Prostate Cancer Prognostic Compositions and Kits

Abstract

Described herein are method, compositions and kits for prognosis of prostate cancer. The methods include determining the ratio of PCA3 and of a prostate-specific marker expression in a urine sample and correlating the value of the PCA3/prostate-specific marker ratio with the aggressiveness and mortality risk of prostate cancer in the subject. The method for prognosing prostate cancer in a sample of a patient includes assessing the amount of a prostate cancer specific PCA3 mRNA and the amount of prostate-specific marker in the sample; determining a ratio value of this amount of prostate cancer specific PCA3 mRNA over the amount of prostate-specific marker; comparing the ratio value to at least one predetermined cut-off value, wherein a ratio value above the predetermined cut-off value is indicative of a higher risk of mortality of prostate cancer as compared to a ratio value below the predetermined cut-off value.

Claims

1.-26. (canceled)

27. A method of characterizing the relative amount of PCA3 nucleic acid in a urine sample obtained from a human subject, the method comprising the steps of: (a) extracting nucleic acids from the urine sample; (b) quantifying, with a real-time nucleic acid amplification reaction that uses nucleic acids extracted in step (a) or the complements thereof as templates, amounts of (i) a PCA3 nucleic acid, and (ii) a second marker nucleic acid; and (c) determining a ratio value for the quantified amount of the PCA3 nucleic acid over the quantified amount of the second marker nucleic acid, thereby characterizing the relative amount of the PCA3 nucleic acid in the urine sample, wherein the real-time nucleic acid amplification reaction uses a pair of primers and a DNA polymerase to amplify the PCA3 nucleic acid, and wherein the real-time nucleic acid amplification reaction comprises monitoring synthesis of the PCA3 nucleic acid with an oligonucleotide probe having a detectable label covalently attached thereto.

28. The method of claim 27, wherein step (a) comprises extracting RNA from the urine sample, and wherein prior to conducting step (b) there is a step for reverse transcribing extracted RNA from step (a) to synthesize cDNA templates used in the real-time nucleic acid amplification reaction.

29. The method of claim 27, wherein a primer of the pair of primers comprises a base sequence that hybridizes to an exon-exon junction in spliced PCA3 RNA or the complement thereof.

30. The method of claim 29, wherein a first primer of the pair of primers comprises a base sequence complementary to an exon sequence present in PCA3 RNA, the exon sequence being selected from the group consisting of: an exon 4a sequence, an exon 4b sequence, an exon 4c sequence, and an exon 4d sequence.

31. The method of claim 30, wherein a second primer of the pair of primers hybridizes to a polymerase-dependent extension product of the first primer of the pair of primers using nucleic acids extracted in step (a) as templates, wherein the polymerase-dependent extension product comprises a base sequence complementary to a base sequence contained within PCA3 exon 3, and wherein the second primer hybridizes to the base sequence complementary to the base sequence contained within PCA3 exon 3.

32. The method of claim 31, wherein either the first primer comprises a sequence of 3-terminal bases that hybridize to a PCA3 exon 3 sequence, or the second primer comprises a sequence of 3-terminal bases that hybridize to the complement of a PCA3 exon 4a sequence.

33. The method of claim 32, wherein the second marker nucleic acid is selected from the group consisting of HK2/KLK2 nucleic acid, PSMA nucleic acid, transglutaminase 4 nucleic acid, acid phosphatase nucleic acid, PCGEM1 nucleic acid, NKX3.1 nucleic acid, prostate stem cell antigen (PSCA) nucleic acid, prostate tumor inducing gene-1 (PTI-1) nucleic acid, PDEF nucleic acid, TMPRSS2 nucleic acid, and ProStase nucleic acid.

34. The method of claim 29, wherein the exon-exon junction in spliced PCA3 RNA or the complement thereof is a junction joining PCA3 exon 3 to PCA3 exon 4 in spliced PCA3 RNA, wherein the first primer hybridizes at its 5-end to a sequence of bases contained within PCA3 exon 4, and wherein the first primer hybridizes at its 3-end to a sequence of bases contained within PCA3 exon 3.

35. The method of claim 34, wherein the second primer hybridizes to a polymerase-dependent extension product of the first primer using nucleic acids extracted in step (a) as templates, wherein the polymerase-dependent extension product comprises a base sequence complementary to a base sequence contained within PCA3 exon 3, and wherein the second primer hybridizes to the base sequence complementary to the base sequence contained within PCA3 exon 3.

36. The method of claim 27, wherein the real-time nucleic acid amplification reaction comprises temperature cycling steps.

37. The method of claim 27, wherein the detectable label of the oligonucleotide probe is a fluorescent moiety, and wherein the oligonucleotide probe further comprises a quencher moiety covalently attached thereto.

