25.5-27 min: 100%; 27-27.1 min: 100-10%; 27.1-30 min: 10%). Fractions containing peaks at 26 min were frozen on dry ice immediately after each chromatography run. After lyophilization, the residue was dissolved in 400 L of 10 mM sodium phosphate buffer pH 7 and immediately frozen until the follow-up reaction. 13-29% yields.
TABLE-US-00018 TABLE 11 Chemical building blocks (3) used for the second-generation library parent amino acid used in CAS number commercial source 3A L-cyclopropylalanine 1M phosphate pH 102735-53-5 Chem-Impex 07175 7 3B (R)-2-(piperidin-3-yl)acetic acid (HCl) 1M phosphate pH 1334509-89- Astatech 56293 7 5 3C L-beta-homoproline (HCl) 1M phosphate pH 53912-85-9 Peptech BL712-1 7 3D 1-piperazineacetic acid 1M phosphate pH 37478-58-3 Sigma, 728144 7 3E anthranilic acid 500 mM NaOH 118-92-3 Sigma A89855-25G 3F isonipecotic acic 1M phosphate pH 498-94-2 Chem-Impex 06897 7 3G cis-4-aminocyclohexanecarboxylic acid 1M phosphate pH 3685-23-2 Oakwood 047831-1g 7 3H 3-aminobenzoic acid 500 mM NaOH 99-05-8 Oakwood 078487- 10 g 3I 2-(trifluoromethyl)-D-phenylalanine 500 mM NaOH 130930-49-3 Chem-Impex 07435 3J D-proline 1M phosphate pH 344-25-2 Chem-Impex 00355 7 3K (1S,2S)-2-aminocyclohexanecarboxylic 1M phosphate pH 24716-93-6 Alfa Aesar H52779 acid 7 3L 4-aminobenzoic acid 500 mM NaOH 150-13-0 Sigma A9878-5G 3M (R)-nipecotic acid 1M phosphate pH 25137-00-2 Chem-Impex 28509 7 3N cycloleucine 1M phosphate pH 52-52-8 Chem-Impex 03534 7 3O 3-azetidinecarboxylic acid 1M phosphate pH 36476-78-5 Oakwood 035210-1g 7 3P L-alanine 1M phosphate pH 56-41-7 7 3Q L-azetidine-2-carboxylic acid 1M phosphate pH 2133-34-8 Chem-Impex 04462 7 3R (2E)-3-(4-aminophenyl)-2-propenoic acid 500 mM NaOH 17570-30-8 AldrichCPR CD5000175-250MG 3S N-benzylglycine 1M phosphate pH 17136-36-6 Chem-Impex 17126 7 3T N-methyl--Alanine 1M phosphate pH 2679-14-3 Astatech 29150 7
[0271] Each amino acid was dissolved in 100 L of either 1 M sodium phosphate buffer pH 7 or 0.5 M NaOH (see Table). In a few cases some sonication was needed. 100 L of 50 mg/mL SIA (succinimidyl iodoacetate, S2) was added and the mixture was agitated for 30 minutes for the phosphate buffer solutions and for 5 minutes for alkaline solutions. Alkaline solutions were diluted with 100 L of 1 M sodium phosphate buffer pH 7. The corresponding 3-4-(diphenylphosphino)benzoic acid amide-linked oligonucleotide solution was added to each solution, the mixtures were agitated at room temperature for 2 h and then desalted using Nap-5 columns (GE Life Sciences, elution with 1 mL of water). 50 L of 2 M TEAA buffer pH 7 was added to each sample followed by filtration with EMD Ultrafree-MC GV 0.22 m filter units. The samples were purified by HPLC (3-25 min: 5-40% MeCN in 0.1M TEAA pH 7 unless otherwise noted, see Table 15), pure fractions were lyophilized and the residues were dissolved in 500 L of 5 mM sodium phosphate buffer pH 7 to be used in DNA-templated reactions.
TABLE-US-00019 TABLE 12 Analytical data for DTS reagents 3
Preparation of Chemically Modified Primers
[0272]
TABLE-US-00020 TABLE 13 Sources of scaffold building blocks code parent amino acid CAS number commercial source A L-Dap-s Fmoc-L-Dap(Mtt)-OH 654670-89-0 EMD Millipore 04121204 B L-Dab-s Boc-L-Dab(Fmoc)-OH 117106-21-5 Chem-Impex 04963 C L-Orn-s Fmoc-L-Orn(Mtt)-OH 343770-23-0 Chem-Impex 03729 D L-Lys-s Fmoc-L-Lys(Mmt)-OH 159857-60-0 Chem-Impex 11187 E L-Dap-a Fmoc-L-Dap(Mtt)-OH 654670-89-0 EMD Millipore 04121204 F L-Dab-a Fmoc-L-Dab(Boc)-OH 125238-99-5 Chem-Impex 03762 G L-Orn-a Fmoc-L-Orn(Mtt)-OH 343770-23-0 Chem-Impex 03729 H L-Lys-a Fmoc-L-Lys(Mmt)-OH 159857-60-0 Chem-Impex 11187 I L-o-NHCH.sub.2-Phe-s Fmoc-2-(Boc-aminomethyl)-L-Phe-OH 1217808-42-8 Peptech FL552 J L-m-NHCH.sub.2-Phe-s Fmoc-3-(Boc-aminomethyl)-L-Phe-OH 266999-24-0 Chem-Impex 16862 K L-p-NHCH.sub.2-Phe-s Fmoc-4-(Boc-aminomethyl)-L-Phe-OH 204715-91-3 Chem-Impex 07408 L L-o-NHCH.sub.2-Phe-a Boc-2-(Fmoc-aminomethyl)-L-Phe-OH 959573-16-1 Peptech BL550 M L-m-NHCH.sub.2-Phe-a Boc-3-(Fmoc-aminomethyl)-L-Phe-OH 959573-13-8 Peptech BL554 N L-p-NHCH.sub.2-Phe-a Boc-4-(Fmoc-aminomethyl)-L-Phe-OH 170157-61-6 Peptech BL300 O S,S-NH.sub.2-Pro Boc-(2S,4S)-4-amino-1-Fmoc- 221352-74-5 Chem-Impex 07324 pyrrolidine-2-carboxylic acid P S,R-NH.sub.2-Pro (2S,4R)-Boc-4-amino-1-Fmoc- 273222-06-3 Chem-Impex 29660 pyrrolidine-2-carboxylic acid Q D-Dap-s Fmoc-D-Dap(Mtt)-OH 1263046-35-0 Chem-Impex 16190 R D-Dab-s Boc-D-Dab(Fmoc)-OH 131570-57-5 Chem-Impex 06297 S D-Orn-s Fmoc-D-Orn(Mtt)-OH 198545-20-9 Chem-Impex 03731 T D-Dys-s Fmoc-D-Lys(Mtt)-OH 198544-94-4 Chem-Impex 03924 U D-Dap-a Fmoc-D-Dap(Mtt)-OH 1263046-35-0 Chem-Impex 16190 V D-Dab-a Fmoc-D-Dab(Mtt)-OH 1217809-38-5 Chem-Impex 16187 W D-Orn-a Fmoc-D-Orn(Mtt)-OH 198545-20-9 Chem-Impex 03731 X D-Dys-a Fmoc-D-Lys(Mtt)-OH 198544-94-4 Chem-Impex 03924 Y D-o-NHCH.sub.2-Phe-s Fmoc-2-(Boc-aminomethyl)-D-Phe-OH 1217729-44-6 Peptech FD553 Z D-m-NHCH.sub.2-Phe-s Fmoc-3-(Boc-aminomethyl)-D-Phe-OH 1217665-54-7 Peptech FD557 UU D-p-NHCH.sub.2-Phe-s Fmoc-4-(Boc-aminomethyl)-D-Phe-OH 268731-06-2 Peptech FD304 VV D-o-NHCH.sub.2-Phe-a Boc-2-(Fmoc-aminomethyl)-D-Phe-OH 1212895-19-6 Peptech BD551 WW D-m-NHCH.sub.2-Phe-a Boc-3-(Fmoc-aminomethyl)-D-Phe-OH 1213080-68-2 Peptech BD555 XX D-p-NHCH.sub.2-Phe-a Boc-4-(Fmoc-aminomethyl)-D-Phe-OH 215302-77-5 Peptech BD302 YY R,S-NH.sub.2-Pro (2R,4S)-Boc-4-amino-1-Fmoc- 1253791-18-2 Chem-Impex 29664 pyrrolidine-2-carboxylic acid ZZ R,R-NH.sub.2-Pro (2R,4R)-Boc-4-amino-1-Fmoc- 1253790-74-7 Chem-Impex 29663 pyrrolidine-2-carboxylic acid
[0273] All primers were prepared on-beads from CCCTGTACAC (SEQ ID NO: 2) primer modified with 5 Amino Modifier 5 (Glen Research) synthesized on 1000 Ac-dC CPG beads.
Primers A, C, D, Q, S, T
[0274] 4 mol of CPG beads was detritylated on the DNA synthesizer, split between two 1.5 mL eppendorf tubes and each batch was washed with 0.6 mL of dry DMF. The corresponding amino acid (200 mol), HBTU (68 mg, 180 mol) and Oxyma Pure (29 mg, 200 mol) were dissolved in 1.2 mL of dry DMF followed by the addition of 70 L of DIPEA (400 mol). The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. The beads were washed with 30.6 mL of DMF and 20.6 mL of MeCN and moved into empty Expedite-type DNA synthesis columns for detritylation on a DNA synthesizer with 3% trichloroacetic acid in dichloromethane followed by washing with ample amounts of MeCN. Detritylation is slow, ample washing with TCA is needed; 4% TFA can be used instead; however, connectivity swapping verification should be conducted. The beads were split between two 1.5 mL eppendorf tubes and each batch was washed with 0.6 mL of dry DMF. Tartaramide S1 (65 mg, 200 mol), HBTU (68 mg, 180 mol) and Oxyma Pure (29 mg, 200 mol) were dissolved in 1.2 mL of dry DMF followed by the addition of 70 L of DIPEA (400 mol), which led to the development of a dark-green color within few minutes. The solution was split in two halves which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 30.6 mL of DMF and 20.6 mL of MeCN followed by the addition of 400 L of AMA solution. After heating to 65 C. for 15 min, the samples were concentrated for 30 min using a speedvac to remove ammonia/methylamine and were diluted with 300 L of 0.1 M TEAA pH 7 buffer. The beads were filtered off using EMD Ultrafree-MC GV 0.22 m filter units and the samples were purified by HPLC under conditions individual for each primer (see
[0275] Table for conditions and retention times). Lyophilized HPLC fractions were redissolved in 500 L of water and desalted with Nap-5 columns (GE Life Sciences, elution with 1 mL of water).
Primers G, H, W, X
[0276] 4 mol of CPG beads was detritylated on the DNA synthesizer, split between two 1.5 mL eppendorf tubes and each batch was washed with 0.6 mL of dry DMF. The corresponding amino acid (200 mol), HBTU (68 mg, 180 mol) and Oxyma Pure (29 mg, 200 mol) were dissolved in 1.2 mL of dry DMF followed by the addition of 70 L of DIPEA (400 mol). The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 30.6 mL of DMF. Fmoc-protection was cleaved by 31 mL washes with 20% piperidine in DMF (5 min agitation on a rotary each time). Each batch was then washed with 20.6 mL of DMF and 20.6 mL of MeCN. Tartaramide S1 (65 mg, 200 mol), HBTU (68 mg, 180 mol) and Oxyma Pure (29 mg, 200 mol) were dissolved in 1.2 mL of dry DMF followed by the addition of 70 L of DIPEA (400 mol), which led to the development of a dark-green color within few minutes. The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 30.6 mL of DMF and 20.6 mL of MeCN and then moved into empty Expedite-type DNA synthesis columns for detritylation on a DNA synthesizer with 3% trichloroacetic acid in dichloromethane followed by washing with ample amounts of MeCN. Each half of the beads was mixed with 400 L of AMA solution. After heating to 65 C. for 15 min, the samples were concentrated for 30 min using a speedvac to remove ammonia/methylamine and were diluted with 300 L of 0.1 M TEAA pH 7 buffer. The beads were filtered off using EMD Ultrafree-MC GV 0.22 m filter units and the samples were purified by HPLC under conditions individual for each primer (see
[0277] Table for conditions and retention times). Lyophilized HPLC fractions were redissolved in 500 L of water and desalted with Nap-5 columns (GE Life Sciences, elution with 1 mL of water).
