Particle for the encapsidation of a genome engineering system

Abstract

The present invention relates to a retroviral particle comprising a protein derived from the Gag polyprotein, an envelope protein, optionally an integrase and at least two encapsidated non-viral RNAs, the encapsidated non-viral RNAs each comprising an RNA sequence of interest bound to an encapsidation sequence, each encapsidation sequence being recognized by a binding domain introduced into the protein derived from the Gag polyprotein and/or into the integrase, and at least one of said sequences of interest of the encapsidated non-viral RNAs comprises a part coding a nuclease.

Claims

1. A retroviral particle, comprising a protein derived from the Gag polyprotein, an envelope protein, optionally an integrase, and at least two encapsidated non-viral RNAs, the encapsidated non-viral RNAs each comprising an RNA sequence of interest bound to an encapsidation sequence, each encapsidation sequence being recognized by a heterologous binding domain introduced into the protein derived from the Gag polyprotein and/or into the integrase, in which the at least two encapsidated non-viral RNAs differ by their sequence of interest, wherein: at least one of said sequences of interest of the encapsidated non-viral RNAs comprises a part coding for a nuclease, said nuclease being chosen from the group constituted by a nuclease associated with CRISPR system; and the sequence of interest of the other encapsidated non-viral RNA corresponds to at least one recognition element of a guide RNA.

2. The retroviral particle according to claim 1, in which the nuclease is Cas9.

3. The retroviral particle according to claim 1, which further comprises at least a third encapsidated non-viral RNA having a sequence of interest corresponding to a second recognition element of a guide RNA or to an additional guide RNA.

4. The retroviral particle according to claim 1, comprising a nucleocapsid protein, an envelope protein, optionally an integrase, and at least two encapsidated non-viral RNAs, the encapsidated non-viral RNAs each comprising an RNA sequence of interest bound to an encapsidation sequence, each encapsidation sequence being recognized by a heterologous binding domain introduced into the nucleocapsid protein and/or into the integrase.

5. The retroviral particle according to claim 4, in which the heterologous binding domain is introduced into the nucleocapsid protein, and a second heterologous binding domain may be introduced into the nucleocapsid and/or into the integrase.

6. The retroviral particle according to claim 1, comprising a nucleocapsid protein, an envelope protein, optionally an integrase, and at least two encapsidated non-viral RNAs, the encapsidated non-viral RNAs each comprising an RNA sequence of interest bound to an encapsidation sequence, at least one encapsidation sequence being the stem-loop motif of the MS2 bacteriophage repeated 12 times, said stem-loop motif being recognized by the Coat protein of the MS2 bacteriophage introduced into the nucleocapsid protein.

7. The retroviral particle according to claim 6, wherein the encapsidated non-viral RNAs comprises, as encapsidation sequence, the stem-loop motif of the MS2 bacteriophage repeated 12 times is an RNA coding Cas9, and a second encapsidated non-viral RNA is an RNA corresponding to at least one recognition element of a guide RNA or coding a guide, said encapsidated non-viral RNAs comprising as encapsidation sequence the stem-loop motif of the MS2 bacteriophage repeated 2 times.

8. The retroviral particle according to claim 1, comprising a nucleocapsid protein, an envelope protein, optionally an integrase, and at least two encapsidated non-viral RNAs, the encapsidated non-viral RNAs each comprising an RNA sequence of interest bound to an encapsidation sequence, at least one encapsidation sequence being the stem-loop motif of the PP7 bacteriophage repeated 2 times, said stem-loop motif being recognized by the Coat protein of the PP7 bacteriophage introduced into the nucleocapsid protein.

9. The retroviral particle according to claim 1, in which the heterologous binding domain is introduced into the integrase, and a second heterologous binding domain may be introduced into the nucleocapsid and/or into the integrase.

10. The retroviral particle according to claim 1, which is a lentiviral particle.

11. A composition comprising the particle according to claim 1.

12. A kit for producing particles according to claim 1, comprising: (i) an expression plasmid comprising at least two different non-viral RNA sequences, each RNA sequence comprising a sequence of interest for which an encapsidation sequence is inserted upstream of, downstream of or within this sequence, or, alternatively, a first and a second expression plasmid each comprising a sequence of interest upstream or downstream of which an encapsidation sequence is inserted, at least one of these sequences of interest coding for a nuclease chosen from a group constituted by nucleases associated with CRISPR system, the other sequence of interest corresponding to at least one recognition element of a guide RNA, (ii) an encapsidation plasmid coding for a protein derived from the Gag polyprotein and/or a chimeric integrase, comprising a binding domain allowing recognition of an encapsidation sequence, and, (iii) an envelope plasmid coding for an envelope protein.

13. The kit according to claim 12, further comprising a second encapsidation plasmid coding for: a protein derived from the wild-type Gag polyprotein, when the first encapsidation plasmid codes for a protein derived from the chimeric Gag polyprotein, and/or a wild-type integrase, when the first encapsidation plasmid codes for a chimeric integrase.

14. A manufacturing method for producing the particle according to claim 1, comprising a step of co-transfection of cells with: (i) an expression plasmid comprising at least two different non-viral RNA sequences, each RNA sequence comprising a sequence of interest for which an encapsidation sequence is inserted upstream of, downstream of or within this sequence, or, alternatively, a first and a second expression plasmid each comprising a sequence of interest upstream or downstream of which an encapsidation sequence is inserted, at least one of these sequences of interest coding for a nuclease chosen from a group constituted by nucleases associated with CRISPR system, the other sequence of interest corresponding to at least one recognition element of a guide RNA, (ii) an encapsidation plasmid coding for a protein derived from the Gag polyprotein and/or a chimeric integrase comprising a binding domain allowing recognition of an encapsidation sequence, and, (iii) an envelope plasmid coding for an envelope protein; and recovery of the supernatant from the transfected cells comprising a plurality of the particle.

15. The method according to claim 14, in which the step of co-transfection is further carried out with a second encapsidation plasmid coding for: a protein derived from the wild-type Gag polyprotein, when the first encapsidation plasmid codes for a protein derived from the chimeric Gag polyprotein, and/or a wild-type integrase, when the first encapsidation plasmid codes for a chimeric integrase.

16. A composition obtained by the method according to claim 14.

17. A method for generating in cells a DNA double-strand break, a point mutation, a sequence deletion including gene knock-out, a sequence insertion or gene replacement, comprising transducing the cells with the particle according to claim 1.

Description

(1) The invention will be better understood from the examples given hereunder by way of illustration, with reference to the figures, which show respectively:

(2) FIG. 1 is a schematic diagram illustrating the expression cassette derived from the pcDNA-EF1-Cas9-MS2 12X expression plasmid comprising a DNA sequence coding the RNA of the Cas9 nuclease, in its wild-type form (WT) or in its mutated form (N);

(3) FIG. 2a illustrates the strategy for modifying the p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) for constructing a p8.74ZF-MS2-Coat;

(4) FIG. 2b is a schematic diagram of the construction of the expression cassette derived from the p8.74ZF-MS2-Coat encapsidation plasmid having the second zinc finger substituted by the Coat protein of the MS2 bacteriophage, obtained by the strategy presented in FIG. 2a;

(5) FIG. 3 is a schematic diagram of the construction of the expression cassette derived from the envelope pENV plasmid;

(6) FIG. 4 is a schematic diagram of the construction of the expression cassette derived from the pILV-EF1-Cas9-WPRE expression plasmid comprising a DNA coding the RNA sequence of the Cas9 nuclease, in its wild-type form (WT) or in its mutated form (N);

(7) FIG. 5a is a schematic diagram of the construction of the expression cassette derived from the pILV-EF1-GFP-WPRE expression plasmid comprising a DNA coding the RNA of the GFP;

(8) FIG. 5b is a schematic diagram of the construction of the expression cassette derived from the pILV-H1-GuideU3-U6-GuideD1-WPRE expression plasmid comprising a DNA coding two non-coding RNAs targeting the sequence of the GFP (sgRNA=guide RNA=Guide U3 and Guide D1 in this case);

(9) FIG. 5c is a schematic diagram of the construction of the expression cassette derived from the pILV-H1/U6-Guide-WPRE expression plasmid comprising a DNA coding a non-coding RNA targeting the sequence of the GFP (sgRNA=guide RNA=Guide);

(10) FIG. 6 is a schematic diagram of the construction of the expression cassette derived from the p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol);

(11) FIG. 7 is a schematic diagram illustrating the expression cassette derived from the pcDNA-H1-GuideD1-MS2 2X expression plasmid bearing a DNA sequence coding a non-coding guide RNA, comprising the scaffold, targeting the sequence of the GFP (sgRNA=guide RNA), in which 2 repetitions of the stem-loop motif of the MS2 RNA (SEQ ID No. 3) were inserted in the expression cassette downstream of the guide RNA;

(12) FIG. 8 is a schematic diagram illustrating the expression cassette derived from the pcDNA-H1-GuideD1Chimeric-MS2 2X expression plasmid bearing a DNA sequence coding a non-coding guide RNA targeting the sequence of the GFP (sgRNA=guide RNA), of a promoter-sequence of interest-Term expression cassette, in which 2 repetitions of the stem-loop motif of the MS2 RNA (SEQ ID No.3) are included in the scaffold part of the chimeric guide;

(13) FIG. 9 illustrates the effectiveness of an MS2 (NC)-RLP 12X particle according to the invention in delivering the RNA coding the Cas9 nuclease Nickase during the transduction of HCT119-GFP cells;

(14) FIG. 10 illustrates the impact of the position of the MS2 repeat motifs for the encapsidation of guide RNAs in MS2 (NC)-RLP 12X particles according to the invention, after the transduction of the HCT119-GFP Cas9 cells;

(15) FIG. 11 illustrates the effectiveness of production of MS2RLP particles delivering guide RNA depending on whether they are produced using a single or double quantity of the expression plasmid bearing the guide RNA for the transduction of the HCT116-GFP-Cas9 cells;

(16) FIG. 12 illustrates the effectiveness of an MS2 (NC)-RLP 12X particle according to the invention in delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas 9), in HCT116-GFP cells;

(17) FIG. 13a is a schematic diagram illustrating the expression cassette derived from the pcDNA.EF1.PPRV.TALEN 5.WPRE MS2(12X) expression plasmid comprising a DNA sequence coding the RNA of the TALEN nuclease constituted by the FokI nuclease fused with a DNA binding domain, TALE, recognizing the 5 strand of the DNA;

(18) FIG. 13b is a schematic diagram illustrating the expression cassette derived from the pcDNA.EF1.PPRV.TALEN 3.WPRE MS2(12X) expression plasmid comprising a DNA sequence coding the RNA of the TALEN nuclease constituted by the FokI nuclease fused with a DNA binding domain, TALE, recognizing the 3 strand of the DNA;

(19) FIG. 14a is a schematic diagram illustrating the expression cassette derived from the pILV.EF1.TALEN 5 expression plasmid comprising a DNA sequence coding the RNA of the TALEN nuclease constituted by the FokI nuclease fused with a DNA binding domain, TALE, recognizing the 5 strand of the DNA;

(20) FIG. 14b is a schematic diagram illustrating the expression cassette derived from the pILV.EF1.TALEN 3 expression plasmid comprising a DNA sequence coding the RNA of the TALEN nuclease constituted by the FokI nuclease fused with a DNA binding domain, TALE, recognizing the 3 strand of the DNA;

(21) FIG. 15a is a schematic diagram illustrating the expression cassette derived from the expression plasmid, pcDNA.EF1.PPRV.ZFP 5.WPRE.MS2 (12X), bearing a DNA recognition domain of the chimeric zinc finger type with the FokI nuclease for recognition of the 5 strand of DNA;

(22) FIG. 15b is a schematic diagram illustrating the expression cassette derived from the pcDNA.EF1.PPRV.ZFP 3.WPRE.MS2 (12X) expression plasmid, bearing a DNA recognition domain of the chimeric zinc finger type with the FokI nuclease for recognition of the 3 strand of DNA;

(23) FIG. 16a is a schematic diagram of the construction of the expression cassette derived from the pILV.EF1.ZFP 5 expression plasmid bearing a DNA recognition domain of the chimeric zinc finger type with the FokI nuclease for recognition of the 5 strand of DNA;

(24) FIG. 16b is a schematic diagram of the construction of the expression cassette derived from the pILV.EF1.ZFP 3 expression plasmid bearing a DNA recognition domain of the chimeric zinc finger type with the FokI nuclease for recognition of the 3 strand of DNA;

(25) FIG. 17 shows a schematic diagram of the expression cassette derived from the expression plasmid bearing, as RNA sequence of interest, Luciferase used for producing lentiviral particles PP7(NC)-RLP 12X, comprising the stem-loop motif PP7 repeated 12 times, according to the invention;

(26) FIG. 18 shows a schematic diagram of modification of the lentiviral p8.74 encapsidation plasmid in order to insert a binding domain in the sequence of the integrase;

(27) FIG. 19 shows a schematic diagram of the expression cassette derived from the encapsidation plasmid used for producing lentiviral particles PP7 (IN)-RLP according to the invention, obtained by modifying the lentiviral p8.74 encapsidation plasmid shown in FIG. VI;

(28) FIG. 20 illustrates the effectiveness of an MS2 (NC)-RLP 12X particle according to the invention in delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas 9), in HCT116-GFP cells;

(29) FIG. 21 is a schematic diagram of the construction of the expression cassette derived from the pcDNA-U6-GuideD1Chimeric-MS2 2X-Term expression plasmid comprising an RNA coding a non-coding RNA targeting the sequence of the GFP (sgRNA=guide RNA=Guide D1 in this case), dependent on the U6 promoter;

(30) FIG. 22 illustrates the effectiveness of an MS2RLP particle in delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas9) in HCT116-GFP cells, as a function of the promoter allowing transcription of the guide RNA in the producer cells;

(31) FIG. 23 is a schematic diagram of the construction of the expression cassette derived from the pcDNA-U6-Guide_antiPD1 Chimeric-MS2 2X-Term expression plasmid comprising an RNA coding a non-coding RNA targeting the PD1 gene (sgRNA=guide RNA=Guide), dependent on the U6 promoter;

(32) FIG. 24 illustrates the effectiveness of an MS2RLP particle in delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas9) into activated primary T lymphocytes, for knock-out of the PD1 gene;

(33) FIG. 25 shows the effectiveness of an ILV particle in delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas9) into activated primary T lymphocytes, for knock-out of the PD1 gene;

(34) FIG. 26 shows the impact of the MS2RLP particles in delivering the CRISPR/Cas9 system for knock-out of the PD1 gene (guide RNA+RNA coding Cas9) on the viability of the activated lymphocytes;

(35) FIG. 27 illustrates analysis of the phenotype of the activated lymphocytes after transduction by the MS2RLP particles delivering the CRISPR/Cas9 system for knock-out of the PD1 gene (guide RNA+RNA coding Cas9);

(36) FIG. 28 is a schematic diagram of the construction of the expression cassette derived from the pcDNA-U6-Guide_antiCXCR4Chimeric-MS2 2X expression plasmid comprising an RNA coding a non-coding RNA targeting the CXCR4 gene (sgRNA=guide RNA=Guide), dependent on the U6 promoter;

(37) FIG. 29 shows the effectiveness of an MS2RLP particle in delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas 9) in activated primary T lymphocytes, for knock-out of the CXCR4 gene;

(38) FIG. 30 shows the impact of the MS2RLP particles delivering the CRISPR/Cas9 system for knock-out of the CXCR4 gene (guide RNA+RNA coding Cas 9) on the viability of the activated primary T lymphocytes; and

(39) FIG. 31 illustrates analysis of the phenotype of the activated T lymphocytes after transduction by MS2RLP particles delivering the CRISPR/Cas9 system for knock-out of the CXCR4 gene (guide RNA+RNA coding Cas 9).

