Acinetobacter o-oligosaccharyltransferases and uses thereof
10869918 ยท 2020-12-22
Assignee
Inventors
Cpc classification
C12N9/1081
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K39/09
HUMAN NECESSITIES
International classification
A61K39/09
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
Abstract
The present application provides methods and uses of O-oligosaccharyltransferase (O-OTases) for generating vaccines. In particular, the present application provides a method of synthesizing a glycoprotein comprising glycosylation of pilin-like protein ComP using a PglL.sub.ComP O-OTase. Uses of glycoproteins synthesized by glycosylating ComP using PglL.sub.ComP O-OTase, particularly for the preparation of vaccines and the like, including a vaccine to Streptococcus, is also provided.
Claims
1. A method of glycosylating a protein in a bacterial cell, the method comprising glycosylating a fusion protein comprising ComP, with an N-glycan in a bacterial cell, using a PglL.sub.ComP O-oligosaccharyltransferase.
2. The method of claim 1 comprising expressing PglL.sub.ComP O-oligosaccharyltransferase, the ComP fusion protein, and the N-glycan together in the bacterial cell.
3. The method of claim 1, wherein the ComP fusion protein comprises an adjuvant or carrier.
4. The method of claim 1, wherein the bacterial cell is Acinetobacter or E. coli.
5. The method of claim 1, wherein the N-glycan is derived from Campylobacter.
6. The method of claim 5, wherein the N-glycan is a Campylobacter jejuni N-heptasaccharide.
7. The method of claim 4, wherein the Acinetobacter is A. baylyi, A. baumannii, A. nosocomialis, or A. calcoaceticus.
8. A conjugate vaccine comprising the glycosylated ComP fusion protein produced in accordance with the method of claim 1.
9. The method of claim 4, wherein the bacterial cell is E. coli.
10. The conjugate vaccine of claim 8, wherein the vaccine comprises an adjuvant or carrier.
11. A conjugate vaccine comprising the glycosylated ComP fusion protein produced in accordance with the method of claim 2.
12. The conjugate vaccine of claim 11, wherein the vaccine comprises an adjuvant or carrier.
13. A conjugate vaccine comprising the glycosylated ComP fusion protein produced in accordance with the method of claim 5.
14. The conjugate vaccine of claim 13, wherein the vaccine comprises an adjuvant or carrier.
15. A conjugate vaccine comprising the glycosylated ComP fusion protein produced in accordance with the method of claim 6.
16. The conjugate vaccine of claim 15, wherein the vaccine comprises an adjuvant or carrier.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) For a better understanding of the present invention, as well as other aspects and further features thereof, reference is made to the following description which is to be used in conjunction with the accompanying drawings, where:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DETAILED DESCRIPTION
(23) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
(24) As used in the specification and claims, the singular forms a, an and the include plural references unless the context clearly dictates otherwise.
(25) The term comprising as used herein will be understood to mean that the list following is non-exhaustive and may or may not include any other additional suitable items, for example one or more further feature(s), component(s) and/or ingredient(s) as appropriate.
(26) A genomic analysis of sequenced genomes of Acinetobacter spp. revealed that, in addition to A. baylyi ADP1, multiple strains within the genus Acinetobacter encode two OTases. In accordance with the present application there are provided genetic and proteomic techniques to demonstrate that both OTases are functional and that one of these enzymes acted as a pilin-specific OTase, whereas the other OTase was able to glycosylate a wide range of proteins. In addition, using mass spectrometry, the glycan structure of A. nosocomialis strain M2 was characterized and the glycoproteome of A. baylyi defined.
(27) In recent years, a panoply of glycosylation pathways have been identified in bacteria. Irrespective of the pathway utilized, both N- and O-glycans often decorate cell surface adhesins in both Gram-negative and Gram-positive bacteria. Examples of glycosylated surface-associated proteins include the O-glycosylation of AIDA-I and TibA in E. coli (Charbonneau et al., 2007; Cote et al., 2013), the type IV pilins of Pseudomonas, Neisseria, Dichelobacter nodosus, and Fransicella tularensis (Castric et al., 1995, Aas et al., 2006; Faridmoayer et al., 2007, Voisin et al. 2007, Cagatay et al., 2008, Egge-Jacobsen et al., 2011), the flagellins in multiple bacterial species (Nothaft & Szymanski, 2010; Iwashkiw et al., 2013), the serine rich adhesins in Streptococcus spp. (Zhou & Wu, 2009), and the N-glycosylation of HMWG in Haemophilus (Gross et al., 2008) and Aggregatibacter actinomycetemcomitans (Tang & Mintz, 2010). Medically relevant Acb members are not the exception and the present application, as well as previous work, show that pilin and multiple outer membrane proteins are O-glycosylated, which could provide an adherence advantage either to host cells, in bacterial communities, or to abiotic surfaces. However, as of yet, the biological role for glycosylation of Acinetobacter pilin subunits has not been elucidated. Specifically, the A. nosocomialis strain M2tfpO::kan mutant was equally as transformable as the parental strain (
(28) As mentioned previously, pilin glycosylation in P. aeruginosa and P. syringae, mediated by PilO and TfpO, respectively, was essential for motility, biofilm formation and virulence (Smedley et al., 2005; Nguyen et al., 2012). Pilin glycosylation had no effect on natural competence in A. baylyi (Porstendorfer et al., 2000) or A. nosocomialis (
(29) As described herein, some Acinetobacter strains encode two OTase homologs, one of which is required for general O-glycosylation and the other that specifically modifies pilin. The majority of the medically relevant Acinetobacter strains, including A. nosocomialis strain M2, encode two contiguous OTases, which are located immediately downstream of a type IVa major pilin subunit gene. At the time of the present application, 76% of A. baumannii isolates with completed genomes encoded a PilA protein containing a carboxy-terminal serine. All isolates containing a gene encoding a PilA protein with a carboxy-terminal serine also encode for a tfpO homolog found immediately downstream of pilA. This finding is congruous with findings reported for the group I pilins (PilAI) found in P. aeruginosa (Kus et al., 2004). Thus there appear to be multiple lineages of pilin genes, specifically, a lineage that contains an allele that encodes for a PilA with a carboxy-terminal serine and the downstream accessory gene tfpO and lineages that are not glycosylated by a TfpO-like activity. All isolates lacking a carboxy-terminal serine on the major pilin protein, including ATCC 17978, do not encode for a tfpO homolog consistent with the separate evolution of Acinetobacter pilin lineages.
(30) In contrast to the contiguous organization of OTases in the medically relevant Acinetobacter spp., the two OTases of the environmental isolate A. baylyi ADP1 are distantly separated on the chromosome. Schulz et al. (2013) showed that the OTase homolog pglL.sub.ComP, which is encoded adjacent to comP, is responsible for ComP modification. Mutational analysis coupled with an in vivo glycosylation assay as well as the characterization of the glycoproteome demonstrated that pglL.sub.ComP is a ComP-specific OTase. On the other hand, the second OTase, PglLADP1, is not an O-antigen ligase as previously suggested but rather a general O-OTase glycosylating multiple protein targets.
(31) The present application provides that PglLM2, encoded by M215_10475, is able to recognize the same motif that the general O-OTase PglL found in all other A. baumannii strains recognizes, as evidenced by the ability of A. nosocomialis M2 to glycosylate OmpA-His. In A. nosocomialis strain M2, both PglLM2 and TfpOM2 utilize the same lipid linked tetrasaccharide to modify their target proteins. The present application provides that PglLM2 was able to transfer two subunits of the glycan, whereas TfpOM2 only transferred a single glycan chain. Previous studies have shown two subunits of the glycans being transferred by general OTases (Scott et al., 2014); and that TfpO is unable to transfer long sugar chains to P. aeruginosa pilin (Faridmoayer et al., 2007). Furthermore, the MPA locus was identified as the source of the genes encoding the proteins responsible for the synthesis of the shared lipid-linked tetrasaccharide.
(32) Although many protein glycosylation systems have been identified, how O-OTases, such as the ones from A. baumannii, Neisseria spp. and Burkholderia spp., recognize the acceptor sequences in their protein targets is still not clear. It has been established that OTases recognize low complexity regions (LCR), rich in serine, alanine and proline (Vik et al., 2009). The pilin specific TfpO enzymes described here recognize a peptide of about 15 amino acids containing many serine and proline residues. Similarly to P. aeruginosa TfpO, it may be suggested, in accordance with the present application, that the carboxy-terminal serine of PilAM2 may serve as the site of TfpOM2-dependent glycosylation. Bacterial species carrying two functional O-OTases, a PglL-general OTase and a pilin-specific OTase have not previously been identified. TfpO is the only OTase present in Pseudomonas (Smedley et al., 2005; Nguyen et al., 2012), while PglL is the only OTase identified in Neisseria (Faridmoayer et al., 2007), A. baumannii ATCC 17978 (Iwashkiw et al., 2012), B. cenocepacia K56-2 (Lithgow et al., 2014) and R. solanacearum (Elhenawy et al., submitted). Three possible O-OTases have been identified in V. cholerae, but the activity of only one of these has been shown in E. coli (Gebhart et al., 2012), and no glycoproteins have been identified in V. cholerae. In N. meningitidis and N. gonorrhoeae, the OTase PglL is able to glycosylate pilin and several other proteins (Aas et al., 2006; Faridmoayer et al., 2007). Although PglL can recognize three glycosylation sites in pilin when the system is reconstituted in E. coli, none of them contain the typical LCR domain found in the remaining Neisseria glycoproteins, indicating that PglL can recognize more than one motif (Musumeci et al., 2014).
(33) In Francisella spp. the OTase is closely related to PilO/TfpO and it appears to be responsible for both pilin and general glycosylation (Balonova et al., 2012). Why Acinetobacter strains require two different OTases to glycosylate pilin and other proteins remains unclear as some pathogenic strains of A. baumannii carry only PglL, which is required for optimal biofilm formation and virulence (Iwashkiw et al., 2012). It is important to note that non-pathogenic A. baylyi ADP1 also contains two O-OTases. However there are several differences between the ComP-specific OTase PglL.sub.ComP of A. baylyi and the pilin-specific OTases TfpO of the medically relevant Acinetobacter spp. Although both OTases are encoded immediately downstream of their cognate protein acceptors (
(34) Although the site of ComP glycosylation has not been identified, it is predicted to be at an internal residue as ComP does not contain a carboxy terminal serine or any carboxy terminal residue associated with post-translational modification. BLAST analysis of the ComP-specific OTase also demonstrated that PglL.sub.ComP is more closely related to the general OTase PglLM2 than to TfpO. Although the pilin-specific TfpO OTase could cross glycosylate different pilins containing carboxy-terminal serines, PglL.sub.ComP was unable to glycosylate the pilins recognized by TfpO.
(35) In accordance with the present application, three different classes of OTases are found to be present in Acinetobacter: the pilin-specific TfpO enzymes that glycosylate pilins containing carboxy-terminal serine residues; the general PglL OTases that recognize LCR in multiple proteins; and PglL.sub.ComP, which appears to be exclusively devoted to the glycosylation of ComP. These enzymes have different biochemical characteristics, which provide helpful information for the synthesis of novel glycoconjugates with biotechnological applications. The differentiation between these enzymes is not trivial, and may not be accurately predicted just by the presence of pfam domains. For example, despite having the highest degree of sequence similarity and being functionally homologous, PilO/TfpO from P. aeruginosa strain 1244 contains the pfam04932 domain, whereas tfpO from A. nosocomialis strain M2 contains the pfam13425 domain. Moreover, the general PglL OTases of the medically relevant Acinetobacter spp., including strain M2 and A. baumannii ATCC 17978, contain domains from the pfam04932 family and the A. baylyi general PglL.sub.ADP1 OTases contain a pfam13425 domain. Adding to the complexity is the fact that the general PglL OTases from medically relevant Acinetobacter spp. and the A. baylyi ComP-specific PglL.sub.ComP contain the same pfam04932 domains yet recognize different sequons. In addition, this pfam domain is present in the WaaL O-antigen ligases. While bioinformatic analyses can be powerful tools to initially locate and identify ORFs encoding proteins predicted to be involved in glycan transfer events, the present application reinforces the concept that the activity of bioinformatically identified O-OTases must be experimentally determined and reveals a complex and fascinating evolutionary pathway for bacterial O-OTases.
(36) In accordance with the present application, and unlike previously known OTases, PglL.sub.ComP can be employed to efficiently attach capsular polysaccharides containing a glucose residue at the reducing end, to a carrier protein, such as ComP. Such capsules are common within the genus Streptococcus. Expression of PglL.sub.ComP in E. coli in presence of plasmids expressing ComP and a capsular polysaccharide from S. pneumoniae resulted in the glycosylation of ComP with said polysaccharide. Injection of this glycoprotein in mice mounted a specific IgG immune response against the capsular polysaccharide, demonstrating the applicability of PglL.sub.ComP to generate recombinant conjugate vaccines against Streptococcus.
(37) To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in any way.
Example 1
(38) Materials and Methods
(39) Strains, Plasmids, and Growth Conditions.