Primers E, U
[0278] Due to connectivity swapping issues (undesired partial conversion of -functionalized products E and U into the corresponding isomers with side-chain tartaramide, primers A and Q), for primers E and U the trityl protection is kept throughout the synthesis. 4 mol of CPG beads was detritylated on the DNA synthesizer, split between two 1.5 mL eppendorf tubes and each batch was washed with 0.6 mL of dry DMF. The corresponding amino acid (200 mol), HBTU (68 mg, 180 mol) and Oxyma Pure (29 mg, 200 mol) were dissolved in 1.2 mL of dry DMF followed by the addition of 70 L of DIPEA (400 mol). The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 30.6 mL of DMF. Fmoc-protection was cleaved by 31 mL washes with 20% piperidine in DMF (5 min agitation on a rotary each time). Each batch was then washed with 20.6 mL of DMF and 20.6 mL of MeCN. Tartaramide S1 (65 mg, 200 mol), HBTU (68 mg, 180 mol) and Oxyma Pure (29 mg, 200 mol) were dissolved in 1.2 mL of dry DMF followed by the addition of 70 L of DIPEA (400 mol), which led to the development of a dark-green color within few minutes. The solution was split in two halves which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 40.6 mL of DMF and 20.6 mL of MeCN. Each half of the beads was mixed with 400 L of AMA solution. After heating to 65 C. for 15 min, the samples were concentrated for 30 min using a speedvac to remove ammonia/methylamine and were diluted with 300 L of 0.1 M TEAA pH 7 buffer to bring the amount of the solvent to 500 L. The beads were filtered off using EMD Ultrafree-MC GV 0.22 m filter units and desalted (important!) with Nap-5 columns (GE Life Sciences) equilibrated in 0.1 M TEAA pH 7 (elution with 1 mL of 0.1 M TEAA pH 7). The resulting samples were combined and purified by HPLC (5-15% MeCN in 0.1 M TEAA pH 7 over 60 min, see Table 17 for retention times). Lyophilized fractions were redissolved in 500 L of water and filtered using EMD Ultrafree-MC GV 0.22 m filter units. 72 L of 24% aqueous TFA was added; after 10 min, the reaction was carefully quenched with 72 L of 28% ammonia and filtered again through a 0.22 m frit. The filtrate was split between two Nap-5 columns, each column was equilibrated with 180 L of water and the product was eluted with 0.7 mL of water. MS (ESI): Primer E, C.sub.113H.sub.150N.sub.38O.sub.67P.sub.10 calc. 1709.8, found 1710.2. Primer U, C.sub.113H.sub.150N.sub.38O.sub.67P.sub.10 calc. 1709.8, found 1710.1.
Primers B, F, R
[0279] 5 mol of CPG beads was detritylated on the DNA synthesizer, split between two 1.5 mL eppendorf tubes and each batch was washed with 0.6 mL of dry DMF. The corresponding amino acid (250 mol), HBTU (85 mg, 225 mol) and Oxyma Pure (35.5 mg, 250 mol) were dissolved in 1 mL of dry DMF followed by the addition of 87 L of DIPEA (500 mol). The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 30.6 mL of DMF. Fmoc-protection was cleaved by washing with 31 mL of 20% piperidine in DMF (5 min agitation on a rotary each time). Each batch was then washed with 30.6 mL of DMF. Tartaramide S1 (81 mg, 250 mol), HBTU (85 mg, 225 mol) and Oxyma Pure (35.5 mg, 250 mol) were dissolved in 1 mL of dry DMF followed by the addition of 87 L of DIPEA (500 mol), which led to the development of a dark-green color within few minutes. The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 30.6 mL of DMF and 20.6 mL of dichloromethane. Boc-protection was cleaved by washing with 500 L of 50% TFA in dichloromethane (1 minute). Each batch was then washed with 10.6 mL of dichloromethane followed by the addition of 600 L of AMA solution (small amounts of dichloromethane on the bottom of the tube were manually removed with a pipette). After heating to 65 C. for 15 min, the samples were concentrated for 30 min using a speedvac to remove ammonia/methylamine. The beads were washed with 0.1 M TEAA pH 7 buffer and filtered off using EMD Ultrafree-MC GV 0.22 m filter units. The samples were purified by HPLC under conditions individualized for each primer (see Table 17 for conditions and retention times). Importantly, due to connectivity swapping, extra effort is needed in order to separate the isomeric product. Lyophilized HPLC fractions were redissolved in 500 L of water and desalted with Nap-5 columns (GE Life Sciences, elution with 1 mL of water).
Primer V
[0280] The reaction was conducted using standard SPPS filter columns with vacuum suction. The oligonucleotide (20 mol) was synthesized trityl-on; the CPG beads were detritylated with 3% trichloroacetic acid until the disappearance of the yellow color and washed with dry DMF. The beads were then transferred into two 5-mL eppendorf tubes. The corresponding amino acid (298 mg, 500 mol), HBTU (171 mg, 450 mol) and Oxyma Pure (71 mg, 500 mol) were dissolved in 3 mL of dry DMF followed by the addition of 174 L of DIPEA (1 mmol). The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each half was then split between three 1.5 mL eppendorf tubes and each of six batches was washed with 30.6 mL of DMF. Fmoc-protection was cleaved by washing with 31 mL of 20% piperidine in DMF (5 min agitation on a rotary each time). The beads were combined in a filter column, washed with ample amount of DMF and split between two 5-mL eppendorf tubes. Tartaramide S1 (162 mg, 500 mol), HBTU (171 mg, 450 mol) and Oxyma Pure (71 mg, 500 mol) were dissolved in 3 mL of dry DMF followed by the addition of 174 L of DIPEA (1 mmol), which led to the development of dark-green color within few minutes. The solution was split in two halves which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 2 h. The beads were combined in a filter column, and washed with DMF and MeCN and split between four 1.5 mL eppendorf tubes followed by the addition of 400 L of AMA to each tube. After heating to 55 C. for 15 min, the samples were concentrated for 30 min using a speedvac to remove ammonia/methylamine and were diluted with 0.1 M TEAA pH 7 buffer to bring the amount of the solvent to 500 L. The beads were filtered off using EMD Ultrafree-MC GV 0.22 m filter units and desalted (important!) with Nap-5 columns (GE Life Sciences) equilibrated in 0.1 M TEAA pH 7 (elution with 1 mL of 0.1 M TEAA pH 7). The resulting samples were combined and purified by HPLC in 0.1 M TEAA pH 7/acetonitrile (0-3 min: 5% MeCN; 3-25 min: 5-40%; 25-25.5 min: 40-100%; 25.5-27 min: 100%; 27-27.1 min: 100-10%; 27.1-30 min: 10%). Fractions corresponding to the peak at 28.5 min were lyophilized, then resuspended in 500 L of water. 72 L of 24% TFA was added, the mixture was left for 30 min and filtered using EMD Ultrafree-MC GV 0.22 m filter units. The mixture was quenched with 72 L of 28% aqueous ammonia, desalted on Nap-5 columns equilibrated in 0.1M TEAA pH 7 and purified by HPLC (9-11.5% MeCN in 0.1 M TEAA pH 7 over 35 min). The fractions corresponding to the peak at 30 min were lyophilized, the residue was dissolved in 500 L of water and desalted using a Nap-5 column (elution with 1 mL of water).
Primers I, J, K, L, M, N, Y, Z, UU, VV, WW, XX
[0281] 5 mol of CPG beads was detritylated on the DNA synthesizer, split between two 1.5 mL eppendorf tubes and each batch was washed with 0.6 mL of dry DMF. The corresponding amino acid (250 mol), HBTU (85 mg, 225 mol) and Oxyma Pure (35.5 mg, 250 mol) were dissolved in 1 mL of dry DMF followed by the addition of 87 L of DIPEA (500 mol). The solution was split in two halves which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 40.6 mL of DMF, 20.6 mL of MeCN and 0.6 mL of dichloromethane. Boc-protection was cleaved by washing with 500 L of 50% TFA in dichloromethane (1 minute). Each batch was then washed with 20.6 mL of dichloromethane and 30.6 mL of DMF. Tartaramide S1 (81 mg, 250 mol), HBTU (85 mg, 225 mol) and Oxyma Pure (35.5 mg, 250 mol) were dissolved in 1 mL of dry DMF followed by the addition of 87 L of DIPEA (500 mol), which led to the development of a dark-green color within few minutes. The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 40.6 mL of DMF and 20.6 mL of MeCN. The two batches were combined and mixed with 600 L of AMA solution. After heating to 65 C. for 15 min, the samples were concentrated for 30 min using a speedvac to remove ammonia/methylamine and were diluted with 400 L of 0.1 M TEAA pH 7 buffer. The beads were filtered off using EMD Ultrafree-MC GV 0.22 m filter units and the samples were purified by HPLC under conditions individual for each primer (see
[0282] Table for conditions and retention times). Lyophilized HPLC fractions were redissolved in 500 L of water and desalted with Nap-5 columns (GE Life Sciences, elution with 1 mL of water).
Primers O, P, YY, ZZ
[0283] 5 mol of CPG beads was detritylated on the DNA synthesizer, split between two 1.5 mL eppendorf tubes and each batch was washed with 0.6 mL of dry DMF. The corresponding amino acid (250 mol), HBTU (85 mg, 225 mol) and Oxyma Pure (35.5 mg, 250 mol) were dissolved in 1 mL of dry DMF followed by the addition of 87 L of DIPEA (500 mol). The solution was split in two halves, which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 30.6 mL of DMF. Fmoc-protection was cleaved by washing with 31 mL of 20% piperidine in DMF (5 min agitation on a rotary each time). Each batch was then washed with 30.6 mL of DMF. Tartaramide S1 (81 mg, 250 mol), HBTU (85 mg, 225 mol) and Oxyma Pure (35.5 mg, 250 mol) were dissolved in 1 mL of dry DMF followed by the addition of 87 L of DIPEA (500 mol), which led to the development of a dark-green color within few minutes. The solution was split in two halves which were added to the CPG beads. The reaction mixtures were agitated on a rotary for 3 h. Each batch of the beads was washed with 30.6 mL of DMF and 20.6 mL of dichloromethane. Boc-protection was cleaved by washing with 500 L of 50% TFA in dichloromethane (1 minute). Each batch was then washed with 10.6 mL of dichloromethane followed by the addition of 600 L of AMA solution (small amount of dichloromethane on the bottom of the tube was manually removed with a pipette). After heating to 65 C. for 15 min, the samples were concentrated for 30 min using a speedvac to remove ammonia/methylamine. The beads were washed with 0.1 M TEAA pH 7 buffer and filtered off using EMD Ultrafree-MC GV 0.22 m filter units. The samples were purified by HPLC, 5-11.5% MeCN in 0.1 M TEAA pH 7 over 35 min (see
[0284] Table for retention times). Lyophilized HPLC fractions were redissolved in 500 L of water and desalted with Nap-5 columns (elution with 1 mL of water). For better yields, it's recommended to conduct the second coupling at 40 C. (Eppendorf Thermomixer).