(40) FIG. 32 is a schematic diagram of the construction of the expression cassette derived from the pILV-H1/U6-GuideantiPD1-WPRE plasmid comprising a DNA sequence coding a non-coding RNA targeting the PD1 gene (sgRNA=guide RNA=Guide);

(41) FIG. 33 shows the effect of the dose of MS2RLP particles delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas 9) for knock-out of the GFP gene in HCT116 cloneD2 target cells;

(42) FIG. 34 is a schematic diagram of the construction of the expression cassette derived from the pcDNA-EF1-Cas9-PP7 2X plasmid comprising a DNA sequence coding the RNA of the Cas9 nuclease;

(43) FIG. 35 is a schematic diagram of the construction of the expression cassette derived from the pcDNA-U6-GuideD1Chimeric-PP7 2X plasmid, comprising a DNA coding a non-coding RNA targeting the sequence of the GFP (sgRNA=guide RNA), of a promoter-sequence of interest-Term expression cassette (sgRNA=guide RNA=Guide), dependent on the U6 promoter, in which 2 repetitions of the stem-loop motif of the PP7 RNA (SEQ ID No.2 and SEQ ID No.4 respectively) are included in the scaffold part of the chimeric guide;

(44) FIG. 36a Illustrates the strategy for modifying the p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) for constructing a p8.74ZF-PP7-Coat plasmid;

(45) FIG. 36b is a schematic diagram of the construction of the expression cassette derived from the p8.74ZF-PP7-Coat encapsidation plasmid having the second zinc finger replaced with the Coat protein of the PP7 bacteriophage, obtained by the strategy shown in FIG. 36a;

(46) FIG. 37 illustrates the effect of the dose of PP7RLP particles delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas9) for knock-out of the GFP gene in HCT116 done D2 target cells;

(47) FIG. 38 is a schematic diagram illustrating the expression cassette derived from the pcDNA.EF1.FluorescentReporter.MS2 12X expression plasmid comprising a DNA sequence coding the RNA of a fluorescent reporter, followed by 12 repetitions of the stem-loop motif of the MS2 RNA (SEQ ID No.1);

(48) FIG. 39 is a schematic diagram illustrating the expression cassette derived from the pcDNA.EF1.FluorescentReporter.PP7 2X expression plasmid comprising a DNA sequence coding the RNA of a fluorescent reporter followed by 2 repetitions of the stem-loop motif of the PP7 RNA (SEQ ID No.2);

(49) FIG. 40 is a schematic diagram of the construction of the expression cassette derived from the pILV-EF1-ZsGreenI-WPRE expression plasmid comprising a DNA coding the RNA of ZsGreenI;

(50) FIG. 41 shows the effect of the wild-type GAG-POL precursor for producing MS2RLP 12X particles on the transfer of RNA in Jurkat cells at a dose of 2 pg p24/cell;

(51) FIG. 42 shows the effect of the wild-type GAG-POL precursor for producing MS2RLP 12X particles on the transfer of RNA in Jurkat cells at a dose of 2 pg p24/cell;

(52) FIG. 43 a and b illustrates analysis of the maturation of the MS2RLP viral particles by anti-p24 Western blot after 15 s (43b) and 1 min (43a); and

(53) FIG. 44 shows the effectiveness of the MS2/PP7 (NC)-RLP 12X 2X particles for the transfer of encapsidated RNAs by the MS2 and PP7 encapsidation sequences in HCT116 target cells.

EXAMPLE 1: COMPARISON OF TRANSFER OF THE RNA CODING CAS9 AFTER TRANSDUCTION OF A PARTICULAR CLONE OF HCT116 CELLS BY ILVS OR MS2RLP PARTICLES ACCORDING TO THE INVENTION

(54) I. Material & Methods

(55) 1. Plasmid Construction

(56) For this example only, the Cas9 used is Cas9 Nickase (in a mutated form).

(57) In the following examples, unless stated otherwise, Cas9 in its wild-type form (WT) is used, the protocol remaining unchanged.

(58) 1.1 Plasmids for Producing MS2-(NC)-RLP 12X Lentiviral Particles According to the Invention

(59) Expression Plasmid for a Sequence of Interest:

(60) The expression plasmid bears an expression cassette (FIG. 1) with or without an intron sequence or RNA stabilizing sequence. In order to transport the RNAs into the lentiviral particles, 12 repetitions of the stem-loop motif of the MS2 RNA (ctagaaaacatgaggatcacccatgtctgcag, SEQ ID No.1) were inserted in an expression cassette downstream of the sequence of the Cas9 enzyme. The promoter used is the EF1 promoter (FIG. 1) but other promoters may be used. The plasmid sequence of interest is a DNA coding the RNA of the Cas9 protein (FIG. 1), in its wild-type form (WT) or in its mutated form (N), for example Nickase.

(61) Encapsidation Plasmid:

(62) The lentiviral particle was modified to contain the sequence of the Coat protein of the MS2 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain. The p8.74 encapsidation plasmid, bearing the genes coding the structural and functional proteins (Gag, Pol), used for production of the MS2RLP particles, is modified in accordance with the strategy illustrated in FIG. 2a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the MS2 bacteriophage by HpaI cloning, to generate the plasmid p8.74ZF-MS2-Coat. This gives the construct illustrated in FIG. 2b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the MS2RLPs.

(63) Envelope plasmid (pENV):

(64) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(65) These plasmids are used for producing MS2-(NC)-RLP 12X lentiviral particles according to the invention. More particularly, these plasmids are used for producing MS2RLP-Cas9 12X lentiviral particles.

(66) 1.2 Plasmids for Producing Integrative Lentiviral Vectors ILV

(67) 1.2.1. Plasmids for Producing Control Integrative Lentiviral Vectors ILVCas9

(68) Expression Plasmid for a Sequence of Interest:

(69) The expression plasmid bears an expression cassette (FIG. 4). This plasmid may contain other elements such as the native sequence WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) or the cPPT/CTS sequence. Viral pathogenicity is eliminated by substitution of regions of the viral genome required for retroviral replication by the transgene. The promoter used is the EF1 promoter, but other promoters may be used. The plasmid sequence of interest is a DNA coding the RNA of the Cas9 protein (FIG. 4), in its wild-type form (WT) or in its mutated form (N).

(70) Encapsidation Plasmid:

(71) The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) is used for production of the integrative lentiviral vectors (FIG. 6).

(72) Envelope Plasmid (pENV):

(73) This plasmid is identical to the envelope plasmid used for producing MS2RLP lentiviral particles (FIG. 3).

(74) 1.2.2. Plasmids for Producing ILV-GFP Integrative Lentiviral Vectors for Generating the HCT116-GFP Clone D2 Target Cells

(75) Expression Plasmid for a Sequence of Interest:

(76) The expression plasmid bears an expression cassette (FIG. 5a). This plasmid may contain other elements such as the native sequence WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) or the cPPT/CTS sequence. Viral pathogenicity is eliminated by substitution of regions of the viral genome required for retroviral replication by the transgene. The promoter used is the EF1 promoter, but other promoters may be used. The sequence of interest is the GFP fluorescent protein (FIG. 5a).

(77) Encapsulation Plasmid:

(78) The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) is used for production of the integrative lentiviral vectors (FIG. 6).

(79) Envelope Plasmid (pENV):

(80) This plasmid is identical to the envelope plasmid used for producing MS2RLP lentiviral particles (FIG. 3).

(81) 1.2.3. Plasmids for Producing Integrative Lentiviral Vectors ILV-H1-GuideU3-U6-GuideD1 for Generating the Target Cells HTC116-GFP Clone D2-H1-GuideU3-U6-GuideD1

(82) Expression Plasmid for a Sequence of Interest:

(83) The expression plasmid bears an expression cassette as described in FIG. 5b. This plasmid may contain other elements such as the native sequence WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) or the cPPT/CTS sequence. Viral pathogenicity is eliminated by substitution of regions of the viral genome required for retroviral replication by the transgene. The promoters used are H1 and U6, but other promoters may be used. The sequences of interest are two non-coding RNAs targeting the sequence of the GFP, called guide U3 and guide D1 hereinafter (sgRNA=guide RNA) (FIG. 5b).

(84) Encapsulation Plasmid:

(85) The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) is used for production of the integrative lentiviral vectors (FIG. 6).

(86) Envelope Plasmid (pENV):

(87) This plasmid is identical to the envelope plasmid used for producing MS2RLP lentiviral particles (FIG. 3)

(88) 2. Production of the Batches of Lentiviral Particles and Lentiviral Vectors

(89) After transfection of the plasmids on producer cells, the supernatants are harvested and used crude or concentrated/purified according to one of the methods mentioned hereunder, described in application WO 2013/014537.

(90) 2.1 Production of the Lentiviral Particles and Lentiviral Vectors

(91) Production is carried out in a 10-stack CellSTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2. For each batch (MS2-(NC)RLP 12X and ILV), the transfection mixture consists of the following three plasmids: One of the expression plasmids described above, depending on whether a particle (MS2-(NC)RLP 12X) or a vector (ILV) is being formed, p8.74ZF Coat (MS2-(NC)-RLP 12X) or p8.74 (ILV) pENV bearing the envelope VSV-G.

(92) More particularly, for batch MS2RLP-Cas9 12X, the transfection mixture consists of the following three plasmids: the pcDNA-EF1-Cas9-MS2 12X expression plasmid (the expression cassette of which is illustrated in FIG. 1) the p8.74ZF-MS2 Coat plasmid (the expression cassette of which is illustrated in FIG. 2b) the pENV plasmid bearing the envelope VSV-G (the expression cassette of which is illustrated in FIG. 3).

(93) More particularly, for the batches ILV-GFP, ILV-H1-GuideU3-U6-GuideD1 or ILV-Cas9, the transfection mixture consists of the following three plasmids: the expression plasmid pILV-EF1-GFP-WPRE (the expression cassette of which is illustrated in FIG. 5a) or pILV-H1-GuideU3-U6-GuideD1-WPRE (the expression cassette of which is illustrated in FIG. 5b) or pILV-EF1-Cas9-WPRE (the expression cassette of which is illustrated in FIG. 4), respectively the p8.74 plasmid (the expression cassette of which is illustrated in FIG. 6) the pENV plasmid bearing the envelope VSV-G (the expression cassette of which is illustrated in FIG. 3).

(94) The respective proportions of the plasmids are as follows: 40% of the expression plasmid, 30% of the p8.74 plasmid (or p8.74ZF), 30% of the pENV plasmid.

(95) 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stericup, Millipore). All the collections are then pooled to compose the crude supernatant.

(96) 2.2 Concentration and Purification of the Lentiviral Vectors and Lentiviral Particles

(97) The vectors and particles are concentrated and purified by one of the following two methods: Method P1 envisages frontal ultrafiltration of the supernatant on central centrifugation units. Method P2 envisages tangential ultrafiltration and then diafiltration of the supernatant. The crude supernatant is concentrated and purified by tangential ultrafiltration using polysulphone hollow-fibre cartridges. The supernatant is treated by diafiltration for 20 diavolumes in continuous mode against DMEM or TSSM buffer. After diafiltration, the retentate is recovered and then concentrated again by frontal ultrafiltration on central centrifugation units.

(98) For Example 1, the supernatants are harvested and used concentrated/purified according to method P1.

(99) 3. Titration of the Batches of Lentiviral Particles and Lentiviral Vectors

(100) 3.1 Titration of the functional particles by qPCR

(101) The HCT116 titration cells (ATCC, CCL-247) are seeded in a 96-well plate in 100 L of DMEM supplemented with 10% FCS, 100 g/mL streptomycin, 100 U/mL penicillin and 2 mM L-Gln (L-glutamine) and then incubated for 24 h at 37 C./5% CO.sub.2. Six serial dilutions are carried out for each vector as well as for an internal standard. The titration cells are transduced with these serial dilutions in the presence of Polybrene 8 g/mL (Sigma) and then incubated for three days at 37 C./5% CO.sub.2. For each series of samples, a well of cells that have not been transduced is added as a control. The titration cells are then trypsinized and the titre (Transduction Unit/mL) is determined by qPCR after extraction of the genomic DNA using the Nucleospin tissue gDNA extraction kit (Macherey-Nagel). The titre obtained (TU/mL) by qPCR is normalized with the internal standard, of which titre was determined beforehand by FACS.

(102) 3.2 Quantification of the Physical Particles by ELISA D24 Assay

(103) The p24 capsid protein is detected directly on the viral supernatant using, and following the recommendations of, the HIV-1 p24 ELISA kit (Perkin Elmer). The p24 protein captured is complexed with a biotinylated polydonal antibody, and then detected by a streptavidin conjugated with horseradish peroxidase (HRP). The resultant complex is detected by spectrophotometry after incubation with the ortho-phenylenediamine-HCl substrate (OPD) producing a yellow coloration that is directly proportional to the quantity of p24 protein captured. The absorbance of each well is quantified with the Synergy H1 Hybrid plate reader (Biotek) and calibrated against the absorbance of a standard range of p24 protein. The viral titre expressed as physical particles per ml is calculated from the concentration of p24 protein obtained, knowing that 1 g of p24 protein corresponds to 10.sup.4 physical particles.

(104) 4. Generation of Target Cells and Transduction by MS2-(NC)-RLP 12X Lentiviral Particles According to the Invention

(105) This example aims to show that it is possible to transfer RNA coding the Cas9 nuclease via non-integrative MS2RLP particles, and that at the end of this RNA transfer, for generating double-stranded DNA breaks allowing knock-out of a target gene.

(106) 4.1 HCT116-GFP Clone D2 Target Cells

(107) The HCT116-GFP Clone D2 target cells are obtained by transduction of HCT116 cells (ATCC, CCL 247) at MOI120 in the presence of 8 g/mL of Polybrene with an integrative lentiviral vector (ILV) expressing GFP. The HCT116-GFP Clone D2 target monoclonal line only containing a single copy of DNA coding GFP was obtained by limit dilution of the HCT116-GFP polyclonal line (prepared from the expression plasmid in FIG. 5a) and screening of the clones by quantification of the number of integrated copies of the GFP sequence by quantitative PCR.

(108) 4.2 HCT116-GFP CloneD2-H1-GuideU3-U6-GuideD1 Target Cells and Transduction by MS2-NC)-RLP 12X Lentiviral Particles According to the Invention

(109) The HCT116-GFP Clone D2 target cells are seeded in a 24-well plate at 25000 cells/cm.sup.2 and incubated for 24 h at 37 C./5% CO.sub.2. Firstly the cells are transduced by the ILV-H1-GuideU3-U6-GuideD1 vectors (prepared from the expression plasmid in FIG. 5b) at MOI40, in the presence of 8 g/mL Polybrene. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium.

(110) One week after transduction with ILV-H1-GuideU3-U6-GuideD1, the HCT116-GFP CloneD2-H1-GuideU3-U6-GuideD2 target cells are transduced by the ILV-EF1-Cas9 vectors at MOI140 (prepared from the expression plasmid in FIG. 4) or the MS2RLP-Cas9 particles at a dose of 10 pg p24/cell, in the presence of 8 g/mL Polybrene. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2RLP particles. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. At D14 post-transduction, the cells are recovered and the percentage of cells expressing GFP is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(111) II. Results

(112) The purpose of this experiment is to compare the effectiveness of transfer of RNA coding Cas9 by the transduction of HCT116-GFP-CloneD2-H1-GuideU3-U6-GuideD1 target cells with ILV-Cas9 vectors or MS2RLP-Cas9 12X particles. Firstly, the results presented in FIG. 9 show that the non-transduced (NT) HCT116 cells are not fluorescent (<0.4% of GFP positive cells), whereas 99% of the HCT116-GFP-CloneD2-H1-GuideU3-U6-GuideD1 target cells are fluorescent. Only 13% of the HCT116-GFP-CloneD2-H1-GuideU3-U6-GuideD1 target cells transduced by the ILV-Cas9 vector are still fluorescent. When the HCT116-GFP-CloneD2-H1-GuideU3-U6-GuideD1 target cells are transduced by the MS2RLP-Cas9 12X particles, a decrease in the number of fluorescent cells of the order of 57% is observed. This shows that 57% of the cells have undergone knock-out of the GFP sequence in their genome. The MS2-(NC)-RLP 12X particles containing 12 repetitions of stem-loop sequences are therefore effective for transfer of the mRNA coding the Cas9 nuclease, and therefore for performing editing of the genome.

EXAMPLE 2: COMPARISON OF THE POSITION OF THE MS2 REPEAT MOTIFS FOR ENCASPIDATION OF GUIDE RNAS IN MS2 (NC)-RLP 2X PARTICLES AFTER TRANSDUCTION OF A SECOND PARTICULAR CLONE OF HCT116 CELLS

(113) I. Material & Methods

(114) 1. Plasmid Construction

(115) 1.1 Plasmids for Producing MS2 (NC)-RLP 2X Lentiviral Particles According to the Invention

(116) Expression Plasmid for a Sequence of Interest:

(117) The expression plasmid bears an expression cassette as described in FIG. 7 or 8, with or without an intron sequence or RNA stabilizing sequence. In order to transport the RNAs into the lentiviral particles, 2 repetitions of the stem-loop motif of the MS2 RNA (ctagaaaacatgaggatcacccatgtctgcag, SEQ ID No.1 for the conventional guide D1, ggccaacatgaggatcacccatgtctgcagggcc SEQ ID No.3 for the chimeric guide D1) were inserted in an expression cassette either downstream of the guide RNA (conventional guide D1, FIG. 7), or included in the part of the scaffold of the guide (chimeric guide D1, FIG. 8). The promoter used is the H1 promoter but other promoters may be used such as the U6 promoter. Use of a promoter of the RNA pol III dependent type, such as H1 or U6, requires the presence of a transcription termination signal (Term). The sequence of interest is a non-coding RNA targeting the sequence of the GFP (sgRNA=guide RNA).