38. The method of claim 27, wherein the real-time nucleic acid amplification reaction produces a double-stranded amplification product, wherein a first strand of the double-stranded amplification product comprises each of a base sequence present in PCA3 exon 3 and a base sequence present in PCA3 exon 4, and wherein a second strand of the double-stranded amplification product comprises each of the complement of the base sequence present in PCA3 exon 3 and the complement of the base sequence present in PCA3 exon 4.

39. The method of claim 38, wherein one primer of the pair of primers hybridizes to the complement of the base sequence present in PCA3 exon 3.

40. The method of claim 38, wherein a first primer of the pair of primers hybridizes to a base sequence present in PCA3 exon 4a.

41. The method of claim 40, wherein a second primer of the pair of primers hybridizes to the complement of the base sequence present in PCA3 exon 3.

42. The method of claim 27, wherein the PCA3 nucleic acid quantified in step (b) comprises a base sequence present in PCA3 exon 3 and a base sequence present in PCA3 exon 4a.

43. The method of claim 42, wherein a first primer of the pair of primers hybridizes to a PCA3 exon 4a sequence of a template nucleic acid extracted in step (a) and extends by activity of the DNA polymerase to produce a polymerase-dependent extension product, and wherein a second primer of the pair of primers hybridizes to the complement of a PCA3 exon 3 sequence contained in the polymerase-dependent extension product.

44. The method of claim 43, wherein the second marker nucleic acid is selected from the group consisting of HK2/KLK2 nucleic acid, PSMA nucleic acid, transglutaminase 4 nucleic acid, acid phosphatase nucleic acid, PCGEM1 nucleic acid, NKX3.1 nucleic acid, prostate stem cell antigen (PSCA) nucleic acid, prostate tumor inducing gene-1 (PTI-1) nucleic acid, PDEF nucleic acid, TMPRSS2 nucleic acid, and ProStase nucleic acid.

45. The method of claim 28, wherein each primer of the pair of primers hybridizes to a sequence contained within a different PCA3 exon or the complement thereof, wherein a first primer of the pair of primers hybridizes to a template nucleic acid extracted in step (a) or the complement thereof and extends by activity of the DNA polymerase to produce a polymerase-dependent extension product, and wherein a second primer of the pair of primers hybridizes to the polymerase-dependent extension product of the first primer.

46. The method of claim 45, wherein the first primer comprises a base sequence complementary to an exon sequence present in PCA3 RNA, the exon sequence being selected from the group consisting of: an exon 4a sequence, an exon 4b sequence, an exon 4c sequence, and an exon 4d sequence.

47. The method of claim 46, wherein the second marker nucleic acid is selected from the group consisting of HK2/KLK2 nucleic acid, PSMA nucleic acid, transglutaminase 4 nucleic acid, acid phosphatase nucleic acid, PCGEM1 nucleic acid, NKX3.1 nucleic acid, prostate stem cell antigen (PSCA) nucleic acid, prostate tumor inducing gene-1 (PTI-1) nucleic acid, PDEF nucleic acid, TMPRSS2 nucleic acid, and ProStase nucleic acid.

48. The method of claim 27, wherein the human subject is known to have prostate cancer prior to conducting step (a).

49. The method of claim 27, wherein if the human subject has prostate cancer, then the ratio value determined in step (c) is indicative of the aggressiveness of the prostate cancer.

50. The method of claim 27, wherein the urine sample is a urine sample obtained without a digital rectal examination.

51. The method of claim 27, wherein the second marker nucleic acid is selected from the group consisting of HK2/KLK2 nucleic acid, PSMA nucleic acid, transglutaminase 4 nucleic acid, acid phosphatase nucleic acid, PCGEM1 nucleic acid, NKX3.1 nucleic acid, prostate stem cell antigen (PSCA) nucleic acid, prostate tumor inducing gene-1 (PTI-1) nucleic acid, PDEF nucleic acid, TMPRSS2 nucleic acid, and ProStase nucleic acid.

52. The method of claim 27, wherein the oligonucleotide probe used for monitoring synthesis of the PCA3 nucleic acid comprises a sequence of at least 10 consecutive nucleotides of SEQ ID NO:1, or the complement thereof.

53. The method of claim 27, wherein the real-time nucleic acid amplification reaction uses a pair of primers and the DNA polymerase to amplify the second marker nucleic acid, wherein the real-time nucleic acid amplification reaction comprises monitoring synthesis of the second marker nucleic acid with an oligonucleotide probe having a detectable label covalently attached thereto, and wherein the detectable label attached to the oligonucleotide probe used for monitoring synthesis of the second marker nucleic acid is different from the detectable label attached to the oligonucleotide probe used for monitoring synthesis of the PCA3 nucleic acid.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0135] Having thus generally described the invention, reference will now be made to the accompanying drawings, showing by way of illustration a preferred embodiment thereof and in which:

[0136] FIG. 1 shows one embodiment of an assay principle of the present invention.