TABLE-US-00021 TABLE 14 Analytical data for chemically modified primers calc. found ret. time HPLC method.sup.a yield formula (z = 2) (z = 2) A 12 min 0-3 min: 5%; 3-25 min: 5- 12.4% C.sub.113 H.sub.150 N.sub.38 O.sub.67 1709.3 1709.6 40% P.sub.10 B 29.5 0-35 min: 5-11.5% 2.1% C.sub.114 H.sub.152 N.sub.38 O.sub.67 1716.3 1716.6 min P.sub.10 C 12 min 0-3 min: 5%; 3-25 min: 5- 9.0% C.sub.115 H.sub.154 N.sub.38 O.sub.67 1723.4 1723.6 40% P.sub.10 D 21 min 0-3 min: 5%; 3-40 min: 5- 3.5% C.sub.116 H.sub.156 N.sub.38 O.sub.67 1730.4 1730.6 20% P.sub.10 E* 27.6 0-60 min: 5-15% (pre-detr.) 7.7% C.sub.133 H.sub.166 N.sub.38 O.sub.67 1709.3 1709.6 min P.sub.10 F 31.0 0-35 min: 5-11.5% 2.4% C.sub.114 H.sub.152 N.sub.38 O.sub.67 1716.3 1716.6 min P.sub.10 G 20 min 0-3 min: 5%; 3-40 min: 5- 9.1% C.sub.115 H.sub.154 N.sub.38 O.sub.67 1723.4 1723.6 20% P.sub.10 H 20 min 0-3 min: 5%; 3-40 min: 5- 10.5% C.sub.116 H.sub.156 N.sub.38 O.sub.67 1730.4 1730.6 20% P.sub.10 I 40 min 0-42 min: 5-12% 7.0% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 P.sub.10 J ~36 min 0-42 min: 5-12% 9.3% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 P.sub.10 K 34.5 0-42 min: 5-12% 6.8% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 min P.sub.10 L 37 min 0-42 min: 5-12% 7.2% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 P.sub.10 M 35 min 0-42 min: 5-12% 7.5% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 P.sub.10 N 33 min 0-42 min: 5-12% 7.7% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.7 P.sub.10 O 27.0 0-35 min: 5-11.5% 0.5% C.sub.115 H.sub.152 N.sub.38 O.sub.67 1722.3 1722.6 min P.sub.10 P 29.0 0-35 min: 5-11.5% 1.6% C.sub.115 H.sub.152 N.sub.38 O.sub.67 1722.3 1722.6 min P.sub.10 Q 19.5 0-3 min: 5%; 3-60 min: 5- 9.6% C.sub.113 H.sub.150 N.sub.38 O.sub.67 1709.3 1709.6 min 30% P10 R 20.8 0-3 min: 5%; 3-40 min: 5- 3.0% C.sub.114 H.sub.152 N.sub.38 O.sub.67 1716.3 1716.6 min 20% P.sub.10 S 20 min 0-3 min: 5%; 3-40 min: 5- 9.5% C.sub.115 H.sub.154 N.sub.38 O.sub.67 1723.4 1723.6 20% P.sub.10 T 21 min 0-3 min: 5%; 3-40 min: 5- 10.9% C.sub.116 H.sub.156 N.sub.38 O.sub.67 1730.4 1730.6 20% P.sub.10 U* 28.4 0-60 min: 5-15% (pre-detr.) 6.6% C.sub.133 H.sub.166 N.sub.38 O.sub.67 1709.3 1709.6 min P.sub.10 V 30 min 0-35 min: 5-11.5% 0.1% C.sub.114 H.sub.152 N.sub.38 O.sub.67 1716.3 1716.6 P.sub.10 W 20 min 0-3 min: 5%; 3-40 min: 5- 5.8% C.sub.115 H.sub.154 N.sub.38 O.sub.67 1723.4 1723.6 20% P.sub.10 X 20 min 0-3 min: 5%; 3-40 min: 5- 6.8% C.sub.116 H.sub.156 N.sub.38 O.sub.67 1730.4 1730.6 20% P.sub.10 Y 38 min 0-42 min: 5-12% 8.2% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 P.sub.10 Z 36 min 0-42 min: 5-12% 8.3% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.7 P.sub.10 UU 34 min 0-42 min: 5-12% 8.0% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 P.sub.10 VV 36.5 0-42 min: 5-12% 3.5% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 min P.sub.10 WW 33.5 0-42 min: 5-12% 3.9% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 min P.sub.10 XX 32.5 0-42 min: 5-12% 3.8% C.sub.120 H.sub.156 N.sub.38 O.sub.67 1754.4 1754.6 min P.sub.10 YY 29.8 0-35 min: 5-11.5% 0.6% C.sub.115 H.sub.152 N.sub.38 O.sub.67 1722.3 1722.6 min P.sub.10 ZZ 27.9 0-35 min: 5-11.5% 0.6% C.sub.115 H.sub.152 N.sub.38 O.sub.67 1722.3 1722.6 min P.sub.10 .sup.aAcetonitrile percentage in 0.1M TEAA pH 7. Concentration ranges correspond to linear gradient.
TABLE-US-00022 TABLE 15 HPLC conditions for connectivity swapping verification of chemically modified primers primer pairs HPLC conditions for 200 pmol.sup.a 4A/4E, 4Q/4U 0-45 mm: 9-12.5% 4B/4F, 4R/4V 0-35 mm: 5-11.5% 4C/4G, 4S/4W 0-30 mm: 9-11% 4D/4H, 4T/4X 0-30 mm: 9-11% 4I/4L, 4Y/4VV 0-40 mm: 9-12% 4J/4M, 4Z/4WW 0-30 mm: 9-11% 4K/4N, 4UU/4XX 0-30 mm: 9-11% .sup.aAcetonitrile percentage in 0.1 M TEAA pH 7. Concentration ranges correspond to linear gradient.
Assembly and Analysis of the Template Library
Assembly of 8,000-Membered I.SUB.4 .Library
[0285] Typical procedure of preparative split ligation. (See
[0286] Large-scale preparative splint ligation. (
[0287] Split-pool oligonucleotide synthesis. After the synthesis of the initial fragment, CPG beads in each Expedite-type column were moved towards one of the two frits by vacuum suction. The columns were cut with a razor blade on the other end and placed into 1.5-mL eppendorf tubes. After centrifugation, all the beads were quantitatively transferred with acetonitrile to a 50-mL conical, and the suspension of the beads in acetonitrile was mixed on a rotary for 30 min. The beads were then manually split between 200-L PCR wells so that the bead level was as even as possible across all the wells. Each well was then loaded into an empty Expedite-type column with excess amount of acetonitrile/vacuum suction. The resulting columns were subject to the next step of oligonucleotide synthesis. This procedure enables highly consistent results for independently conducted split-pool campaigns. The 14 library for the preparation of the DTS macrocycle library was synthesized via a 4-step split-pool process starting from 22 columns of 1 mol Ac-dC CPG.
Different Enzymatic Methods for Template Library Assembly
[0288] For each of the methods, Cy3-labeled primers can be used, which enable unambiguous band identification after PAGE purifications. In PCR amplifications of I.sub.4 library isolated yields of PAGE-purified amplicons above 3-6% could not be achieved even at a very high concentration of primers (5 M). To address this challenge, we optimized a stoichiometric variant of the assembly scheme based on primer extensions without PCR amplification (
[0289] Since the PCR method (
TABLE-US-00023 TABLE16 AnalyticaldataofCy3-labeledpoly-A-taggedprimers SEQ ID calc. found Sequence NO: formula (z=5) (z=5) A (A).sub.6-Cy3-(A).sub.25-sp18- 21864 C511H630N225O263P48 3121.2 3121.2 GAGTGGGATGTGGATAG B (A).sub.6-Cy3-(A).sub.25-sp18- 21865 C509H629N224O261P48 3107.0 3107.0 GAGTGGGATGCAACTAG C (A).sub.6-Cy3-(A).sub.25-sp18- 21866 C511H631N222O263P48 3113.0 3113.0 GAGTGGGATGTTAATAG D (A).sub.6-Cy3-(A).sub.25-sp18- 21867 C510H629N226O260P48 3111.8 3111.9 GAGTGGGATGACAATAG E (A).sub.6-Cy3-(A).sub.25-sp18- 21868 C511H630N225O263P48 3121.2 3121.2 GAGTGGGATGTGAGTAG F (A).sub.6-Cy3-(A).sub.25-sp18- 21869 C509H631N218O265P48 3103.4 3103.6 GAGTGGGATGTTCCTAG G (A).sub.6-Cy3-(A).sub.25-sp18- 21870 C511H631N222O263P48 3113.0 3113.1 GAGTGGGATGTATATAG H (A).sub.6-Cy3-(A).sub.25-sp18- 21871 C511H630N225O261P48 3114.8 3114.9 GAGTGGGATGAAATTAG I (A).sub.6-Cy3-(A).sub.25-sp18- 21872 C509H630N221O263P48 3105.2 3105.4 GAGTGGGATGCTACTAG J (A).sub.6-Cy3-(A).sub.25-sp18- 21873 C510H631N220O264P48 3108.2 3108.4 GAGTGGGATGTCTATAG K (A).sub.6-Cy3-(A).sub.25-sp18- 21874 C510H629N226O260P48 3111.8 3112.0 GAGTGGGATGAAACTAG L (A).sub.6-Cy3-(A).sub.25-sp18- 21875 C511H629N228O259P48 3116.6 3116.7 GAGTGGGATGAAAATAG M (A).sub.6-Cy3-(A).sub.25-sp18- 21876 C510H629N226O260P48 3111.8 3112.0 GAGTGGGATGCAAATAG N (A).sub.6-Cy3-(A).sub.25-sp18- 21877 C509H630N221O263P48 3105.2 3105.3 GAGTGGGATGACCTTAG O (A).sub.6-Cy3-(A).sub.25-sp18- 21878 C509H631N218O265P48 3103.4 3103.6 GAGTGGGATGTCCTTAG P (A).sub.6-Cy3-(A).sub.25-sp18- 21879 C510H631N220O264P48 3108.2 3108.3 GAGTGGGATGTTACTAG Q (A).sub.6-Cy3-(A).sub.25-sp18- 21880 C511H631N222O263P48 3113.0 3113.3 GAGTGGGATGTAATTAG R (A).sub.6-Cy3-(A).sub.25-sp18- 21881 C510H630N223O262P48 3110.0 3110.0 GAGTGGGATGTAACTAG S (A).sub.6-Cy3-(A).sub.25-sp18- 21882 C510H630N223O262P48 3110.0 3110.0 GAGTGGGATGAATCTAG T (A).sub.6-Cy3-(A).sub.25-sp18- 21883 C510H631N220O264P48 3108.2 3108.3 GAGTGGGATGCTATTAG U (A).sub.6-Cy3-(A).sub.25-sp18- 21884 C511H631N222O264P48 3116.2 3116.4 GAGTGGGATGTGATTAG V (A).sub.6-Cy3-(A).sub.25-sp18- 21885 C511H633N216O267P48 3109.4 3109.6 GAGTGGGATGTTTTTAG W (A).sub.6-Cy3-(A).sub.25-sp18- 21886 C510H632N217O266P48 3106.4 3106.6 GAGTGGGATGCTTTTAG X (A).sub.6-Cy3-(A).sub.25-sp18- 21887 C511H631N222O263P48 3113.0 3113.0 GAGTGGGATGAATTTAG Y (A).sub.6-Cy3-(A).sub.25-sp18- 21888 C510H631N220O264P48 3108.2 3108.3 GAGTGGGATGTATCTAG Z (A).sub.6-Cy3-(A).sub.25-sp18- 21889 C509H629N224O261P48 3107.0 3107.2 GAGTGGGATGAACCTAG UU (A).sub.6-Cy3-(A).sub.25-sp18- 21890 C509H630N221O263P48 3105.2 3105.3 GAGTGGGATGTCACTAG VV (A).sub.6-Cy3-(A).sub.25-sp18- 21891 C509H629N224O261P48 3107.0 3107.0 GAGTGGGATGCACATAG WW (A).sub.6-Cy3-(A).sub.25-sp18- 21892 C510H631N220O264P48 3108.2 3108.4 GAGTGGGATGCATTTAG XX (A).sub.6-Cy3-(A).sub.25-sp18- 21893 C510H631N220O264P48 3108.2 3108.3 GAGTGGGATGACTTTAG YY (A).sub.6-Cy3-(A).sub.25-sp18- 21894 C511H632N219O265P48 3111.2 3111.2 GAGTGGGATGTATTTAG ZZ (A).sub.6-Cy3-(A).sub.25-sp18- 21895 C510H632N217O266P48 3106.4 3106.6 GAGTGGGATGTCTTTAG Cy3 =cyanine 3 (Glen Research); sp18 =spacer-18 (Glen Research)
TABLE-US-00024 TABLE 17 Reaction compositions for the preparative PCR route towards the heavy strand of the template library (see FIGs. 23A to 23C, method A) [Stock] M [Final] M volume (l) polyA primer 100 2 4.0 dNTPs 1000 1.33 6.65 Water 161.35 10 NEB buffer 2 10 1 20.0 Klenow exo- 5000 U/mL 5 U/L 0.1 U/L 4.0 Template 2.5 0.05 4.0 Total 200.00 Thermopol buffer 10 10 1 480 dNTPs 10000 200 96 Forward primer 100 5 240 Reverse primer 100 5 240 Water 3504 Vent 2000 U/mL 2 U/L 0.02 U/L 48 Template (from Klenow extension) 0.05 0.002 192 Total 4800
[0290] Preparative PCR Amplification
[0291] Water, I.sub.4 template, Cy3-labeled poly-A-tagged primer (for better identification of the amplicon band on a polyacrylamide gel), dNTPs and 10 NEB buffer 2 were mixed with Klenow(exo-) enzyme (New England Biolabs, M0212L, 5000 u/mL), the reaction mixture was split between PCR tube wells, heated at 37 C. for 30 min and at 75 C. for 20 min (for enzyme inactivation). The resulting solution was used as a template source for the mastermix for Vent-amplification, which was prepared at 0 C. The thermocycler was pre-heated to 95 C. prior to loading of the PCR tubes. After 18 cycles (determined by qPCR, end of exponential amplification phase), the reaction mixture was combined with 500 L of 3 M NaOAc pH 5.3 buffer and split between two 50-mL conical tubes. 15 mL of saturated guanidinium chloride solution and 22.5 mL of isopropanol were added to each conical, and each mixture was passed through a separate Omega HiBind Midi spin column (maximum capacities of the columns were almost reached). Each column was washed with 3 mL of DNA wash buffer (Omega), centrifuged at 3,200 rcf for 10 min, hydrated with 1 mL of water for 10 min and eluted by centrifugation at 3,200 rcf for 10 min. The resulting combined solution (1.7 mL) was split evenly between four Amicon Ultra 0.5 mL 10K, UFC501096 regenerated cellulose filter units and centrifuged at 14,000 rcf for 2 min. The resulting concentrated solution (560 L) was combined with 520 L of formamide containing GelPilot dye (Qiagen) and loaded on two 5% TBE-Urea gels, 30 L/well without heating denaturation (which would be conducted in a library format). The gels were run at 200V at room temperature (55 C. would be needed for the library format to separate the bands) until the primer band, which runs almost synchronously with bromophenol blue, was at the very bottom of the gel. Faint pink bands of the amplicon between the bromophenol blue and xylene cyanol were cut out, split between eight 2-mL eppendorf tubes, gently crushed and subject to three dry ice freeze/thaw cycles prior to addition of 0.4 mL of 1 TE buffer pH 7.5 to each tube. After overnight extraction on a rotary at 4 C., the maximum possible volume of the solution was separated from the gel, filtered through EMD Ultrafree-MC GV 0.22 m filter unit, mixed with 40 L of 3M NaOAc pH 5.2 buffer and 1.2 mL of freezer-cold ethanol. After 1 h at 20 C., the tubes were centrifuged at 20,000 rcf at 4 C. for 40 min, the pellets were dried in vacuo for 0.5 h, dissolved in the overall amount of 200 L of water and desalted on a Nap-5 column (GE Life Sciences). 792 pmol of the double-stranded amplicon was obtained, 3.3% yield.