(118) Encapsidation Plasmid:

(119) The lentiviral particle was modified to contain the sequence of the Coat protein of the MS2 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the MS2RLP 2X particles is modified in accordance with the strategy illustrated in FIG. 2a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the MS2 bacteriophage by HpaI cloning, to generate the plasmid p8.74ZF-MS2-Coat. This gives the construct illustrated in FIG. 2b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the MS2RLP 2X.

(120) Envelope Plasmid (pENV):

(121) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(122) These plasmids are used for producing MS2-(NC)-RLP 12X lentiviral particles according to the invention. More particularly, these plasmids are used for production of the lentiviral particles MS2RLP-GuideD1Classical 2X and MS2RLP-GuideD1 Chimeric 2X.

(123) 1.2 Plasmids for Producing Integrative Lentiviral Vectors ILV

(124) 1.2.1. Plasmids for Producing Control Integrative Lentiviral Vectors ILV-GuideD1

(125) Expression Plasmid for a Sequence of Interest:

(126) The expression plasmid bears an expression cassette as described in FIG. 5c. This plasmid may contain other elements such as the native sequence WPRE (Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element) or the cPPT/CTS sequence. Viral pathogenicity is eliminated by substitution of regions of the viral genome required for retroviral replication by the transgene. The promoters used are H1 and U6, but other promoters may be used. The sequence of interest is a guide (FIG. 5c).

(127) Encapsidation Plasmid:

(128) The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) is used for production of the integrative lentiviral vectors (FIG. 6).

(129) Envelope Plasmid (pENV):

(130) This plasmid is identical to the envelope plasmid used for producing MS2RLP lentiviral particles (FIG. 3).

(131) 1.2.2. Plasmids for Producing ILV-GFP Integrative Lentiviral Vectors for Generating the HCT116-GFP Clone D2 Target Cells

(132) These plasmids are prepared by a method identical to that in Example 1.

(133) 1.2.3 Plasmids for Producing ILV-Cas9 Integrative Lentiviral Vectors for Preparing the HCT116-GFP Clone D2-EF1-Cas9WT Target Cells

(134) These plasmids are prepared by a method identical to that in Example 1.

(135) 2. Production of Batches of Lentiviral Particles and Lentiviral Vectors

(136) The lentiviral particles and the lentiviral vectors are produced as described in Example 1 and are concentrated and purified according to method P1 as described in Example 1.

(137) More particularly, for the batch MS2RLP-GuideD1 Classical 2X and MS2RLP-GuideD1Chimeric 2X, the transfection mixture consists of the following three plasmids: the pcDNA-H1-GuideD1-MS2 2X expression plasmid (the expression cassette of which is illustrated in FIG. 7) or the pcDNA-H1-GuideD1Chimeric-MS2 2X plasmid (the expression cassette of which is illustrated in FIG. 8) the p8.74ZF-MS2 Coat plasmid (the expression cassette of which is illustrated in FIG. 2b) the pENV plasmid bearing the envelope VSV-G (the expression cassette of which is illustrated in FIG. 3).

(138) The proportion of plasmids used is identical to that in Example 1.

(139) 3. Titration of the Batches of Lentiviral Particles and Lentiviral Vectors

(140) The lentiviral particles and the lentiviral vectors are titrated as described in Example 1.

(141) 4. Generation of Target Cells and Transduction by MS2-NC)-RLP 2X Lentiviral Particles According to the Invention

(142) This example aims to determine whether the position of the MS2 repeated stem-loop motifs for encapsidation of guide RNA in MS2RLP particles has an impact on the effectiveness of the particles for knock-out of a target gene.

(143) 4.1 HCT116-GFP CloneD2 Target Cells

(144) This clone is prepared by a method identical to that in Example 1.

(145) 4.2 HCT116-GFP CloneD2-Cas9 Target Cells and Transduction by MS2-(NC)-RLP 2X Lentiviral Particles According to the Invention

(146) The HCT116-GFP Clone D2 cells are seeded in a 24-well plate at 25000 cells/cm.sup.2 and incubated for 24 h at 37 C./5% CO.sub.2. Firstly the cells are transduced by the ILV-Cas9 vectors, at MOI140, in the presence of 8 g/mL Polybrene. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. One week after transduction with the ILV-Cas9 vectors, the HCT116-GFP CloneD2-Cas9 target cells are transduced by the MS2 (NC)-RLP 2X particles delivering the anti-GFP guide RNAs (classical or chimeric) at a dose of 10 pg p24/cell, or by the ILV-GuideD1 vectors at MOI40, in the presence of 8 g/mL Polybrene. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2RLP particles. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. At D14 post-transduction by the MS2RLP-guides-MS2 2X, the cells are recovered and the percentage of cells expressing GFP is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(147) II. Results

(148) The purpose of this experiment is to compare the position of the MS2 repeat motifs for encapsidation of guide RNAs in the MS2RLP 2X particles after transduction. Firstly, the results presented in FIG. 10 show that the non-transduced (NT) HCT116 cells are not fluorescent (<0.16% of GFP positive cells), whereas more than 99% of the HCT116-GFP CloneD2 target cells are fluorescent. Just 13% of the HCT116-GFP CloneD2-Cas9 target cells transduced by the ILV-GuideD1 vectors are still fluorescent. When the HCT116-GFP doneD2-Cas9 target cells are transduced by the MS2RLP 2X-Guide particles, a very slight decrease in the number of fluorescent cells of 2% is observed for the MS2RLP-GuideD1 Classical 2X transporting the classical guides and a larger decrease of the order of 10% for the MS2RLP-GuideD1Chimeric 2X transporting the chimeric guides. The position of the MS2 repeat motifs therefore impacts the effectiveness of the MS2RLP 2X particles. Although the percentage extinction remains moderate, the results show that the MS2RLP 2X particles allow transfer of guide RNA, and therefore genome editing.

EXAMPLE 3: IMPACT OF THE SINGLE OR DOUBLE QUANTITY OF THE EXPRESSION PLASMID BEARING THE GUIDE RNA IN THE MS2 (NC)-RLP 2X PARTICLES FOR TRANSDUCTION OF THE SECOND CLONE OF HCT116 CELLS

(149) I. Material & Methods

(150) 1. Plasmid Construction

(151) 1.1 Plasmids for Producing Integrative Lentiviral Vectors ILV

(152) 1.1.1 Plasmids for Producing ILV-Cas9 Integrative Lentiviral Vectors for Preparing the HCT116-GFP Clone D2-EF1-Cas9 Target Cells

(153) These plasmids are prepared by a method identical to that in Example 1.

(154) 1.1.2 Plasmids for producing ILV-GFP integrative lentiviral vectors for Generating the HCT116-GFP Clone D2 Target Cells

(155) These plasmids are prepared by a method identical to that in Example 1.

(156) 1.1.3 Plasmids for Producing Control Integrative Lentiviral Vectors ILV for the Guides (ILV-GuideD1)

(157) These plasmids are prepared by a method identical to that in Example 2.

(158) 1.2 Plasmids for Producing MS2 (NC)-RLP 2X Lentiviral Particles According to the Invention.

(159) These plasmids are prepared by a method identical to that in Example 1. More particularly, the plasmids employed for producing MS2RLP-GuideD1Chimeric 2X lentiviral particles are used.

(160) 2. Production of Batches of Lentiviral Particles and Lentiviral Vectors

(161) 2.1 Production of the Lentiviral Particles and Lentiviral Vectors

(162) Production is carried out in a 10-stack CellISTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2. The MS2RLP 2X particles are produced by transfection of the following three plasmids: One of the expression plasmids described above, used in single or double quantity depending on whether a particle is being formed (MS2-(NC)-RLP 2X) or in single quantity for an integrative vector (ILV), p8.74ZF Coat (MS2-(NC)-RLP 2X) or p8.74 (ILV); pENV bearing the envelope VSV-G.

(163) More particularly, the MS2RLP-GuideD1Chimeric 2X lentiviral particles are produced by transfection of the following three plasmids: the pcDNA-H1-GuideD1Chimeric-MS2 2X expression plasmid (the expression cassette of which is illustrated in FIG. 8) used in single or double quantity p8.74ZF Coat-MS2 Coat (the expression cassette of which is illustrated in FIG. 2b) pENV bearing the envelope VSV-G (the expression cassette of which is illustrated in FIG. 3).

(164) The proportions of the plasmids are as follows: 40% of the expression plasmid, 30% of the p8.74 or p8.74ZF plasmid, 30% of the pENV plasmid, 60% of the expression plasmid, 20% of the p8.74 or p8.74ZF plasmid, 20% of the pENV plasmid, for the case when production comprises a single expression plasmid, the quantity of which is doubled.

(165) 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stericup, Millipore). All the collections are then pooled to compose the crude supernatant.

(166) The ILV-Cas9 lentiviral vectors are produced as described in Example 1.

(167) The ILV-GFP lentiviral vectors are produced as described in Example 1.

(168) The ILV-GuideD1 lentiviral vectors are produced as described in Example 2.

(169) 2.2 Concentration and Purification of the Lentiviral Particles and Lentiviral Vectors

(170) The vectors and particles are concentrated and purified according to method P1, described in Example 1.

(171) 3. Titration of the Batches of Lentiviral Particles and Lentiviral Vectors

(172) The lentiviral particles and the lentiviral vectors are titrated as described in Example 1.

(173) 4. Generation of Target Cells and Transduction by MS2-(NC)-RLP 2X Lentiviral Particles According to the Invention

(174) This example aims to compare the effectiveness of MS2 (NC)-RLP 2X particles for knock-out of a target gene with particles produced with a single or double quantity of the expression plasmid bearing the guideD1Chimeric RNA, targeting the sequence coding GFP contained in the HCT116-GFP cloneD2-EF1-Cas9 cells expressing the Cas9 enzyme constitutively.

(175) 4.1 HCT116-GFP cloneD2 Target Cells

(176) This done is prepared by a method identical to that in Example 1.

(177) 4.2 HCT116-GFP cloneD2-Cas9 Target Cells and Transduction by MS2-(NC)-RLP 2X Lentiviral Particles According to the Invention

(178) The HCT116-GFP Clone D2 cells are seeded in a 24-well plate at 25000 cells/cm.sup.2 and incubated for 24 h at 37 C./5% CO.sub.2. Firstly the cells are transduced by the ILV-Cas9 vectors at MOI40, these vectors being as prepared in Example 2, in the presence of 8 g/mL Polybrene. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. One week after transduction with ILV-Cas9, the HCT116-GFP CloneD2-Cas9 cells are transduced by the MS2RLP particles delivering the chimeric guides D1 (produced with a single or double dose of expression plasmid) or by the vector ILV-GuideD1, at a dose of 10 pg p24/cell, in the presence of 8 g/mL Polybrene. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2 (NC)-RLP 2X particles. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. At D14 post-transduction, the cells are recovered and the percentage of cells expressing GFP as well as the fluorescence intensity are quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(179) II. Results

(180) The purpose of this experiment is to compare production of MS2RLP particles delivering guide RNA produced using a single or double quantity of the expression plasmid. Firstly, the results presented in FIG. 11 show that the non-transduced (NT) HCT116 cells are not fluorescent (<0.2% of GFP positive cells), whereas more than 99% of the HCT116-GFP CloneD2 target cells are fluorescent. Less than 9% of the HCT116-GFP CloneD2-Cas9 target cells transduced by the vector ILV-GuideD1 are still fluorescent. When the HCT116-GFP CloneD2-Cas9 target cells are transduced by the MS2RLP-GuideD1Chimeric 2X, a 6% decrease in the number of fluorescent cells is observed for the MS2RLP 2X particles transporting the chimeric guides produced in a single dose of the expression plasmid. This decrease is doubled (13% of HCT116-GFP CloneD2-Cas9 negative target cells) for the MS2RLP 2X particles transporting the chimeric guides produced with a double dose of expression plasmid. It is probable that the double dose of expression plasmid used for production of the MS2RLP 2X particles therefore improves the degree of encapsidation of the guideD1 RNAs, hence better effectiveness in knock-out of the GFP sequence.

EXAMPLE 4: EFFECTIVENESS OF AN MS2RLP PARTICLE IN DELIVERING THE CRISPR/CAS9 SYSTEM (GUIDE RNA+RNA CODING CAS9) IN HCT116-GFP CELLS

(181) I. Material & Methods

(182) 1. Plasmid Construction

(183) 1.1 Plasmids for producing MS2 (NC)-RLP 12X 2X lentiviral particles according to the invention

(184) Expression Plasmid for a Sequence of Interest:

(185) The expression plasmids of which the expression cassette is described in Example 1 (FIG. 1, pcDNA-EF1-Cas9-MS2 12X) and in example 2 (FIG. 8, pcDNA-H1-GuideD1 Chimeric-MS2 2X) were used for co-encapsidating, in the same MS2RLP12X-2X particle, both the RNA coding Cas9 and the guide RNA targeting the sequence of the GFP integrated into the genome of the target cells (HCT116-GFP CloneD2).

(186) Encapsidation Plasmid:

(187) The lentiviral particle was modified to contain the sequence of the Coat protein of the MS2 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the MS2RLP 12X-2X particles is modified in accordance with the strategy illustrated in FIG. 2a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the MS2 bacteriophage by HpaI cloning, to generate the plasmid p8.74ZF-MS2-Coat. This gives the construct illustrated in FIG. 2b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the MS2RLPs.

(188) Envelope Plasmid (pENV):

(189) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(190) These plasmids are used for producing MS2(NC)-RLP 12X and 2X (or MS2RLP 12X 2X) lentiviral particles according to the invention. More particularly, these plasmids are used for producing MS2RLP-Cas9 12XGuideD1Chimeric 2X lentiviral particles.

(191) 1.2. Plasmids for Producing ILV-GFP Integrative Lentiviral Vectors for Generating the HCT116-GFP Clone D2 Target Cells

(192) These plasmids are prepared by a method identical to that in Example 1.

(193) 2. Production of Batches of Lentiviral Particles and Lentiviral Vectors

(194) After transfection of the plasmids on producer cells, the supernatants are harvested and used crude or concentrated/purified according to one of the aforementioned methods P1 or P2, described in application WO 2013/014537.

(195) 2.1 Production of the Lentiviral Particles

(196) Production is carried out in a 10-stack CellISTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2.

(197) The MS2 (NC)-RLP 12X-2X particles are produced by transfection of the following four plasmids: The two expression plasmids described above, of which the pcDNA-H1-GuideD1 Chimeric-MS2 2X plasmid (FIG. 8) is used in double the quantity of the pcDNA-EF1-Cas9-MS212X plasmid; p8.74ZF-MS2-Coat; pENV bearing the envelope VSV-G.

(198) More particularly, the MS2RLP-Cas9 12X-GuideD1Chimeric 2X lentiviral particles are produced by transfection of the following four plasmids: The two expression plasmids described above, of which the plasmid pcDNA-H1-GuideD1Chimeric-MS2 2X (the expression cassette of which is illustrated in FIG. 8) is used in double the quantity of the plasmid pcDNA-EF1-Cas9-MS212X (the expression cassette of which is illustrated in FIG. 1); p8.74ZF-MS2-Coat (the expression cassette of which is illustrated in FIG. 2b); pENV bearing the envelope VSV-G (the expression cassette of which is illustrated in FIG. 3).

(199) 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stericup, Millipore). All the collections are then pooled to compose the crude supernatant.

(200) This production therefore comprises two expression plasmids, an encapsidation plasmid and an envelope plasmid. The proportion of plasmids used is: 33% of the expression plasmid coding the guide, 17% of the expression plasmid coding Cas9 (the quantity of expression plasmid coding the guide is doubled with respect to that of the expression plasmid coding Cas9), 25% of the p8.74ZF plasmid, and 25% of the pENV plasmid.

(201) The ILV-GFP lentiviral vectors are produced as described in Example 1.