(40) A list of bacterial strains and plasmids used herein are as follows:
(41) TABLE-US-00001 TABLE 1 Plasmids and bacterial strains used herein Reference/ Plasmid or strain Relevant characteristic(s) Source PLASMIDS pFLP2 Encodes FLP recombinase Kumar et al., (2010) pKD13 Contains kanamycin resistance gene from Tn5 flanked by Datsenko & FRT sites Wanner, (2000) pRSM3542 pKD13 containing kan-sacB Carruthers et al., (2013) pGEM-T-Ez General cloning plasmid Promega pCC1 Single copy, general cloning plasmid Epicentre pSMART-LCKAN Low copy blunt cloning vector Lucigen pGEM-pilA pGEM containing pilA with 1 kb flanking DNA Harding et al. (2013) pGEM-pilA::kan-sacB pGEM-pilA containing pilA::kan This study pCC1-pilA-tfpO-pglL pCC1 containing the pilA-tfpO-pglL locus with This study approximately 1 kb of flanking DNA pRSM3510 pKNOCK derivative with a mini-Tn7 element containing a Harding et al. multiple cloning site (2013) pRSM3510-pilA pRSM3510 containing pilA with expression driven from the Harding et al. predicted pilA promoter (2013) pRSM3510-pilA[S136A] pRSM3510-pilA with a carboxy terminal serine to alanine This study point mutation pRSM3510-pilA[S132A] pRSM3510-pilA with a serine 132 to alanine point mutation This study pRSM3510-pilA.sup.P-tfpO pRSM3510 containing the predicted pilA promoter, the ATG This study of pilA, a FLP scar, the last 21 bp of pilA, and the tfpO gene including the 48 bp intergenic region between pilA and tfpO pCC1-pglL::kan pCC1-pilA-tfpO-pglL containing pglL::kan This study pGEM-weeH::kan pGEM-T-Ez containing weeH::kan This study pRSM4063 pSMART-LCKan containing an the empty mini-Tn7 element This study from pRSM3510 along with 2 kb of flanking DNA up and downstream of the attTn7 from strain M2 pRSM4063-weeH pRSM4063 containing the weeH gene with its predicted This study promoter pWH1266 E. coli - Acinetobacter shuttle vector Hunger et al., (1990) pGEM-wafY::kan pGEM-T-Ez containing wafY::kan This study pGEM-wafZ::kan pGEM-T-Ez containing wafZ::kan This study pGEM-wagB::kan pGEM-T-Ez containing wagB::kan This study pCC1-GT pCC1 containing the predicted promoter of the wxy gene This study (329 bp upstream), wxy, wafY, wafZ, wagA, gnaB, and wagB pCC1-wxy.sup.P-wafY pCC1-GT lacking the wxy open reading frame This study pCC1-wxy.sup.P-wafZ pCC1-GT lacking the wxy and wafY open reading frames This study pCC1-wxy.sup.P-wagB pCC1-GT lacking the wxy, wafY, wagA, and gnaB open This study reading frames pRSM4063-wxy.sup.P-wafY pRSM4063 containing wafY driven off the predicted wxy This study promoter pRSM4063-wxy.sup.P-wafZ pRSM4063 containing wafZ driven off the predicted wxy This study promoter pRSM4063-wxy.sup.P-wagB pRSM4063 containing wagB driven off the predicted wxy This study promoter pWH-pilA.sub.M2 pWH1266 expressing pilA.sub.M2 driven by the predicted pilA This study promoter pRSM3510-A1S_1193-his pRSM3510 containing A1S_1193 driven off its predicted This study native promoter pET-15b General plasmid for expression and cloning of recombinant Novagen proteins based on the T7-promoter driven system pET-15b-rsPilA.sub.M2 pET-15b expressing a truncated pilA from the T7 promoter This Study pEXT20 Amp.sup.r cloning and expression vector, IPTG inducible. Dykxhoorn et al., (1996) pBAVMCS Km.sup.r pBAV1K-T5-gfp derivative with gfp ORE removed. Nakar & Constitutive E. coli/Acinetobacter shuttle vector Gutnick, (2001) pBAV-comP-his Km.sup.r pBAVmcs constitutively expressing C-6X His-tagged This Study comP from A. baylyi, inserted at BamHI and SalI. pWH-pilA.sub.17978-His pWH1266 expressing pilA.sub.17978 driven by the predicted pilA This study promoter pEXT-pglL.sub.comP Amp.sup.r pEXT20 expressing C-6X His-tagged pglL.sub.ComP from This Study A. baylyi inserted at BamHI and SalI, IPTG inducible. pEXT-pglL.sub.ADP1 Amp.sup.r pEXT20 expressing C-6X His-tagged pglL.sub.ADP1 from This Study A. baylyi inserted at BamHI and SalI, IPTG inducible. pEXT-tfpO.sub.19606 Amp.sup.r pEXT20 expressing C-10X His-tagged tfpO.sub.19606 from This Study A. baumannii ATCC 19606 inserted at BamHI and SalI, IPTG inducible. pEXT-pglL.sub.19606 Amp.sup.r pEXT20 expressing C-10X His-tagged pglL.sub.19606 from This Study A. baumannii ATCC 19606 inserted at BamHI and SalI, IPTG inducible. pAMF22 Tp.sup.r C-10X His-tagged dsbA1 from N. meningitidis MC58 Faridmoayer cloned into pMLBAD, Arabinose inducible. A. and Feldman M F. (unpublished) pBAV-dsbA1-His C-6X His-tagged dsbA1 subcloned into pBAVMCS, Km.sup.r, at This Study BamHI and HindIII. Constitutively expressing. pACYCpglB Cm.sup.r pACYC184-based plasmid encoding the C. jejuni Wacker et al., protein glycosylation locus cluster with mutations W458A (2002) and D459A in PglB, IPTG inducible. pBAVMCS- Km.sup.r pBAVMCS constitutively expressing C-10X hist- Scott et al., A1S_1193His10X tagged A1S_1193 inserted at BamHI and SalI. (2014) STRAINS Acinetobacter nosocomialis Metro Health Systems Clinical Isolate Niu et al., strain M2 (2008) M2pilA::kan Strain M2 containing a deletion of pilA and replacement with Harding et al. a kanamycin resistance cassette (2013) M2pilA::kan-sacB Strain M2 containing a deletion of pilA and replacement with This study a kan-sacB cassette M2pilA Strain M2 containing an unmarked, in-frame deletion of pilA This study M2pilT Strain M2 containing an unmarked, in-frame deletion of pilA Harding et al. (2013) M2tfpO::kan Strain M2 containing a deletion of tfpO and replacement This study with a kanamycin resistance cassette M2tfpO::kanpilT::strep M2tfpO::kan containing a deletion of pilT and replacement This study with a streptomycin resistance cassette M2pglL::kan Strain M2 containing a deletion of pglL and replacement This study with a kanamycin cassette M2pilA (pilA[S136A]+) M2pilA::kan with a mini-Tn7 element containing an allele This study of pilA with a carboxy-terminal serine to alanine point mutation M2wafY::kan Strain M2 containing a deletion of wafY and replacement This study with a kanamycin resistance cassette M2wafZ::kan Strain M2 containing a deletion of wafZ and replacement This study with a kanamycin resistance cassette M2wagB::kan Strain M2 containing a deletion of wagB and replacement This study with a kanamycin resistance cassette M2weeH::kan Strain M2 containing a deletion of weeH and replacement This study with a kanamycin resistance cassette M2pilA::kan (pilA+) M2pilA::kan with a mini-Tn7 element containing the pilA Harding et al. gene transcribed from its predicted promoter (2013) M2tfpO::kan (tfpO+) M2tfpO::kan with a mini-Tn7 element containing the tfpO This study gene transcribed from the pilA predicted promoter M2wafY::kan (wafY+) M2wafY::kan with a mini-Tn7 element containing the wafY This study gene under control of the predicted wxy promoter M2wafZ::kan (wafZ+) M2wafZ::kan with a mini-Tn7 element containing the wafY This study gene under control of the predicted wxy promoter M2wagB::kan (wagB+) M2wagB::kan with a mini-Tn7 element containing the This study wafY gene under control of the predicted wxy promoter M2weeH::kan (weeH+) M2pilA::kan with a mini-Tn7 element containing the pilA This study gene fused to a FLAG tag transcribed from its predicted promoter M2 (A1S_1193-his+) Strain M2 with a mini-Tn7 element containing A1S_1193- This study his transcribed from its predicted promoter M2tfpO::kan (A1S_1193- M2tfpO::kan with a mini-Tn7 element containing This study his+) A1S_1193-his transcribed from its predicted promoter M2pglL::kan (A1S_1193- M2pglL::kan with a mini-Tn7 element containing This study his+) A1S_1193-his transcribed from its predicted promoter A. baumannii ATCC 17978 Reference A. baumannii strain ATCC A. baumannii ATCC 19606 Reference A. baumannii strain ATCC A. baumannii 27413 A. baumannii clinical isolate isolated at Nationwide NCH Children's Hospital (NCH) from body fluid A. baylyi ADP1 Environmental isolate de Berardinis et al., (2008) A. baylyi pglL.sub.ComP::kan Strain ADP1 with pglL.sub.comP deleted and replaced with a de Berardinis kanamycin resistance casette et al. (2008) A. baylyi pglL.sub.ADP1::kan Strain ADP1 with pglL.sub.ADP1 deleted and replaced with a de Berardinis kanamycin resistance casette et al. (2008) E. coli DH5a General cloning strain Invitrogen E. coli EC100D pir+ General cloning strain, pir.sup.+ Epicentre E. coli DY380 Recombineering strain Lee et al., (2001) E. coli DH5a(pFLP2) Carries FLP recombinase gene under temperature control Kumar et al. (2010) E. coli HB101(pRK2013) Conjugation helper strain Figurski & Helinski, (1979) E. coli EC100D(pTNS2) Carries transposase genes for mini-Tn7 transposition Choi et al., (2005) E. coli Origami 2(DE3) K-12 derivative containing mutations in trxB and gor genes Novagen and a host lysogen of DE3 E. coli Stellar chemically HST08 strain derivative for high transformation efficiencies Clontech competent cells E. coli CLM24 Constructed from E. coli W3110 (IN(rrnD-rrnE)1 rph-1). Feldman et waaL mutant al., (2005)
(42) All bacteria were grown on L-agar or in LB-broth at 37 C. unless otherwise noted. When appropriate, antibiotics were added to the A. nosocomialis or A. baumannii cultures at the following concentrations except when noted otherwise: 100 g ampicillin/mL, 20 g kanamycin/mL, or 12.5 g chloramphenicol/mL. When appropriate, E. coli cultures were supplemented with antibiotics at the following concentrations: 50 g ampicillin/mL for E. coli strains containing plasmids other than pGEM derivatives, 100 g ampicillin/mL for E. coli strains containing pGEM derivatives, or 20 g kanamycin/mL. R. solanacearum was grown at 30 C. in BG media (Boucher et al., 1985).
(43) Bioinformatic Analysis of Acinetobacter OTases.
(44) Protein sequences for Acinetobacter specific OTases were analyzed using NCBI's Basic Local Alignment Search Tool (BLAST) and protein domains identified using the Conserved Domain Database for the annotation of proteins (Marchler-Bauer et al., 2004, Marchler-Bauer et al., 2009, Marchler-Bauer et al., 2011).
(45) Generation of a Strain with an in-Frame Deletion of pilA.
(46) The pilA mutant was constructed, generating an in-frame deletion of pilA, according to the methodology published previously by our group (Harding et al., 2013). Primer sets 1 and 2 were used and can be found in the primer table in the supplemental materials.
(47) Construction of the tfpO::Kan Mutant.
(48) The tfpO::kan mutant was constructed previously (Harding et al., 2013); however, at that time the gene was designated as the pgyA gene, not the tfpO gene.
(49) Complementation of the tfpO::Kan Mutant.
(50) To complement the tfpO::kan mutant, the tfpO gene was cloned with the predicted pilA promoter into a mini-Tn7 element as previously described. Briefly, gDNA from the pilA mutant was used as template with primer set 3 to generate an amplicon containing the predicted pilA promoter, the ATG start codon of the pilA open reading frame, a FLP scar, the last 21 bp of pilA, the 53 bp intergenic region, and the entire tfpO open reading frame. A four-parental mating strategy was used to introduce the mini-Tn7 element containing tfpO driven off the predicted pilA promoter into the tfpO::kan mutant as previously described (Harding et al., 2013). A correct clone was verified by sequencing and designated as the tfpO+ complement.
(51) Plasmid Construction and Transfer into E. coli.
(52) The pilA gene from strain M2 was PCR amplified from gDNA using primer set 4 and cloned into the EcoRV site of pWH1266. A correct clone containing the pWH-pilAM2 plasmid was verified by restriction digestion and sequencing. pWH-pilAM2 was purified from E. coli harboring the plasmid, then electroporated into Acinetobacter isolates. Acinetobacter isolates were made electrocompetent according to the methods previously described (Aranda et al., 2010). The pBAV-comP-His plasmid was built by using primer set 32. The sticky-ended amplicon was digested with the respective restriction enzymes and ligated into the vector pBAVmcs in the same sites. The ligation was then electroporated into DH5-E with transformants being selected for on L-agar plates supplemented with kanamycin. The pEXT-pglL.sub.ComP, pEXT-pglL.sub.ADP1, pEXT-tfpO19606 and pEXT-pglL19606 plasmids were built using primer sets 33, 34, 35 and 36 respectively. The resulting amplicons were digested with BamHI and SalI and inserted in the same sites of pEXT20. Ligations were electroplated into DH5-E and transformants were selected for on L-agar plates supplemented with ampicillin.
(53) pWH-pilA17978-His construction and western blot analysis.
(54) The pilA allele from A. baumanii ATCC 17978 was PCR Amplified Using Primer Set 37. The PCR Product was purified and End-it repaired to phosphorylate the 5 ends. The vector pWH1266 was linearized with EcoRI, End-it repaired, and then treated with alkaline phosphatase. The linearized pWH1266 and the PCR purified pilA allele were ligated, transformed into DH5, and transformants were selected on L-agar supplemented with ampicillin. The pWH-pilA17978 plasmid was sequenced verified and used as template for an inverse PCR to add a C-terminal hexa-histidine tag using primer set 38. The PCR product was purified, DpnI treated, End-it repaired, and ligated. The ligation was electroporated into DH5 and transformants were selected on L-agar supplemented with ampicillin. The pWH-pilA17978-His electroporated into A. baumannii strains as previously described and naturally transformed into A. baylyi strains according to our previously described methods for transforming A. nosocomialis strain M2. Acinetobacter transformants were selected on L-agar supplemented with ampicillin. Western blot analysis on whole cell lysates was conducted as described above with the following exceptions. Strains were grown in LB broth without NaCl and were normalized to an OD600=2.0.
(55) Construction of a Strain M2 pglL::Kan Mutant.
(56) The entire pilA-tfpO-pglL locus along with 1 kb of flanking DNA from A. nosocomialis strain M2 was amplified using primer set 6. The PCR product was ligated to pCC1 (Epicentre) and transformed into E. coli EPI300. A correct clone containing the pCC1-pilA-tfpO-pglL vector was verified by restriction digestion and sequencing. To replace the pglL gene with a kanamycin cassette, a modified recombineering protocol was used as previously described (Harding et al., 2013). To introduce the mutation into A. nosocomialis strain M2, the plasmid pCC1-pgl::kan was linearized and transformed via natural transformation. Transformants were selected on L-agar supplemented with kanamycin. The M2pglL:kan region in the mutant was verified by sequencing.
(57) Generation of strains containing point mutations in pilA in strain M2. To generate a strain with a carboxy-terminal serine to alanine point mutation in the pilA gene of strain M2, the M2pilA mutant was complemented with a mini-Tn7 element containing a variant of the pilA allele, where the carboxy-terminal serine was mutated to an alanine (pRSM3510-pilA[S136A]). The pRSM3510-pilA[S136A] plasmid was constructed using the Quikchange Site Directed Mutagenesis Kit (Stratagene) according to the manufacturer's protocol using primer set 8. A correct clone carrying the pRSM3510-pilA[S136A] plasmid was verified by restriction digest and sequencing. The mini-Tn7 construct containing the pilA[S136A] allele was transposed into the attTn7 of strain M2 via a four-parental mating strategy previously described above. The same protocol was used to generate the pilA[S132A] except primer set 39 was used.
(58) Construction of Glycosyl-Transferase Mutants in the Strain M2 Background.
(59) In order to replace each glycosyl-transferase gene with a kanamycin resistance cassette, an In-Fusion HD EcoDry cloning kit was used according to the manufacturers protocol (ClonTech). The following protocol describing the construction of the M2weeH::kan mutation was used for each glycosyl-transferase mutant, except the 15 bp overhangs were added to the primers which amplified the 5 and 3 flanking regions of each respective gene. Briefly, the upstream and downstream flanking DNA regions around weeH were PCR amplified with primer sets 9 and 10 respectively. The Tn5 kanamycin cassette and pGEM vector were PCR amplified with 15 bp overhangs homologous to the DNA in which they were to be recombined using primer sets 11 and 12 respectively. The PCR amplicons were gel extracted and ethanol precipitated. One hundred nanograms of each product was added to the In-fusion EcoDry cloning tube according to the manufacturer's protocol and incubated at 37 C. for 15 mins then at 50 C. for 15 mins. The newly generated vector was transformed into chemically competent Stellar cells (Clontech) according to the manufacturer's protocol. Transformants were selected for on L-agar plates supplemented with kanamycin. A correct clone containing the pGEM-weeH::kan plasmid was sequence verified. The weeH::kan cassette was PCR amplified using the forward primer of primer set 9 with reverse primer of primer set 10. The amplicon was DpnI treated, ethanol precipitated, then transformed into strain M2 according to previously published methodologies. A correct clone designated M2weeH::kan was sequence verified.
(60) The upstream and downstream regions of wafY were amplified using primer sets 17 and 18, linearized pGEM was amplified using primer set 15, and the kanamycin cassette was amplified with primer set 16. The above protocol was used to In-Fuse all four PCR products. pGEM-wafY::kan was linearized with EcoRI and introduced into A. nosocomialis strain M2 via natural transformation as previously described. A correct clone designated M2 wafY::kan was sequence verified.
(61) The upstream and downstream regions of wag were amplified using primer sets 19 and 20 and the upstream and downstream regions of wagB were amplified using primer sets 21 and 22. Mutants were then constructed as described for the wafY mutant. Clones designated M2 wafZ::kan and M2 wagB::kan were identified and sequence verified.
(62) Construction of pRSM4063.
(63) To generate the pRSM4063 vector, an empty mini-Tn7 element was first introduced into strain M2 via a four-parental mating strategy previously described. Transposition of the empty mini-Tn7 element into the attTn7 was sequence verified generating the strain M2attTn7::MCS_Empty. Genomic DNA was purified from this strain and used as a template in a PCR using primer set 13. The forward primer of primer set 13 is approximately 2 kb upstream of the mini-Tn7 element and the reverse primer of primer set 13 is approximately 2 kb downstream of the mini-Tn7 element. The ensuing PCR product was ligated into the pSMART-LCKan vector, sequence verified, and designated pRSM4063.
(64) Construction of the weeH Complemented Mutant.
(65) To complement the weeH::kan mutant, weeH plus 375 bp of upstream DNA was PCR amplified using primer set 14. The amplicon was digested with XmaI and KpnI, cloned into pRSM4063 and electroporated into DH5. To complement the weeH::kan mutant, pRSM4063-weeH was linearized with NdeI and introduced into M2 weeH::kan via natural transformation according to a previously published procedure (Harding et al., 2013).