Preparative Primer Extension with Klenow(Exo-) Polymerase
TABLE-US-00025 TABLE 18 Reaction composition for the first primer extension step of the template library assembly [Stock] M [Final] M volume (l) polyA primer 100 2.5 500 dNTPs 10000 200 400 Water 16667 10 NEB buffer 2 10 1 2000 Klenow exo- 5000 U/mL 5 U/L 0.025 U/L 100 Template 150 2.5 333 Total 20000
[0292] For 50 nmol reactions: Water, the template, the primer, dNTPs and 10 NEB buffer 2 were mixed in a 50-mL conical tube and were left at 37 C. for 1 h. Klenow(exo-) enzyme (New England Biolabs, 5000 u/mL) was added, and the reaction was left at 37 C. for 2 days. The reaction was split between two 50-mL conical tubes. Each solution was mixed with 1 mL of 3 M NaOAc pH 5.2 buffer followed by 30 mL of freezer-cold absolute ethanol. The mixture was left at 20 C. for 6 hours. The tubes were spun at 15,000 g for 30 minutes, the supernatant was discarded and the pellets were dried in vacuo for a few hours. Each pellet was dissolved in 500 L of water, the resulting solutions were desalted with a Nap-5 column (GE Life Sciences, elution with 1 mL of water). Combined solutions were concentrated to 540 L using 10K Amicon Ultra 0.5 mL regenerated cellulose filter units. 540 L of formamide containing GelPilot dye (Qiagen) was added. The mixture was moved into PCR strips (60 l per well), heated to 95 C. for 3 minutes and then rapidly cooled on ice for 20-30 seconds. The samples were quickly loaded on the gel using Integra Viaflo electronic pipette to minimize cooling of the gel. Purification was conducted on two 10% TBE-Urea gels at 55 C. (the gel was pre-equilibrated at 55 C. for 30 minutes before loading the sample; 0.5 TBE, 200V, run until xylene cyanol band was right at the bottom, 55 min). The product band of each of the two gels was cut out, split between three 2-mL tubes, manually crushed and subject to three dry ice freeze/thaw cycles. 1 mL of 10 mM Tris pH 8 buffer was added to each tube, followed by rotation at room temperature in the absence of light for 24 hours. The gel was centrifuged down, as much supernatant as possible was manually separated. The gels were washed with 0.5 mL of 10 mM Tris pH 8 buffer. Combined supernatants were centrifuged down, the clear supernatant was separated, the gel-containing residue was filtered through EMD Ultrafree-MC GV 0.22 m filter units. The resulting solution (8 mL) was moved to a 50 mL conuical tube, followed by the addition of 800 L of 3 M NaOAc pH 5.2 buffer and 24 mL of freezer-cold absolute ethanol. The mixture was left at 20 C. overnight and centrifuged at 15,000 g for 30 minutes. The supernatant was discarded and the pellet was dried in vacuo for a few hours. The product was dissolved in 500 L of water and desalted with a Nap-5 column (GE Life Sciences, elution with 1 mL of water). Concentrations were determined based on UV absorption at 260 nm (calculated as equimolar mixtures of 8,000 oligonucleotides). The purity of the products was confirmed by analytical PAGE analysis (10% TBE-Urea gel).
TABLE-US-00026 TABLE 19 Yields of heavy strands of template sublibraries, Klenow(exo-) primer extension. nmol % 4A 23.9 48% 4B 21.2 42% 4C 25.2 50% 4D 23.4 47% 4E 18.2 36% 4F 25.4 51% 4G 21.9 44% 4H 22.2 44% 4I 21.7 43% 4J 25.8 52% 4K 21.4 43% 4L 21.6 43% 4M 22.5 45% 4N 23.4 47% 4O 23.5 47% 4P 22.2 44% 4Q 23.1 46% 4R 22.5 45% 4S 20.0 40% 4T 20.5 41% 4U 21.1 42% 4V 17.5 35% 4W 21.6 43% 4X 19.4 39% 4Y 20.7 41% 4Z 21.8 44% 4UU 22.3 45% 4VV 18.1 36% 4WW 22.3 45% 4XX 20.9 42% 4YY 19.6 39% 4ZZ 20.1 40%
Preparative Primer Extension with Vent Polymerase
TABLE-US-00027 TABLE 20 Reaction composition for the second primer extension step of the template library assembly [Stock] M [Final] M volume (l) Thermopol buffer 10 10 1 240 dNTPs 10000 1000 240 Modified primer varied varied varied, 1.2 eq. Water 824-(primer) Vent 2000 U/mL 2 U/L 0.08 U/L 96 Template varied varied 1000 Total 2400
[0293] Klenow-extended product (1 mL, see above) was directly used for the next step. 1.2 equivalents of the chemically-modified primers were used. All the components except the enzyme were mixed in a 5-mL tube and the solution was heated to 46 C. for 30 min (Southwest Science SH1002 digital dry bath). After the addition of the enzyme, the reaction mixture was left at 46 C. for 24 hours and was then moved to a 50-mL conical tube containing 250 L of 3M NaOAc pH 5.2 buffer. After the addition of 7.5 mL of freezer-cold absolute ethanol the mixture was left at 20 C. for 3 h and centrifuged at 15,000 g for 30 min. The supernatant was discarded and the pellet was dried in vacuo. The product was dissolved in 500 L of water and desalted using a Nap-5 column (GE Life Sciences, elution with 1 mL of water). The eluate was concentrated to 450 L using 10K Amicon Ultra 0.5 mL regenerated cellulose filter units. 450 L of formamide containing GelPilot dye (Qiagen) was added. The mixture was moved into PCR strips (50 l per well), heated to 95 C. for 3 minutes and then rapidly cooled on ice for 20-30 seconds. The samples were quickly loaded on the gel using Integra Viaflo electronic pipette to minimize cooling of the gel. Purification was conducted on two 10% TBE-Urea gels at 55 C. (the gel was pre-equilibrated at 55 C. for 30 minutes before loading the sample; 0.5 TBE, 200V, run until xylene cyanol band was 1 cm away from the bottom of the gel, 45 min). The product band of each of the two gels was cut out, split between three 2-mL tubes, manually crushed and subject to three dry ice freeze/thaw cycles. 1 mL of 10 mM Tris pH 8 buffer was added to each tube, followed by rotation at room temperature in the absence of light for 24 hours. The gel was centrifuged down and as much supernatant as possible was manually separated. The gels were washed with 0.5 mL of 10 mM Tris pH 8 buffer. Combined supernatants were centrifuged down, the clear supernatant was separated, the gel-containing residue was filtered through EMD Ultrafree-MC GV 0.22 m filter units. The resulting solution (9 mL) was split between two 50 mL conical tubes. 45 mL of Buffer UM (vide supra) was added to each conical and each of the resulting solutions was passed through a HiBind DNA Midi column (Omega Bio-tek). The columns were washed with 31 mL of Omega DNA Wash buffer (or Buffer PE, or 4:1 mixture of ethanol with 10 mM Tris-HCl pH 7.5) and centrifuged at 3,000 g for 10 minutes. After hydration with 1 mL of water for 10 min, the columns were centrifuged again at 3,000 g for 10 minutes. Combined eluates (1.7 mL) were mixed with 17 L of 1M Tris pH 8 and stored at 20 C. Concentrations were determined based on UV absorption at 260 nm (calculated as equimolar mixtures of 8,000 oligonucleotides). The purity of the products was confirmed by analytical PAGE analysis (10% TBE-Urea gel).
TABLE-US-00028 TABLE 21 Yields of the template sublibraries, Vent primer extension. nmol % 4A 6.8 29% 4B 7.3 34% 4C 4.7 19% 4D 6.0 26% 4E 3.2 18% 4F 8.4 33% 4G 5.5 25% 4H 7.5 34% 4I 6.8 31% 4J 7.0 27% 4K 7.7 36% 4L 7.1 33% 4M 6.4 29% 4N 10.1 43% 4O 10.0 43% 4P 9.8 44% 4Q 8.2 35% 4R 8.5 38% 4S 8.8 44% 4T 8.7 42% 4U 4.8 23% 4V 5.7 32% 4W 8.3 38% 4X 9.0 46% 4Y 8.4 40% 4Z 10.6 48% 4UU 7.6 34% 4VV 9.6 53% 4WW 10.7 48% 4XX 10.4 50% 4YY 6.7 34% 4ZZ 9.7 48%
DTS Library Assembly and Analysis
Library Assembly
[0294] All reagents were used in the amounts proportional to the relative ratios of the corresponding codons obtained from high-throughput sequencing data.
[0295] It was found that instead of using buffer UM (4:6 saturated aqueous guanidinium chloride-isopropanol, 10 volumes), isolation of DNA from the 3.sup.rd step DTS reaction mixture on silica membranes (spin columns) is possible after simple dilution of the reaction mixture with isopropanol in 1:1 ratio. The observed recovery exceeded 95%, yet the remaining 5% could be isolated from the filtrate using buffer UM. Dilution of DTS reaction media with isopropanol can therefore be considered as a simpler alternative to buffer UM. For the DTS library preparation, this protocol was applied only to the more sensitive step 3; one can choose to use either buffer UM or isopropanol dilution after each of the three DTS steps. Therefore, steps 1 and 2 require the use of Buffer UM.
[0296] Each of two 50-mL conical tubes was charged with 13.6 mL of the template library solution (125 nmol combined), 2.6 mL of 1 M MES buffer pH 6.0, 5.2 mL of 5 M NaCl solution, DTS reagents (1.024 mL), sulfo-NHS solution (85 mg of 1 mL of water) and 2.076 mL of water (to bring the overall volume to 26 mL). The solutions were heated to 55 C. in a Southwest Science SH1002 digital dry bath for 1 h and then cooled in another identical dry bath at 30 C. over 1 h. EDC (100 mg) solution in 500 L of water was added, and the reaction was left at 30 C. for 3 hours. 130 L of acetic anhydride (1 L per 200 L) was added to each conical. After 2 h at 30 C., each batch was mixed with 6.5 mL (25% v/v) of 1 M NaOH solution, which was quenched with the same volume (6.5 mL) of 3 M NaOAc buffer pH 5.2. The reaction was poured into 800 mL of buffer UM (see General Methods) and passed through 14 HiBind DNA Midi columns (Omega Bio-tek). Each column was washed with 31 mL of Omega DNA Wash buffer (or Buffer PE, or 4:1 mixture of ethanol with 10 mM Tris-HCl pH 7.5) and centrifuged at 3,000 g for 10 minutes. After hydration with 1 mL of water for 10 min, the columns were centrifuged again at 3,000 g for 10 minutes. Combined eluates (11.9 mL) were split between two 50 mL conical tubes. The second DTS step was conducted in an identical manner (keep in mind different volumes).