(202) 2.2 Concentration and Purification of the Lentiviral Particles and Lentiviral Vectors

(203) The particles and the vectors are concentrated and purified according to method P1 described in Example 1.

(204) 3. Titration of the Physical Particles by ELISA p24 Assay

(205) The p24 capsid protein is detected directly on the viral supernatant using, and following the recommendations of, the HIV-1 p24 ELISA kit (Perkin Elmer). The p24 protein captured is complexed with a biotinylated polyclonal antibody, and then detected by a streptavidin conjugated with horseradish peroxidase (HRP). The resultant complex is detected by spectrophotometry after incubation with the ortho-phenylenediamine-HCl substrate (OPD) producing a yellow coloration that is directly proportional to the quantity of p24 protein captured. The absorbance of each well is quantified on the Synergy H1 Hybrid plate reader (Biotek) and calibrated against the absorbance of a standard range of p24 protein. The viral titre expressed as physical particles per ml is calculated from the concentration of p24 protein obtained, knowing that 1 g of p24 protein corresponds to 10.sup.4 physical particles.

(206) The lentiviral particles and the lentiviral vectors are titrated as described in Example 1.

(207) 4. Generation of Target Cells and Transduction by MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(208) This example aims to show that it is possible to co-encapsidate, in the same MS2RLP 12X-2X particle, both the RNA coding Cas9 and the guide RNA targeting the sequence of the GFP, integrated into the genome of the target cells, and then transfer these different RNAs via the MS2RLP-Cas9 12X-GuideD1Chimeric 2X particles into the target cells, HCT116-GFP doneD2. At the end of this transfer of RNA, the CRISPR/Cas9 system should be functional and generate breaks of double-stranded DNA allowing knock-out of the target gene, and thus transform the GFP+ cells into GFP cells, using one and the same tool for transfer of the 2 constituents of the CRISPR/Cas9 system.

(209) 4.1 HCT116-GFP cloneD2 Target Cells

(210) This clone is prepared by a method identical to that in Example 1.

(211) 4.2 Transduction of the HCT116-GFP CloneD2 Target Cells by MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(212) The HCT116-GFP Clone D2 cells are seeded in a 24-well plate at 25000 cells/cm.sup.2 and incubated for 24 h at 37 C./5% CO.sub.2. The HCT116-GFP CloneD2 cells are transduced by the MS2RLP 12X-2X particles delivering both Cas9 and the chimeric guide D1, at a dose of 10 pg p24/cell in the presence of 8 g/mL Polybrene. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2RLP 12X-2X particles. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. A second transduction was carried out under the same conditions (FIG. 20), 6 days after the first transduction. Finally, a third transduction was carried out under the same conditions 12 days after the first transduction (FIG. 12). 14 days after the last transduction, the cells are recovered and the percentage of cells expressing GFP is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(213) II. Results

(214) The purpose of this experiment is to study the possibility of simultaneously transferring RNAs coding Cas9 and guide RNAs via MS2RLP 12X 2X particles by measuring the functionality of the CRISPR/Cas9 system in target cells. Firstly, the results presented in FIG. 12 show that the non-transduced (NT) HCT116 cells are not fluorescent (<0.2% of GFP+ cells), whereas the HCT116-GFP CloneD2 target cells are fluorescent at more than 96%. When the target cells are transduced with the MS2 (NC)-RLP 12X-2X particles delivering the complete CRISPR/Cas9 system, 14 days after the third transduction of the cells, a 38% decrease is noted in the number of fluorescent cells. There is therefore knock-out of the GFP gene of the order of 38% with MS2RLP 12X 2X particles delivering both Cas9 nuclease and the anti-GFP guides. Extinction of the target gene by the CRISPR/Cas9 system is therefore 3 times more effective when the target cells are transduced by a single batch of MS2RLP particles that have been produced by co-transfection of two species of expression plasmids expressing a nuclease and guide RNAs respectively, than when two batches of particles transporting respectively the RNA of the Cas9 nuclease and guide RNAs are added at the moment of transduction (FIG. 12 and FIG. 1). The CRISPR Cas9 system is therefore more efficient with particles transporting the multiple RNAs coding Cas9 and the guide RNAs, respectively.

(215) The results presented in FIG. 20 show that the non-transduced (NT) HCT116 cells are not fluorescent (<0.2% of GFP+ cells), whereas the HCT116-GFP cloneD2 target cells are fluorescent at more than 99%. When the target cells are transduced with the MS2 (NC)-RLP 12X 2X particles delivering the complete CRISPR/Cas9 system, 14 days after the second transduction of the cells, a 57% decrease is noted in the number of fluorescent cells. There is therefore knock-out of the GFP gene of the order of 57% with MS2RLP 12X-2X particles delivering the RNAs coding both for the Cas9 nuclease and the anti-GFP guides. As a reminder, it is found that the percentage of cells expressing the GFP decreases by 12.8% when Cas9 is expressed constitutively and the guide RNA is supplied by the MS2RLP particles (FIG. 11). The percentage of cells expressing the GFP is therefore five times lower when the MS2RLP particles deliver both the RNA coding Cas9 and the guide RNA after two transductions (FIG. 20). Analysis of the cells still expressing GFP after two transductions versus three transductions by the MS2RLP-Cas9 12X-GuideD1Chimeric 2X particles shows that the CRISPR system seems more effective after two transductions (57% effectiveness, FIG. 20) than after three transductions (38% effectiveness, FIG. 12). This difference could be explained by the fact that when the CRISPR system is delivered into the target cell (HCT116-GFP CloneD2), it will generate a break of double-stranded DNA at the level of the target sequence, i.e. the sequence coding the protein GFP, but also on other sequences non-specifically. In fact, the CRISPR system has a certain level of non-specific cleavage, called off-target effect, allowing the generation of double-stranded DNA breaks that also undergo the DNA repair system (NHEJ system, for Non Homologous End Joining), just like the double-stranded DNA breaks generated specifically. The more the CRISPR system is delivered into the target cell, the more it will display off-target effects, there will be double-stranded DNA breaks generated in the same target cell. This system reaches a limit for which the NHEJ system becomes saturated, and the DNA is no longer repaired. In this case, non-repair of the genomic DNA induces death of the transduced cell. This is what is observed in the cells transduced 3 times by the MS2RLP-Cas9 12X-GuideD1Chimeric 2X particles. In fact, the cells transduced three times eventually die in the culture flask. Thus, the cells that have not been transduced, and therefore have not been affected by the CRISPR system allowing extinction of the protein GFP, have a proliferative advantage with respect to the cells transduced three times, explaining why the level of cells expressing the GFP is higher after three transductions by the MS2RLP-Cas9 12X-GuideD1Chimeric 2X particles than after two transductions.

(216) In conclusion, these MS2RLP 12X 2X particles mark themselves out as being the best tool for co-delivering the CRISPR/Cas9 system, using just one batch of particles, after one or two transductions, according to the effectiveness of genome editing, and according to the cellular type as well.

EXAMPLE 5: LENTIVIRAL PARTICLES ACCORDING TO THE INVENTION FOR THE TALEN SYSTEM

(217) The use of the TALEN system in a genome editing strategy requires the use of a first TALEN that is fixed upstream of the site of cleavage of the double-stranded DNA generated (TALEN 5), as well as a second TALEN that is fixed downstream of the site of cleavage of the double-stranded DNA generated (TALEN 3).

(218) FIG. 13a shows the expression plasmid allowing production of MS2RLP 12X particles expressing a TALEN that is fixed upstream (5 side) of the cleavage of double-stranded DNA generated.

(219) FIG. 13b shows the expression plasmid allowing production of MS2RLP 12X particles expressing a TALEN that is fixed downstream (3 side) of the cleavage of double-stranded DNA generated.

(220) FIG. 14a shows the expression plasmid allowing production of integrative particles ILV expressing a TALEN that is fixed upstream (5 side) of the cleavage of double-stranded DNA generated.

(221) FIG. 14b shows the expression plasmid allowing production of integrative particles ILV expressing a TALEN that is fixed downstream (3 side) of the cleavage of double-stranded DNA generated.

EXAMPLE 6: LENTIVIRAL PARTICLES ACCORDING TO THE INVENTION FOR THE ZN FINGER NUCLEASE SYSTEM

(222) Use of the Zn Finger Nuclease system in a genome editing strategy requires the use of a first Zn Finger that is fixed upstream of the site of cleavage of the double-stranded DNA generated (ZFP 5), as well as a second Zn Finger that is fixed downstream of the site of cleavage of the double-stranded DNA generated (ZFP 3).

(223) FIG. 15a shows the expression plasmid allowing production of MS2RLP 12X particles expressing a Zn Finger that is fixed upstream (5 side) of the cleavage of double-stranded DNA generated.

(224) FIG. 15b shows the expression plasmid allowing production of MS2RLP 12X particles expressing a Zn Finger that is fixed downstream (3 side) of the cleavage of double-stranded DNA generated.

(225) FIG. 16a shows the expression plasmid allowing production of integrative particles ILV expressing a Zn Finger that is fixed upstream (5 side) of the cleavage of double-stranded DNA generated.

(226) FIG. 16b shows the expression plasmid allowing production of integrative particles ILV expressing a Zn Finger that is fixed downstream (3 side) of the cleavage of double-stranded DNA generated.

EXAMPLE 7: CONSTRUCTION OF PP7(IN)-RLP LENTIVIRAL PARTICLES BY MODIFICATION OF INTEGRASE

(227) I. Material & Methods

(228) 1. Plasmid Construction

(229) Expression Plasmid for a Sequence of Interest:

(230) The expression plasmid bears an expression cassette (see FIG. 17) with or without an intron sequence or RNA stabilizing sequence. In order to transport the mRNAs into the lentiviral particles, 12 repetitions of the stem-loop motif of the PP7 RNA (ctagaaaggagcagacgatatggcgtcgctccctgcag SEQ ID No.2) were inserted in an expression cassette downstream of the reporter gene (FIG. 17).

(231) The promoter used may be the CMV or EF1 promoter (FIG. 17) but other promoters may be used. The sequence of interest may be a DNA coding a reporter protein such as native Firefly Luciferase (FIG. 17), a green (ZsGreenI), red (mCherry) or blue (mtBFP) fluorescent protein, or a cDNA coding a protein, for example the CRE protein. The sequence of interest may also be that of an shRNA, an miRNA, an sgRNA, an LncRNA or a circRNA.

(232) Encapsidation Plasmid:

(233) The lentiviral particle was modified to contain the sequence of the Coat protein of the bacteriophage PP7 in the integrase. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the PP7(IN)-RLP particles is modified in accordance with the strategy illustrated in FIG. 18: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid on which the protein Coat of the PP7 phage is fused with the C terminal domain of the integrase. This fusion, obtained by HpaI cloning, makes it possible to generate the P8.74-POL-PP7 Coat plasmid. This gives the construct illustrated in FIG. 19. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT).

(234) Envelope Plasmid (pENV):

(235) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(236) 2. Production, Concentration/Purification and Titration of the Lentiviral Particles

(237) The lentiviral particles are produced as described in Example 1, according to method P1.

(238) 3. Luciferase Expression Kinetics

(239) The HCT116 cells (ATCC, CCL-247) are seeded in a 96-well plate and incubated for 24 h at 37 C./5% CO.sub.2. Transduction by the PP7(IN)-RLP-Luc 12X particles produced according to method P1 is carried out at a dose of 2.8 g p24/cell, in the presence of 8 g/mL Polybrene. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. At 4 h, 8 h, 24, 32, and 48 h post-transduction, the cells are recovered and luciferase expression is analysed using the OneGlo Luciferase assay kit (Promega) following the supplier's recommendations and using the Synergy H1 Hybrid plate reader (Biotek). This assay is carried out in triplicate. HCT116 cells that have not been transduced are used as a control.

(240) II. Results

(241) It is possible to transport RNAs into the lentiviral particles with PP7-Coat in integrase. Maximum luciferase expression is reached at 8 h. After 8 h, luciferase activity decreases. The PP7(IN)-RLP particles therefore make it possible to deliver RNAs.

EXAMPLE 8: EFFECTIVENESS OF AN MS2RLP PARTICLE IN DELIVERING THE CRISPR/CAS9 SYSTEM (GUIDE RNA+RNA CODING CAS9) INTO HCT116-GFP CELLS, AS A FUNCTION OF THE PROMOTER ALLOWING TRANSCRIPTION OF THE GUIDE RNA IN THE PRODUCER CELLS

(242) I. Material & Methods

(243) 1. Plasmid Construction

(244) 1.1 Plasmids for Producing MS2 (NC)-RLP 12X and 2X Lentiviral Particles

(245) Expression Plasmid for a Sequence of Interest:

(246) The expression plasmids described in Example 1 (FIG. 1, pcDNA-EF1-Cas9-MS2 12X) and in FIG. 21, pcDNA-U6-GuideD1 Chimeric-MS2 2X were used for co-encapsidating, in the same MS2RLP 12X-2X particle, both the RNA coding Cas9 and the guide RNA D1 under the control of the U6 promoter, targeting the sequence of the GFP integrated into the genome of the target cells (HCT116-GFP CloneD2).

(247) Encapsidation Plasmid:

(248) The lentiviral particle was modified to contain the sequence of the Coat protein of the MS2 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the MS2RLP 12X-2X particles is modified in accordance with the strategy illustrated in FIG. 2a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the MS2 bacteriophage by HpaI cloning, to generate the p8.74ZF-MS2-Coat plasmid. This gives the construct illustrated in FIG. 2b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the MS2RLPs.

(249) Envelope Plasmid (pENV):

(250) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(251) More particularly, these plasmids are used for producing MS2RLP-Cas9 12X-GuideD1Chimeric 2X lentiviral particles.

(252) 1.2. Plasmids for Producing ILV-GFP Integrative Lentiviral Vectors for Generating the HCT116-GFP Clone D2 Target Cells

(253) These plasmids are prepared by a method identical to that in Example 1.

(254) 2. Production of Batches of Lentiviral Particles and Lentiviral Vectors

(255) After transfection of the plasmids on producer cells, the supernatants are harvested and used crude or concentrated/purified according to one of the aforementioned methods P1 or P2, described in application WO 2013/014537.

(256) 2.1 Production of the Lentiviral Particles and Lentiviral Vectors

(257) Production is carried out in a 10-stack CellISTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2.

(258) The MS2 (NC)-RLP 12X 2X particles are produced by transfection of the following four plasmids: The two expression plasmids described above of which pcCDNA-U6-GuideD1Chimeric-MS2 2X plasmid (the expression cassette of which is illustrated in FIG. 21) is used in double the quantity of the pcDNA-EF1-Cas9-MS2 12X plasmid (the expression cassette of which is illustrated in FIG. 1); p8.74ZF-MS2-Coat; pENV bearing the envelope VSV-G.

(259) 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stericup, Millipore). All the collections are then pooled to compose the crude supernatant.

(260) The MS2 (NC)-RLP 12X 2X lentiviral particles are produced as described in Example 4.

(261) The ILV-GFP lentiviral vectors are produced as described in Example 1.

(262) 2.2 Concentration and Purification of the Lentiviral Particles

(263) The particles are concentrated and purified according to method P1 described in Example 1.

(264) 3. Titration of the Physical Particles by ELISA p24 Assay

(265) The p24 capsid protein is detected directly on the viral supernatant using, and following the recommendations of, the HIV-1 p24 ELISA kit (Perkin Elmer). The p24 protein captured is complexed with a biotinylated polyclonal antibody, and then detected by a streptavidin conjugated with horseradish peroxidase (HRP). The resultant complex is detected by spectrophotometry after incubation with the ortho-phenylenediamine-HCl substrate (OPD) producing a yellow coloration that is directly proportional to the quantity of p24 protein captured. The absorbance of each well is quantified on the Synergy H1 Hybrid plate reader (Biotek) and calibrated against the absorbance of a standard range of p24 protein. The viral titre expressed as physical particles per ml is calculated from the concentration of p24 protein obtained, knowing that 1 g of p24 protein corresponds to 10.sup.4 physical particles.

(266) The lentiviral particles and the lentiviral vectors are titrated as described in Example 1.

(267) 4. Generation of Target Cells and Transduction by MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(268) This example aims to show that it is possible to co-encapsidate, in the same MS2RLP 12X-2X particle, both the RNA coding Cas9 and the guideD1 RNAs targeting the sequence of the GFP integrated into the genome of the target cells, and then transfer these different RNAs via the MS2 (NC)-RLP 12X-2X particles into the target cells, HCT116-GFP cloneD2. At the end of this transfer of RNA, the CRISPR/Cas9 system should be functional and generate breaks of double-stranded DNA allowing knock-out of the target gene, and thus transform the GFP+ cells into GFP cells, using one and the same tool for transfer of the 2 constituents of the CRISPR/Cas9 system.