(66) Construction of the wafY, Waft, and wagB Complemented Mutants.
(67) Given the lack of an obvious promoter driving expression of each of the glycosyl-transferase genes and the over-lapping nature of the open reading frames, the upstream wxy promoter was selected to drive expression of each of the three genes. Each glycosyl-transferase mutant was complemented by returning the deleted gene driven off the predicted wxy promoter to the chromosome using the mini-Tn7 system. Briefly, the glycosyl-transferase locus was PCR amplified using primer set 23, End-It repaired (Epicentre) and ligated into pCC1 (Epicentre). Transformants were selected on chloramphenicol and the pCC1-GT plasmid was verified by restriction digest. The pCC1-GT plasmid contained the predicted promoter of the wxy gene (329 bp upstream), wxy, waft, wag wagA, gnaB, and wagB.
(68) To generate the wxy promoter-wafY construct, an inverse PCR strategy was employed to remove the wxy gene and join the wxy promoter to the ATG start codon of the wafY gene using primer set 24 and pCC1-GT as template. The subsequent PCR product was End-It repaired (Epicentre) and ligated to itself generating the pCC1-wxyP-waft construct. The wxyP-wafY DNA fragment was PCR amplified using primer set 27, which contained XmaI and KpnI restriction overhangs. The PCR product was digested and ligated to predigested pRSM3510 then transformed into EC100D cells. Transformants were selected for on L-agar supplemented with kanamycin. The mini-Tn7 element containing wxyPwafY was introduced into the M2wafY::kan mutant using a four-parental mating strategy previously described.
(69) The same process was used to generate pRSM3510-wxyP-wafY except primer set 25 and primer set 28 were used. The mini-Tn7 element containing wxyP-wafY was introduced to the M2 wafZ::kan mutant via a four-parental mating strategy. The wxyP-wagB fragment was generated using primer set 26 and primer set 29, but was cloned into pRSM4063. The pRSM4063-wxyP-wagB vector was linearized with XhoI and introduced into M2wagB::kan via natural transformation as previously described.
(70) Construction and Transfer of p4063-A1S_1193-5X into Acinetobacter Strains.
(71) The A1S_1193 open reading frame along with its predicted promoter was PCR amplified to include a C-terminal 5His tag using primer set 30, which also contained XmaI and KpnI restriction overhangs. The PCR product was digested and ligated to pre-digested pRSM4063. The pRSM4063-A1S_1193-5X vector was linearized with XhoI and introduced to Acinetobacter strains via natural transformation as previously described.
(72) Construction of pET-15b-rsPil.sub.AM2.
(73) A truncated His-tagged recombinant, soluble derivative of pilA (rsPilAM2) was amplified using gDNA from A. nosocomialis strain M2 as template with primer set 31 deleting the first 28 amino acids of the PilA protein. This PCR product was then used as template for a second PCR where the forward primer of primer set 15 contained an NdeI site and the reverse contained a BamHI site to aid in directional cloning into pET-15b. The amplicon was digested with NdeI and BamHI then ligated into the expression vector pET-15b, which was digested with NdeI and BamHI generating a first codon fusion driven off of the T7 promoter with an N-terminal His tag followed by a thrombin cleavage site. Ligation products were electroporated into DH5-E (Invitrogen), transformants were subcloned and verified to contain the vector with insert by restriction digestion and sequencing. A correct clone was transformed into E. coli strain Origami B (DE3) (Novagen) for expression of the recombinant protein.
(74) rsPilAM2 Purification.
(75) Origami B(DE3) (Millipore) containing pET15b-rsPilAM2 was inoculated into 100 mL of LB broth to an A600 nm optical density of 0.05 and grown at 37 C. with 180 rpm to mid-log phase at which point rsPilAM2 expression was induced with IPTG at a final concentration of 500 M. Cells were transitioned to 19 C. with 180 rpm and grown for 18 h. Cells were harvested by centrifugation into two equal pellets and resolved in 4 mL each of 1 Ni-NTA Bind Buffer (Novagen) with protease inhibitors (Roche). Resuspended pellets were added to 15 mL TeenPrep Lysing matrix B tubes (MP Biomedicals) and lysed in a Fast Prep 24 homogenizer (MP Biomedicals) with two rounds at 6.0 m/s for 40 seconds with a 5 minute incubation on ice between each round. Supernatants were separated from the unlysed bacteria and the lysing matrix by centrifugation at 4000 rpm for 10 mins at 4 C. Supernatants were further clarified with 1 hour of ultracentrifugation at 100,000g for 1 hour at 4 C. Clarified supernatants were incubated with 1 mL of Ni-NTA His bind resin (Novagen) for 2 hours at 4 C. with gentle rocking followed by two 4 mL washes with 1 Ni-NTA wash buffer. His-tag rsPilAM2 was eluted from the resin with three washes of Ni-NTA elution buffer and dialyzed overnight in phosphate buffered saline. The N-terminal His tag on rsPilAM2 was thrombin cleaved with 0.04 units/L of biotinylated-thrombin (Novagen) for 2 hours at room temperature. The biotinylated-thrombin was captured with streptavidin-agarose beads for 30 minutes and the rsPilA.sub.M2 was collected with a centrifugation in a spin filter at 500g for 5 minutes. To remove any small peptides containing the cleaved His-tag or uncleaved His-tag rsPilAM2, the filtrate was run over Ni-NTA bind resin and the flow through was collected as pure, cleaved rsPilA.sub.M2. The pure protein was dialyzed in phosphate buffer saline with 50% glycerol then normalized to 1 mg/mL using a BCA total protein assay kit (Pierce).
(76) Generation of Polyclonal Antiserum Against rsPilAM2.
(77) Polyclonal antiserum against rsPil.sub.AM2 was raised following our previously described methods (Actis et al., 1985). Briefly, 100 g of purified rsPil.sub.AM2 emulsified in one milliliter of Freund's complete adjuvant was injected using a 23 gauge needle at ten intracutaneous sites into the haunch of a 6-month old female New Zealand white rabbit (Charles River Laboratories International, Inc., Wilmington, Mass.). Injections consisting of 100 g rsPilAM2 emulsified in Freund's incomplete adjuvant were subsequently delivered at 15-day intervals, and serum was collected at 10-day intervals following the initial injection. The specificity and reactivity of the anti-rsPil.sub.AM2 antibodies were confirmed by immunoblotting rsPil.sub.AM2 and A. nosocomialis strain M2 whole-cell lysates after proteins were size-fractionated by SDS-PAGE.
(78) Transformation Efficiency Assays.
(79) Natural transformation was assayed as described previously (Harding et al., 2013). Transformation efficiency was calculated by dividing the CFU of transformants by the total CFU. Experiments were conducted on at least three separate occasions.
(80) Quantitative Dimethylation of A. baylyi ADP1 Membrane Extracts.
(81) Quantitative dimethylation of lysates from A. baylyi ADP1, the ADP1pglL.sub.ComP mutant, and the ADP1 pglL.sub.ADP1 mutant was performed as outlined previously (Boersema et al., 2009). Briefly, 1 mg of peptide lysate from each strain was resuspended in 30 l of 100 mM tetraethylammonium bromide and mixed with the following combinations of 200 mM formaldehyde (30 l) and 1M sodium cyanoborohyride (3 l) isotopologues: ADP1 samples were labeled with light formaldehyde (CH.sub.2O) and light sodium cyanoborohyride (NaBH.sub.3CN), ADP1pglL.sub.ADP1 samples with medium formaldehyde (CD2O) and light sodium cyanoborohyride, and ADP1 pglL.sub.ComP with heavy formaldehyde (.sup.13CD.sub.2O) and heavy sodium cyanoborodeuteride (NaBD.sub.3CN). Reagents were mixed and samples incubated at room temperature for 1 h. Dimethylation reactions were repeated twice to ensure complete labeling of all amine groups. Dimethylation reactions were terminated by the addition of 30 l of 1M NH.sub.4Cl for 20 minutes at room temperature. Samples were acidified by addition of 5% (v/v) acetic acid and allowed to equilibrate in the dark for 1 h before pooling the three samples at 1:1:1 ratio. Pooled samples were then STAGE tip purified, lyophilized, and stored at 20 C.
(82) Western Blot Analyses.
(83) Western blot analyses were preformed according to previously described methodologies (Harding et al., 2013). Primary antibodies used were Anti-rsPilAM2 or Penta-His Antibody (Qiagen). Secondary antibodies used were Goat anti-rabbit IgG (H+L), alkaline phosphatase antibody (Molecular Probes) and Goat-anti mouse IgG (H+L), alkaline phosphatase antibody (Molecular Probes). Membranes were developed with the BCIP/NBT Liquid Substrate System (Sigma).
(84) Pili Shear Preparations.
(85) Pili shear preparations were prepared as previously described with the following modifications. Briefly, bacterial lawns were removed from the agar surface and resuspended in 5 mL of ice cold DPBS supplemented with 1 protease inhibitors (Roche). The bacterial suspensions were normalized to an optical density at A600 nm equal to 70. To shear surface exposed proteins, bacterial suspensions were vortexed on high for 1 minute. Bacteria were pelleted at 10,000g for 10 minutes at 4 C. The supernatants were collected and again centrifuged at 10,000g for 10 minutes at 4 C. The supernatants were collected and further clarified by centrifugation at 20,000g for 5 mins at 4 C. The sheared surface proteins were precipitated with ammonium sulfate at a final concentration of 30%. Precipitated proteins were pelleted by centrifugation at 20,000g for 10 minutes at 4 C. The supernatants were discarded and the pellets were resuspended in 100 L of 1 Laemmli buffer. Preparations were boiled for 10 minutes, run on SDS-PAGE, coomassie-stained, and bands were excised and prepared for mass spectrometric analysis according to Shevchenko et al. (2006). Briefly, bands were washed with water and dehydrated with acetonitrile (ACN) repeatedly. Disulfide bonds were reduced with 10 mM DTT in 50 mM NH4HCO3 for 60 minutes at 37 C. followed by alkylation of cysteine thiol groups with 50 mM iodoacetamide in 50 mM NH4HCO3 for 60 minutes in the dark at room temperature. Gel pieces were then washed with 50 mM NH4HCO3, dehydrated with 100% ACN and dried. Pilin was digested with 0.02 mg/mL trypsin in 50 mM NH4HCO3 (Promega) at 37 C. for 16 hours. Peptides were eluted with 100% ACN and water and lyophilized Tryptic peptides were resuspended in 0.1% Trifluoroacetic acid and desalted with a C18 ZipTip (Millipore, USA). 60% ACN was used to elute the peptides, which were dried in a speedvac and resuspended with 0.1% Formic Acid. The analysis was done using a Q-TOF Premier (Waters, Manchester, UK) coupled to a nanoACQUITY (Waters) ultra-performance liquid chromatography system as previously described (Wang et al., 2007). MassLynx, v. 4.1 (Waters) was used to analyze the data. OmpA-His was purified from strain M2 and prepared for ESI-QTOF MS/MS analysis as described above.
(86) LPS Extraction and Silver Staining
(87) LPS from A. baylyi and R. solanacearum was extracted from overnight cultures by the TRI-reagent method as described previously (Yi & Hackett, 2000). Equal amounts of LPS were loaded on 12.5% SDS-PAGE gels for LPS separation followed by silver staining as previously described (Tsai & Frasch, 1982).
(88) DsbA1 Glycosylation in E. coli
(89) E. coli CLM24 cells were co-transformed with three plasmids: one plasmid encoding the C. jejuni glycosylation locus, another plasmid encoding a single O-OTase gene, and the last plasmid, pAMF22, encoding dsbAl-His Ampicillin (100 g/ml), trimethoprim (50 g/ml) and chloramphenicol (10 g/ml) were added as required for plasmid selection. Cells were grown at 37 C. to an OD600 of 0.4-0.6 and then were induced with 0.1 mM IPTG and/or 0.2% arabinose. Cultures requiring arabinose induction were given a second dose of induction after 4 hours. Whole cell lysates were obtained at stationary phases and western blot analyses were employed to determine DsbA1 modification.
(90) Digestion of Membrane Enriched Samples of A. baylyi ADP1
(91) Peptide lysates for glycopeptide enrichment and quantitative analysis were prepared according to Lithgow et al. (2014) with minor modifications. Briefly, 2 mg of dried membrane enriched protein samples were solubilized in 6 M urea, 2 M thiourea, 40 mM NH4HCO3 and reduced with 10 mM Dithiothreitol (DTT). Reduced, solubilized peptides were alkylated with 25 mM iodoacetamide (IAA) for one hour in the absence of light. The resulting alkylated protein mixture was digested with Lys-C( 1/100 w/w) for 4 hours at 25 C., diluted 1:5 in 40 mM NH4HCO3, then digested with trypsin ( 1/50 w/w) overnight at 25 C. Digestion was terminated with the addition of 1% trifluoroacetic acid (TFA). Peptide digests were purified using the C18 empore (Sigma-Aldrich, St. Louis Mo.) STop And Go Extraction (STAGE) tips (Rappsilber et al., 2007) to remove primary amide and salts.
(92) Enrichment of A. baylyi ADP1 Glycopeptides Using ZIC-HILIC Purification
(93) ZIC-HILIC enrichment was performed according to (Scott et al., 2011) with minor modifications. Micro-columns composed of 10 m ZIC-HILIC resin (Sequant, Umea, Sweden) packed into p10 tips containing a 1 mm.sup.2 excised C8 Empore disc (Sigma) were packed to a bed length of 0.5 cm. Prior to use, the columns were washed with ultra pure water, followed by 95% acetonitrile (ACN), and then equilibrated with 80% ACN and 5% formic acid (FA). Samples were resuspended in 80% ACN and 5% FA and insoluble material was removed by centrifugation at 16,100g for 5 min at 4 C. Samples were adjusted to a concentration of 3 g/L and 150 g of peptide material was loaded onto a column and washed with 10 load volumes of 80% ACN, 5% FA. Unbound fractions were collected, pooled, and dried by vacuum centrifugation. ZIC-HILIC bound peptides were eluted with 3 load volumes of ultra-pure water and concentrated using vacuum centrifugation. Biological replicates were subjected to ZIC-HILIC enrichment independently using freshly prepared reagents.
(94) Identification of Glycopeptides Using Reversed-Phase LC-MS, CID MS-MS and HCD MS-MS
(95) Purified glycopeptides/peptides were resuspended in Buffer A (0.5% acetic acid) and separated using reversed-phase chromatography on either an Agilent 1290 Series HPLC (Agilent Technologies, Mississauga, ON) coupled to LTQ-Orbitrap Velos (Thermo Scientific, San Jose Calif.) for qualitative analysis of glycopeptides or an EASY-nLC1000 system coupled to a Q-exactive for quantitative studies. For qualitative analysis of A. baylyi ADP1 glycopeptides, a packed in-house 20 cm, 75 m inner diameter, 360 m outer diameter, ReproSilPur C18 AQ 1.9 m (Dr. Maisch, Ammerbuch-Entringen, Germany) column was used. For quantitative studies a house packaged 45 cm, 50 m inner diameter, 360 m outer diameter, ReproSilPur C18 AQ 1.9 m column was used. In both systems, samples were loaded onto a trap column, an in-house packed 2 cm, 100 m inner diameter, 360 m outer diameter column containing Aqua 5 m C18 (Phenomenex, Torrance, Calif.), at 5 L/min prior to gradient separation and infused for mass spectrometry. A 180 min gradient was run from 0% buffer B (80% ACN, 0.5% acetic acid) to 32% B over 140 min, next from 32% B to 40% B in the next 5 min, then increased to 100% B over 2.5 min period, held at 100% B for 2.5 min, and then dropped to 0% B for another 20 min Unbound fractions from ZIC-HILIC glycopeptide enrichment were subjected to analysis using the same instrumental set up as qualitative analysis of glycopeptides. Both instruments were operated using Xcalibur v2.2 (Thermo Scientific) with a capillary temperature of 275 C. in a data-dependent mode automatically switching between MS, CID MS-MS and HCD MS-MS for qualitative analysis as previously described (Scott et al., 2011) and using a top 10 data-dependent approach switching between MS (resolution 70 k, AGC target of 110.sup.6), and HCD MS-MS events (resolution 17.5 k AGC target of 110.sup.6 with a maximum injection time of 60 ms, NCE 28 with 20% stepping) for quantitative studies.