[0297] For the third step, the combined spin-column eluates (11.9 mL) were split between two 50-mL conical tubes. Each of two tubes was charged with 2.6 mL of 1 M MES buffer pH 6.0, 5.2 mL of 5 M NaCl solution, DTS reagents (0.64 mL), sulfo-NHS solution (85 mg of 1 mL of water) and 10.11 mL of water (to bring the overall volume to 26 mL). The solutions were heated to 55 C. in a Southwest Science SH1002 digital dry bath for 1 h and then cooled in another identical dry bath at 37 C. over 1 h. EDC (100 mg) solution in 500 L of water was added, and the reaction was left at 37 C. for 3 hours. The solution in each conical was diluted just with 25 mL of isopropanol and passed through 14 HiBind DNA Midi columns (Omega Bio-tek). Each column was washed with 31 mL of Omega DNA Wash buffer (or Buffer PE, or 4:1 mixture of ethanol with 10 mM Tris-HCl pH 7.5) and centrifuged at 3,000 g for 10 minutes. After hydration with 1 mL of water for 10 min, the columns were centrifuged again at 3,000 g for 10 minutes. Combined eluates were concentrated to 900 L (combined) in four 10K Amicon Ultra 0.5 mL regenerated cellulose filter units.
[0298] 360 L of formamide containing GelPilot dye (Qiagen) was added. The sample was loaded on two 10% TBE-Urea gels without heating (35 L/well, 0.5 TBE, 200V, run until xylene cyanol band was 0.5 cm away from the end of the gel). The upper band of each of the two gels was cut out, split between four 0.5 mL tubes and centrifuged down into 2-mL tubes through 27-gauge holes. 1 mL of 10 mM phosphate buffer pH 7 was added to each tube, followed by rotation at 4 C. in the absence of light for 15 hours (important: extraction at room temperature leads to some degree of product decomposition). The gel was centrifuged down to separate the supernatant. Each gel residue was washed with 21 mL of cold 10 mM phosphate buffer (all solutions from this point on were kept on ice). Combined solutions were filtered through a 50-mL tube sterile filtration unit and the membrane was washed with ample amount of the buffer to give 36 mL of the filtrate.
[0299] 150 mL of saturated GuHCl and 225 mL of isopropanol were added and the resulting solution was passed through a single Omega HiBind Midi column, which was then washed with 3 mL of Omega DNA Wash Buffer, centrifuged for 10 min at 3,200 rcf, hydrated for 10 min with 10 mM phosphate buffer pH 7.4 and centrifuged again for 10 min at 3200 rcf. Eppendorf DNA Lobind tubes were used from this point on.
[0300] The solution was diluted with 0.15 L of water to 1 mL and split into two portions. Each portion was mixed with 500 L of 100 mM sodium periodate in 1 M NaOAc pH 3.5. After 5 minutes, the combined reaction mixture was passed through four Nap-5 columns (GE Life Sciences) equilibrated in water (loading in 500 L, elution with 1 mL of water). 111 L of 1 M HEPES pH 8.5 was added to each of the four eluates, and the reactions were left for 4 hours at room temperature in the absence of light. Combined solutions were mixed with 16 mL of saturated GuHCl and 24 mL of isopropanol and passed through an Omega HiBind Midi column, which was washed with 3 mL of Omega DNA wash buffer, centrifuged for 10 min at 3,200 rcf, hydrated with 1 mL of water for 10 min and centrifuged again for 10 min at 3,200 rcf. The eluate was concentrated in a 10K Amicon filter unit to 100 L. 50 L of formamide/GelPilot dye solution was added and the sample was loaded without heating on a 5% TBE-Urea gel (5 wells), 200 V, room temperature. The gel was run until bromophenol blue was at the very end of the gel. The lower band was cut out, split between two 0.5 mL microcentrifuge tubes and centrifuged down to 2 mL tubes through a 27-gauge orifice (20,000 rcf). The gel was subject to three dry ice freeze-thaw cycles, then 1 mL of 1 TE pH 7.5 was added and the product was extracted with rotation at room temperature in the absence of light for 24 h. The supernatant was separated, and filtered through a 0.22 um frit. The gel was extracted again in the same manner. The extracts (6 mL) were combined in two 50 conicals. Each half was mixed with 15 mL of sat. GuHCl and 22.5 mL of IPA and the combined solution was passed through a single Omega HiBind Midi column, which was washed with 5 mL of Omega DNA wash buffer, centrifuged at 3,200 rcf for 10 min, hydrated with 1 mL of 10 mM phosphate buffer pH 7.4 for 10 min and centrifuged again at 3,200 rcf for 10 min. After determination of the concentration the solution was aliquoted in 60 pmol portions and stored at 80 C.
Library Characterization
[0301] MALDI analysis of DTS-prepared macrocycles. 100 L of 1 M sample of the library in water was mixed with 5 L of 1 M ammonium acetate pH 4.5, 200 units of S1 nuclease (Thermo, in 2 L) and was incubated at 37 C. for 30 min. The sample was lyophilized, redissolved in 0.1% formic acid solution and desalted with a Millipore ZipTip (the tip was washed with 210 L of 0.1% TFA in 50% aqueous acetonitrile, then 210 L of 0.1% aqueous formic acid, the sample was loaded with multiple cycles of aspiration/dispensing followed by elution into 3 L of 0.1% TFA in 50% aqueous acetonitrile with multiple cycles of aspiration/dispensing). 0.5 L of the sample was mixed with 0.5 L of CHCA matrix/0.1% TFA in 50% aqueous acetonitrile, dried on a MALDI plate and analyzed in a standard negative mode on a ultrafleXtreme MALDI-TOF/TOF Mass Spectrometer (Bruker) with 60-80% laser power.
Selections and High-Throughput Sequencing
General Procedure for Selections and High-Throughput Sequencing
[0302] Eppendorf LoBind microcentrifuge tubes (1.5 mL, 022431021) and MagJet magnetic rack (ThermoFisher, MR02) were used for all the operations with magnetic beads. All solutions were cooled to 0 C. All incubations were conducted via sideways rotation on a tiltable tube rotator, so that the top of the microcentrifuge tube never touches the solution). For the bead washing/elution steps, after each removal of the supernatant on the magnetic rack the beads were resuspended in the next portion of washing/eluting solution and transferred to a new microcentrifuge tube (to minimize contamination). All flow-throughs are usually saved and kept at 80 C.
[0303] For a His-tagged protein, 25 L of Dynabeads (His-Tag Isolation and Pulldown, 10103D) were washed with 2300 L PBST (50 mM sodium phosphate pH 8.0, 300 mM NaCl, 0.01% Tween-20, 5 mM DTT depending on whether the target needs reductive media). 5-40 g of the protein was diluted into 300 L PBST and incubated with the beads at 4 C. for 30 min. The flow-through was immediately frozen at 78 C. The beads were washed with 2200 L TBST (50 mM Tris-HCl pH 8, 150 mM NaCl, 0.05% Tween-20, 5 mM DTT) followed by a 15-minute incubation with the blocking solution at 4 C. (100 L TBST, 0.6 mg/mL yeast total RNA). The required amount of the DNA-encoded library (e.g. 20 pmol) was then incubated with the beads in 50 L TBST w/RNA for 60 min at 4 C. The flow-throughs from this point on are saved for the library regeneration. The beads are washed with 3200 TBST. Elution was accomplished by exposure of the beads to 50 L of TBST containing 300 mM imidazole (5 min). Note: whereas BSA was previously used as a blocking agent in addition to yeast RNA, it was found that conducting selections without BSA gives cleaner results. For targets prone to covalently bind macrocycles, much shorter incubation with the library (5 min) can be recommended. The eluate is directly used for qPCR with adaptor primers for HTS barcoding in order to find the maximum number of cycles within the exponential amplification range. Preparative PCR is then run with the identified number of cycles without addition of SYBR Green.
TABLE-US-00029 TABLE22 PrimersusedfortheDTSlibraryamplification Primer Primersequence5-3 Re_DTL_primer2 TGGAGTTCAGACGTGTGCTCTTCCGATCTCCCTGTA CAC(SEQIDNO:96) Fw_DTL_primer2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAG TGGGATG(SEQIDNO:97) Fw_DTL_T_primer2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGA GTGGGATG(SEQIDNO:98) Fw_DTL_CT_primer2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTG AGTGGGATG(SEQIDNO:99) FwDTL_ACT_primer2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTACT GAGTGGGATG(SEQIDNO:100) Fw_DTL_CACT_primer2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAC TGAGTGGGATG(SEQIDNO:101) Fw_DTL_TCACT_primer2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCA CTGAGTGGGATG(SEQIDNO:102)
TABLE-US-00030 TABLE 23 Reaction composition for the first post-selection qPCR amplification [Stock] M [Final] M volume (l) 2 Q5 mastermix NEB M0494L 2 1 12.5 Forward primer 10 0.5 1.25 Reverse primer 10 0.5 1.25 SYBR Green I 10 1 2.5 Water 6.5 Selection eluate 1.0 Total 25.0
[0304] The PCR reaction is then diluted with 75 L of water and 500 L of PB buffer (Qiagen, 5 M GuHCl, 30% 2-propanol) and passed through a Qiaquick spin column (1 min at 6,000 rcf).
[0305] The column was washed with 0.7 mL of Omega DNA wash buffer (or Qiagen buffer PE, 10 mM Tris-HCl pH 7.5, 80% ethanol, 1 min, 17900 rcf). After removal of the flow-through the column was centrifuged at 17,900 rcf for 1 min, hydrated with 50 L of water for 1 min, then centrifuged again for 1 min at 17,900 rcf. The resulting sample was diluted 100 times for the next amplification. The second amplification is carried out in an identical manner with standard Illumina barcoding primers.
Selections Against Insulin-Degrading Enzyme
Macrocycle Synthesis
General Procedures of Solid-Phase Macrocycle Synthesis
[0306] Boc/Alloc protecting group exchange..sup.58,59 A number of scaffold building blocks (4E,4F,4G,4I-4P,4U-4ZZ) are not commercially available in Fmoc,Alloc-protected form. Typically, 2.5-3.0 g of N-Boc,N-Fmoc amino acid were dissolved in trifluoroacetic acid (15 mL). After stirring for one hour at room temperature the solvent was removed by rotary evaporation. The resulting product was dissolved in THF and water (1:1, 200 mL) with sodium carbonate (3 eq.) at 0 C. Diallyl dicarbonate (TCI America P1277, 1.5 eq.) was added dropwise and the solution stirred for 2 hours at room temperature. THF was removed by rotary evaporation. The aqueous solution was washed with diethyl ether (100 mL), then acidified (10% HCl, 15 mL) and extracted with ethyl acetate (3100 mL). The combined organic layers were extracted with brine, dried with anhydrous sodium sulfate, and concentrated by rotary evaporation to yield the N-Alloc,N-Fmoc product as either a white solid or pale viscous oil, in 90-99% yield.
[0307] Installation of the scaffold and building blocks. Bis-(2-aminoethyl)-ether trityl resin (EMD Millipore, 0.3 mmol/g loading, typically 0.10 mmol scale per macrocycle for initial selections follow-up) was placed into a peptide synthesis vessel and swollen in 5 mL of dry DMF for 30 m. Constant bubbling of dry nitrogen was maintained throughout the synthesis. In a separate flask, scaffold building block D (Fmoc,Alloc-protected, 5 equiv.) and 2-(1H-7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyl uronium hexafluorophosphate (HATU, 4.75 equiv.) were dissolved in anhydrous DMF (4 mL) followed by the addition of N,N-diisopropylethylamine (DIPEA, 10 equiv.). After 5 min at room temperature the resulting solution was combined with the pre-swollen resin and mixed with nitrogen bubbling for 30-60 min. The vessel was then eluted and the resin washed three times with N-methyl-2-pyrrolidone (NMP, 10 vol. each time). Following each coupling step, Fmoc deprotection was effected with 20% piperidine in NMP (10 vol.) for 5 min, repeated three times, followed by washing three times with NMP (10 vol.) and twice with DMF (10 vol.).
[0308] The general procedure for amide coupling of building blocks A, B and C involved treatment of the resin with DMF solutions of HATU-activated N-Fmoc amino acids (5 equiv.) at room temperature for 30-60 minutes, mixing with dry nitrogen bubbling. The general procedure for HATU-activation is treating a solution of N-Fmoc amino acid (5 equiv.) and HATU (4.75 equiv.) in anhydrous DMF (10 vol.) with DIPEA (10 equiv.) for 5 min at room temperature. For cis-alkene macrocycles, the Fmoc group is not cleaved immediately after C-amino acid coupling. If both cis- and trans-isomers are synthesized, the resin is split in two halves at this point.
[0309] Trans-alkene (fumarate) installation. Following the final Fmoc deprotection procedure, the -amine of building block C is coupled with allyl fumarate monoester (10 equiv.) using activation conditions as previously described with HATU (9.5 equiv.) and DIPEA (20 equiv.) in anhydrous DMF (10 vol.). N-hydroxysuccinimide (NHS) (10 equiv.) may also be added to this coupling. Allyl fumarate coupling is accomplished by 1 hr mixing with dry nitrogen bubbling, followed by washing five times with NMP (10 vol.) and three times with CHCl.sub.3 (10 vol.).