(269) 4.1 HCT116-GFP cloneD2 Target Cells

(270) This done is prepared by a method identical to that in Example 1.

(271) 4.2 Transduction of the HCT116-GFP CloneD2 Target Cells by MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(272) The HCT116-GFP Clone D2 cells are seeded in a 24-well plate at 25000 cells/cm.sup.2 and incubated for 24 h at 37 C./5% CO.sub.2. The HCT116-GFP CloneD2 cells are transduced by the MS2RLP 12X 2X particles delivering both Cas9 and the guide D1, at a dose of 10 pg p24/cell, in the presence of 8 g/mL Polybrene. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2RLP 12X 2X particles. The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. At D14 post-transduction, the cells are recovered and the percentage of cells expressing GFP is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(273) II. Results

(274) The purpose of this experiment is to evaluate the effect of the promoter allowing expression of the guide RNA for generating MS2RLP particles simultaneously delivering RNAs coding Cas9 and guide RNAs.

(275) In this example, two promoters are tested: H1 and U6.

(276) Firstly, the results presented in FIG. 22 show that the non-transduced (NT) HCT116 cells are not fluorescent (<0.1% of GFP+ cells), whereas the HCT116-GFP doneD2 target cells are fluorescent at more than 99%. When the target cells are transduced with the MS2 (NC)-RLP 12X 2X particles delivering the complete CRISPR/Cas9 system, 14 days after the second transduction of the cells, a decrease is noted in the number of fluorescent cells of 46.2% in the case of the particles generated starting from the plasmid bearing the H1 promoter, and 81.9% in the case of the particles generated starting from the plasmid bearing the U6 promoter. Thus, the strongest knock-out of the GFP gene of the order of 81.9% is observed with MS2RLP 12X 2X particles generated starting from the plasmid bearing the U6 promoter after two transductions. The percentage of cells expressing the GFP is therefore almost 2 times lower when the particles are generated starting from the plasmid bearing the U6 promoter than when the particles are generated starting from the plasmid bearing the H1 promoter. In conclusion, the nature of the promoter used for generating the guide RNAs to be encapsidated in the MS2RLP particles has an impact on the effectiveness of the MS2RLP particle delivering the CRISPR/Cas9 system.

EXAMPLE 9: EFFECTIVENESS OF AN MS2RLP PARTICLE IN DELIVERING THE CRISPR/CAS9 SYSTEM (GUIDE RNA+RNA CODING CAS9) INTO ACTIVATED PRIMARY T LYMPHOCYTES, FOR KNOCK-OUT OF THE PD1 GENE

(277) I. Material & Methods

(278) 1. Plasmid Construction

(279) 1.1 Plasmids for Producing MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(280) Expression Plasmid for a Sequence of Interest:

(281) The expression plasmid described in Example 1 (the expression cassette of which is illustrated in FIG. 1, pcDNA-EF1-Cas9-MS2 12X) and the expression plasmid of which the expression cassette is illustrated in FIG. 23, pcDNA-U6-Guide_antiPD1Chimeric-MS2 2X were used for co-encapsidating, in the same MS2RLP 12X-2X particle, both the RNA coding Cas9 and the guide RNA under the control of the U6 promoter, targeting the sequence of the PD1 gene integrated into the genome of the primary T lymphocytes.

(282) Encapsidation Plasmid:

(283) The lentiviral particle was modified to contain the sequence of the Coat protein of the MS2 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the MS2RLP 12X-2X particles is modified in accordance with the strategy illustrated in FIG. 2a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the MS2 bacteriophage by HpaI cloning, to generate the p8.74ZF-MS2-Coat plasmid. This gives the construct illustrated in FIG. 2b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the MS2RLPs.

(284) Envelope Plasmid (pENV):

(285) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(286) These plasmids are used for producing MS2 (NC)-RLP 12X 2X lentiviral particles according to the invention. More particularly, these plasmids are used for producing MS2RLP-Cas9 12X-GuideantiPD1 Chimeric 2X lentiviral particles.

(287) 1.2 Plasmids for Producing Control MS2-(NC)-RLP 12X Lentiviral Particles According to the Invention

(288) These plasmids are prepared by a method identical to that in Example 1. More particularly, these plasmids are used for producing MS2RLP-Cas9 12X lentiviral particles, as described in paragraph 1.1 of Example 1.

(289) 1.3 Plasmids for producing control ILVCas9+GuideantiPD1 integrative lentiviral vectors

(290) Expression Plasmid for a Sequence of Interest:

(291) The expression plasmids bear an expression cassette as described in FIG. 4 and an expression cassette as described in FIG. 32. These plasmids may contain other elements such as the native sequence WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) or the cPPT/CTS sequence. Viral pathogenicity is eliminated by substitution of regions of the viral genome required for retroviral replication by the transgene. For the first plasmid, the promoter used is the EF1 promoter, but other promoters may be used. The plasmid sequence of interest is a DNA coding the RNA of the Cas9 protein (FIG. 4), in its wild-type form (WT) or in its mutated form (N).

(292) For the second plasmid, the promoters used are U6 or H1, but other promoters may be used. The sequence of interest is an antiPD1 guide (FIG. 32).

(293) Encapsidation Plasmid:

(294) The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) is used for production of the integrative lentiviral vectors (FIG. 6).

(295) Envelope Plasmid (pENV):

(296) This plasmid is identical to the envelope plasmid used for producing MS2RLP lentiviral particles (FIG. 3).

(297) 2. Production of Batches of Lentiviral Particles and Lentiviral Vectors After transfection of the plasmids on cells, the supernatants are harvested and used crude or concentrated/purified according to one of the aforementioned methods P1 or P2, described in application WO 2013/014537.

(298) 2.1 Production of the Lentiviral Particles and Lentiviral Vectors

(299) Production is carried out in a 10-stack CellSTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2.

(300) The MS2 (NC)-RLP 12X 2X particles are produced by transfection of the following four plasmids: The two expression plasmids described above of which pcDNA-U6-Guide_antiPD1 Chimeric-MS2 2X plasmid (the expression cassette of which is illustrated in FIG. 23) is used in double the quantity of the pcDNA-EF1-Cas9-MS2 12X plasmid (the expression cassette of which is illustrated in FIG. 1); p8.74ZF-MS2-Coat; pENV bearing the envelope VSV-G.

(301) The MS2 (NC)-RLP 12X 2X particles are produced by the method described in Example 4.

(302) More particularly, these plasmids are used for producing the MS2RLP-Cas9 12X-GuideantiPD1 Chimeric 2X lentiviral particles.

(303) 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stericup, Millipore). All the collections are then pooled to compose the crude supernatant.

(304) The control MS2 (NC)-RLP 12X lentiviral particles are produced as described in Example 4.

(305) Production, purification and titration of the control lentiviral vectors ILV, expressing the CRISPR/Cas9 system (guide RNA+Cas9), are carried out under the same conditions as in Example 1, according to method P2.

(306) 2.2 Concentration and Purification of the Lentiviral Particles

(307) The particles are concentrated and purified according to method P2 described in Example 1.

(308) 3. Titration of the Physical Particles by ELISA p24 Assay

(309) The p24 capsid protein is detected directly on the viral supernatant using, and following the recommendations of, the HIV-1 p24 ELISA kit (Perkin Elmer). The p24 protein captured is complexed with a biotinylated polydonal antibody, and then detected by a streptavidin conjugated with horseradish peroxidase (HRP). The resultant complex is detected by spectrophotometry after incubation with the ortho-phenylenediamine-HCl substrate (OPD) producing a yellow coloration that is directly proportional to the quantity of p24 protein captured. The absorbance of each well is quantified on the Synergy H1 Hybrid plate reader (Biotek) and calibrated against the absorbance of a standard range of p24 protein. The viral titre expressed as physical particles per ml is calculated from the concentration of p24 protein obtained, knowing that 1 g of p24 protein corresponds to 10.sup.4 physical particles.

(310) The lentiviral particles and the lentiviral vectors are titrated as described in Example 1.

(311) 4. Preparation of the Target Cells and Transduction by MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(312) This example aims to show that it is possible to co-encapsidate, in the same MS2RLP 12X 2X particle, both the RNA coding Cas9 and the guide RNA targeting the sequence of the PD1 gene, and then transfer these different RNAs via the MS2 (NC)-RLP 12X 2X particles into the target cells, the activated primary T lymphocytes. At the end of this transfer of RNA, the CRISPR/Cas9 system should be functional and generate breaks of double-stranded DNA allowing knock-out of the target PD1 gene using one and the same tool for transfer of the 2 constituents of the CRISPR/Cas9 system.

(313) 4.1 Preparation of the Target Cells, Activated Primary T Lymphocytes

(314) The target cells, the T lymphocytes, are prepared from a peripheral blood sample. The mononuclear cells from the peripheral blood are isolated by Ficoll gradient centrifugation, and then undergo adherence for 2 hours at 37 C./5% CO.sub.2 in a T75 flask. The cells in suspension are recovered, and the T lymphocytes are purified by negative selection using magnetic beads (Pan T cell isolation kit, Miltenyi Biotec). The purified T lymphocytes are activated for 24 hours (Dynabeads Human T-Activator CD3/CD28, ThermoFisher) at 37 C./5% CO.sub.2.

(315) 4.2 Transduction of the Target Cells, Activated Primary T Lymphocytes

(316) The target cells, activated primary T lymphocytes, are seeded in a 96-well plate at 1 000 000 cells/mL and transduced by the MS2RLP 12X 2X particles delivering both Cas9 and the guide, or by the MS2RLP 12X particles delivering only Cas9 (negative control), in the presence of 8 g/mL Polybrene, at different doses (0.1; 0.5; 1 or 5 pg p24/cell), or by the ILV particles delivering both Cas9 and the guide (positive control), at different doses (MOI 5, 10, 25, 50). A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2RLP 12X 2X and MS2RLP 12X particles.

(317) The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. 48 hours later, a second transduction is carried out under the same conditions as the first. Four days after the second transduction, the cells are recovered and the percentage of cells expressing PD1 is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec) after immunolabelling of the cells with the antiPD1 antibody (Miltenyi Biotec).

(318) Viability is analysed by adding Viobility Fixable Dyes (Miltenyi Biotec) just before FACS analysis of the cells, and the phenotyping of the lymphocytes is carried out by immunolabelling of the cells with the anti-TCR and antiCD25 antibodies (Miltenyi Biotec).

(319) II. Results

(320) The purpose of this experiment is to evaluate the effectiveness of the CRISPR/Cas9 system delivered by the MS2RLP particles for knock-out of an endogenous gene of primary cells, for example the PD1 gene in activated primary T lymphocytes (FIG. 24).

(321) The PD1 gene receives particular attention in the tumoral context since extinction of expression of PD1 allows recognition of tumour cells by the immune system.

(322) When the cells are transduced with the MS2 (NC)-RLP 12X 2X particles delivering the complete CRISPR/Cas9 system, four days after the second transduction, a decrease is noted in the number of cells expressing the protein PD1 of 31% in the case of the first dose (0.1 pg p24/cell), 60% in the case of the second dose (0.5 pg p24/cell), 75% in the case of the third dose (1 pg p24/cell) and 86% in the case of the fourth dose (5 pg p24/cell). In parallel, MS2RLP expressing only Cas9 is used as negative control of knock-out of the PD1 gene. The results show that the percentage of cells expressing the PD1 protein is stable, whatever the dose of MS2RLP 12X 2X particles delivering the CRISPR/Cas9 system used.

(323) FIG. 25 shows the effectiveness of the ILV particle in delivering the CRISPR/Cas9 system for knock-out of the PD1 gene under conditions comparable to those used for delivering the CRISPR/Cas9 system using the MS2RLP 12X 2X particles. At the highest MOI used (MOI 50), 42% of the cells express the PD1 gene whereas at the highest dose of MS2RLP (5 pg p24/cell), there only remain 14% of cells expressing the PD1 gene. The MS2RLP particle is therefore the best tool for delivering the CRISPR/Cas9 system and allowing effective knock-out of an endogenous target.

(324) FIGS. 24 and 25 were obtained from transduction of activated human T lymphocytes, which are primary cells, and are therefore sensitive and delicate for any manipulation. FIG. 26 illustrates measurement of the viability of the T lymphocytes, after the first and the second transduction with the MS2RLP 12X-2X particles delivering the CRISPR/Cas9 system. FIG. 26 allows determination of the optimum dose of MS2RLP 12X 2X particles delivering the CRISPR/Cas9 system, corresponding to 1 pg p24/cell, in order to obtain effective knock-out of the PD1 gene (FIG. 24, 75% knock-out of the PD1 gene) without affecting the viability of the activated T lymphocytes.

(325) FIG. 27 illustrates analysis of the phenotype of the T lymphocytes, after the second transduction with the MS2RLP 12X-2X particles delivering the CRISPR/Cas9 system, by measuring the expression of the TCR and the CD25 activation marker. The results show that the percentage of cells expressing TCR and CD25 is stable, whatever the dose of MS2RLP particles used.

(326) In conclusion, FIGS. 24, 26 and 27 show that the MS2RLP particles are the best tool for delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas9) while preserving the viability and the phenotype of the T lymphocytes transduced.

EXAMPLE 10: EFFECTIVENESS OF AN MS2RLP PARTICLE IN DELIVERING THE CRISPR/CAS9 SYSTEM (GUIDE RNA+RNA CODING CAS9) INTO ACTIVATED PRIMARY T LYMPHOCYTES, FOR KNOCK-OUT OF THE CXCR4 GENE

(327) I. Material & Methods

(328) 1. Plasmid Construction

(329) 1.1 Plasmids for Producing MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(330) Expression Plasmid for a Sequence of Interest:

(331) The expression plasmids described in Example 1 (the expression cassette of which is illustrated in FIG. 1, pcDNA-EF1-Cas9-MS2 12X) and in FIG. 28, pcDNA-U6-Guide_antiCXCR4Chimeric-MS2 2X, were used for co-encapsidating, in the same MS2RLP 12X 2X particle, both the RNA coding Cas9 and the guide RNA under the control of the U6 promoter, targeting the sequence of the CXCR4 gene integrated into the genome of the primary T lymphocytes.

(332) Encapsidation Plasmid:

(333) The lentiviral particle was modified to contain the sequence of the Coat protein of the MS2 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the MS2RLP 12X-2X particles is modified in accordance with the strategy Illustrated in FIG. 2a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the MS2 bacteriophage by HpaI cloning, to generate the p8.74ZF-MS2-Coat plasmid. This gives the construct illustrated in FIG. 2b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the MS2RLPs.

(334) Envelope Plasmid (pENV):

(335) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(336) These plasmids are used for producing MS2 (NC)-RLP 12X 2X lentiviral particles according to the invention. More particularly, these plasmids are used for producing MS2RLP-Cas9 12X-GuideantiCXCR4Chimeric 2X lentiviral particles.

(337) 1.2 Plasmids for Producing Control MS2-(NC)-RLP 12X Lentiviral Particles According to the Invention

(338) These plasmids are prepared by a method identical to that in Example 1. More particularly, these plasmids are used for producing MS2RLP-Cas9 12X lentiviral particles, as described in paragraph 1.1 of Example 1.

(339) 2. Production of the Batches of Lentiviral Particles

(340) After transfection of the plasmids on producer cells, the supernatants are harvested and used crude or concentrated/purified according to one of the aforementioned methods P1 or P2, described in application WO 20131014537.

(341) 2.1 Production of the Lentiviral Articles

(342) Production is carried out in a 10-stack CellSTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2.

(343) The MS2 (NC)-RLP 12X-2X particles are produced by transfection of the following four plasmids: The two expression plasmids described above of which pcDNA-U6-Guide_antiCXCR4Chimeric-MS2 2X plasmid (the expression cassette of which is illustrated in FIG. 28) is used in double the quantity of the pcDNA-EF1-Cas9-MS2 12X plasmid (the expression cassette of which is illustrated in FIG. 1); p8.74ZF-MS2-Coat; pENV bearing the envelope VSV-G.

(344) The proportion of plasmids used is identical to that in Example 4.

(345) More particularly, these plasmids are used for producing the MS2RLP-Cas9 12X-GuideantiCXCR4Chimeric 2X lentiviral particles.

(346) 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stencup, Millipore). All the collections are then pooled to compose the crude supernatant.