(96) Identification of A. baylyi ADP1 Glycopeptides
(97) Raw files for qualitative glycosylation analysis were processed as previously described (Scott et al., 2011, 2012). Briefly, Proteome Discoverer v. 1.2 (Thermo Scientific) was used to search the resulting glycopeptide data using MASCOT v2.4 against the A. baylyi ADP1 database (obtained from UNIPROT, http://www.uniprot.org/, 681 2014 Jun. 10, Taxon identifier: 62977 containing 3263 protein sequences). Mascot searches were performed using the following parameters: peptide mass accuracy 20 ppm; fragment mass accuracy 0.02 Da; no enzyme specificity, fixed modificationscarbamidomethyl, variable modificationsmethionine oxidation and deamidated N, Q. The instrument setting of MALDI-QUAD-TOF was chosen as previous studies show quadrupole-like fragmentation within HCD spectra (Olsen et al., 2007). Scan events that did not result in peptide identifications from MASCOT searches were exported to Microsoft Excel (Microsoft, Redmond Wash.). To identify possible glycopeptides within exported non match scans, the MS-MS module of GPMAW 8.2 called mgf graph was used to identify HCD scan events that contained the 204.08 m/z oxonium of HexNAc. All scan events containing the oxonium 204.08 m/z ion were manually inspected to identify possible glycopeptides. To facilitate glycopeptide assignments HCD scan events containing the 204.08 oxonium were manual inspected to identify potential deglycosylated peptides ions. Within these HCD scans the MS features (m/z, charge and intensity), which corresponded to masses below that of the deglycosylated peptide were extracted using the Spectrum list function of Xcalibur v2.2. The resulting numerical values of the detected MS features were scripted into mgf files and the peptide mass set to that of the deglycosylated peptide mass. The resulting mgf files were then searched using the MASCOT setting described above. All spectra were searched with the decoy option enabled and no matches to this database were detected; the false discovery rate (FDR) was 0%.
(98) Quantitative analysis of dimethylated A. baylyi ADP1 and mutant glycopeptides was performed as previously reported (Lithgow et al., 2014). Briefly, dimethylated A. baylyi ADP1 glycopeptides were identified as above and quantified by manually extracting the area under the curve of the monoisotopic peak using Xcalibur v2.2. Triplex (wild type ADP1 vs ADP1pglL.sub.ComP vs ADP1pglL.sub.ADP1).
(99) Results
(100) The Two OTase Homologs Encoded by Acinetobacter Contain Different Pfam Domains
(101) It was previously reported that A. baylyi ADP1 encodes two proteins containing domains from the Wzy_C superfamily (Schulz et al., 2013). Through bioinformatic analyses we identified several Acinetobacter spp. with two open reading frames (ORFs) immediately downstream of the major type IVa pilin subunit pilA (
(102) In A. nosocomialis strain M2, the pilA gene is immediately upstream of two genes, M215_10480 and M215_10475, both of which encode members of the Wzy_C superfamily M215_10480 and M215_10475 contain the pfam13425 and the pfam04932 domains, respectively (
(103) The second ORF, M215_10475, encodes a predicted protein that contains a domain from the pfam04932 family, a domain that has been found in all previously characterized PglL orthologs as well as in O-antigen ligases. The PglL_A and the PglL_B domains were also identified in M215_10475. It appears that this protein is an ortholog of the PglL general OTases; thus, we have designated ORF M215_10475 as pglLM2 (
(104) Transcriptome analysis was performed on mid log phase M2 cells using RNA-seq (data not shown). PilAM2 transcription was readily observed; tfpOM2 transcription was also observed but the levels dropped precipitously beginning at the intergenic region between pilAM2 and tfpOM2. A predicted Rho-independent terminator is located immediately upstream of the ATG start codon of tfpOM2. It is likely that pilAM2 and tfpOM2 are in an operon separated by a leaky transcriptional terminator. These findings are consistent with transcriptional studies of pilA and pilO (tfpO) of P. aeruginosa 1244 (Castric, 1995). Downstream of the tfpOM2 gene is the pglLM2 gene. Since the genes encoding both OTases are in close proximity and use the same lipid-linked oligosaccharide as a substrate, it was speculated that these genes would be cotranscribed. There does appear to be some transcriptional read through but transcript levels for the pglLM2 gene are markedly higher than the tfpOM2 levels, suggesting that the intergenic region between tfpOM2 and pglLM2 contains a promoter, which also drives transcription of pglLM2.
(105) In the A. baylyi ADP1 genome, the comP gene, encoding a pilin-like protein, is followed by ACIAD3337 encoding a pfam04932-containing OTase-like protein, which was designated pglL by Schulz et al., (2013). This has been designated ACIAD3337 as pglL.sub.ComP due to its proximity to comP (
(106) A second pfam13425 domain containing ORF (ACIAD0103) predicted to encode a WaaL ligase ortholog was also identified. ACIAD0103 was not located near the pilin gene homolog, but instead was found within a glycan biosynthetic locus. This is herein designated ACIAD0103 as the pglL.sub.ADP1 (
(107) In A. baumannii ATCC 17978, a well-studied strain with respect to its glycosylation, only one general O-OTase was identified, which was previously designated PglL (Iwashkiw et al., 2012; Lees-Miller et al., 2013).
(108) TfpO is Required for Post-Translational Modification of Pilin in A. nosocomialis Strain M2.
(109)
(110) Immediately downstream of tfpO in strain M2 is pglLM2, which encodes a homolog of the general O-OTases responsible for glycosylation of many membrane associated proteins in Neisseria gonorrhoeae and N. meningiditis (Vik et al., 2009; Brud et al., 2011). To determine if PglLM2 also played a role in post-translational modification of PilA, an isogenic mutant strain lacking pglLM2 was generated. Western blot analysis of whole cell lysates from the pglLM2 mutant demonstrated that PilA existed primarily in the modified form, indicating that PglLM2 is not required for the post-translational modification of PilA as observed (
(111) PilA.sub.M2 was Glycosylated in a TfpO.sub.M2-Dependent Manner with a Tetrasaccharide Containing (HexNAc)2, Hexose and N-Acetyl-deoxyHexose.
(112) To confirm that PilA was glycosylated by TfpO, PilA was purified from surface shear preparations from strain M2, a hyper-piliated M2pilT mutant, and a hyper-piliated M2tfpO::kanpilT::strep mutant. The pilT gene encodes for the predicted retraction ATPase; therefore, mutants lacking pilT have a hyper-piliated phenotype, which results in an abundance of surface exposed PilA. Proteins in the shear preparations were separated by SDS-PAGE, coomassie-stained, excised and subjected to mass spectrometric analysis.
(113) The Carboxy-Terminal Serine136 of PilAM2 was Required for Pilin Modification.
(114) In P. aeruginosa 1244 the pilin protein PilA is glycosylated in a TfpO-dependent manner (Castric, 1995). The glycosylation site was later determined to be at the carboxy terminal serine 148 (Comer et al., 2002) Amino acid sequences of PilA proteins from Acinetobacter spp., including A. nosocomialis M2, were compared to the P. aeruginosa 1244 PilA. Although the sequences share limited homology, strain M2's PilA sequence also contains a C-terminal serine, which was included in the glycopeptide identified by MS (
(115)
(116) In order to determine if the carboxy-terminal serine136 was required for PilA post-translational modification, the M2(pilA[S136A])+ strain was generated. First, a strain with an in-frame deletion of the pilA gene was generated so as to not affect the transcription of the downstream tfpO gene. We then complemented the M2pilA strain with an allele of pilA where the carboxy-terminal serine was mutated to an alanine residue generating an M2(pilA[S136A])+ strain.
(117)
(118) The Major Polysaccharide Antigen (MPA) Locus is Required for Post-Translational Modification of PilAM2.
(119) Hu et al. recently developed a molecular serotyping scheme for Acinetobacter spp. containing a major polysaccharide antigen (MPA) locus. The MPA locus, found between the conserved fkpA and lldP genes, was identified in all sequenced Acinetobacter strains included in their study and was also present in A. nosocomialis strain M2 (Hu et al., 2013, Carruthers et al., 2013). The MPA locus from A. nosocomialis strain M2 contains three predicted glycosyl-transferases (designated wafY, wag, and wagB) and one predicted initiating glycosyl-transferase (designated weeH or pglC) (
(120) pglLM2 Encodes a PglL-Like O-OTase in A. nosocomialis Strain M2 and Uses the Same Tetrasaccharide Precursor as a Donor for General Protein Glycosylation.
(121) In
(122)
(123) ACIAD0103 is not a WaaL O-Antigen Ligase and is not Required for ComP Modification.
(124) As noted above, two OTase-like proteins containing domains from the Wzy_C superfamily are encoded in the A. baylyi ADP1 genome. One of these, pglL.sub.ComP (ACIAD3337), is located adjacent to comP. Schulz et al. (2013) determined, and we independently confirmed, that pglL.sub.ComP (ACIAD3337) is required for ComP modification (
(125) Schulz et al. (2013) speculated that the other Wzy_C superfamily domain-containing protein, PglL.sub.ADP1 (ACIAD0103), encoded a WaaL O-antigen ligase. For LPS biosynthesis, the O-antigen repeat unit is sequentially assembled on the same lipid carrier as the O-glycan on the cytoplasmic side of the inner membrane, flipped to the periplasm, polymerized to form the O-antigen chain and transferred to the lipid A-core polysaccharide by the O-antigen ligase (Hug & Feldman, 2011). Differences in the number of O-antigen subunit repeats in LPS molecules appear as a ladder-like banding pattern in LPS silver stains (Whitfield, 1995). In order to determine if pglL.sub.ADP1 was acting as an O-antigen ligase, we purified LPS from A. baylyi ADP1, the ADP1pglL.sub.ComP::kan, and ADP1pglL.sub.ADP1::kan mutants and silver stained the SDS PAGE-separated preparation.
(126) As illustrated in
(127) ACIAD0103 Encodes the General O-OTase, PglLADP1, in A. baylyi ADP1
(128) PglL.sub.ADP1 was tested to determine if it is able to glycosylate DsbA1 from N. meningitidis and OmpA from A. baumannii ATCC 17978, which are also modified by general O-OTases in their respective strains, and were previously employed as models to study glycosylation (Vik et al., 2009; Iwashkiw et al., 2012; Gebhart et al., 2012; Lithgow et al., 2014). These two proteins were independently expressed in wild-type, pglL.sub.ComP and pglL.sub.ADP1 A. baylyi strains. DsbA1-His (
(129) In vivo glycosylation assays in E. coli were performed to further confirm the OTase activity of PglL.sub.ADP1 (Gebhart et al., 2012). We employed E. coli CLM24, a strain lacking the WaaL O-antigen ligase, which leads to the accumulation of lipid-linked glycan precursors that then are able to serve as substrates for heterologous O-OTase activity (Feldman et al., 2005). E. coli CLM24 was transformed with plasmids encoding an acceptor protein (DsbA1), a glycan donor (the Campylobacter jejuni lipid-linked oligosaccharide (CjLLO)), and one OTase, as previously described (Faridmoayer et al., 2007; Ielmini & Feldman, 2011). We also included PglL.sub.ComP and employed TfpO19606 and PglL19606, encoding the pilin-specific and the general O-OTase from A. baumannii ATCC 19606, as controls. DsbA1-His was detected with an anti-histidine antibody and glycosylation was detected employing the hR6 antibody, which is reactive against the C. jejuni heptasaccharide.
(130) As illustrated in
(131) Comparative Proteomic Analysis of A. baylyi ADP1 Wild-Type, pglL.sub.ComP and pglL.sub.ADP1 Strains.
(132) To determine a role of both putative O-OTases in A. baylyi ADP1 glycosylation, we compared the glycoproteome of A. baylyi ADP1 to either the ADP1pglL.sub.ComP mutant or the APD1pglL.sub.ADP1 mutant. Using ZIC-HILIC for glycopeptide enrichment (Iwashkiw et al., 2012; Nothaft et al., 2012; Scott et al., 2014; Lithgow et al., 2014) and multiple MS/MS fragmentation approaches (Scott et al., 2011), 21 unique glycopeptides from eight protein substrates were identified 360 within A. baylyi ADP1. Similar to the diversity observed within other Acinetobacter spp. (Scott et al., 2014), A. baylyi ADP1 generated unique glycans with glycopeptides decorated with one of four pentasaccharide glycoforms composed of 286-217-HexNAc3 (1112.41 Da,
(133) Glycopeptide Quantitative Labeling
(134)
(135) Quantitative dimethylation labeling enabled comparison of all three strains simultaneously providing an internal positive control for glycopeptide enrichment and led to the detection of seven glycopeptides (Table 2). Consistent with the requirement of PglL.sub.ADP1 for glycosylation, no glycopeptides derived from the pglL.sub.ADP1 mutant (
(136) Using dimethyl labeling and ZIC-HILIC, the O-OTase responsible for glycosylation of individual glycopeptides was confirmed. Glycopeptides derived from A. baylyi ADP1 WT, labeled with light label and A. baylyi ADP1pglL.sub.ComP labeled with heavy label, were observed at near 1:1 levels; whereas, A. baylyi ADP1pglL.sub.ADP1, labeled with medium label, was undetectable within samples. Conversely non-glycosylated peptides were observed at a near 1:1:1 level between all three strains. A and D) The MS spectra of the light, medium and heavy isotopologues of the glycopeptide 113KLAEPAASAVADQNSPLSAQQQLEQK138 (SEQ ID NO: 108) (Q6F825_ACIAD) and non-glycosylated peptide 166AQSVANYLSGQGVSSSR182 (SEQ ID NO: 109) (Q6FDR2_ACIAD) enabled the comparison of glycosylation across all three strains. No glycopeptides were observed within ADP1pglL.sub.ADP1 while non-glycosylated peptides were observed a near 1:1:1 ratio. B and E) Comparison of the extracted ion chromatograms of the light, medium and heavy isotopologues confirm the absent of ADP1pglL.sub.ADP1 derived glycopeptides and the 1:1:1 ratio of non-glycosylated peptides. C) HCD fragmentation confirming the identification of the heavy isotopologues of the glycopeptide 113KLAEPAASAVADQNSPLSAQQQLEQK138 (SEQ ID NO: 108), confirming its origins from ADP1pglL.sub.ComP. F) HCD fragmentation confirming the identification of the medium isotopologues of the non-glycosylated peptide 166AQSVANYLSGQGVSSSR182 (SEQ ID NO: 109), confirming its origins from ADP1pglL.sub.ADP1.
(137) Table 2 shows dimethylated glycopeptides identified in A. baylyi ADP1. Dimethylated Glycopeptides identified in A. baylyi ADP1 wild type (light) and OTase mutant (heavy). Identifications are grouped according to the corresponding Uniprot number. The protein name, parent m/z, charge state, glycan mass, peptide mass, glycan composition, peptide sequence and mascot ion score are provided for each identified glycopeptide. For each identified peptide the dimethylation observed is denoted to aid read distinguish glycopeptide observed from wild type (containing dimethyl N-term and K) and the complement (containing dimethyl N-term 2H(6)13C(2) and K2H(6)13C(2)).