[0310] Allyl deprotections for cis and trans macrocycles. Simultaneous allyl ester and N-allyloxycarbonyl group cleavage were effected with three consecutive treatments with a solution of tetrakis(triphenylphosphine)palladium(0) (0.5 equiv. per allyl/alloc group) dissolved in degassed CHCl.sub.3 containing acetic acid and N-methylmorpholine (40:2:1 ratio, 20 vol.), mixing by nitrogen bubbling for 1 hour. The resin was then washed twice with 20 vol. of 5% DIPEA in DMF, twice with a 5% solution of sodium diethyldithiocarbamate trihydrate in DMF (20 vol.), twice with a 5% solution of hydroxybenzotriazole monohydrate in DMF, and finally washed with 50% CH.sub.2Cl.sub.2 in DMF and re-equilibrated with anhydrous DMF (10 vol.).
[0311] Cis-alkene (maleic anhydride) coupling. Maleic anhydride (10 equiv.) was mixed with DIPEA (20 eq) in DMF and added to the Alloc-deprotected resin to couple to the side-chain amine of the scaffold (D) amino acid. After 1 hour, the resin is washed with DMF three times. The C-amino acid Fmoc group was then removed using 1% DBU in DMF (1,8-diazabicyclo[5.4.0]undec-7-ene), three washes of 1 min (it is necessary to use a non-nucleophilic base at this step, to prevent coupling to the free acid). The resin was then washed three times with 20% DIPEA/DMF for salt exchange.
[0312] Cyclization. The resin was treated with pentafluorophenyl diphenylphosphinate (FDPP, 5 equiv.) and DIPEA (10 equiv.) in anhydrous DMF (10 vol.), mixing by nitrogen bubbling (3 hrsovernight). The resin was then washed with NMP (20 vol.), CH.sub.2Cl.sub.2 (20 vol.) and dried.
[0313] Cleavage. The macrocyclized product was cleaved from the resin by two 5-minute treatments of the macrocycle-bound resin with 95% TFA containing 2.5% water and 2.5% triisopropylsilane (20 vol.), followed by TFA washes (5 vol.) until the solvent runs clear (2-4 washes). The TFA solution was dried on a rotary evaporator, and the peptide was precipitated into cold (80 C.), dry Et.sub.2O. The ethereal supernatant as decanted, the remaining solid dried and dissolved in a minimum volume of 3:1 DMF-water prior (1 mL) to filtration and purification. HPLC purification was performed on an Agilent 1260 Infinity LC system with a C18 column (Kinetex, 15030 mm, 5 m particle, 100 pore size) using a gradient of 10-60% acetonitrile/water (0.1% TFA) over 27 minutes (15 mL/min). Fractions containing the desired macrocyclic peptide were freeze-dried to produce a white powder. Typical yields were 5-10% based on theoretical resin loading.
IDE Selection Hits
[0314]
TABLE-US-00031 TABLE 5 High-resolution mass spectrometry data for the prepared macrocycles. compound calculated observed cis-DJPM 836.4341 836.4372 trans-DJPM 836.4341 836.4372 trans-DJPM-amide 749.3657 749.3664 cis-DJPR 760.4028 760.4054 trans-DJPR 760.4028 760.4O67 trans-DJLysM 806.4236 806.4258 cis-DJQR 772.4028 772.4033 trans-DJQR 772.4028 772.4058 cis-DJIR 904.4215 904.4231 trans-DJIR 904.4215 904.4254 cis-CODVV 785.3981 785.3973 trans-CODVV 785.3981 785.4003 cis-DJPI 836.4341 836.4368 trans-DJPI 836.4341 836.4356
[0315] trans-DJPM (IDE IC.sub.50=50 nM)
[0316] ESI-Tof HRMS calculated for [MH].sup.+836.4341, found 836.4372. .sup.1H NMR (500 MHz, DMSO-d.sub.6) 8.85 (d, J=5.0 Hz, 1H), 8.42 (d, J=7.3 Hz, 1H), 8.22 (t, J=6.0 Hz, 1H), 8.04-7.89 (m, 2H), 7.89-7.75 (m, 4H), 7.75-7.60 (m, 5H), 7.56 (t, J=8.0 Hz, 2H), 7.47 (d, J=7.1 Hz, 2H), 7.24 (t, J=7.4 Hz, 1H), 7.17 (t, J=8.6 Hz, 2H), 6.92 (d, J=15.5 Hz, 1H), 6.89-6.79 (m, 1H), 6.67 (d, J=15.5 Hz, 1H), 4.47-3.74 (m+water signal), 3.59 (t, J=5.1 Hz, 2H), 3.48 (t, J=6.0 Hz, 2H), 3.39-3.23 (m, 2H), 3.23-3.07 (m, 2H), 3.07-2.87 (m, 3H), 1.73-1.44 (m, 5H), 1.34 (d, J=7.3 Hz, 4H)..sup.13C NMR (126 MHz, DMSO-d.sub.6) 195.85, 172.69, 172.52, 171.73, 170.65, 166.54, 164.68, 144.37, 139.41, 139.11, 137.73, 135.38, 133.39, 132.93, 132.29, 130.20, 130.14, 129.87, 129.64, 128.97, 128.56, 128.03, 127.28, 69.30, 66.75, 56.90, 55.72, 51.42, 50.53, 43.48, 40.46, 40.29, 40.12, 39.96, 39.79, 39.62, 39.46, 39.16, 38.90, 38.15, 37.47, 34.84, 33.88, 33.41, 32.01, 26.42, 26.10, 25.94, 17.38.
[0317] cis-DJIR (IDE IC.sub.50=40 nM)
[0318] ESI-Tof HRMS calculated for [MH].sup.+836.4341, found 836.4368. .sup.1H NMR (500 MHz, DMSO-d.sub.6) 8.87 (d, J=8.3 Hz, 1H), 8.46 (d, J=8.7 Hz, 1H), 8.41-8.30 (m, 1H), 7.90 (d, J=8.1 Hz, 1H), 7.86 (d, J=8.6 Hz, 1H), 7.81-7.61 (m, 8H), 7.61-7.50 (m, 2H), 7.49-7.42 (m, 1H), 7.40 (d, J=8.0 Hz, 2H), 6.29 (d, J=12.0 Hz, 1H), 6.08 (d, J=12.0 Hz, 1H), 4.71-4.60 (m, 1H), 4.60-4.48 (m, 1H), 4.36-4.22 (m, 2H), 3.9-1.3 (mm, 27H+water signal). .sup.13C NMR (126 MHz, DMSO-d.sub.6) 195.91, 172.15, 171.67, 170.96, 170.56, 166.90, 164.79, 164.79, 158.71 (q, J=32.3 Hz, trifluoroacetate), 143.90, 137.8-137.6 (m), 137.26, 135.41, 135.32, 133.52, 132.97, 132.68, 131.78, 130.22, 130.04, 129.94, 129.90, 129.85, 129.31, 129.0-128.9 (m), 128.34, 127.99, 127.75, 127.36, 126.5-126.2 (m), 126.13, 123.95, (118.49, 116.12-part of trifluoroacetate q), 69.25, 66.79, 53.83, 53.23, 50.72, 50.41, 39.09, 38.74, 36.67, 34.60, 33.81, 33.63, 32.69, 32.07, 31.04, 26.45, 26.10, 25.90.
TABLE-US-00032 TABLE 6 Sources of scaffold amino acids for solid-phase macrocycle synthesis. code amino acid CAS number Chem-Impex # A L-Dap-s Fmoc-L-Dap(Alloc)-OH 188970-92-5 04973 B L-Dab-s Fmoc-L-Dab(Alloc)-OH 204316-32-5 04964 C L-Orn-s Fmoc-L-Orn(Alloc)-OH 147290-11-7 04994 D L-Lys-s Fmoc-L-Lys(Alloc)-OH 146982-27-6 03616 E L-Dap-a Boc-L-Dap(Fmoc)-OH 122235-70-5 06305 F L-Dab-a Boc-L-Dab(Fmoc)-OH 117106-21-5 04963 G L-Orn-a Boc-L-Orn(Fmoc)-OH 150828-96-9 02719 H L-Lys-a Aloc-L-Lys(Fmoc)-OH 186350-56-1 14363 I L-o-NHCH.sub.2-Phe-s Fmoc-2-(Boc-aminomethyl)-L- 1217808-42-8 16861 Phe-OH J L-m-NHCH.sub.2-Phe- Fmoc-3-(Boc-aminomethyl)-L- 266999-24-0 16862 s Phe-OH K L-p-NHCH.sub.2-Phe-s Fmoc-4-(Boc-aminomethyl)-L- 204715-91-3 07408 Phe-OH L L-o-NHCH.sub.2-Phe-a Boc-2-(Fmoc-aminomethyl)-L- 959573-16-1 16857 Phe-OH M L-m-NHCH.sub.2-Phe- Boc-3-(Fmoc-aminomethyl)-L- 959573-13-8 16858 a Phe-OH N L-p-NHCH.sub.2-Phe-a Boc-4-(Fmoc-aminomethyl)-L- 170157-61-6 07406 Phe-OH O S,S-NH.sub.2-Pro Fmoc-ABPC(2S,4S)-OH 174148-03-9 04942 P S,R-NH.sub.2-Pro Fmoc-ABPC(2S,4R)-OH 176486-63-8 04941 Q D-Dap-s Fmoc-D-Dap(Alloc)-OH 178924-05-5 12403 R D-Dab-s Fmoc-D-Dab(Alloc)-OH 387824-78-4 12402 S D-Orn-s Fmoc-D-Orn(Alloc)-OH 214750-74-0 05704 T D-Lys-s Fmoc-D-Lys(Alloc)-OH 214750-75-1 05702 U D-Dap-a Boc-D-Dap(Fmoc)-OH 131570-56-4 06304 V D-Dab-a Boc-D-Dab(Fmoc)-OH 131570-57-5 06297 W D-Orn-a Boc-D-Orn(Fmoc)-OH 163336-15-0 05511 X D-Lys-a Boc-D-Lys(Fmoc)-OH 115186-31-7 05505 Y D-o-NHCH.sub.2-Phe-s Fmoc-2-(Boc-aminomethyl)-D- 1217729-44-6 16863 Phe-OH Z D-m-NHCH.sub.2-Phe-s Fmoc-3-(Boc-aminomethyl)-D- 1217665-54-7 16864 Phe-OH UU D-p-NHCH.sub.2-Phe-s Fmoc-4-(Boc-aminomethyl)-D- 268731-06-2 07409 Phe-OH VV D-o-NHCH.sub.2-Phe-a Boc-2-(Fmoc-aminomethyl)-D- 1212895-19-6 16859 Phe-OH WW D-m-NHCH.sub.2-Phe-a Boc-3-(Fmoc-aminomethyl)-D- 1213080-68-2 16860 Phe-OH XX D-p-NHCH.sub.2-Phe-a Boc-4-(Fmoc-aminomethyl)-D- 215302-77-5 07407 Phe-OH YY R,S-NH.sub.2-Pro (2R,4S)-Fmoc-4-amino-1-Boc- 1018332-23-4 29662 pyrrolidine-2-carboxylic acid ZZ R,R-NH.sub.2-Pro (2R,4R)-Fmoc-4-amino-1-Boc- 1018332-24-5 29661 pyrrolidine-2-carboxylic acid
Biological Activity Assays
[0319] IDE Assays with Fluorogenic Decapeptide Substrate.
[0320] Recombinant human N-His.sub.6-IDE.sub.42-1019 (R&D Systems) was assayed using the fluorophore/quencher-tagged peptide substrate Mca-RPPGFSAFK(Dnp)-OH (R&D) according to the manufacturer's instructions and using the recommended buffer 50 mM Tris, pH 7.5, 1 M NaCl (fluorophore Mca=(7-methoxycounnarin-4-yl)acetyl and quencher Dnp=2,4-dinitrophenyl). The enzyme mixture (48 L) was transferred to a 96-well plate and combined with 2 L of inhibitor in DMSO solutions, as 3-fold dilution series. The mixtures were allowed to equilibrate for 5 minutes and the enzymatic reaction was started by addition of substrate peptide in assay buffer (50 L), immediately mixed by orbital shaking, and monitored on a fluorescence plate reader (excitation at 320 nm, emission at 405 nm). Concentration-dependent IDE inhibition profiles were obtained in triplicate for DJPM and DJIR analogs, and in duplicate for less active hits. Inhibitor 6bK was used as a positive control in each assay, and error bars correspond to the standard error.
Regeneration of DNA-Encoded and DNA-Templated Libraries
[0321] Regeneration of DNA-encoded libraries can be achieved by using Buffer UM (vide supra). See
[0322] Note: the precise yield of the regeneration protocol is higher than the apparent one, since the initial flow-throughs did not contain 100% of the library used for each selection.