(347) The control MS2-(NC)RLP 12X lentiviral particles are produced as described in Example 1.

(348) 2.2 Concentration and Purification of the Lentiviral Particles

(349) The particles are concentrated and purified according to method P2 described in Example 1.

(350) 3. Titration of the Physical Particles by ELISA p24 Assay

(351) The p24 capsid protein is detected directly on the viral supernatant using, and following the recommendations of, the HIV-1 p24 ELISA kit (Perkin Elmer). The p24 protein captured is complexed with a biotinylated polydonal antibody, and then detected by a streptavidin conjugated with horseradish peroxidase (HRP). The resultant complex is detected by spectrophotometry after incubation with the ortho-phenylenediamine-HCl substrate (OPD) producing a yellow coloration that is directly proportional to the quantity of p24 protein captured. The absorbance of each well is quantified on the Synergy H1 Hybrid plate reader (Biotek) and calibrated against the absorbance of a standard range of p24 protein. The viral titre expressed as physical particles per ml is calculated from the concentration of p24 protein obtained, knowing that 1 g of p24 protein corresponds to 10.sup.4 physical particles.

(352) 4. Preparation of the Target Cells and Transduction by MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(353) This example aims to show that it is possible to co-encapsidate, in the same MS2RLP 12X-2X particle, both the RNA coding Cas9 and the guide RNA targeting the sequence of the CXCR4 gene, and then transfer these different RNAs via the MS2 (NC)-RLP 12X-2X particles into the target cells, activated primary T lymphocytes. At the end of this transfer of RNA, the CRISPR/Cas9 system should be functional and generate breaks of double-stranded DNA allowing knock-out of the target CXCR4 gene using one and the same tool for transfer of the 2 constituents of the CRISPR/Cas9 system.

(354) 4.1 Preparation of the Target Cells, Activated Primary T Lymphocytes

(355) The T lymphocyte target cells are prepared from a peripheral blood sample. The mononuclear cells of the peripheral blood are isolated by Ficoll gradient centrifugation, and then undergo adherence for 2 hours at 37 C./5% CO.sub.2 in a T75 flask. The cells in suspension are recovered, and the T lymphocytes are purified by negative selection using magnetic beads (Pan T cell isolation kit, Miltenyi Biotec). The purified T lymphocytes are activated for 24 hours (Dynabeads Human T-Activator CD3/CD28, ThermoFisher) at 37 C./5% CO.sub.2.

(356) 4.2 Transduction of the Target Cells. Activated Primary T Lymphocytes

(357) The target cells, activated primary T lymphocytes, are seeded in a 96-well plate at 1 000 000 cells/mL and transduced by the MS2RLP 12X 2X particles delivering both Cas9 and the guide, or by the MS2RLP 12X particles delivering only Cas9 (negative control), in the presence of 8 g/mL Polybrene, at different doses (0.1; 0.5; 1 or 5 pg p24/cell). A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2RLP 12X 2X and MS2RLP 12X particles.

(358) The transduction supernatant is removed 4 hours later and replaced with fresh supplemented culture medium. 48 hours later, a second transduction is carried out under the same conditions as the first. Four days after the second transduction, the cells are recovered and the percentage of cells expressing CXCR4 is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec) after immunolabelling of the cells with the antiCXCR4 antibody (Miltenyi Biotec).

(359) Viability is analysed by adding Viobility Fixable Dyes (Miltenyi Biotec) just before FACS analysis of the cells, and phenotyping of the lymphocytes is carried out by immunolabelling of the cells with the anti-TCR and antiCD25 antibodies (Miltenyi Biotec).

(360) II. Results

(361) The purpose of this experiment is to evaluate the effectiveness of the CRISPR/Cas9 system delivered by the MS2RLP particles for knock-out of an endogenous gene of primary cells, for example the CXCR4 gene in activated primary T lymphocytes (FIG. 29).

(362) The CXCR4 gene is a target of interest since extinction of its expression in CD4+ T lymphocytes allows blocking of infection by the HIV-1 virus.

(363) When the cells are transduced with the MS2 (NC)-RLP 12X 2X particles delivering the complete CRISPR/Cas9 system, four days after the second transduction, a decrease is noted in the number of cells expressing the CXCR4 protein of 92% in the case of the first dose (0.1 pg p24/cell), 97% in the case of the second dose (0.5 pg p24/cell), 98% in the case of the third dose (1 g p24/cell) and 99% in the case of the fourth dose (5 pg p24/cell).

(364) In parallel, MS2RLP expressing only Cas9 is used as negative control of knock-out of the CXCR4 gene. The results show that the percentage of cells expressing the CXCR4 protein is stable, whatever the dose of MS2RLP 12X particles delivering only the Cas9 protein.

(365) FIGS. 30 and 31 were obtained from transduction of activated human T lymphocytes, which are primary cells, and are therefore sensitive and delicate for any manipulation. FIG. 30 illustrates measurement of the viability of the T lymphocytes, after the first and the second transduction with the MS2RLP 12X-2X particles delivering the CRISPR/Cas9 system. It is observed that the viability of the T lymphocytes is not altered by the transduction(s) with the MS2RLP 12X 2X particles, whatever the dose used.

(366) The optimum dose of MS2RLP 12X 2X particles delivering the CRISPR/Cas9 system corresponds to 5 pg p24/cell, and makes it possible to obtain effective knock-out of the CXCR4 gene (FIG. 29, 99% knock-out of the CXCR4 gene) without affecting the viability of the activated T lymphocytes.

(367) FIG. 31 illustrates analysis of the phenotype of the T lymphocytes, after the second transduction with the MS2RLP 12X 2X particles delivering the CRISPR/Cas9 system for knock-out of the CXCR4 gene, by measuring the expression of the TCR and the CD25 activation marker. The results show that the percentage of cells expressing TCR and CD25 is stable, whatever the dose of MS2RLP particles used.

(368) In conclusion, FIGS. 29, 30 and 31 show that the MS2RLP particles are the best tool for delivering the CRISPR/Cas9 system (guide RNA+RNA coding Cas9) while preserving the viability and the phenotype of the T lymphocytes transduced.

EXAMPLE 11: DOSE EFFECT OF AN MS2RLP PARTICLE DELIVERING THE CRISPR/CAS9 SYSTEM (GUIDE RNA+RNA CODING CAS91 IN HCT116-GFP CELLS

(369) I. Material & Methods

(370) 1. Plasmid Construction

(371) 1.1 Plasmids for Producing MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(372) These plasmids are prepared by a method identical to that in Example 8. More particularly, these plasmids are used for producing MS2RLP-Cas9 12X-GuideD1Chimeric 2X lentiviral particles.

(373) 1.2 Plasmids for Producing ILV-GFP Integrative Lentiviral Vectors for Generating the HCT116-GFP Clone D2 Target Cells

(374) These plasmids are prepared by a method identical to that in Example 1.

(375) 2. Production of Batches of Lentiviral Particles and Lentiviral Vectors

(376) After transfection of the plasmids on producer cells, the supernatants are harvested and used crude or concentrated/purified according to one of the aforementioned methods P1 or P2 as described in application WO 2013/014537.

(377) 2.1 Production of the Lentiviral Particles and Lentiviral Vectors

(378) The MS2RLP 12X 2X lentiviral particles are produced by the method described in Example 4.

(379) The ILV-GFP lentiviral vectors are produced as described in Example 1.

(380) 2.2 Concentration and Purification of the Lentiviral Particles and Lentiviral Vectors

(381) The lentiviral particles and the lentiviral vectors are concentrated and purified according to method P1 described in Example 1.

(382) 3. Titration of the Batches of Lentiviral Particles and Lentiviral Vectors

(383) The lentiviral particles and the lentiviral vectors are titrated by the method described in Example 1.

(384) 4. Generation of Target Cells and Transduction by MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(385) This example aims to show that an MS2RLP 12X 2X particle delivering the CRISPR Cas9 system in target cells has a dose effect on the effectiveness of genome editing. At the end of this transfer of RNA, the CRISPR/Cas9 system should be functional and generate breaks of double-stranded DNA allowing knock-out of the target gene, and thus transform the GFP+ cells into GFP cells, using one and the same tool for transfer of the 2 constituents of the CRISPR/Cas9 system.

(386) 4.1 HCT116-GFP cloneD2 Target Cells

(387) This done is prepared by a method identical to that in Example 1.

(388) 4.2 Transduction of the HCT116-GFP CloneD2 Target Cells by the MS2 (NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(389) The HCT116-GFP CloneD2 target cells are seeded in a 24-well plate at 25000 cells/cm.sup.2 and incubated for 24 h at 37 C./5% CO.sub.2. The HCT116-GFP CloneD2 target cells are transduced by the MS2RLP-Cas9 12X-GuideD1Chimeric 2X particles, delivering both Cas9 and the chimeric guide D1, at different doses (0.5; 1; 5 or 10 pg p24/cell) in the presence of 8 g/mL Polybrene. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2RLP 12X 2X particles. The transduction supernatant is removed 5 hours later and replaced with fresh supplemented culture medium. A second transduction was carried out under the same conditions 6 days after the first transduction (FIG. 33). 7 days after the last transduction, the cells are recovered and the percentage of cells expressing GFP is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(390) II. Results

(391) The purpose of this experiment is to study the ability of the MS2RLP 12X 2X particles according to the invention to induce a dose effect on genome editing, by simultaneously transferring RNAs coding Cas9 and guide RNAs at various concentrations and measuring the extinction of the GFP in HCT116-GFP CloneD2's, with a first transduction (FIG. 33, % of T1 positive cells) and a second transduction (FIG. 33, % of T2 positive cells).

(392) Firstly, the results presented in FIG. 33 show that the HCT116-GFP CloneD2 target cells are 100% fluorescent whereas the non-transduced (NT) HCT116 cells are not fluorescent. When the cells are transduced with the MS2RLP 12X 2X particles delivering the complete CRISPR/Cas9 system, 7 days after the second transduction of the cells (FIG. 33, % of T2 positive cells), a decrease is noted in the number of fluorescent cells following a dose effect. Stronger extinction of the GFP is observed after the second transduction than after the first transduction whatever the dose of pg p24/cell (0.5, 1, 5 or 10).

(393) After the second transduction, there is knock-out of the GFP gene of the order of 33% for a dose of 0.5 pg p24/cell, knock-out of the GFP gene of the order of 39% for 1 pg p24/cell, knock-out of the GFP gene of the order of 58% for 5 pg p24/cell and finally knock-out of the GFP gene of the order of 65% at 10 g p24/cell. A second transduction therefore allows the effectiveness of knock-out of the GFP to be increased with respect to the first transduction. The higher the dose of MS2RLP 12X 2X particles, the greater the knock-out of the GFP.

EXAMPLE 12: EFFECTIVENESS OF A PP7RLP PARTICLE IN DELIVERING THE CRISPR/CAS9 SYSTEM (GUIDE RNA+RNA CODING CAS91 IN HCT116-GFP CELLS

(394) I. Material & Methods

(395) 1. Plasmid Construction

(396) 1.1. Plasmids for Producing PP7 (NC)-RLP 2X Lentiviral Particles According to the Invention

(397) In this Example, the PP7 (NC)-RLP 2X particles will be called PP7 (NC)-RLP 2X 2X as they comprise two different series of stem-loop motifs of PP7 (1st series of motifs: SEQ ID No.2 followed by SEQ ID No.4 and 2nd series of motifs: SEQ ID No.5 followed by SEQ ID No.6).

(398) Expression Plasmids for a Sequence of Interest:

(399) The first expression plasmid bears an expression cassette as described in FIG. 34 (pcDNA-EF1-Cas9-PP7 2X), with or without an intron sequence or RNA stabilizing sequence. In order to transport the mRNAs into the lentiviral particles, 2 repetitions of the stem-loop motif of the PP7 RNA (ctagaaaggagcagacgatatggcgtcgctccctgcag SEQ ID No.2 and ctagaaaccagcagagcatatgggctcgctggctgcag SEQ ID No.4) were inserted in an expression cassette downstream of the sequence of the Cas9 enzyme (FIG. 34). The promoter used is the EF1 promoter (FIG. 34) but other promoters may be used. The plasmid sequence of interest is a DNA coding the RNA of the Cas9 protein (FIG. 34), in its wild-type form (WT) or in its mutated form (N).

(400) The second expression plasmid bears an expression cassette as described in FIG. 35 (pcDNA-U6-GuideD1Chimeric-PP7 2X), with or without an intron sequence or RNA stabilizing sequence. In order to transport the guide RNAs into the lentiviral particles, 2 repetitions of the stem-loop motif of the PP7 RNA (ggagcagacgatatggcgtcgctcc SEQ ID No.5 and ccagcagagcatatgggctcgctgg SEQ ID No.6) were inserted in an expression cassette in the part of the scaffold of the guide (chimeric guide, FIG. 35). The promoter used is U6 but other promoters may be used, such as promoter H1. Use of a promoter of the RNA pol III dependent type, such as H1 or U6, requires the presence of a transcription termination signal (Term). The sequence of interest is a non-coding RNA targeting the sequence of the GFP (sgRNA=guide RNA).

(401) These expression plasmids were used for co-encapsidating, in the same PP7RLP 2X particle, both the RNA coding Cas9 and the guide RNA targeting the sequence of the GFP integrated into the genome of the target cells (HCT116-GFP CloneD2).

(402) Encapsidation Plasmid:

(403) The lentiviral particle was modified to contain, in the nucleocapsid protein, in place of the second Zn finger domain, the sequence of the Coat protein of the bacteriophage PP7. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the PP7RLP 2X particles is modified in accordance with the strategy illustrated in FIG. 36a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the PP7 bacteriophage by HpaI cloning, to generate the p8.74ZF-PP7-Coat plasmid. This gives the construct illustrated in FIG. 36b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the PP7RLP 2X 2X.

(404) Envelope Plasmid (pENV):

(405) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(406) More particularly, these plasmids are used for producing PP7RLP Cas9 2X-GuideD1Chimeric 2X lentiviral particles.

(407) 1.2. Plasmids for Producing ILV-GFP Integrative Lentiviral Vectors for Generating the HCT116-GFP Clone D2 Target Cells

(408) These plasmids are prepared by a method identical to that in Example 1.

(409) 2. Production of Batches of Lentiviral Particles and Lentiviral Vectors

(410) After transfection of the plasmids on producer cells, the supernatants are harvested and used crude or concentrated/purified according to one of the aforementioned methods P1 or P2 as described in application WO 2013/014537.

(411) 2.1 Production of the Lentiviral Particles and Lentiviral Vectors

(412) Production is carried out in a 10-stack CellSTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2.

(413) The PP7 (NC)-RLP 2X 2X particles, preferably PP7RLP-Cas9 2X-GuideD1Chimeric 2X, are produced by transfection of the following four plasmids: The two expression plasmids described above, of which pcDNA-U6-GuideD1Chimeric-PP7 2X plasmid (the expression cassette of which is illustrated in FIG. 35) is used in double the quantity of the pcDNA-EF1-Cas9-PP7 2X plasmid (the expression cassette of which is illustrated in FIG. 34); p8.74ZF-PP7-Coat (the expression cassette of which is illustrated in FIG. 36b); pENV bearing the envelope VSV-G (the expression cassette of which is illustrated in FIG. 3).

(414) The PP7 (NC)-RLP 2X 2X particles are produced by the method described in Example 4. 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stericup, Millipore). All the collections are then pooled to compose the crude supernatant.

(415) The ILV-GFP lentiviral vectors are produced as described in Example 1.

(416) 2.2 Concentration and Purification of the Lentiviral Particles and Lentiviral Vectors

(417) The lentiviral particles and the lentiviral vectors are concentrated and purified according to method P1 described in Example 1.

(418) 3. Titration of the Batches of Lentiviral Particles and Lentiviral Vectors

(419) The lentiviral particles and the lentiviral vectors are titrated as described in Example 1.

(420) 4. Generation of Target Cells and Transduction by PP7 (NC)-RLP 2X 2X Lentiviral Particles According to the Invention

(421) This example aims to show that a PP7RLP particle delivering the CRISPR Cas9 system to target cells has a dose effect on the effectiveness of genome editing. At the end of this transfer of RNA, the CRISPR/Cas9 system should be functional and generate breaks of double-stranded DNA allowing knock-out of the target gene, and thus transform the GFP+ cells into GFP cells, using one and the same tool for transfer of the 2 constituents of the CRISPR/Cas9 system.