(138) TABLE-US-00002 TABLE2 DimethylatedglycopeptidesidentifiedinAcinetobacterbaylyiADP1(SEQIDNOs:79-82) Pre- Pre- Mascot Number Pro- Glycan cursor cursor ion of tein Fastaheaders peptide Charge mass m/z MH+ score labels Q6F7U4 >tr|Q6F7U4|Q6F7U4_ACIAD SSELEDLFNSDGGAASE 4 1112.41 966.9369 3864.7238 96 Dimethyl Uncharacterizedprotein PAASDKTAAK (K); OS=Acinetobacter Dimethyl baylyi(strainATCC (K); 33305/BD413/ADP1) Dimethyl GN=ACIAD3186 (N-term) PE=4SV=1 Q6F825 >tr|Q6F825|Q6F825_ACIAD KLAEPAASAVADQNSP 4 1112.41 980.4813 3918.9013 47 Dimethyl Uncharacterizedprotein LSAQQQLEQK (K); OS=Acinetobacter Dimethyl baylyi(strainATCC (K); 33305/BD413/ADP1) Dimethyl GN=ACIAD3092 (N-term) PE=4SV=1 Q6FCV1 >tr|Q6FCV1|Q6FCV1_ACIAD IDAAADHAAASTEHAA 4 1112.41 890.9106 3560.6187 112 Dimethyl Uncharacterizedprotein DKAEVATR (K); OS=Acinetobacter Dimethyl baylyi(strainATCC (N-term) 33305/BD413/ADP1) GN=ACIAD1233 PE=4SV=1 Q6F8B6 >tr|Q6F8B6|Q6F8B6_ACIAD SASKPNVEASVSSQNAT 4 1154.43 966.6921 3863.7684 52 Dimethyl Uncharacterizedprotein LSASQPQHQ (K); OS=Acinetobacter Dimethyl baylyi(strainATCC (N-term) 33305/BD413/ADP1) GN=ACIAD2990 PE=4SV=1 Q6FCV1 >tr|Q6FCV1|Q6FCV1_ACIAD IDAAADHAAASTEHAAD 4 1154.43 901.4081 3602.6325 122 Dimethyl Uncharacterizedprotein KAEVATR (K); OS=Acinetobacter Dimethyl baylyi(strainATCC (N-term) 33305/BD413/ADP1) GN=ACIAD1233 PE=4SV=1 Q6F8B6 >tr|Q6F8B6|Q6F8B6_ACIAD SASKPNVEASVSSQNAT 4 1196.43 977.1939 3905.7756 39 Dimethyl Uncharacterizedprotein LSASQPQHQ (K); OS=Acinetobacter Dimethyl baylyi(strainATCC (N-term) 33305/BD413/ADP1) GN=ACIAD2990 PE=4SV=1 Q6FCV1 >tr|Q6FCV1|Q6FCV1_ACIAD IDAAADHAAASTEHAAD 4 1196.43 911.9099 3644.6396 118 Dimethyl Uncharacterizedprotein KAEVATR (K); OS=Acinetobacter Dimethyl baylyi(strainATCC (N-term) 33305/BD413/ADP1) GN=ACIAD1233 PE=4SV=1 (SEQIDNOs:79-82)
(139)
(140) PglL.sub.ComP Acceptor Protein Specificity Distinguishes it from TfpO and General O-OTases
(141) Given the strong genetic linkage between the major type IVa pilin genes and downstream O-OTase genes on Acinetobacter chromosomes, we sought to determine whether these O-OTases were specific for their cognate pilin protein. A plasmid expressing PilAM2 from A. nosocomialis strain M2 was expressed into different Acinetobacter spp., and then conducted western blot analysis probing for the expression and electrophoretic mobility of the pilin protein. PilAM2 was modified by A. baumannii ATCC 19606 and the clinical isolate A. baumannii 27413, both of which encode tfpO homologs and pilins containing terminal serine residues, as evidenced by the presence of both the higher molecular weight and lower molecular forms of PilAM2 (
(142) On the contrary, when ComP-His was heterologously expressed in different Acinetobacter spp., it was found that it was glycosylated only in A. baylyi ADP1. Strains encoding tfpO homologs were unable to modify ComP-His, with the exception of A. baumannii ATCC 19606, which appeared to have a marginal capacity to modify ComP-His (
(143) Multiple species within the Acinetobacter genus are nosocomial opportunistic pathogens of increasing relevance worldwide. Among the virulence factors utilized by these bacteria are the type IV pili and a protein O-glycosylation system. Glycosylation is mediated by O-oligosaccharyltransferases (O-OTases), enzymes that transfer the glycan from a lipid carrier to target proteins. O-OTases are difficult to identify due to similarities with the WaaL ligases that catalyze the last step in LPS synthesis. A bioinformatics analysis revealed the presence of two genes encoding putative O-OTases or WaaL ligases in most of the strains within the genus Acinetobacter. Employing A. nosocomialis M2 and A. baylyi ADP1 as model systems, the present application provides that these genes encode two O-OTases, one devoted uniquely to type IV pilin, and the other one responsible for glycosylation of multiple proteins. With the exception of ADP1, the pilin-specific OTases in Acinetobacter resemble the TfpO/PilO O-Otase from Pseudomonas aeruginosa. In ADP1 instead, the two O-OTases are closely related to PglL, the general O-OTase first discovered in Neisseria. However, one of them is exclusively dedicated to the glycosylation of the pilin-like protein ComP.
(144) Glycopeptides identified in Acinetobacter baylyi ADP1 wild type are shown in Table 3. Identifications are grouped according to the corresponding Uniprot number. The protein name, parent m/z, charge state, glycan mass, peptide mass, glycan composition, peptide sequence and mascot ion score are provided for each identified glycopeptide.
(145) TABLE-US-00003 TABLE3 GlycopeptidesidentifiedinA.baylyiADP1(SEQIDNOs:79-88) GlycopeptidesidentifiedinAcinetobacterbaylyiADP1 Protein Pre- Pre- acces- cursor cursor Pre- sion Protein m/z MH+ cursor RT Mascot Peptide Glycan number name [Da] [Da] Charge [min] Peptide score mass mass page Q6F875.sub. Uncharac- 703.98 2109.92 3 19.49 AAHAASAAASK 62 955.50 1154.43 3 ACIAD terized protein Q6F875.sub. Uncharac- 717.98 2151.93 3 20.80 AAHAASAAASK 35 955.50 1196.43 4 ACIAD terized protein Q6FCV1.sub. Uncharac- 766.33 2296.97 3 29.47 DAAHDAAASVEK 54 1184.56 1112.41 5 ACIAD terized protein Q6FCV1.sub. Uncharac- 720.06 2877.23 4 27.44 IDAAADHAAASTEHAADK 40 1764.82 1112.41 6 ACIAD terized protein; Q6FCV1.sub. Uncharac- 730.57 2919.24 4 27.93 IDAAADHAAASTEHAADK 32 1764.82 1154.42 7 ACIAD terized protein; Q6FCV1.sub. Uncharac- 741.07 2961.25 4 28.51 IDAAADHAAASTEHAADK 46 1764.82 1196.44 8 ACIAD terized protein; Q6FCV1.sub. Uncharac- 701.72 3504.57 5 37.64 IDAAADHAAASTEHAADKAEVATR 46 2392.15 1112.42 9 ACIAD terized protein; Q6FCV1.sub. Uncharac- 710.12 3546.58 5 38.00 IDAAADHAAASTEHAADKAEVATR 38 2392.15 1154.43 10 ACIAD terized protein; Q6FCV1.sub. Uncharac 897.90 3588.59 4 39.70 IDAAADHAAASTEHAADKAEVATR 21 2392.15 1196.44 11 ACIAD terized protein; Q6F7K5.sub. Uncharac- 1579.39 4736.14 3 83.54 IYQNTDTSSAASQTSASPTTQGLG 23 3623.72 1112.42 12 ACIAD terized DFLHAQEQLR protein Q6F7K5.sub. Uncharac- 1593.39 4778.15 3 84.29 IYQNTDTSSAASQTSASPTTQGLG 47 3623.72 1154.43 13 ACIAD terized DFLHAQEQLR protein Q6F7K5.sub. Uncharac- 1607.39 4820.16 3 84.77 IYQNTDTSSAASQTSASPTTQGLG 50 3623.72 1196.44 14 ACIAD terized DFLHAQEQLR protein Q6F825.sub. Uncharac- 1278.95 3834.82 3 55.92 KLAEPAASAVADQNSPLSAQQQLE 50 2722.40 1112.42 15 ACIAD terized QK protein Q6F825.sub. Uncharac- 1292.95 3876.83 3 55.87 KLAEPAASAVADQNSPLSAQQQLE 58 2722.40 1154.43 16 ACIAD terized QK protein Q6F825.sub. Uncharac- 980.46 3918.84 4 55.74 KLAEPAASAVADQNSPLSAQQQLE 48 2722.40 1196.44 17 ACIAD terized QK protein Q6F814.sub. Putative 814.04 2440.11 3 20.96 NTAASSVAATHKK 65 1285.69 1154.42 18 ACIAD secretion protein (HlyD family) Q6F814.sub. Putative 828.05 2482.12 3 20.59 NTAASSVAATHKK 56 1285.69 1196.44 19 ACIAD secretion protein (HlyD family) Q6F8B6.sub. Uncharac- 1283.91 3849.72 3 37.41 SASKPNVEASVSSQNATLSASQPQ 57 2653.28 1196.44 20 ACIAD terized HQ protein Q6F7U4.sub. Uncharac- 1260.88 3780.64 3 66.46 SSELEDLFNSDGGAASEPAASDKT 60 2668.22 1112.41 21 ACIAD terized AAK protein Q6FAJ2.sub. Uncharac- 989.48 3954.88 4 66.33 VEQIVAQPAPASSVQFKPSNPEID 26 2842.46 1112.42 22 ACIAD terized YK protein Q6FAJ2.sub. Uncharac- 999.98 3996.89 4 66.92 VEQIVAQPAPASSVQFKPSNPEID 21 2842.47 1154.43 23 ACIAD terized YK protein
Example 2
(146) Materials and Methods:
(147) Strains and Plasmids
(148) A list of the bacterial strains and plasmids used in this study is found in Table 4. A. baylyi genomic DNA was isolated using the DNeasy blood and tissue kit (Qiagen). For amplifying the gene aciad3337 (pglL.sub.ComP) with its upstream non-coding region, primers igrF (ACTGGTCGACTAGTAGTACTATATGGCTTTAAA; SEQ ID NO: 89) and igrR (ACTGCTGCAGTTAATATTCTATTGAACAAAATTTTAAC; SEQ ID NO: 90) were used. The resulting PCR product was digested with SalI and PstI and inserted in the same sites of pEXT20, creating pMN8. Plasmid pMN1 was constructed by subcloning ComP from pBAV-ComP-his into BamHI and SalI sites of pEXT20. Plasmid pMN2 was constructed by subcloning pglL.sub.ComP with its upstream region from the SalI and PstI sites of pMN8 to pMN1.
(149) TABLE-US-00004 TABLE 4 Bacterial Strains and plasmids used in this study Reference/ Strain/Plasmid Description Source Strains E. coli CLM24 W3110, waaL ligase Feldman et al. (2005) E. coli CLM37 W3110, wecA glycosyltransferase Linton et al. (2005) E. coli SDB1 W3110, waaL ligase, wecA glycosyltransferase Garcia- Quintanilla et al. (2014) E. coli DH5 General cloning strain Invitrogen Plasmids pEXT20 Cloning vector, Amp.sup.R, IPTG inducible Dykxhoorn et al., (1996) pBAV-ComP-his C-6X His-tagged ComP cloned in BamHI and SalI sites Harding et of pBAVmcs, Kan.sup.R, constitutive expression al., (2015) pMN1 C-6X His-tagged ComP cloned in BamHI and SalI sites This work of pEXT20, Amp.sup.R, IPTG inducible pMN2 Non-coding region and PglL.sub.ComP cloned in SalI and PstI This work sites of pMN1, Amp.sup.R, IPTG inducible pMN3 ComP S69A in pMN2 background This work pMN4 PglL.sub.ComP H325A in pMN2 background This work pMN8 Non-coding region and PglL.sub.ComP cloned in SalI and PstI This work sites of pEXT20, Amp.sup.R, IPTG inducible pMAF10 HA-tagged PglB cloned in pMLBAD, TpR, Arabinose Feldman et inducible al. (2005) pAMF10 C-10 His-tagged NmPglL cloned inyo pEXT20, Faridmoayer AmpR, IPTG inducible et al., (2008) pIH18 C-6X His-tagged AcrA from C. cloned into pEXT21, Hug et al., SpR, IPTG inducible 2010 pAMF22 C-6X His-tagged dsbA1 from N. meningitidis MC58 Faridmoayer cloned into pMLBAD, Tp.sup.R Arabinose inducible et al., (unpublished) pACYCpglBmut pACYC184-based plasmid encoding the C. jejuni pgl Wacker et locus with mutations W458A and D459A in PglB. Cm.sup.R, al., (2002) IPTG inducible. pEXT20-pglL.sub.ADP1 pEXT20 expressing C-6X His-tagged pglLADP1 from Harding et A. baylyi inserted at BamHI and SalI, Amp.sup.R, IPTG al., (2015) inducible pLPS2 P. aeruginosa O11 antigen synthesis cluster, Tet.sup.R Goldberg et al., (1992) pJHCV32 E. coli O7 antigen synthesis cluster, Tet.sup.R Feldman et al., (1999) pNLP80 S. pneumoniae CPS14 cluster on pWSK129, Kan.sup.R Price et al., unpublished pOSH59 S. pneumoniae CPS15b cluster on pACT3, Cm.sup.R Posch et al., unpublished pPR1347 S. enterica serovar Typhimurium O antigen synthesis Neal et al., cluster, Kan.sup.R (1993)
(150) Glycosylation in E. coli
(151) Electrocompetent E. coli CLM24, CLM37 or SDB1 were prepared as per the protocol described by Dower and colleagues (Dower et al., 1988). Cells were transformed with plasmids encoding the glycan synthesis loci, acceptor protein and OTase. For plasmid selection, ampicillin (100 g/ml), tetracycline (20 g/ml), trimethoprim (50 g/ml), chloramphenicol (12.5 g/ml), kanamycin (20 g/ml) and spectinomycin (80 g/ml) were added as needed. Cells were grown at 37 C. in LB broth to an OD.sub.600 of 0.4-0.6, induced with 0.05 mM or 0.1 mM IPTG or 0.2% arabinose as required and left overnight at 37 C. Cultures requiring arabinose induction received a second dose of arabinose after 4 hours. Whole cell lysates were obtained at stationary phases, of which 0.1 OD were loaded on 12.5% SDS-PAGE gels, which were then transferred to nitrocellulose membranes. Western blot analysis was employed to determine protein modification and antibodies used are outlined in Table 5. Nitrocellulose membranes were visualized using the Odyssey Infrared Imaging System (LiCor Biosciences, USA).
(152) TABLE-US-00005 TABLE 5 Antibodies used in the present application Reference/ Antibody Description Source Anti His Poly Rabbit polyclonal, 1:4000 Rockland Anti His Mono Mouse monoclonal, 1.5000 Abcam Anti CPS14 Rabbit polyclonal, 1:1000 Statens Anti CPS15b Rabbit polyclonal, 1:1000 Statens Anti Pseudomonas O11 Rabbit polyclonal, 1:500 Lam lab, antigen University of Guelph Anti Salmonella LT2 O Rabbit polyclonal, 1:1000 Statens antigen hR6 Rabbit polyclonal, 1:200000 Aebi lab Goat Anti rabbit IR680 1:15000 Li-Cor Goat Anti mouse IR800 1:15000 Li-Cor HRP-conjugated IgM Mouse monoclonal 1:10000 Rockland HRP-conjugated IgG Mouse monoclonal 1:10000 Rockland HRP-conjugated Rabbit polyclonal 1:5000 Rockland
(153) Total Membrane Preparations
(154) Cells grown overnight at 37 C. in Terrific broth were washed with phosphate buffered saline (PBS) buffer and resuspended in the same buffer. Cells were lysed by two rounds of cell disruption using a French press at 20 kpsi followed by the addition of a protease inhibitor cocktail (Roche). Lysates were centrifuged for 30 minutes at 10000g to get rid of cell debris and supernatants were then ultracentrifuged at 100000g for 60 minutes to pellet total membranes. The pellet was resuspended in a buffer containing 0.1% Triton 100 or 1% n-dodecyl--D-maltoside (DDM) in 10 ml PBS and membrane proteins were solubilized by tumbling overnight. An equal volume of PBS was added to the suspension to reduce detergent concentration and the suspension was ultracentrifuged at 100000 G for 60 minutes. Supernatants, which correspond to solubilized membrane proteins, were loaded on columns for nickel affinity protein purifications.
(155) Nickel Affinity Protein Purifications
(156) Hexa-histidine-tagged proteins were purified from solubilized total membranes by nickel affinity chromatography. Briefly, total membranes were loaded on nickel-nitrilotriacetic acid (Ni-NTA) agarose columns (Qiagen) previously equilibrated with a buffer containing 20 mM imidazole. To remove unbound proteins, the column was washed four times each with buffers containing 20 mM and 30 mM imidazole. His-tagged proteins bound to the column were eluted over six fractions with an elution buffer containing 250 mM imidazole.