Computer Scripts
[0323] All the computer programs developed for this project were written and executed in the Visual Basic for Applications framework (Microsoft).
Generation of Electronic Databases of Compounds
[0324] The sequence for generation of a ChemFinder library of macrocycles is as follows: [0325] 1) VBA generation of sdf files (sub sdf_file_generator) in MS Excel. [0326] 2) Saving of each spreadsheet as an individual sdf file (tab-delimited text). [0327] 3) Creation of ChemDraw nicknames for building blocks (1A to 4ZZ). [0328] 4) Opening and saving of each sdf file in CambridgeSoft ChemDraw (works well in no later than v.14). [0329] 5) Processing of each sdf file with the script which restores names of macrocycles. [0330] 6) Import of the files to ChemFinder (works well in no later than v.14). A MolfileName field has to be created before import. [0331] 7) Automatic cleanup of imported structures: call a .cfs file with a four-line script: [0332] LOOP [0333] RECORD NEXT [0334] CLEAN DENOVO [0335] ENDLOOP [0336] 8) Calculation & export of parameters to a spreadsheet
Generation of SDF Files:
[0337] Sub sdf_file_generator( )
by Usanov
[0338] For dd=1 To 16 Two files are generated for each scaffold codons, each defined by variables dd and ch. Each file is written in a new Excel spreadsheet and is supposed to be manually saved with .sdf extension thereafter. Only first 16 scaffolds were used for bulk calculation of parameters (the other half contains epimeric analogues, which are identical to the first half for these calculations)
For ch=1 To 2
n=0 Line #
If ch=1 Then iii=1 definition of which half of codons 3 is included in a given spreadsheet.
If ch=1 Then jjj=10
If ch=2 Then iii=11
If ch=2 Then jjj=20
If dd=1 Then ddd=4A
If dd=2 Then ddd=4B
[and so on-fill the lines]
If dd=26 Then ddd=4Z
If dd=27 Then ddd=4UU
If dd=28 Then ddd=4VV
If dd=29 Then ddd=4WW
If dd=30 Then ddd=4XX
If dd=31 Then ddd=4YY
If dd=32 Then ddd=4ZZ
Sheets.Add after:=Sheets(Sheets.Count)
Sheets(ActiveSheet.Name).Name=Mid(ddd, 2, 2) & ch
[0339] For aa=1 To 20
For bb=1 To 20
For cc=iii To jjj
If aa=1 Then aaa=1A
If aa=2 Then aaa=1B
[and so on-fill the lines]
If aa=20 Then aaa=1T
If bb=1 Then bbb=2A
If bb=2 Then bbb=2B
[and so on-fill the lines]
If bb=20 Then bbb=2T
If cc=1 Then ccc=3A
If cc=2 Then ccc=3B
[and so on-fill the lines]
If cc=20 Then ccc=3T
writing the SDF code
n=n+1
ActiveSheet.Range(a & n).Value=aaa & - & bbb & - & ccc & - & ddd
[0340] n=n+1
ActiveSheet.Range(a & n).Value=name
[0341] n=n+2
ActiveSheet.Range(a & n).Value=10 10 0 0 0 0 0 0 0 0999 V2000
[0342] n=n+1
ActiveSheet.Range(a& n).Value=1.4475 0.1141 0.0000 C 0 0 0 0 0 0 0 0 0 0 0 0
[0343] n=n+1
ActiveSheet.Range(a & n).Value=1.46810.5871 0.0000 C 0 0 0 0 0 0 0 0 0 0
[0344] n=n+1
ActiveSheet.Range(a& n).Value=0.7875 0.6504 0.0000 C 0 0 0 0 0 0 0 0 0 0 0 0
[0345] n=n+1
ActiveSheet.Range(a & n).Value=0.7296 1.2544 0.0000 0 0 0 0 0 0 0 0 0 0 0 0 0
[0346] n=n+1
ActiveSheet.Range(a & n).Value=0.0953 0.4294 0.0000 & ccc & 0 0 0 0 0 0 0 0 0 0 0 0
[0347] n=n+1
ActiveSheet.Range(a & n).Value=2.12811.0409 0.0000 C 0 0 0 0 0 0 0 0 0 0
[0348] n=n+1
ActiveSheet.Range(a& n).Value=2.92501.2544 0.0000 O 0 0 0 0 0 0 0 0 0 0 0 0
[0349] n=n+1
ActiveSheet.Range(a & n).Value=1.9969 0.6504 0.0000 & bbb & 0 0 0 0 0 0 0 0 0 0
[0350] n=n+1
ActiveSheet.Range(a & n).Value=0.30561.1027 0.0000 & ddd & 0 0 0 0 0 0 0 0 0 0 0 0
[0351] n=n+1
ActiveSheet.Range(a & n).Value=2.92500.8140 0.0000 & aaa & 0 0 0 0 0 0 0 0 0 0 0 0
[0352] n=n+1
ActiveSheet.Range(a & n).Value=1 2 2 0
[0353] n=n+1
ActiveSheet.Range(a & n).Value=1 3 1 0
[0354] n=n+1
ActiveSheet.Range(a & n).Value=3 4 2 0
[0355] n=n+1
ActiveSheet.Range(a & n).Value=3 5 1 0
[0356] n=n+1
ActiveSheet.Range(a & n).Value=2 6 1 0
[0357] n=n+1
ActiveSheet.Range(a & n).Value=6 7 2 0
[0358] n=n+1
ActiveSheet.Range(a & n).Value=6 9 1 0
[0359] n=n+1
ActiveSheet.Range(a & n).Value=5 8 1 0
[0360] n=n+1
ActiveSheet.Range(a & n).Value=8 10 1 0
[0361] n=n+1
ActiveSheet.Range(a & n).Value=10 9 1 0
[0362] n=n+1
ActiveSheet.Range(a & n).Value=M END
[0363] n=n+1
ActiveSheet.Range(a & n).Value=$$$$
Next cc
Next bb
Next aa
Next ch
Next dd
End Sub
Restoring Names in the SDF File:
Sub InsertMacrocycleName( )
by Usanov
[0364] nachalo=1 line # of the file, beginning of each sdf file record
Dim per(4) macrocycle building blocks, extracted in random order
Dim perr(4) renumbered building blocks in the right order
Do
[0365] If ActiveSheet.Range(a & nachalo).Value= Then Exit Sub checks if the end of the file is reached
aa=nachalo current cell no, the beginning line # of the record
x=1 to be used with per( )
cc=0 exit while auxiliary variable
Do While cc=0 scans each record for lines containing information of the library member building blocks
curr=ActiveSheet.Range(a & aa).Value
If curr=$$$$ Then cc=1 exits loop if the end of a record is reached
If InStr(1, curr, SMT)< >0 Then per(x)=Right(curr, 3) extraction of building block names, not ordered in any record
If InStr(1, curr, SMT)< >0 Then x=x+1
aa=aa+1
Loop
[0366] konec=aa-1 the end line # of the record
For k=1 To 4 trimming the macrocycle elements
per(k)=Replace(per(k), {circumflex over ()}, )
per(k)=Replace(per(k), ,
Next k
[0367] For k=1 To 4 reordering and reformatting building blocks
If InStr(1, per(k), 1)< >0 Then per(k)=Mid(per(k), InStr(1, per(k), 1), Len(per(k))-InStr(1, per(k), 1)+1)
If InStr(1, per(k), 1)< >0 Then perr(1)=per(k)
If InStr(1, per(k), 2)< >0 Then per(k)=Mid(per(k), InStr(1, per(k), 2), Len(per(k))-InStr(1, per(k), 2)+1)
If InStr(1, per(k), 2)< >0 Then perr(2)=per(k)
If InStr(1, per(k), 3)< >0 Then per(k)=Mid(per(k), InStr(1, per(k), 3), Len(per(k))-InStr(1, per(k), 3)+1)
If InStr(1, per(k), 3)< >0 Then perr(3)=per(k)
If InStr(1, per(k), 4)< >0 Then per(k)=Mid(per(k), InStr(1, per(k), 4), Len(per(k))-InStr(1, per(k), 4)+1)
If InStr(1, per(k), 4)< >0 Then perr(4)=per(k)
Next k
[0368] ActiveSheet.Range(a & nachalo).Value=perr(1) & perr(2) & perr(3) & perr(4) name in the right format
nachalo=konec+1 beginning line for the next record
For k=1 To 4 clearing variables
per(k)=
perr(k)=
Next k
Loop
End Sub
Analysis of Selections
[0369] The array and auxiliary variable are declared as follows:
Dim r(256000) As Double an array of values where values correspond to the number of counts and each index reflext a unique number assigned to each macrocycle (vide infra) Dim ReadData As String
For each of the files the initial fastq file is split in, the following subroutine:
Do Until EOF(1)
Line Input #1, ReadData
[0370] pp=WTMrev(ReadData) checking the reverse (complementary) sequence
If pp< >0 And pp< > Then r(pp)=r(pp)+1 r(pp)
If pp=0 Or pp= Then qq=WTMforw(ReadData) checking the direct sequence
If pp=0 And qq< >0 And qq< > Then r(qq)=r(qq)+1
If pp= And qq< >0 And qq< > Then r(qq)=r(qq)+1
Loop
Close #1
[0371] Called Functions are defined as follows:
Function WTMrev(f As String) As String checking the reverse (complementary) sequence the selection is very stringent, only perfect sequences are counted, no mutations allowed
RP=InStr(1, f, GAGTGGGATG(SEQ ID NO: 103))
If RP=0 Then Exit Function
[0372] ff=Mid(f, RP, 55)
RP=1
LP=InStr(1, ff, GTGTACAGGG (SEQ ID NO: 104))
If LP=0 Then Exit Function
[0373] const1=InStr(1, ff, AACTT)
If const1=0 Then Exit Function
const2=InStr(1, ff, ATCAT)
If const2=0 Then Exit Function
const3=InStr(1, ff, TAG)
If const3=0 Then Exit Function
codon3=Mid(ff, const1+5, 6)
If codon3=TCCGAT Then sc3=1
If codon3=TGCACA Then sc3=2
[and so on-fill the lines]
If codon3=ACAAGG Then sc3=20
If sc3=0 Then Exit Function
codon2=Mid(ff, const2+5, 6)
If codon2=TTCAGC Then sc2=1
If codon2=ATCGAC Then sc2=2
[and so on-fill the lines]
If codon2=AGCTTC Then sc2=20
If sc2=0 Then Exit Function
codon1=Mid(ff, RP+17, 6)
If codon1=AAAGCC Then sc1=1
If codon1=AAGCCT Then sc1=2
[and so on-fill the lines]
If codon1=TGAAGC Then sc1=20
If sc1=0 Then Exit Function
codon4=Mid(ff, RP+10, 4)
If codon4=TGGA Then sc4=1
If codon4=CAAC Then sc4=2
[and so on-fill the lines]
If codon4=TATC Then sc4=25
If codon4=AACC Then sc4=26
If codon4=TCAC Then sc4=27
If codon4=CACA Then sc4=28
If codon4=CATT Then sc4=29
If codon4=ACTT Then sc4=30
If codon4=TATT Then sc4=31
If codon4=TCTT Then sc4=32
If sc4=0 Then Exit Function
WTMrev=8000*(sc4-1)+400*(sc3-1)+20*(sc2-1)+sc1 generation of the unique number # of the macrocycle
End Function
[0374] Function WTMforw(f As String) As String checking the direct sequence
LP=InStr(1, f, CCCTGTACAC(SEQ ID NO: 105))
If LP=0 Then Exit Function
[0375] ff=Mid(f, LP, 55)
LP=1
[0376] const1=InStr(1, ff, AAGTT)
If const1=0 Then Exit Function
const2=InStr(1, ff, ATGAT)
If const2=0 Then Exit Function
const3=InStr(1, ff, CTA)
If const3=0 Then Exit Function
RP=InStr(1, ff, CATCCCACTC(SEQ ID NO: 106))
If RP=0 Then Exit Function
[0377] codon3=Mid(ff, LP+10, 6)
If codon3=ATCGGA Then sc3=1
If codon3=TGTGCA Then sc3=2
[and so on-fill the lines]
If codon3=CCTTGT Then sc3=20
If sc3=0 Then Exit Function
codon2=Mid(ff, const1+5, 6)
If codon2=GCTGAA Then sc2=1
If codon2=GTCGAT Then sc2=2
[and so on-fill the lines]
If codon2=GAAGCT Then sc2=20
If sc2=0 Then Exit Function
codon1=Mid(ff, const2+5, 6)
If codon1=GGCTTT Then sc1=1
If codon1=AGGCTT Then sc1=2
[and so on-fill the lines]
If codon1=GCTTCA Then sc1=20
If sc1=0 Then Exit Function
codon4=Mid(ff, RP-4, 4)
If codon4=TCCA Then sc4=1
If codon4=GTTG Then sc4=2
[and so on-fill the lines]
If codon4=GATA Then sc4=25
If codon4=GGTT Then sc4=26
If codon4=GTGA Then sc4=27
If codon4=TGTG Then sc4=28
If codon4=AATG Then sc4=29
If codon4=AAGT Then sc4=30
If codon4=AATA Then sc4=31
If codon4=AAGA Then sc4=32
If sc4=0 Then Exit Function
WTMforw=8000*(sc4-1)+400*(sc3-1)+20*(sc2-1)+sc1 generation of the unique number # of the macrocycle
End Function
[0378] The results are then exported to a .csv file:
Open fpathway & fname & .csv For Output As #
For n=1 To 256000
Print #7, r(n)
Next n
Close #7
REFERENCES