(422) 4.1 HCT116-GFP cloneD2 Target Cells

(423) This done is prepared by a method identical to that in Example 1.

(424) 4.2 Transduction of the HCT116-GFP CloneD2 Target Cells by PP7 (NC)-RLP 2X 2X Lentiviral Particles According to the Invention

(425) The HCT116-GFP CloneD2 target cells are seeded in a 24-well plate at 25000 cells/cm.sup.2 and incubated for 24 h at 37 C./5% CO.sub.2. The HCT116-GFP CloneD2 target cells are transduced by the PP7RLP 2X 2X particles delivering both Cas9 and the guide D1Chimeric at different doses (0.5; 1; 5 or 10 g p24/cell) in the presence of 8 g/mL Polybrene. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the PP7RLP 2X 2X particles. The transduction supernatant is removed 17 hours later and replaced with fresh supplemented culture medium. A second transduction was carried out under the same conditions 6 days after the first transduction (FIG. 37). 7 days after the last transduction, the target cells are recovered and the percentage of cells expressing GFP is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(426) II. Results

(427) The purpose of this experiment is to study the ability of the PP7RLP particles to induce a dose effect on genome editing, by simultaneously transferring an RNA coding Cas9 and a guide RNA targeting the sequence coding the protein GFP at different concentrations and by measuring the extinction of the GFP in HCT116-GFP CloneD2's by cytometry, with a first transduction (FIG. 37, % of T1 positive cells) and a second transduction (FIG. 37, % of T2 positive cells).

(428) Firstly, the results presented in FIG. 37 show that the non-transduced (NT) HCT116 cells are not fluorescent, whereas the HCT116-GFP cloneD2 target cells are 100% fluorescent. When the HCT116-GFP doneD2 cells are transduced with the PP7RLP 2X particles delivering the complete CRISPR/Cas9 system, 7 days after the first and the second transduction of the target cells (FIG. 37, % of T2 positive cells), a decrease is noted in the number of fluorescent cells following a dose effect. Just as for the MS2RLP particles, a stronger extinction of the GFP is observed after the second transduction than after the first transduction whatever the number of pg p24/cell (0.5, 1, 5 or 10).

(429) After the second transduction, there is knock-out of the GFP gene of the order of 33% for a dose of 0.5 pg p24/cell, of the order of 54% for 1 pg p24/cell, of the order of 85% for 5 pg p24/cell and finally of the order of 75% at 10 pg p24/cell. A second transduction therefore allows the effectiveness of knock-out of the GFP to be increased with respect to the first transduction. The higher the dose of PP7RLP particles, the greater the knock-out of the GFP, reaching a maximum effectiveness of extinction at a dose of 5 pg p24/cell. Moreover, the PP7RLP particles have an off-target effect as described in Example 4, between the doses of PP7RLP particles 5 pg p24/cell and 10 pg p24/cell. The dose and the number of transductions used are therefore important factors to be taken into account for the effectiveness of the PP7RLP particles in delivering the complete CRISPR/Cas9 system.

(430) The PP7RLP particles give a higher percentage extinction of the GFP in the HCT116-GFP cloneD2 target cells than the MS2RLP particles (FIG. 37 and FIG. 22 respectively). At the optimum dose of each particle, knock-out of the GFP gene of the order of 85% for 5 pg p24/cell of PP7RLP particles vs. 82% for 10 pg p24/cell of MS2RLP particles is noted, or a twice higher dose than for the PP7RLP particles. The effectiveness of the PP7RLP particles makes it possible to optimize CRISPR/Cas9 RNA transfer, in particular in delicate primary cells, which may be sensitive to several transductions. In conclusion, these PP7RLP particles mark themselves out as being the best tool for co-delivering the CRISPR/Cas9 system, with the use of a single type of particles.

EXAMPLE 13: IMPACT OF THE WILD-TYPE GAG-POL PRECURSOR FOR PRODUCTION OF THE MS2RLP-ZSGREEN1 12X PARTICLES WITH A VIEW TO OPTIMIZATION OF THE EFFECTIVE MS2RLP-CRISPR/CAS9 PARTICLES (GUIDE RNA+RNA CODING CAS9)

(431) I. Material & Methods

(432) 1. Plasmid Construction

(433) 1.1 Plasmid for Producing an MS2RLP 12X Lentiviral Particle According to the Invention

(434) Expression Plasmid for a Sequence of Interest:

(435) The expression plasmid bears an expression cassette (as described in FIG. 38) with or without an intron sequence or RNA stabilizing sequence. In order to transport the RNAs into the lentiviral particles, 12 repetitions of the stem-loop motif of the MS2 RNA (ctagaaaacatgaggatcacccatgtctgcag, SEQ ID No.1) were inserted in an expression cassette downstream of the sequence of the ZsGreenI protein. The promoter used is the EF1 promoter but other promoters may be used. The plasmid sequence of interest is a DNA coding the RNA of the ZsGreenI protein.

(436) Encapsidation Plasmids:

(437) The first encapsidation plasmid is the p8.74ZF plasmid of which expression cassette is described in FIG. 2b, obtained by modification of the p8.74 encapsidation plasmid to contain, in the nucleocapsid protein, in place of the second Zn finger domain, the sequence of the Coat protein of the MS2 bacteriophage, according to the strategy Illustrated in FIG. 2a and as described in Example 1.

(438) The second encapsidation plasmid is the p8.74 plasmid, bearing the genes coding the wild-type structural and functional proteins (Gag, Pol), as presented in FIG. 6.

(439) Envelope Plasmid (pENV):

(440) This plasmid bears the gene coding an envelope protein, which may be VSVG coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(441) More particularly, these plasmids are used for producing MS2RLP-ZsGreenI12X lentiviral particles.

(442) 1.2 Plasmid for Producing Control Integrative Lentiviral Vectors ILV-ZsGreenI

(443) Expression Plasmid for a Sequence of Interest:

(444) The expression plasmid bears an expression cassette as described in FIG. 41. This plasmid may contain other elements such as the native sequence WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) or the cPPT/CTS sequence. Viral pathogenicity is eliminated by substitution of regions of the viral genome required for retroviral replication by the transgene. The promoter used is the EF1 promoter, but other promoters may be used. The plasmid sequence of interest is a DNA coding the RNA of the ZsGreenI protein.

(445) Encapsidation Plasmid:

(446) The p8.74 encapsidation plasmid, bearing the genes coding the structural and functional proteins (Gag, Pol), is used for production of the integrative lentiviral vectors (FIG. 6).

(447) Envelope Plasmid (pENV):

(448) This plasmid is identical to the envelope plasmid used for producing MS2RLP lentiviral particles (FIG. 3).

(449) 2. Production of Batches of Lentiviral Particles and Lentiviral Vectors

(450) 2.1 Production of the Lentiviral Particles

(451) Production is carried out in a 10-stack CellISTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2.

(452) The MS2RLP 12X particles are produced by transfection of the following four plasmids: The expression plasmid described above, of which the expression cassette is illustrated in FIG. 38; p8.74ZF-MS2-Coat (the expression cassette of which is illustrated in FIG. 2b) and the p8.74 plasmid (the expression cassette of which is illustrated in FIG. 6), using four different ratios of the two encapsidation plasmids, [100%-0%]; [90%-10%]; [80%-20%] and [50%-50%], respectively; pENV bearing the envelope VSV-G (the expression cassette of which is illustrated in FIG. 3).

(453) The MS2RLP-ZsGreenI 12X lentiviral particles are produced as described in Example 1, i.e. with the following respective proportions of the plasmids: 40% of the expression plasmid, 30% of the p8.74 plasmid (or p8.74ZF), 30% of the pENV plasmid (ratio [100%-0%]).

(454) More particularly, the respective proportions of the plasmids are as follows: ratio [90%-10%]:40% of the expression plasmid, 27% of the p8.74ZF plasmid, 3% of the p8.74 plasmid, 30% of the pENV plasmid; ratio [80%-20%]:40% of the expression plasmid, 24% of the p8.74ZF plasmid, 6% of the p8.74 plasmid, 30% of the pENV plasmid; ratio [50%-50%]:40% of the expression plasmid, 15% of the p8.74ZF plasmid, 15% of the p8.74 plasmid, 30% of the pENV plasmid.

(455) In the case of the production of an MS2 (NC)-RLP 12X 2X particle for transferring the complete CRISPR/Cas9 system, the particles are produced by the method as described in Example 8. More particularly, the respective proportions of the plasmids are as follows: 33% of the expression plasmid coding the guide, 17% of the expression plasmid coding Cas9 (the quantity of expression plasmid coding the guide is doubled with respect to that of the expression plasmid coding Cas9), 25% of the p8.74ZF plasmid, 25% of the pENV plasmid (ratio [100%-0%]), More particularly, the respective proportions of the plasmids are as follows: ratio [90%-10%]:40% of the expression plasmid, 22.5% of the p8.74ZF plasmid, 2.5% of the p8.74 plasmid, 30% of the pENV plasmid; ratio [80%-20%]:40% of the expression plasmid, 20% of the p8.74ZF plasmid, 5% of the p8.74 plasmid, 30% of the pENV plasmid ratio [50%-50%]:40% of the expression plasmid, 12.5% of the p8.74ZF plasmid, 12.5% of the p8.74 plasmid, 30% of the pENV plasmid

(456) More particularly, these plasmids are used for producing the MS2RLP-ZsGreenI 12X lentiviral particles.

(457) The integrative lentiviral vectors ILV-ZsGreenI containing the EF1-ZsGreenI expression cassette are produced as a control.

(458) For the ILV-ZsGreenI batches, the transfection mixture consists of the following three plasmids: the expression plasmid of which the expression cassette is illustrated in FIG. 40 the p8.74 plasmid (of which the expression cassette is illustrated in FIG. 6) the pENV plasmid bearing the envelope VSV-G (of which the expression cassette is illustrated in FIG. 3).

(459) 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stericup, Millipore). All the collections are then pooled to compose the crude supernatant.

(460) 2.2 Concentration and Purification of the Lentiviral Particles

(461) The lentiviral particles and the lentiviral vectors are concentrated and purified according to method P1 described in Example 1.

(462) 3. Titration of the Batches of Lentiviral Particles and Lentiviral Vectors

(463) The lentiviral particles and the lentiviral vectors are titrated as described in Example 1.

(464) 4. Preparation of the Target Cells and Transduction by MS2RLP 12X Lentiviral Particles According to the Invention

(465) Jurkat target cells (ATCC TIB-152) are seeded at 200000 cells/mL in a 96-well plate, transduced by the MS2RLP 12X particles at two doses (2 and 10 g p24/cell), or by control ILV-ZsGreenI lentiviral vectors at MOI40, in the presence of 4 g/mL Polybrene and then incubated at 37 C./5% CO.sub.2. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2RLP 12X particles. The transduction supernatant is removed 5 hours later and replaced with fresh supplemented culture medium. 24 h post-transduction, the target cells are recovered and the percentage of cells expressing ZsGreenI is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(466) 5. Analysis of Maturation of the MS2RLP Viral Particles by Anti-p24 Western Blot

(467) 48 h after transfection of the producer cells (HEK293T) with the plasmids for producing the MS2RLP 12X particles, the culture supernatants are recovered and then concentrated according to method P1, as described in Example 1, and titrated by quantification of the p24 protein, as described in Example 1. The equivalent of 15 ng of p24 is loaded for each condition of ratio of the plasmids p8.74ZF-MS2-Coat/p8.74 on an SDS-PAGE 4/12% denaturing gel and then migrated for 1 h at 200V in MOPS1X buffer. After transfer onto a nylon membrane, the proteins are hybridized with an anti-p24 antibody [clone 39/5.4 A, Abcam). The Western blot is developed using the Pierce Fast Western Blot Kit, ECL Substrate (Pierce). The bands are visualized by chemiluminescence on autoradiography film.

(468) II. Results

(469) This example aims to show that it is possible to improve the functionality of the MS2RLP particles by improving the maturation of the GAG precursor during production of the particles, demonstrated by the proof of concept on the production of MS2RLP 12X particles. The p8.74ZF-MS2 plasmid allows expression of a GAG precursor comprising the Coat protein of the bacteriophage in place of the second zinc finger of the Nucleocapsid protein. This Coat protein is likely to disturb the maturation of the GAG precursor, when it is cleaved into three proteins: the Matrix protein, the Capsid protein and the Nucleocapsid protein. These three proteins are indispensable to the structure of the viral particles.

(470) Supply of the wild-type GAG precursor by the p8.74 plasmid in addition to the p8.74ZF-MS2-Coat encapsidation plasmid during production of the MS2RLP-ZsGreenI 12X particles might allow enhancement of the maturation of the GAG precursor when it is expressed owing to the p8.74ZF-MS2 plasmid, and thus increase the functionality of the MS2RLP particles.

(471) The purpose of this experiment is to evaluate the impact of the p8.74 plasmid when it is co-transfected, in the producer cells of the MS2RLP 12X particles, at the same time as the p8.74ZF-MS2-Coat encapsidation plasmid making it possible to improve the maturation of the GAG precursor, and thus make the final particles more functional for the transduction of target cells.

(472) In this example, four ratios of p8.74ZF-MS2-Coat/p8.74 encapsidation plasmids are tested:100/0; 90/10; 80/20 and 50/50. An integrative vector ILV expressing ZsGreenI is used as a control. The cells are transduced at two quantities of p24/ml:2 pg p24/cell (FIG. 41) and 10 pg p24/cell (FIG. 42).

(473) Firstly, the results presented in FIG. 41 show that for the cells that were not transduced, the percentage of fluorescent cells is very dose to 0, whereas the cells transduced by the MS2RLP-ZsGreenI 12X particles are fluorescent at more than 99% whatever ratio of encapsidation plasmids is used. It is important to note that the fluorescence intensity of ZsGreenI increases as a function of the increase in the quantity of p8.74 plasmid. The cells transduced by the MS2RLP-ZsGreenI 12X particles produced with 50% of the p8.74ZF-MS2-Coat encapsidation plasmid and 50% of the p8.74 plasmid have a fluorescence intensity of 7.76 whereas that of the cells transduced by the MS2RLP-ZsGreenI 12X particles produced only with the p8.74ZF-MS2-Coat encapsidation plasmid is 3.5.

(474) FIG. 42 shows the same result in terms of percentage of cells transduced. Regarding the fluorescence intensity, as the quantity of p8.74 plasmid increases, the fluorescence intensity increases, as shown in FIG. 41. The cells transduced by the MS2RLP-ZsGreenI 12X particles produced with 50% of the p8.74ZF-MS2-Coat encapsidation plasmid and 50% of the p8.74 plasmid have a fluorescence intensity of 60.67 whereas that of the cells transduced by the MS2RLP-ZsGreenI 12X particles produced only with the p8.74ZF-MS2-Coat encapsidation plasmid is 11.48.

(475) This signifies that at doses of 2 g and 10 pg p24/cell, the fluorescence obtained is two and five times greater, respectively, when the particles are produced with 50% of the p8.74ZF-MS2-Coat encapsidation plasmid and 50% of the p8.74 plasmid than when they are produced only with the p8.74ZF-MS2-Coat plasmid.

(476) Use of the p8.74 plasmid in the production of MS2RLP particles, in co-transfection with the p8.74ZF-MS2-Coat plasmid, therefore supplied a gain on the improvement of the functionality of the MS2RLP-ZsGreenI 12X particles, with a view to optimization of the MS2RLP particles.

(477) FIG. 43 shows the maturation of the MS2RLP-ZsGreenI 12X particles in biochemical terms, by searching for the p24 protein in the production supernatant containing the particles. It corresponds to an analysis of the viral supernatants by anti-p24 Western blot, at two exposure times of the autoradiography film, one minute (FIG. 43a) and fifteen seconds (FIG. 43b).

(478) In the case of an integrative lentiviral particle derived from HIV, produced solely with the p8.74 plasmid as encapsidation plasmid, the p24 protein is detectable at four levels: in the p160 protein precursor (GAG-POL) in the p55 protein precursor (GAG), in the mature protein state (p24) in other intermediate protein precursors in the course of maturation (between p160 and p55, and between p55 and p24).

(479) If maturation takes place normally, the p24 protein should be detected in larger quantities in the mature state (p24) than in the state of protein precursors (p160, p55) or of intermediate protein precursors. In fact, maturation of the viral particles takes place after release of the particle by the producer cell. In other words, during their production, the particles bud at the surface of the producer cell, and then are released from the cell in the state of immature particles. It is only after release of the particles in the supernatant that the GAG-POL and GAG protein precursors mature into definitive proteins.