(157) Alternatively, AKTA purifier (Amersham Biosciences, Sweden) was employed for protein purifications. Solubilized membrane proteins were first filtered through 0.45 m and 0.22 m filters, and then loaded on a His-Trap HP column (GE Healthcare) previously equilibrated with a buffer containing 20 mM imidazole. Unbound proteins were removed by washing the column ten times each with buffers containing 20 mM and 30 mM imidazole. To elute proteins bound to the column, gradient elutions with an incremental increase in imidazole concentration of the elution buffer were used.
(158) Mouse Immunizations:
(159) Imidazole was removed by an overnight round of dialysis followed by 2 2-hour rounds in a dialysis buffer composed of 250 ml PBS containing 0.25% DDM. Proteins were quantified using a DC kit (biorad) after which the samples were diluted to approximately 6 g/ml and 0.6 g injected per mouse. Two groups of 10 mice were injected either unglycosylated ComP or CPS-conjugated ComP. Sera from the mice were obtained before immunization, 7 and 21 days post immunization. A booster dose was given on the 14.sup.th day.
(160) Whole Cell ELISAs.
(161) S. pneumoniae serotype 14 (Statens Serum Institut, Denmark) was grown overnight in BHI broth at 37 C. with 5% CO2 aerobic conditions. Cells were washed in 1PBS and OD was adjusted to 0.6. Cells were then heat inactivated by incubation at 60 C. for 2 h followed by immobilizing on Corning high binding 96 well plates (50 L/well). Plates were incubated overnight at 4 C. The following day, wells were washed three times with 1PBS (100 L/well) before blocking with 5% skimmed milk for 2 h. The wells were washed three times with PBS. Plates were then incubated for an hour at room temperature with mouse sera (100 L/well) at a 1:500 dilution in 2.5% skimmed milk in PBST. For the positive control, a commercial rabbit polyclonal antibody against CPS of serotype 14 was used (Statens serum institute). Negative control wells were treated with skimmed milk instead of the primary antibody. After incubation with the primary antibody, wells were washed three times with PBS. This was followed by a 1-hour incubation with secondary HRP-conjugated antibodies (100 L/well). Antibodies employed were the anti mouse IgM (1:10000), anti mouse IgG (1:10000) and anti rabbit (1:5000) HRP-conjugated antibodies diluted in 2.5% skimmed milk in PBST. After incubation, the wells were washed three times with PBS and 100 L of the chromogenic substrate TMB (Cell Signaling Technology) was added to each well and the plate was incubated at room temperature for 5 minutes after which the absorbance at 650 nm was measured using a BioTek plate reader.
(162) Bacterial surface glycans such as capsular polysaccharides (CPS) and O antigens are good vaccine candidates as they were demonstrated to provide glycan-specific protection. Said glycans when used alone elicit T cell-independent immune responses, with no memory cells being formed, and subsequent booster doses are required to sustain protection. As a result, the efficacy of glycan-only vaccines has been well documented in adults under 55 years. However, children <5 respond poorly, if at all, to these vaccines, which has been attributed to the low expression of CD21 on the surface of B cells in the spleen and blood at this age. In the elderly, polysaccharide vaccines are less effective due to the physiological age-associated atrophy of haematopoietic tissue and primary lymphoid organs, causing a decreased production of B and T cells (Griffioen et al., 1991; Simell et al., 2008) (Reviewed by Pace, 2013).
(163) Conjugate vaccines, where surface glycans are linked to immunogenic proteins, have greatly reduced incidence of diseases, compared to glycan-only vaccines. In conjugate vaccines, surface glycans are conjugated to immunogenic proteins, and this elicits T cell-dependent immune responses, which are stronger immune responses that are also associated with the development of memory cells for subsequent infections. The efficacy of conjugate vaccines was demonstrated in children <5 years, which could be attributed to the fact that infant T cells show adult immunophenotypes and mount equally robust immune responses to conjugate vaccine antigens (Timens et al., 1989). For these reasons, conjugate vaccines are gaining momentum in the vaccine market (reviewed by Pace, 2013).
(164) Most conjugate vaccines in the market today are synthesized by chemically conjugating glycans to proteins, which is an expensive process with numerous drawbacks (Dick and Beurret, 1989; Peeters et al., 2003; Lees et al., 2006). Exploiting OTases to perform this conjugation in bacteria has been suggested as a method for cutting vaccine manufacturing costs and improving the efficiency of the process (Terra et al., 2012). OTases heterologously expressed in a bacterial expression system (usually engineered Escherichia coli strains) transfer lipid-linked glycans to acceptor proteins, after which the glycoprotein is subsequently purified. Examples of OTase-conjugated vaccines include, but are not limited to, those against Pseudomonas aeruginosa, Francisella tularensis, Burkholderia pseudomallei, Shigella flexneri and Shigella dysenteriae (Horzempa et al., 2008; Cuccui et al., 2013; Garcia-Quintanilla et al., 2014; Kampf et al., 2015; Ravenscroft et al., 2015).
(165) To date, the best-characterized OTases for producing conjugate vaccines are the Campylobacter N-OTase PglB (CjPglB) and the O-OTases TfpO/Pilo from Pseudomonas aeruginosa and NmPglL from Neisseria meningitidis. The mentioned OTases were found be specific towards the glycans transferred and the range of acceptor proteins they glycosylate.
(166) Regarding acceptor proteins, CjPglB transfers glycans to Asn residues of acceptor proteins that lie in the sequon D/EX.sub.1NX.sub.2S/T (SEQ ID NO: 110), with X being any amino acid except proline, and the residue in the 2 position being acidic, namely glutamic acid (D) or aspartic acid (E) (Kowarik et al., 2006). A DQNAT sequon (SEQ ID NO: 111) was identified to be the optimal sequon for glycosylation by CjPglB (Chen et al., 2007). Insertion of this sequon, termed glycotag, at N or C termini of unglycosylated proteins such as E. coli maltose-binding protein MalE induced glycosylation by CjPglB (Fisher et al., 2010).
(167) No consensus sequence has been identified for the glycosylation site of O-OTases to date. Instead, the glycosylated residues identified were in low complexity regions, with an abundance of serine, proline and alanine residues (Vik et al., 2009). This means that acceptor proteins are limited to the natural substrates of O-OTases, which in case of TfpO is the P. aeruginosa strain 1244 Type IV pilin PilA and in case of NmPglL is a wide range of proteins. However, a similar idea to the N-glycosylation glycotags has been employed in P. aeruginosa, where TfpO was able to glycosylate other proteins with the C terminal 15 residues of PilA (where the glycosylation site lies) fused to their C terminal (Qutyan et al., 2010).
(168) With regards to glycan specificity, CjPglB requires an acetamido group at C-2 of the reducing end for glycan transfer to acceptor proteins. Furthermore, CjPglB was shown to only transfer glycans with N-acetylated sugar residues at the reducing end of the glycan such as FucNAc, GalNAc, GlcNAc and Bac (Feldman et al., 2005; Wacker et al., 2006). Additionally, CjPglB was demonstrated to transfer Burkholderia. pseudomallei O polysaccharide II, the equivalent of O antigen. This glycan is a polymer of disaccharide repeating subunits composed of glucose and O-acetyl deoxytalose (Garcia-Quintanilla et al., 2014).
(169) TfpO/Pilo was demonstrated to transfer multiple Pseudomonas O antigens, all of which are either tri or tetrasaccharides with FucNAc at the reducing end, to PilA. TfpO also transferred the E. coli O157 antigen, a tetrasaccharide with GalNAc at the reducing end (DiGiandomenico et al., 2002; Horzempa et al., 2006). Furthermore, TfpO was demonstrated to only transfer short chain oligosaccharides of the E. coli O7 antigen, a pentasaccharide with GlcNAc at the reducing end, greatly limiting its potential for the conjugate vaccine industry apart from Pseudomonas conjugate vaccines (Faridmoayer et al., 2007).
(170) NmPglL on the other hand displayed a more relaxed glycan specificity than TfpO, and was demonstrated to transfer sugars with N-acetylated glycans at the reducing end as well as glycans with Gal residues at the reducing end, characteristic of the Salmonella enterica S. typhimurium O antigen (which could not be transferred by CjPglB). In addition to having different glycan and protein specificities, the O-OTases NmPglL and TfpO are sequentially and phylogenetically distinct, which suggests that they comprise two distinct classes of O-OTases. PglL-like OTases appear to be far more superior and with more potential in glycoengineering than TfpO-like OTases, given their ability to transfer longer oligosaccharides and their more relaxed glycan specificity.
(171) A limitation of all characterized OTases to date is that none of them are able to transfer glycans with glucose residues at the reducing end. Such glycans are characteristic of the capsular polysaccharides of members of the genus Streptococcus, an example of which being S. pneumoniae.
(172) Streptococcus pneumoniae, or the Pneumococcus, is one of the leading causes of bacterial meningitis in infants and children. Children under 5, the elderly and immunocompromised are at a particular high risk of community-acquired pneumococcal infections (Reviewed by Watson et al., 1993). In 2000, conservative estimates of Pneumococcus infections predicted 14.5 million cases. Pneumococcus-associated mortalities in children under 5 years are estimated to be 826000 annually, accounting for approximately 11% of mortalities in children under 5 (O'Brien et al., 2009). More than 90 serotypes have been identified for the Pneumococcus, each possessing a structurally and immunogenically distinct polysaccharide capsule that is the basis of pneumococcus vaccines (Lund, 1970; Kadioglu et al., 2008). Pneumococcus conjugate vaccines available in the market are produced by chemical conjugations of CPS to the modified diphtheria toxin CRM.sub.197, which, despite its exceptional efficacy, is significantly more expensive than polysaccharide-only vaccines according to the CDC vaccine price list. This has led the slow implementation of Pneumococcus vaccine programs by low-income countries without external aid (Wenger, 2001; Weinberger et al., 2011).
(173) As a result of this, an OTase capable of biologically conjugating the Streptococcus CPS to acceptor proteins, such as that of the Pneumococcus, would revolutionize immunization against this organism, leading to significantly cheaper vaccines and ultimately leading to a reduction in disease burden and child deaths especially in low-income countries.
(174) In the present example there is provided an O-OTase that appears to constitute a novel class of O-OTases. The OTase is called PglL.sub.ComP and was identified in the non-pathogenic strain Acinetobacter baylyi (Harding et al., 2015). This OTase is phylogenetically and sequentially similar to PglL-like OTases and transfers similar glycans (
Example 3
(175) In the present example there is provided evidence that injection of CPS14-conjugated to ComP via PglL.sub.ComP in E. coli mounts an IgG immune response against S. pneumoniae serotype 14 capsule.
(176) In this example, it was sought to determine whether ComP conjugated with the S. pneumoniae serotype 14 capsular polysaccharide would generate an immunogenic response in a murine model. Overexpressed his-tagged ComP either conjugated to CPS or in its unglycosylated form were purified by Nickel affinity chromatography from E. coli SDB1 detergent-solubilized total membranes. For immunization, 60 ng of CPS-conjugated ComP were used per mouse (n=10) and as a control group, mice were immunized with 60 ng of unglycosylated ComP each (n=10). A booster dose of the glycoprotein was administered on day 14 and pre immune sera and post immune sera (day 7 and day 21) were collected. To determine if there was an immunogenic response, we performed whole cell ELISAs by immobilizing heat-killed S. pneumoniae serotype 14 on 96 well plates. Pre immune and post-immune sera from day 7 did not produce and immune response to the whole cells. Post immune sera from day 21 of the mice injected with CPS-conjugated ComP demonstrated marginal IgM and significant IgG based immune responses against this serotype. An IgG immune response was not seen with the negative control mice injected with the glycosylated ComP (