[0379] 1. Hser, J., Mannhold, R., Kubinyi, H. & Folkers, G. High-throughput screening in drug discovery. (Wiley, 2006). [0380] 2. Macarron, R. et al. Impact of high-throughput screening in biomedical research. Nat. Rev. Drug Discov. 10, 188-195 (2011). [0381] 3. Dandapani, S. & Marcaurelle, L. A. Grand Challenge commentary: accessing new chemical space for undruggable targets. Nat. Chem. Biol. 6, 861-863 (2010). [0382] 4. Brenner, S. & Lerner, R. A. Encoded combinatorial chemistry. Proc. Nat. Acad. Sci. U.S.A. 89, 5381-5383 (1992). [0383] 5. Gartner, Z. J. & Liu, D. R. The generality of DNA-templated synthesis as a basis for evolving non-natural small molecules. J. Am. Chem. Soc. 123, 6961-6963 (2001). [0384] 6. Gartner, Z. J. et al. DNA-templated organic synthesis and selection of a library of macrocycles. Science 305, 1601-1605 (2004). [0385] 7. Zimmermann, G. & Neri, D. DNA-encoded chemical libraries: foundations and applications in lead discovery. Drug Discov. Today 21, 1828-1834 (2016). [0386] 8. Goodnow, R. A. A handbook for DNA-encoded chemistry: theory and applications for exploring chemical space and drug discovery. (Wiley, 2014). [0387] 9. Franzini, R. M., Neri, D. & Scheuermann, J. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries. Acc. Chem. Res. 47, 1247-1255 (2014). [0388] 10. Krall, N., Scheuermann, J. & Neri, D. Small targeted cytotoxics: current state and promises from DNA-encoded chemical libraries. Angew. Chem. Int. Ed. 52, 1384-1402 (2013). [0389] 11. Mannocci, L., Leimbacher, M., Wichert, M., Scheuermann, J. & Neri, D. 20 Years of DNA-encoded chemical libraries. Chem. Commun. 47, 12747-12753 (2011). [0390] 12. Kleiner, R. E., Dumelin, C. E. & Liu, D. R. Small-molecule discovery from DNA-encoded chemical libraries. Chem. Soc. Rev. 40, 5707-5717 (2011). [0391] 13. Scheuermann, J. & Neri, D. DNA-encoded chemical libraries: a tool for drug discovery and for chemical biology. ChemBioChem 11, 931-937 (2010). [0392] 14. Clark, M. A. Selecting chemicals: the emerging utility of DNA-encoded libraries. Curr. Opin. Chem. Biol. 14, 396-403 (2010). [0393] 15. Buller, F., Mannocci, L., Scheuermann, J. & Neri, D. Drug discovery with DNA-encoded chemical libraries. Bioconjugate Chem. 21, 1571-1580 (2010). [0394] 16. Clark, M. A. et al. Design, synthesis and selection of DNA-encoded small-molecule libraries. Nat. Chem. Biol. 5, 647-654 (2009). [0395] 17. Doyon, J. B., Snyder, T. M. & Liu, D. R. Highly Sensitive in Vitro Selections for DNA-Linked Synthetic Small Molecules with Protein Binding Affinity and Specificity. J. Am. Chem. Soc. 125, 12372-12373 (2003). [0396] 18. Scheuermann, J. & Neri, D. Dual-pharmacophore DNA-encoded chemical libraries. Curr. Opin. Chem. Biol. 26, 99-103 (2015). [0397] 19. Wrenn, S. J., Weisinger, R. M., Halpin, D. R. & Harbury, P. B. Synthetic ligands discovered by in vitro selection. J. Am. Chem. Soc. 129, 13137-13143 (2007). [0398] 20. Li, Y., Zhao, P., Zhang, M., Zhao, X. & Li, X. Multistep DNA-templated synthesis using a universal template. J. Am. Chem. Soc. 135, 17727-17730 (2013). [0399] 21. Hansen, M. H. et al. A yoctoliter-scale DNA reactor for small-molecule evolution. J. Am. Chem. Soc. 131, 1322-1327 (2009). [0400] 22. Chan, A. I., McGregor, L. M. & Liu, D. R. Novel selection methods for DNA-encoded chemical libraries. Curr. Opin. Chem. Biol. 26, 55-61 (2015). [0401] 23. Satz, A. L. DNA encoded library selections and insights provided by computational simulations. ACS Chem. Biol. 10, 2237-2245 (2015). [0402] 24. Satz, A. L. Simulated screens of DNA encoded libraries: the potential influence of chemical synthesis fidelity on interpretation of structure-activity relationships. ACS Comb. Sci. 18, 415-424 (2016). [0403] 25. Connors, W. H., Hale, S. P. & Terrett, N. K. DNA-encoded chemical libraries of macrocycles. Curr. Opin. Chem. Biol. 26, 42-47 (2015). [0404] 26. Levin, J. I. Macrocycles in drug discovery. (Royal Society of Chemistry, 2014). [0405] 27. Driggers, E. M., Hale, S. P., Lee, J. & Terrett, N. K. The exploration of macrocycles for drug discovery-an underexploited structural class. Nat. Rev. Drug. Discov. 7, 608-624 (2008). [0406] 28. Marsault, E. & Peterson, M. L. Macrocycles are great cycles: applications, opportunities, and challenges of synthetic macrocycles in drug discovery. J. Med. Chem. 54, 1961-2004 (2011). [0407] 29. White, C. J. & Yudin, A. K. Contemporary strategies for peptide macrocyclization. Nat. Chem. 3, 509-524 (2011). [0408] 30. Yudin, A. K. Macrocycles: lessons from the distant past, recent developments, and future directions. Chem. Sci. 6, 30-49 (2015). [0409] 31. Villar, E. A. et al. How proteins bind macrocycles. Nat. Chem. Biol. 10, 723-731 (2014). [0410] 32. Dougherty, P. G., Qian, Z. & Pei, D. Macrocycles as protein-protein interaction inhibitors. Biochem. J. 474, 1109 (2017). [0411] 33. Giordanetto, F. & Kihlberg, J. Macrocyclic drugs and clinical candidates: what can medicinal chemists learn from their properties? J. Med. Chem. 57, 278-295 (2014). [0412] 34. Gartner, Z. J., Kanan, M. W. & Liu, D. R. Expanding the reaction scope of DNA-templated synthesis. Angew. Chem. Int. Ed. 41, 1796-1800 (2002). [0413] 35. Gartner, Z. J., Kanan, M. W. & Liu, D. R. Multistep small-molecule synthesis programmed by DNA templates. J. Am. Chem. Soc. 124, 10304-10306 (2002). [0414] 36. Li, X. & Liu, D. R. DNA-templated organic synthesis: Nature's strategy for controlling chemical reactivity applied to synthetic molecules. Angew. Chem. Int. Ed. 43, 4848-4870 (2004). [0415] 37. Calderone, C. T., Puckett, J. W., Gartner, Z. J. & Liu, D. R. Directing otherwise incompatible reactions in a single solution by using DNA-templated organic synthesis. Angew. Chem. Int. Ed. 41, 4104-4108 (2002). [0416] 38. Tse, B. N., Snyder, T. M., Shen, Y. & Liu, D. R. Translation of DNA into a library of 13 000 synthetic small-molecule macrocycles suitable for in vitro selection. J. Am. Chem. Soc. 130, 15611-15626 (2008). [0417] 39. Mullard, A. DNA tags help the hunt for drugs. Nature 530, 367-369 (2016). [0418] 40. Kleiner, R. E., Dumelin, C. E., Tiu, G. C., Sakurai, K. & Liu, D. R. In vitro selection of a DNA-templated small-molecule library reveals a class of macrocyclic kinase inhibitors. J. Am. Chem. Soc. 132, 11779-11791 (2010). [0419] 41. Georghiou, G., Kleiner, R. E., Pulkoski-Gross, M., Liu, D. R. & Seeliger, M. A. Highly specific, bisubstrate-competitive Src inhibitors from DNA-templated macrocycles. Nat. Chem. Biol. 8, 366-374 (2012). [0420] 42. Maianti, J. P. et al. Anti-diabetic activity of insulin-degrading enzyme inhibitors mediated by multiple hormones. Nature 511, 94-98 (2014). [0421] 43. Aleem, Saadat U. et al. Structural and Biochemical Basis for Intracellular Kinase Inhibition by Src-specific Peptidic Macrocycles. Cell Chem. Biol. 23, 1103-1112 (2016). [0422] 44. Snyder, T. M., Tse, B. N. & Liu, D. R. Effects of template sequence and secondary structure on DNA-templated reactivity. J. Am. Chem. Soc. 130, 1392-1401 (2008). [0423] 45. Lipinski, C. A., Lombardo, F., Dominy, B. W. & Feeney, P. J. Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv. Drug Deliv. Rev. 23, 3-25 (1997). [0424] 46. Veber, D. F. et al. Molecular properties that influence the oral bioavailability of drug candidates. J. Med. Chem. 45, 2615-2623 (2002). [0425] 47. Pye, C. R. et al. Nonclassical size dependence of permeation defines bounds for passive adsorption of large drug molecules. J. Med. Chem. 60, 1665-1672 (2017). [0426] 48. Bockus, A. T. et al. Probing the physicochemical boundaries of cell permeability and oral bioavailability in lipophilic macrocycles inspired by natural products. J. Med. Chem. 58, 4581-4589 (2015). [0427] 49. Hewitt, W. M. et al. Cell-permeable cyclic peptides from synthetic libraries inspired by natural products. J. Am. Chem. Soc. 137, 715-721 (2015). [0428] 50. Matsson, P. & Kihlberg, J. How big is too big for cell permeability? J. Med. Chem. 60, 1662-1664 (2017). [0429] 51. Over, B. et al. Structural and conformational determinants of macrocycle cell permeability. Nat. Chem. Biol. 12, 1065-1074 (2016). [0430] 52. Doak, B. C., Over, B., Giordanetto, F. & Kihlberg, J. Oral druggable space beyond the rule of 5: insights from drugs and clinical candidates. Chem. Biol. 21, 1115-1142 (2014). [0431] 53. Doak, B. C., Zheng, J., Dobritzsch, D. & Kihlberg, J. How beyond rule of 5 drugs and clinical candidates bind to their targets. J. Med. Chem. 59, 2312-2327 (2016). [0432] 54. Matsson, P., Doak, B. C., Over, B. & Kihlberg, J. Cell permeability beyond the rule of [0433] 5. Adv. Drug Deliv. Rev. 101, 42-61 (2016). [0434] 55. Watkins, J. N. E. & SantaLucia, J. J. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes. Nucleic Acids Res. 33, 6258-6267 (2005). [0435] 56. Irwin, J. J. et al. An Aggregation Advisor for Ligand Discovery. J. Med. Chem. 58, 7076-7087 (2015). [0436] 57. Berti, L., D'Agostino, P. S., Boeneman, K. & Medintz, I. L. Improved peptidyl linkers for self-assembly of semiconductor quantum dot bioconjugates. Nano Res. 2, 121-129 (2009). [0437] 58. Ahmed, S., Beleid, R., Sprules, T. & Kaur, K. Solid-Phase Synthesis and CD Spectroscopic Investigations of Novel -Peptides from 1-Aspartic Acid and -Amino-1-alanine. Org. Lett. 9, 25-28 (2007). [0438] 59. Demmer, O., Dijkgraaf, I., Schottelius, M., Wester, H. J. & Kessler, H. Introduction of Functional Groups into Peptides via N-Alkylation. Org. Lett. 10, 2015-2018 (2008).
EQUIVALENTS AND SCOPE
[0439] In the claims articles such as a, an, and the may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include or between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
[0440] Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the disclosure, or aspects described herein, is/are referred to as comprising particular elements and/or features, certain embodiments described herein or aspects described herein consist, or consist essentially of, such elements and/or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms comprising and containing are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments described herein, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0441] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present disclosure that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment described herein can be excluded from any claim, for any reason, whether or not related to the existence of prior art.
[0442] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present disclosure, as defined in the following claims.