(480) In the case of an MS2RLP 12X particle derived from HIV, produced solely with the p8.74ZF-MS2-Coat plasmid as encapsidation plasmid, the p24 protein is detectable at four levels: in the p172 protein precursor (GAGZF-MS2-Coat-POL) in the p67 protein precursor (GAGZF-MS2-Coat), in the mature protein state (p24) in other intermediate protein precursors in the course of maturation (between p172 and p67, and between p67 and p24).

(481) In this MS2RLP-ZsGreenI 12X particle, each precursor is heavier than 12 kDa, which corresponds to the size of the Coat protein of the MS2 bacteriophage inserted in the second zinc finger of the Nucleocapsid protein.

(482) FIG. 43 shows, on track ILV, the different forms of protein precursors, p160 (GAG-POL), p55 (GAG) as well as the perfectly mature p24 protein. There is a majority of mature p24 protein, compared to the protein precursor forms. On track 100/0, corresponding to MS2RLP-ZsGreenI 12X particles produced solely with the p8.74ZF-MS2-Coat plasmid as encapsidation plasmid, the proportion of precursors/mature p24 protein increases with respect to ILV, showing that insertion of the Coat protein of the MS2 bacteriophage decreases the maturation of the viral particles. On tracks 90/10, 80/20 and 50/50, the proportion of protein precursors p172 and p67 decreases to the benefit of the protein precursors p160 and p55 respectively, reaching one and the same expression level for track 50/50. Addition of the p8.74 plasmid to the p8.74ZF-MS2-Coat plasmid as encapsidation plasmid for producing particles results in an increase in the proportion of the mature p24 protein (FIG. 43b, 15 seconds of exposure). This result shows that to promote maturation of the protein precursors in the MS2RLP particles, it is necessary to add at least 10% of p8.74 plasmid in addition to the p8.74ZF-MS2-Coat plasmid as encapsidation plasmid for producing particles.

(483) In conclusion, production of the MS2RLP particles using at least 10% of p8.74 plasmid in addition to the p8.74ZF-MS2-Coat plasmid as encapsidation plasmid not only makes it possible to increase the maturation of the precursors into mature proteins, but in addition makes it possible to increase the functionality of the particles after transduction of target cells.

EXAMPLE 14: RECRUITMENT OF NON-VIRAL RNAS DIRECTED BY TWO DIFFERENT ENCAPSIDATION SEQUENCES (MS2 AND PP71 WITH A VIEW TO OPTIMIZATION OF TRANSFER OF THE CRISPR SYSTEM BY AN RLP PARTICLE (MODULATION OF THE TYPES OF RNA ENCAPSIDATED)

(484) I. Material & Methods

(485) 1. Plasmid Construction

(486) 1.1 Plasmids for Producing MS2/PP7(NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(487) Expression Plasmids for a Sequence of Interest:

(488) The first expression plasmid bears an expression cassette as described in FIG. 38, with or without an intron sequence or RNA stabilizing sequence. In order to transport the RNAs into the lentiviral particles, 12 repetitions of the stem-loop motif of the MS2 RNA (ctagaaaacatgaggatcacccatgtctgcag, SEQ ID No.1) were inserted in an expression cassette downstream of the RNA coding a reporter protein such as native firefly luciferase, a green fluorescent protein (ZsGreenI), a red fluorescent protein (mCherry) as described in FIG. 38, or a cDNA coding a protein, for example a nuclease, such as the Cas9 protein in its wild-type form (WT) or in its mutated form (N). The promoter used may be the CMV or EF1 promoter (FIG. 38) but other promoters may be used.

(489) The second expression plasmid bears an expression cassette as described in FIG. 39, with or without an intron sequence or RNA stabilizing sequence. In order to transport the mRNAs into the lentiviral particles, 2 repetitions of the stem-loop motif of the PP7 RNA (ctagaaaggagcagacgatatggcgtcgctccctgcag SEQ ID No.2 and ctagaaaccagcagagcatatgggctcgctggctgcag SEQ ID No.4) were inserted in an expression cassette downstream of the RNA coding a reporter protein such as native firefly luciferase, a green fluorescent protein (ZsGreenI), a red fluorescent protein (mCherry) as described in FIG. 39, or a cDNA coding a protein, for example a nuclease, such as the Cas9 protein in its wild-type form (WT) or in its mutated form (N). The promoter used may be the CMV or EF1 promoter (FIG. 39) but other promoters may be used.

(490) Encapsidation Plasmids:

(491) The lentiviral particle was modified to contain the sequence of the Coat protein of the MS2 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain, or PP7. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the MS2RLP 12X particles is modified in accordance with the strategy illustrated in FIG. 2a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the MS2 bacteriophage by HpaI cloning, to generate the p8.74ZF-MS2-Coat plasmid. This gives the construct illustrated in FIG. 2b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the MS2RLP 12X.

(492) The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the PP7RLP 2X particles is modified in accordance with the strategy illustrated in FIG. 36a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the PP7 bacteriophage by HpaI cloning, to generate the p8.74ZF-PP7-Coat plasmid. This gives the construct illustrated in FIG. 36b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the PP7RLP 2X.

(493) Envelope Plasmid (pENV):

(494) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(495) More particularly, these plasmids are used for producing MS2/PP7-RLP-mCherry 12X-ZsGreenI 2X lentiviral particles.

(496) 1.2 Plasmids for Producing Control MS2(NC)-RLP 12X Lentiviral Particles According to the Invention

(497) Expression Plasmid for a Sequence of Interest:

(498) The expression plasmid bears an expression cassette as described in FIG. 38 with or without an intron sequence or RNA stabilizing sequence. In order to transport the RNAs into the lentiviral particles, 12 repetitions of the stem-loop motif of the MS2 RNA (ctagaaaacatgaggatcacccatgtctgcag, SEQ ID No.1) were inserted in an expression cassette downstream of the RNA of a reporter protein such as native firefly luciferase, a green fluorescent protein (ZsGreenI), a red fluorescent protein (mCherry) as described in FIG. 38, or a cDNA coding a protein, for example a nuclease, such as the Cas9 protein in its wild-type form (WT) or in its mutated form (N). The promoter used may be the CMV or EF1 promoter (FIG. 38) but other promoters may be used.

(499) Encapsidation Plasmid:

(500) The lentiviral particle was modified to contain the sequence of the Coat protein of the MS2 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the MS2RLP 12X particles is modified in accordance with the strategy illustrated in FIG. 2a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the MS2 bacteriophage by HpaI cloning, to generate the p8.74ZF-MS2-Coat plasmid. This gives the construct illustrated in FIG. 2b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the MS2RLP 12X.

(501) Envelope Plasmid (pENV):

(502) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(503) More particularly, these plasmids are used for producing MS2RLP-mCherry 12X lentiviral particles.

(504) 1.3 Plasmids for Producing Control PP7(NC)-RLP 2X Lentiviral Particles According to the Invention

(505) Expression Plasmid for a Sequence of Interest:

(506) The expression plasmid bears an expression cassette as described in FIG. 39, with or without an intron sequence or RNA stabilizing sequence. In order to transport the mRNAs into the lentiviral particles, 2 repetitions of the stem-loop motif of the PP7 RNA (ctagaaaggagcagacgatatggcgtcgctccctgcag SEQ ID No.2 and ctagaaaccagcagagcatatgggctcgctggctgcag SEQ ID No.4) were inserted in an expression cassette downstream of the RNA coding a reporter protein such as native firefly luciferase, a green fluorescent protein (ZsGreenI), a red fluorescent protein (mCherry) as described in FIG. 39, or a cDNA coding a protein, for example a nuclease, such as the Cas9 protein in its wild-type form (WT) or in its mutated form (N). The promoter used may be the CMV or EF1 promoter (FIG. 39) but other promoters may be used.

(507) Encapsidation Plasmid:

(508) The lentiviral particle was modified to contain the sequence of the Coat protein of the PP7 bacteriophage in the nucleocapsid protein, in place of the second Zn finger domain. The p8.74 encapsidation plasmid bearing the genes coding the structural and functional proteins (Gag, Pol) used for production of the PP7RLP 2X particles is modified in accordance with the strategy illustrated in FIG. 36a: this p8.74 plasmid is used for generating, by assembly PCR, a plasmid lacking the second zinc finger of the p8.74ZF nucleocapsid protein. The second zinc finger is substituted by the Coat protein of the PP7 bacteriophage by HpaI cloning, to generate the p8.74ZF-PP7-Coat plasmid. This gives the construct illustrated in FIG. 36b. The Pol coding sequence may be deleted or mutated in certain functional elements such as for example the sequence coding reverse transcriptase (RT) or integrase (IN) without altering the function of the PP7RLP 2X.

(509) Envelope Plasmid (pENV):

(510) This plasmid bears the gene coding an envelope protein, which may be VSV-G coding the envelope protein of the Vesicular stomatitis virus (FIG. 3).

(511) More particularly, these plasmids are used for producing PP7RLP-ZsGreenI 2X lentiviral particles.

(512) 2. Production of the Batches of Lentiviral Particles

(513) After transfection of the plasmids on producer cells, the supernatants are harvested and used crude or concentrated/purified according to one of the aforementioned methods P1 or P2 as described in application WO 2013/014537.

(514) 2.1 Production of the Lentiviral Particles

(515) Production is carried out in a 10-stack CellISTACK (6360 cm.sup.2, Corning) with HEK293T producer cells (ATCC, CRL-11268), cultured in Dulbecco's Modified Eagle's Medium (DMEM, Gibco, Paisley, UK) supplemented with 1% penicillin/streptomycin and 1% of ultraglutamine (PAA) at 37 C. in a humid atmosphere at 5% CO.sub.2.

(516) The MS2/PP7(NC)-RLP 12X 2X, preferably MS2/PP7-RLP-mCherry 12X-ZsGreenI 2X, lentiviral particles are produced by transfection of the following five plasmids: The two expression plasmids described above including the pcDNA.EF1.mCherry.MS2 12X plasmid (the expression cassette of which is illustrated in FIG. 38) (50%) and the pcDNA.EF1.ZsGreenI.PP7 2X plasmid (of which the expression cassette is illustrated in FIG. 39) (50%), used in a single quantity; p8.74ZF-PP7-Coat (50%) of which the expression cassette is illustrated in FIG. 36b and p8.74ZF-MS2-Coat (50%) of which expression cassette is illustrated in FIG. 2b; pENV bearing the envelope VSV-G of which the expression cassette is illustrated in FIG. 3.

(517) The MS2/PP7 (NC)-RLP 12X 2X lentiviral particles are produced as described in Example 1, i.e. with the following respective proportions of the plasmids:40% of the expression plasmid, 30% of the p8.74 plasmid (or p8.74ZF), 30% of the pENV plasmid. More particularly, the respective proportions of the plasmids are as follows: 20% of the pcDNA.EF1.mCherry.MS2 12X expression plasmid, 20% of the pcDNA.EF1.ZsGreenI.PP7 2X expression plasmid, 30% of the p8.74ZF plasmid, 30% of the pENV plasmid.

(518) In the case of the production of an MS2/PP7 (NC)-RLP 12X 2X particle for transferring the complete CRISPR/Cas9 system, the particles are produced by the method as described in Example 8. More particularly, the respective proportions of the plasmids are as follows: 33% of the expression plasmid coding the guide, 17% of the expression plasmid coding Cas9 (the quantity of expression plasmid coding the guide is doubled with respect to that of the expression plasmid coding Cas9), 25% of the p8.74ZF plasmid and 25% of the pENV plasmid.

(519) The control MS2 (NC)-RLP 12X lentiviral particles, preferably MS2-RLP-mCherry 12X, are produced by transfection of the following three plasmids: The expression plasmid described above pcDNA.EF1.mCherry.MS2 12X (of which the expression cassette is illustrated in XXXVIII); p8.74ZF-MS2-Coat of which the expression cassette is illustrated in FIG. 2b; pENV bearing the envelope VSV-G of which the expression cassette is illustrated in FIG. 3.

(520) The MS2 (NC)-RLP 12X lentiviral particles are produced as described in Example 1.

(521) The control PP7 (NC)-RLP 2X lentiviral particles, preferably PP7-RLP-ZsGreenI 2X, are produced by transfection of the following three plasmids: The expression plasmid described above pcDNA.EF1.ZsGreenI.PP7 2X (of which the expression cassette is illustrated in FIG. 39); p8.74ZF-PP7-Coat of which the expression cassette is illustrated in FIG. 36b; pENV bearing the envelope VSV-G of which the expression cassette is illustrated in FIG. 3.

(522) The PP7(NC)-RLP 2X lentiviral particles are produced as described in Example 1.

(523) 24 hours after standard transfection with calcium phosphate, the culture supernatant is replaced with fresh unsupplemented DMEM medium. The producer cells are incubated at 37 C./5% CO.sub.2. After changing the medium, the supernatant is harvested four times (32 h, 48 h, 56 h and 72 h post-transfection). Each collection is clarified by 5 min centrifugation at 3000 g before being microfiltered on a 0.45 m filter (Stericup, Millipore). All the collections are then pooled to compose the crude supernatant.

(524) 2.2 Concentration and Purification of the Lentiviral Particles

(525) The lentiviral particles are concentrated and purified according to method P1 described in Example 1.

(526) 3. Titration of the Batches of Lentiviral Particles

(527) The lentiviral particles are titrated as described in Example 1.

(528) 4. Transduction by MS2PP7(NC)-RLP 12X 2X Lentiviral Particles According to the Invention

(529) This example is carried out using MS2/PP7(NC)-RLP 12X 2X particles allowing transfer of several types of RNAs and therefore expression of several different proteins (ZsGreenI+mCherry).

(530) HCT116 target cells (ATCC, CCL-247) were seeded in a 24-well plate and incubated for 24 h at 37 C./5% CO.sub.2 and were transduced by the MS2/PP7(NC)-RLP 12X 2X particles at a dose of 10 pg p24/cell.

(531) The controls carried out are as follows: transduction with the MS2RLP-mCherry 12X and PP7RLP-ZsGreenI 2X lentiviral particles, at a dose of 10 pg p24/cell each; transduction with the MS2RLP-mCherry 12X lentiviral particles alone, at a dose of 10 pg p24/cell; transduction with the PP7RLP-ZsGreenI 2X lentiviral particles alone, at a dose of 10 pg p24/cell.

(532) Transduction by the lentiviral particles is carried out in the presence of 8 g/mL of Polybrene. A cell defence mechanism inhibitor, BX795 (Invivogen), is used at a concentration of 6 M in the case of the MS2/PP7(NC)-RLP 12X 2X, MS2RLP-mCherry 12X and PP7RLP-ZsGreenI 2X particles. The target cells are recovered at 48 h post-transduction and the percentage of cells expressing ZsGreenI and mCherry is quantified by cytometry (Macs Quant VYB, Miltenyi Biotec).

(533) II. Results

(534) FIG. 44 illustrates the effectiveness of the MS2/PP7(NC)-RLP 12X 2X particles for transfer of RNAs encapsidated by the encapsidation sequences derived from the bacteriophages MS2 and PP7 into HCT116 target cells. The figure shows that the proportion of bifluorescent cells is 97% after transduction of the MS2/PP7(NC)-RLP 12X 2X particles, at a dose of 10 pg p24/cell, and 98% after transduction of the MS2RLP-mCherry 12X and PP7RLP-ZsGreenI 2X particles, at 20 pg p24/cell. Therefore the same order of transduction effectiveness is observed with the MS2/PP7(NC)-RLP 12X 2X particles, for a dose that is half that of MS2/PP7(NC)-RLP 12X 2X.

(535) The target cells transduced by the MS2RLP-mCherry 12X particles alone or PP7RLP-ZsGreenI 2X particles alone have a percentage transduction effectiveness similar to the percentage obtained after transduction of the target cells by the MS2/PP7(NC)-RLP 12X 2X particles for a single fluorescent protein. The results therefore show that the RLP particles are capable of transporting and transferring at least 2 types of RNAs encapsidated by two different systems (PP7 and MS2) in a single transduction of the target cells.

(536) Demonstration of the capacity for transferring different types of RNA directed by two different encapsidation sequences, MS2 and PP7, in a single transduction of one and the same batch of RLP represents a significant gain on the modulation of the types of RNA encapsidated in particular for effective transfer of the CRISPR/Cas9 system. By replacing the RNAs coding the fluorescent reporters with RNAs coding the Cas9 nuclease and for a non-coding guide RNA, this modulation could allow diversification of the genome editing applications using the CRISPR/Cas9 system.