(177) TABLE-US-00006 TABLE6 Primersusedinthepresentapplication Prim- er Set Sequence 1 F AGAATACTTGCATAGTGACAGGTTACAG(SEQIDNO:1) R GTTATGGCGGCGGTGGAGGTC(SEQIDNO:2) 2 F CAAAAAGCTTATATAAAAACATACATACAATCTTTGGGGAA AAGGCTATGATTCCGGGGATCCGTCGACC(SEQIDNO:3) R GGATTGACCTCTCTTTTTTATTTCTAAAATTACGATGCTAC AAATGATTGTGTAGGCTGGAGCTGCTTCG(SEQIDNO:4) 3 F GCGGGATCCGCAAATTGGTGATGTGATGTCTCG(SEQID NO:5) R GCGGGTACCGCTGCGAGGAATAAAAAGAATACT(SEQID NO:6) 4 F GCGGGATCCGCAAATTGGTGATGTGATGTCTCG(SEQID NO:7) R GCGGGTACCTCGTATTGTGAACTAGACCATCCT(SEQID NO:8) 5 F GCGGGATCCGCAAATTGGTGATGTGATGTCTCG(SEQID NO:9) R GCGGGTACCGCTGCGAGGAATAAAAAGAATACT(SEQID NO:10) 6 F AGAATACTTGCATAGTGACAGGTTACAG(SEQIDNO:11) R CGCATTTATATTTGGGGATTACTC(SEQIDNO:12) 7 F CTTCCATGTATAATTCTTCTCAAGTTTTTGGTCTGTAACCT GTCACTATGATTCCGGGGATCCGTCGACC(SEQIDNO:13) R AAAATCCCCTTGAAAACAAGGGGATTTTTTTATTTATCTTT TAATAATTGTGTAGGCTGGAGCTGCTTCG(SEQIDNO:14) 8 F CTTCCTCAATCATTTGTAGCAGCGTAATTTTAGAAATAAAAA AG(SEQIDNO:15) R CTTTTTTATTTCTAAAATTACGCTGCTACAAATGATTGAGGA AG(SEQIDNO:16) 9 F ATGAAAAAACTTGAGCACCTTGC(SEQIDNO:17) R TGTTTGCTCTTATTTCTACTG(SEQIDNO:18) 10 F TTGTCATTTATAAAGTTAGTCAC(SEQIDNO:19) R TGTACACCTGATTTTAATATTCTA(SEQIDNO:20) 11 F GAAATAAGAGCAAACAATTCCGGGGATCCGTCGACC(SEQ IDNO:21) R CTTTATAAATGACAATGTAGGCTGGAGCTGCTTCG(SEQ IDNO:22) 12 F CTCAAGTTTTTTCATCGCCATGGCGGCCGGGAGCATG(SEQ IDNO:23) R AAAATCAGGTGTACAACTAGTGAATTCGCGGCCGCCTGCA (SEQIDNO:24) 13 F CGTCCCCAAAAGCGTGAA(SEQIDNO:25) R TTAGGCAAATTTCGAAGCGTGAT(SEQIDNO:26) 14 F GCGCCCGGGATAAGTGCTCAATTGATGG(SEQIDNO:27) R GGTACCGAGATCCCAAACCAGCAAC(SEQIDNO:28) 15 F ACTAGTGAATTCGCGGCCGCCTGCA(SEQIDNO:29) R CGCCATGGCGGCCGGGAGCATG(SEQIDNO:30) 16 F ATTCCGGGGATCCGTCGACC(SEQIDNO:31) R TGTAGGCTGGAGCTGCTTCG(SEQIDNO:32) 17 F CCGGCCGCCATGGCGATGACGATTGGTTTAATTTTTTC (SEQIDNO:33) R ACGGATCCCCGGAATCATACTTGTAAAAAAAAAAGTATTT (SEQIDNO:34) 18 F CAGCTCCAGCCTACAATGGAAGAAAATTCTTTATTAATTT (SEQIDNO:35) R CGCGAATTCACTAGTTTAAACATATTTTTCCCATTTC(SEQ IDNO:36) 19 F CCGGCCGCCATGGCGATGACTCCTGCCGGAGG(SEQID NO:37) R ACGGATCCCCGGAATTTAATAAAGAATTTTCTTCCATTTAC (SEQIDNO:38) 20 F CAGCTCCAGCCTACAATAGTAGGACTAAAAAAATGATTTCG (SEQIDNO:39) 20 R CGCGAATTCACTAGTTTATTTATATAACCCTTTTTCTTTC (SEQIDNO:40) 21 F CGGCCGCCATGGCGATGTTTAAAAATGTATTAATTACTGG (SEQIDNO:41) R ACGGATCCCCGGAATCATTTATTTATATAACCCTTTTTCT (SEQIDNO:42) 22 F CAGCTCCAGCCTACAATAAATTTAAAATATTCATAAATCT (SEQIDNO:43) R CGCGAATTCACTAGTTTATAATTTAAGTTCTTGAATCAAC (SEQIDNO:44) 23 F CTACATTGTTTATTTTTACCAGAA(SEQIDNO:45) R GAAGCTTGAAGTTATCCACGAA(SEQIDNO:46) 24 F CATCAAAAATACCAGCCTAAATTATC(SEQIDNO:47) R CCATTGTTTGAAATTATTTAGGG(SEQIDNO:48) 25 F CATCAAAAATACCAGCCTAAATTATC(SEQIDNO:49) R GAAGAAAATTCTTTATTAATTTCTG(SEQIDNO:50) 26 F CATCAAAAATACCAGCCTAAATTATC(SEQIDNO:51) R GAAAAAGGGTTATATAAATAAATG(SEQIDNO:52) 27 F GCGCCCGGGCTACATTGTTTATTTTTACCAGAA(SEQID NO:53) R GCGGGTACCACCATCATTGACTACTAAGACCTC(SEQID NO:54) 28 F GCGCCCGGGCTACATTGTTTATTTTTACCAGAA(SEQID NO:55) R GCGGGTACCTTCTACATCCAATACCAGTCGT(SEQIDNO: 56) 29 F GCGCCCGGGCTACATTGTTTATTTTTACCAGAA(SEQID NO:57) R GCGGGTACCGAAGCTTGAAGTTATCCACGAA(SEQIDNO: 58) 30 F GCGCCCGGGCCGAAGCAGGGTGGGTGTTAGT(SEQIDNO: 59) R GCGGGTACCTTAGTGGTGGTGGTGGTGTTGAGCTACTGAAAAC TCAATAC(SEQIDNO:60) 31 F GCCATATGGCTTATCAAAACTATATTGCTAAATCTC(SEQ IDNO:61) R GCGGATCCCTCTTTTTTATTTCTAAAATTACGATGCT(SEQ IDNO:62) 32 F ATAGGATCCATGAATGCACAAAAGGGTTTTACC(SEQID NO:63) R TATGTCGACTCAGTGGTGGTGGTGGTGGTGACCACGACATTCT GATGG(SEQIDNO:64) 33 F ATATGGATCCGTGGTTGATAGTAGTACTATATGG(SEQID NO:65) R ATATGTCGACTCAGTGGTGGTGGTGGTGGTGATATTCTATTGA ACAAAATTTTAACTTAGG(SEQIDNO:66) 34 F ATATGGATCCGTGGCTGGTTCCCCGCGTGTGTATAATAGC (SEQIDNO:67) R ATATGTCGACTTAGTGGTGGTGGTGGTGGTGCTTGGATGACTC TACAGCAGAAGC(SEQIDNO:68) 35 F ACTGGGATCCATGTTAAAAAAAATTATTCTATTTC(SEQID NO:69) R ACTGGTCGACTAAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTG AGGAATTTTTGAGGTTGGTAC(SEQIDNO:70) 36 F ACTGGGATCCATGCAAGTATTCTTTCTGTTC(SEQIDNO: 71) R ACTGGTCGACTAAGTGGTGGTGGTGGTGGTGGTGGTGGTGGT GTTTATTTTTTAACAACTCTGCC(SEQIDNO:72) 37 F GGTGGACGTGGAGGAG(SEQIDNO:73) R CTTGCTTGGGTTACATCAGTGCT(SEQIDNO:74) 38 F AATTATTGTACAGCCTTTTG(SEQIDNO:75) R CATCATCATCATCATCACTAATATTAAAAATGTATAAAAAAC ACC(SEQIDNO:76) 39 F CCAGTTGAATTACTTCCTCAAGCATTTGTAGCATCGTAAT (SEQIDNO:77) R ATTACGATGCTACAAATGCTTGAGGAAGTAATTCAACTGG (SEQIDNO:78)
REFERENCES
(178) Aas, F. E., Egge-Jacobsen, W., Winther-Larsen, H. C., Lvold, C., Hitchen, P. G., Dell, A., & Koomey, M. (2006). Neisseria gonorrhoeae type IV pili undergo multisite, hierarchical modifications with phosphoethanolamine and phosphocholine requiring an enzyme structurally related to lipopolysaccharide phosphoethanolamine transferases. The Journal of Biological Chemistry 281(38): 27712-23. Abd-El-Haleem, D., Moawad, H., Zaki, E. A., & Zaki, S. (2002). Molecular characterization of phenol-degrading bacteria isolated from different Egyptian ecosystems. Microbial Ecology 43(2): 217-24. Arroyo, L. A., Mateos, I., Gonzalez, V., & Aznar, J. (2009). In vitro activities of tigecycline, minocycline, and colistin-tigecycline combination against multi- and pandrug-resistant clinical isolates of Acinetobacter baumannii group. Antimicrobial Agents and Chemotherapy 53(3): 1295-6. Balonova, L., Mann, B. F., Cerveny, L., Alley, W. R., Chovancova, E., Forslund, A.-L., . . . Stulik, J. (2012). Characterization of protein glycosylation in Francisella tularensis subsp. holarctica: identification of a novel glycosylated lipoprotein required for virulence. Molecular & Cellular Proteomics: MCP 11(7): M111.015016. Bentley, S. D., Aanensen, D. M., Mavroidi, A., Saunders, D., Rabbinowitsch, E., Collins, M., et al. (2006) Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. PLoS Genet 2: e31. Brud, B., Viburiene, R., Hartley, M. D., Paulsen, B. S., Egge-Jacobsen, W., Imperiali, B., & Koomey, M. (2011). Genetic and molecular analyses reveal an evolutionary trajectory for glycan synthesis in a bacterial protein glycosylation system. Proceedings of the National Academy of Sciences of the United States of America 108(23): 9643-8. Boucher, C. A., Barberis, P. A., & Demery, D. A. (1985). Transposon Mutagenesis of Pseudomonas solanacearum: Isolation of Tn5-Induced Avirulent Mutants. Microbiology 131(9): 2449-2457. Brzoska, A. J., Hassan, K. A., de Leon, E. J., Paulsen, I. T., & Lewis, P. J. (2013). Single step selection of drug resistant Acinetobacter baylyi ADP1 mutants reveals a functional redundancy in the recruitment of multidrug efflux systems. PloS One 8(2): e56090. Cagatay, T. I., & Hickford, J. G. H. (2008). Glycosylation of type-IV fimbriae of Dichelobacter nodosus. Veterinary Microbiology 126(1-3): 160-7. Carruthers, M. D., Nicholson, P. A., Tracy, E. N., & Munson, R. S. (2013). Acinetobacter baumannii Utilizes a Type VI Secretion System for Bacterial Competition. PLoS One 8(12): e59388. Castric, P. (1995). pilO, a gene required for glycosylation of Pseudomonas aeruginosa 1244 pilin. Microbiology 141: 1247-54. Charbonneau, M.-E., Girard, V., Nikolakakis, A., Campos, M., Berthiaume, F., Dumas, F., . . . Mourez, M. (2007). O-linked glycosylation ensures the normal conformation of the autotransporter adhesin involved in diffuse adherence. Journal of Bacteriology 189(24): 8880-9. Chen, M. M., Glover, K. J., and Imperiali, B. (2007) From peptide to protein: comparative analysis of the substrate specificity of N-linked glycosylation in C. jejuni. Biochemistry 46: 5579-85. Choi, A. H. K., Slamti, L., Avci, F. Y., Pier, G. B., & Maira-Litran, T. (2009). The pgaABCD locus of Acinetobacter baumannii encodes the production of poly-beta-1-6-N-acetylglucosamine, which is critical for biofilm formation. Journal of Bacteriology 191(19): 5953-63. Choi, C. H., Hyun, S. H., Lee, J. Y., Lee, J. S., Lee, Y. S., Kim, S. A., . . . Lee, J. C. (2008). Acinetobacter baumannii outer membrane protein A targets the nucleus and induces cytotoxicity. Cellular Microbiology 10(2): 309-19. Comer, J. E., Marshall, M. A., Blanch, V. J., Deal, C. D., & Castric, P. (2002). Identification of the Pseudomonas aeruginosa 1244 pilin glycosylation site. Infection and Immunity 70(6): 2837-45. Cote, J.-P., Charbonneau, M.-E., & Mourez, M. (2013). Glycosylation of the Escherichia coli TibA self-associating autotransporter influences the conformation and the functionality of the protein. PloS One 8(11): e80739. Coyne, M. J., Fletcher, C. M., Chatzidaki-Livanis, M., Posch, G., Schaffer, C., & Comstock, L. E. (2013). Phylum-wide general protein O-glycosylation system of the Bacteroidetes. Molecular Microbiology 88(4): 772-83. Cuccui, J., Thomas, R. M., Moule, M. G., D'Elia, R. V, Laws, T. R., Mills, D. C., et al. (2013) Exploitation of bacterial N-linked glycosylation to develop a novel recombinant glycoconjugate vaccine against Francisella tularensis. Open Biol 3: 130002. De Berardinis, V., Vallenet, D., Castelli, V., Besnard, M., Pinet, A., Cruaud, C., . . . Weissenbach, J. (2008). A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1. Molecular Systems Biology 4: 174. Dick, W. E., and Beurret, M. (1989) Glycoconjugates of bacterial carbohydrate antigens. A survey and consideration of design and preparation factors. Contrib Microbiol Immunol 10: 48-114. DiGiandomenico, A., Matewish, M. J., Bisaillon, A., Stehle, J. R., Lam, J. S., and Castric, P. (2002) Glycosylation of Pseudomonas aeruginosa 1244 pilin: glycan substrate specificity. Mol Microbiol 46: 519-30. Egge-Jacobsen, W., Salomonsson, E. N., Aas, F. E., Forslund, A.-L., Winther-Larsen, H. C., Maier, J., . . . Koomey, M. (2011). O-linked glycosylation of the PilA pilin protein of Francisella tularensis: identification of the endogenous protein-targeting oligosaccharyltransferase and characterization of the native oligosaccharide. Journal of Bacteriology 193(19): 5487-97. Faridmoayer, A., Fentabil, M. A., Mills, D. C., Klassen, J. S., & Feldman, M. F. (2007). Functional characterization of bacterial oligosaccharyltransferases involved in O linked protein glycosylation. Journal of Bacteriology 189(22): 8088-98. Feldman, M. F., Wacker, M., Hernandez, M., Hitchen, P. G., Marolda, C. L., Kowarik, M., . . . Aebi, M. (2005). Engineering N-linked protein glycosylation with diverse O antigen lipopolysaccharide structures in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America 102(8): 3016-21. Fisher, A. C., Haitjema, C. H., Guarino, C., Celik, E., Endicott, C. E., Reading, C. A., et al. (2010) Production of Secretory and Extracellular N-Linked Glycoproteins in Escherichia coli. Appl Environ Microbiol 77: 871-881. Garcia-Quintanilla, F., Iwashkiw, J. A., Price, N. L., Stratilo, C., and Feldman, M. F. (2014) Production of a recombinant vaccine candidate against Burkholderia pseudomallei exploiting the bacterial N-glycosylation machinery. Front Microbiol 5: 381. Gebhart, C., Ielmini, M. V., Reiz, B., Price, N. L., Aas, F. E., Koomey, M., & Feldman, M. F. (2012). Characterization of exogenous bacterial oligosaccharyltransferases in Escherichia coli reveals the potential for O-linked protein glycosylation in Vibrio cholerae and Burkholderia thailandensis. Glycobiology 22(7): 962-74. Gordon, N. C., & Wareham, D. W. (2010). Multidrug-resistant Acinetobacter baumannii: mechanisms of virulence and resistance. International Journal of Antimicrobial Agents 35(3): 219-26. Gottig, S., Gruber, T. M., Higgins, P. G., Wachsmuth, M., Seifert, H., & Kempf, V. A. J. (2014). Detection of pan drug-resistant Acinetobacter baumannii in Germany. The Journal of Antimicrobial Chemotherapy 69(9): 2578-9. Griffioen, A. W., Rijkers, G. T., Janssens-Korpela, P., and Zegers, B. J. (1991) Pneumococcal polysaccharides complexed with C3d bind to human B lymphocytes via complement receptor type 2. Infect Immun 59: 1839-45. Gross, J., Grass, S., Davis, A. E., Gilmore-Erdmann, P., Townsend, R. R., & St Geme, J. W. (2008). The Haemophilus influenzae HMW1 adhesin is a glycoprotein with an unusual N-linked carbohydrate modification. The Journal of Biological Chemistry 283(38): 26010-5. Harding, C. M., Tracy, E. N., Carruthers, M. D., Rather, P. N., Actis, L. A., & Munson, R. S. (2013). Acinetobacter baumannii strain M2 produces type IV pili which play a role in natural transformation and twitching motility but not surface-associated motility. mBio 4(4): e00360-13. Harding, C. M., Nasr, M. A., Kinsella, R. L., Scott, N. E., Foster, L. J., Weber, B. S., et al. (2015) Acinetobacter strains carry two functional oligosaccharyltransferases, one devoted exclusively to type IV pilin, and the other one dedicated to O-glycosylation of multiple proteins. Mol Microbiol. Horzempa, J., Dean, C. R., Goldberg, J. B., and Castric, P. (2006) Pseudomonas aeruginosa 1244 pilin glycosylation: glycan substrate recognition. J Bacteriol 188: 4244-52. Horzempa, J., Held, T. K., Cross, A. S., Furst, D., Qutyan, M., Neely, A. N., and Castric, P. (2008) Immunization with a Pseudomonas aeruginosa 1244 pilin provides O-antigen-specific protection. Clin Vaccine Immunol 15: 590-7. Hu, D., Liu, B., Dijkshoorn, L., Wang, L., & Reeves, P. R. (2013). Diversity in the major polysaccharide antigen of Acinetobacter baumannii assessed by DNA sequencing, and development of a molecular serotyping scheme. PloS One 8(7): e70329. Hug, I., & Feldman, M. F. (2011). Analogies and homologies in lipopolysaccharide and glycoprotein biosynthesis in bacteria. Glycobiology 21(2): 138-51. Ielmini, M. V, & Feldman, M. F. (2011). Desulfovibrio desulfuricans PglB homolog possesses oligosaccharyltransferase activity with relaxed glycan specificity and distinct protein acceptor sequence requirements. Glycobiology 21(6): 734-42. Iwashkiw, J. A., Seper, A., Weber, B. S., Scott, N. E., Vinogradov, E., Stratilo, C., . . . Feldman, M. F. (2012). Identification of a General O-linked Protein Glycosylation System in Acinetobacter baumannii and Its Role in Virulence and Biofilm Formation. PLoS Pathogens 8(6): e1002758. Iwashkiw, J. A., Vozza, N. F., Kinsella, R. L., & Feldman, M. F. (2013). Pour some sugar on it: the expanding world of bacterial protein O-linked glycosylation. Molecular Microbiology 89(1): 14-28. Kadioglu, A., Weiser, J. N., Paton, J. C., and Andrew, P. W. (2008) The role of Streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nat Rev Microbiol 6: 288-301. Kampf, M. M., Braun, M., Sirena, D., Ihssen, J., Thony-Meyer, L., and Ren, Q. (2015) In vivo production of a novel glycoconjugate vaccine against Shigella flexneri 2a in recombinant Escherichia coli: identification of stimulating factors for in vivo glycosylation. Microb Cell Fact 14: 12. Kowarik, M., Young, N. M., Numao, S., Schulz, B. L., Hug, I., Callewaert, N., et al. (2006) Definition of the bacterial N-glycosylation site consensus sequence. EMBO J 25: 1957-66. Kus, J. V, Tullis, E., Cvitkovitch, D. G., & Burrows, L. L. (2004). Significant differences in type IV pilin allele distribution among Pseudomonas aeruginosa isolates from cystic fibrosis (CF) versus non-CF patients. Microbiology 150: 1315-26. Lees, A., Sen, G., and LopezAcosta, A. (2006) Versatile and efficient synthesis of protein-polysaccharide conjugate vaccines using aminooxy reagents and oxime chemistry. Vaccine 24: 716-729. Lees-Miller, R. G., Iwashkiw, J. A., Scott, N. E., Seper, A., Vinogradov, E., Schild, S., & Feldman, M. F. (2013). A common pathway for O-linked protein-glycosylation and synthesis of capsule in Acinetobacter baumannii. Molecular Microbiology 89(5): 816-30. Lithgow, K. V., Scott, N. E., Iwashkiw, J. A., Thomson, E. L. S., Foster, L. J., Feldman, M. F., & Dennis, J. J. (2014). A general protein O-glycosylation system within the Burkholderia cepacia complex is involved in motility and virulence. Molecular Microbiology 92(1): 116-137. Logan, S. M. (2006). Flagellar glycosylationa new component of the motility repertoire? Microbiology 152: 1249-62. Lund, E. (1970) On the nomenclature of the pneumococcal types. Int J Syst Bacteriol 20: 321-323. Mara, K., Decorosi, F., Viti, C., Giovannetti, L., Papaleo, M. C., Maida, I., . . . Fani, R. (2012). Molecular and phenotypic characterization of Acinetobacter strains able to degrade diesel fuel. Research in Microbiology 163(3): 161-72. Marchler-Bauer A., Bryant S H. (2004). CD-Search: protein domain annotations on the fly. Nucleic Acids Research 32(W): 327-331. Marchler-Bauer A. et al. (2009). CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Research 37(D): 205-10. Marchler-Bauer A. et al. (2011). CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Research 39(D): 225-9. Mescher, M. F., & Strominger, J. L. (1976). Structural (shape-maintaining) role of the cell surface glycoprotein of Halobacterium salinarium. Proceedings of the National Academy of Sciences of the United States of America 73(8): 2687-91. Musumeci, M. A., Faridmoayer, A., Watanabe, Y., & Feldman, M. F. (2014). Evaluating the role of conserved amino acids in bacterial O-oligosaccharyltransferases by in vivo, in vitro and limited proteolysis assays. Glycobiology 24(1): 39-50. Neuberger, A. (1938). Carbohydrates in protein: The carbohydrate component of crystalline egg albumin. The Biochemical Journal 32(9): 1435-51. Nguyen, L. C., Taguchi, F., Tran, Q. M., Naito, K., Yamamoto, M., Ohnishi-Kameyama, M., . . . Ichinose, Y. (2012). Type IV pilin is glycosylated in Pseudomonas syringae pv. tabaci 6605 and is required for surface motility and virulence. Molecular Plant Pathology 13(7): 764-74. Nothaft, H., Scott, N. E., Vinogradov, E., Liu, X., Hu, R., Beadle, B., . . . Szymanski, C. M. (2012). Diversity in the protein N-glycosylation pathways within the Campylobacter genus. Molecular & Cellular Proteomics: MCP 11(11): 1203-19. Nothaft, H., & Szymanski, C. M. (2010). Protein glycosylation in bacteria: sweeter than ever. Nature Reviews. Microbiology 8(11): 765-78. O'Brien, K. L., Wolfson, L. J., Watt, J. P., Henkle, E., Deloria-Knoll, M., McCall, N., et al. (2009) Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374: 893-902. Olsen, J. V, Macek, B., Lange, O., Makarov, A., Horning, S., & Mann, M. (2007). Higher-energy C-trap dissociation for peptide modification analysis. Nature Methods 4(9): 709-12. Pace, D. (2013) Glycoconjugate vaccines. Expert Opin Biol Ther 13: 11-33. Peeters, C. C. A. M., Lagerman, P. R., Weers, O. de, Oomen, L. A., Hoogerhout, P., Beurret, M., et al. (2003) Preparation of polysaccharide-conjugate vaccines. Methods Mol Med 87: 153-74. Perez, J. M., McGarry, M. A., Marolda, C. L., & Valvano, M. A. (2008). Functional analysis of the large periplasmic loop of the Escherichia coli K-12 WaaL O-antigen ligase. Molecular Microbiology 70(6): 1424-40. Porstendorfer, D., Gohl, O., Mayer, F., & Averhoff, B. (2000). ComP, a Pilin-Like Protein Essential for Natural Competence in Acinetobacter sp. Strain BD413: Regulation, Modification, and Cellular Localization. Journal of Bacteriology 182(13): 3673-3680. Power, P., & Jennings, M. (2003). The genetics of glycosylation in Gram-negative bacteria. FEMS Microbiology Letters 218(2): 211-222. Power, P. M., Seib, K. L., & Jennings, M. P. (2006). Pilin glycosylation in Neisseria meningitidis occurs by a similar pathway to wzy-dependent O-antigen biosynthesis in Escherichia coli. Biochemical and Biophysical Research Communications 347(4):904-8. Qutyan, M., Henkel, M., Horzempa, J., Quinn, M., and Castric, P. (2010) Glycosylation of Pilin and Nonpilin Protein Constructs by Pseudomonas aeruginosa 1244. J Bacteriol 192: 5972-5981. Rappsilber, J., Mann, M., & Ishihama, Y. (2007). Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nature Protocols 2(8): 1896-906. Ravenscroft, N., Haeuptle, M. A., Kowarik, M., Fernandez, F. S., Carranza, P., Brunner, A., et al. (2015) Purification and characterization of a Shigella conjugate vaccine, produced by glycoengineering Escherichia coli. Glycobiology cwv077. Ruan, X., Loyola, D. E., Marolda, C. L., Perez-Donoso, J. M., & Valvano, M. A. (2012). The WaaL O-antigen lipopolysaccharide ligase has features in common with metal ion-independent inverting glycosyltransferases. Glycobiology 22(2): 288-99. Schulz, B. L., Jen, F. E. C., Power, P. M., Jones, C. E., Fox, K. L., Ku, S. C., . . . Jennings, M. P. (2013). Identification of bacterial protein O oligosaccharyltransferases and their glycoprotein substrates. PloS One 8(5):e62768. Scott, N. E., Kinsella, R. L., Edwards, A. V. G., Larsen, M. R., Dutta, S., Saba, J., . . . Feldman, M. F. (2014). Diversity Within the O-linked Protein Glycosylation Systems of Acinetobacter Species. Molecular & Cellular Proteomics: MCP 13(9):2354-70. Scott, N. E., Nothaft, H., Edwards, A. V. G., Labbate, M., Djordjevic, S. P., Larsen, M. R., Cordwell, S. J. (2012). Modification of the Campylobacter jejuni N-linked glycan by EptC protein-mediated addition of phosphoethanolamine The Journal of Biological Chemistry 287(35): 29384-96. Scott, N. E., Parker, B. L., Connolly, A. M., Paulech, J., Edwards, A. V. G., Crossett, B., . . . Cordwell, S. J. (2011). Simultaneous glycan-peptide characterization using hydrophilic interaction chromatography and parallel fragmentation by CID, higher energy collisional dissociation, and electron transfer dissociation MS applied to theN-linked glycoproteome of Campylobacter jejuni. Molecular & Cellular Proteomics: MCP 10(2): M000031-MCP201. Simell, B., Landenkari, M., Reunanen, A., Kayhty, H., and Vakevainen, M. (2008) Effects of Ageing and Gender on Naturally Acquired Antibodies to Pneumococcal Capsular Polysaccharides and Virulence-Associated Proteins. Clin Vaccine Immunol 15: 1391-1397. Sleytr, U. B. (1975). Heterologous reattachment of regular arrays of glycoproteins on bacterial surfaces. Nature 257(5525): 400-402. Smedley, J. G., Jewell, E., Roguskie, J., Horzempa, J., Syboldt, A., Stolz, D. B., & Castric, P. (2005). Influence of pilin glycosylation on Pseudomonas aeruginosa 1244 pilus function. Infection and Immunity 73(12): 7922-31. Szymanski, C. M., Yao, R., Ewing, C. P., Trust, T. J., & Guerry, P. (1999). Evidence for a system of general protein glycosylation in Campylobacter jejuni. Molecular Microbiology 32(5): 1022-1030. Tang, G., & Mintz, K. P. (2010). Glycosylation of the collagen adhesin EmaA of Aggregatibacter actinomycetemcomitans is dependent upon the lipopolysaccharide biosynthetic pathway. Journal of Bacteriology 192(5): 1395-404. Terra, V. S., Mills, D. C., Yates, L. E., Abouelhadid, S., Cuccui, J., and Wren, B. W. (2012) Recent developments in bacterial protein glycan coupling technology and glycoconjugate vaccine design. J Med Microbiol 61: 919-926. Timens, W., Boes, A., Rozeboom-Uiterwijk, T., and Poppema, S. (1989) Immaturity of the human splenic marginal zone in infancy. Possible contribution to the deficient infant immune response. J Immunol 143: 3200-6. Tsai, C. M., & Frasch, C. E. (1982). A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Analytical Biochemistry 119(1): 115-9. van Selm, S., van Cann, L. M., Kolkman, M. A. B., van der Zeijst, B. A. M., and Putten, J. P. M. van (2003) Genetic basis for the structural difference between Streptococcus pneumoniae serotype 15B and 15C capsular polysaccharides. Infect Immun 71: 6192-8. Vaneechoutte, M., Young, D. M., Ornston, L. N., De Baere, T., Nemec, A., Van Der Reijden, T., . . . Dijkshoorn, L. (2006). Naturally Transformable Acinetobacter sp. Strain ADP1 Belongs to the Newly Described Species Acinetobacter baylyi. Applied and Environmental Microbiology 72(1): 932-936. Varki, A. (1993). Biological roles of oligosaccharides: all of the theories are correct. Glycobiology 3(2): 97-130. Vik, A., Aas, F. E., Anonsen, J. H., Bilsborough, S., Schneider, A., Egge-Jacobsen, W., & Koomey, M. (2009). Broad spectrum O-linked protein glycosylation in the human pathogen Neisseria gonorrhoeae. Proceedings of the National Academy of Sciences of the United States of America 106(11): 4447-52. Voisin, S., Kus, J. V, Houliston, S., St-Michael, F., Watson, D., Cvitkovitch, D. G., . . . Burrows, L. L. (2007). Glycosylation of Pseudomonas aeruginosa strain Pa5196 type IV pilins with Mycobacterium-like alpha-1,5-linked d-Araf oligosaccharides. Journal of Bacteriology 189(1): 151-9. Wacker, M., Feldman, M. F., Callewaert, N., Kowarik, M., Clarke, B. R., Pohl, N. L., et al. (2006) Substrate specificity of bacterial oligosaccharyltransferase suggests a common transfer mechanism for the bacterial and eukaryotic systems. Proc Natl Acad Sci USA 103: 7088-93. Wang, N., Mackenzie, L., De Souza, A. G., Zhong, H., Goss, G., & Li, L. (2007). Proteome profile of cytosolic component of zebrafish liver generated by LC-ESI MS/MS combined with trypsin digestion and microwave-assisted acid hydrolysis. Journal of Proteome Research 6(1): 263-72. Watson, D. A., Musher, D. M., Jacobson, J. W., and Verhoef, J. (1993) A Brief History of the Pneumococcus in Biomedical Research: A Panoply of Scientific Discovery. Clin Infect Dis 17: 913-924. Weber, B. S., Miyata, S. T., Iwashkiw, J. A., Mortensen, B. L., Skaar, E. P., Pukatzki, S., & Feldman, M. F. (2013). Genomic and functional analysis of the type VI secretion system in Acinetobacter. PloS One 8(1): e55142. Weinberger, D. M., Malley, R., and Lipsitch, M. (2011) Serotype replacement in disease after pneumococcal vaccination. Lancet (London, England) 378: 1962-73. Wenger, J. (2001) Vaccines for the developing world: current status and future directions. Vaccine 19: 1588-1591. Whitfield, C. (1995). Biosynthesis of lipopolysaccharide O antigens. Trends in Microbiology 3(5): 178-185. Wisplinghoff, H., Paulus, T., Lugenheim, M., Stefanik, D., Higgins, P. G., Edmond, M. B., . . . Seifert, H. (2012). Nosocomial bloodstream infections due to Acinetobacter baumannii, Acinetobacter pittii and Acinetobacter nosocomialis in the United States. Journal of Infection 64(3): 282-290. Yi, E. C., & Hackett, M. (2000). Rapid isolation method for lipopolysaccharide and lipid A from Gram-negative bacteria. The Analyst 125(4): 651-656. Zhou, M., & Wu, H. (2009). Glycosylation and biogenesis of a family of serine-rich bacterial adhesins. Microbiology 155: 317-27. Actis, L. A., Potter, S. A., & Crosa, J. H. (1985). Iron-regulated outer membrane protein OM2 of Vibrio anguillarum is encoded by virulence plasmid pJM1. Journal of Bacteriology, 161(2), 736-42. Aranda, J., Poza, M., Pardo, B. G., Rumbo, S., Rumbo, C., Parreira, J. R., . . . Bou, G. (2010). A rapid and simple method for constructing stable mutants of Acinetobacter baumannii BMC Microbiology, 10(1), 279. Boersema, P. J., Raijmakers, R., Lemeer, S., Mohammed, S., & Heck, A. J. R. (2009). Multiplex peptide stable isotope dimethyl labeling for quantitative proteomics. Nature Protocols, 4(4), 484-94. Carruthers, M. D., Nicholson, P. A., Tracy, E. N., & Munson, R. S. (2013). Acinetobacter baumannii utilizes a type VI secretion system for bacterial ComPetition. PloS One, 8(3), e59388. Choi, K.-H., Gaynor, J. B., White, K. G., Lopez, C., Bosio, C. M., Karkhoff-Schweizer, R. R., & Schweizer, H. P. (2005). A Tn7-based broad-range bacterial cloning and expression system. Nature Methods, 2(6), 443-8. Datsenko, K. A., & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America, 97(12), 6640-5. De Berardinis, V., Vallenet, D., Castelli, V., Besnard, M., Pinet, A., Cruaud, C., . . . Weissenbach, J. (2008). A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1. Molecular Systems Biology, 4, 174. Dykxhoorn, D. M., St. Pierre, R., & Linn, T. (1996). A set of compatible tac promoter expression vectors. Gene, 177(1-2), 133-136. Feldman, M. F., Wacker, M., Hernandez, M., Hitchen, P. G., Marolda, C. L., Kowarik, M., . . . Aebi, M. (2005). Engineering N-linked protein glycosylation with diverse O antigen lipopolysaccharide structures in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 102(8), 3016-21. Figurski, D. H., & Helinski, D. R. (1979). Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proceedings of the National Academy of Sciences, 76(4), 1648-1652. Harding, C. M., Tracy, E. N., Carruthers, M. D., Rather, P. N., Actis, L. A., & Munson, R. S. (2013). Acinetobacter baumannii strain M2 produces type IV pili which play a role in natural transformation and twitching motility but not surface-associated motility. mBio, 4(4), e00360-13. Hunger, M., Schmucker, R., Kishan, V., & Hillen, W. (1990). Analysis and nucleotide sequence of an origin of an origin of DNA replication in Acinetobacter calcoaceticus and its use for Escherichia coli shuttle plasmids. Gene, 87(1), 45-51. Kumar, A., Dalton, C., Cortez-Cordova, J., & Schweizer, H. P. (2010). Mini-Tn7 vectors as genetic tools for single copy gene cloning in Acinetobacter baumannii. Journal of Microbiological Methods, 82(3), 296-300. Lee, E. C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A., Court, D. L., . . . Copeland, N. G. (2001). A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics, 73(1), 56-65. Nakar, D., & Gutnick, D. L. (2001). Analysis of the wee gene cluster responsible for the biosynthesis of the polymeric bioemulsifier from the oil-degrading strain Acinetobacter lwoffii RAG-1. Microbiology, 147(7), 1937-1946. Niu, C., Clemmer, K. M., Bonomo, R. A., & Rather, P. N. (2008). Isolation and characterization of an autoinducer synthase from Acinetobacter baumannii. Journal of Bacteriology, 190(9), 3386-92. Scott, N. E., Kinsella, R. L., Edwards, A. V. G., Larsen, M. R., Dutta, S., Saba, J., . . . Feldman, M. F. (2014). Diversity Within the O-linked Protein Glycosylation Systems of Acinetobacter Species. Molecular & Cellular Proteomics: MCP, 13(9), 2354-70. Wacker, M., Linton, D., Hitchen, P. G., Nita-Lazar, M., Haslam, S. M., North, S. J. Aebi, M. (2002). N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science (New York, N.Y.), 298(5599), 1790-3.
(179) All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill of those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication, patent, or patent applications was specifically and individually indicated to be incorporated by reference.
(180) The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.