[0137] FIGS. 2A-2B show a gene-based PCA3-analysis of urinary sediments after extended DRE. FIG. 2A shows a plot of sensitivity over specificity. Urinary sediments were obtained after extended DRE from a cohort of 108 men with serum PSA levels>3 ng/ml. The diagnostic efficacy of the PCA3-based assay of urinary sediments is visualized by a Receiver Operating Characteristic (ROC) curve. Based on this ROC curve, a cut-off level of 200.10.sup.3 was determined. FIG. 2B shows the PCA3/PSA values obtained from the urinary sediments of FIG. 2A, but summarized in a box-plot. The median PCA3/PSA value (thick black horizontal line), outliers (open circles) and extremes (stars) are shown. The cut-off value is indicated by a dashed line.

[0138] FIG. 3 shows the prognostic significance of PCA3/PSA. Urinary sediments were obtained after extended DRE from a new cohort of 136 men with serum PSA levels>3 ng/ml. In a box-plot the PCA3/PSA values obtained from these urinary sediments were correlated with Gleason score. The median PCA3/PSA value (thick black horizontal line), outliers (open circles) and extremes (stars) are shown. Because of minor adjustments to the assay a new cut-off value of 132.Math.10.sup.3 was determined, which is indicated by a dashed line.

[0139] FIG. 4 shows the PCA3/PSA performance correlated with Gleason score. In 49 patients, cancer was identified by histopathological evaluation of the biopsies. Here the distribution of Gleason scores is shown in cases of which the PCA3/PSA test was positive/true positive and the ones in which the test was negative, using a cut-off value of 13210.sup.3 for PCA3/PSA ratio. Numbers of cases are on the y-axis.

[0140] FIG. 5 shows an embodiment of the present invention wherein a correlation between Gleason scores (no malignancy and scores 4-9) and the mean and median ratio for PCA3/PSA mRNAs in biopsies is shown.

[0141] FIG. 6 is similar to FIG. 5 except that the correlation between Gleason scores (no malignancy and scores 4-9) and the mean and median ratio for PCA3/PSA mRNAs is presented as a graph.

[0142] FIG. 7 shows the sensitivity per grade of the method of the present invention using a PCA3/PSA threshold of 13210.sup.3.

[0143] FIG. 8 is similar to FIG. 7 except that the results are presented in a graph.

[0144] FIG. 9 shows the relationship between mean tumor volume and particular ratios of PCA3/PSA mRNAs (i.e., below 132 0.10.sup.3 and above 132.10.sup.3).

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0145] One of the major challenges for markers in prostate cancer is to meet the need for a diagnostic test that also predicts the clinical behavior of prostate cancer. The PCA3 gene is strongly over-expressed in prostate cancer when compared to non malignant prostate epithelial cells due to a unique mechanism of transcriptional regulation. Herein it is demonstrated that aggressive cells are more invasive and thus are more likely to mobilize and shed into the ductal system. In addition, it was unexpectedly demonstrated that the PCA3/second prostate specific marker (e.g., PSA) ratio can be correlated with tumor volume. Therefore, after extended DRE the ratio PCA3/PSA mRNA can be correlated with stage, grade, tumor volume and thus, biological aggressiveness of prostate cancer, thereby enabling a more accurate cancer diagnosis and prognosis as well as the prescription of a more appropriate treatment regime for the patient.

[0146] Tables 4 shows the expression of PCA3 in prostate. Table 6 shows a comparison of PCA3 mRNA expression in prostate. Table 7 shows the correlation between PCA3/PSA and the malignancy of prostate cancer.

[0147] In one embodiment, a new cohort of patients that entered the clinic with elevated PSA serum levels (>3 ng/ml) was tested prospectively. The patients received study information and signed informed consent in order to enter the study. For histological assessment, ultrasound guided biopsy for the presence or absence of malignancy was performed. In 49 patients, cancer was identified by histopathological evaluation of the biopsies. The histology and the PCA3/PSA mRNA ratio obtained immediately before the biopsies were compared.

[0148] Surprisingly, a clear correlation was seen between Gleason score and the level of PCA3/PSA mRNA ratio's (FIGS. 3, 5 and 6). Subsequently, the distribution of Gleason grades in cases of which the test was positive/true positive and the ones in which the test was negative was analyzed. The false negatives were of significant lower grade than the true positive.

[0149] The PCA3/PSA mRNA ratio analyzed in urinary sediments after extended DRE is therefore shown as a prognostic and theranostic parameter.

[0150] Despite many advances in recent years, the precision with which an individual suffering from prostate cancer can be staged and prognosed is far from being optimal. One of the reasons is that PSA and PSM prostate markers are expressed in normal and cancerous cells and that their expression tends to decrease in poorly differentiated tumors (which are generally the more aggressive type). Therefore, the diagnosis and prognosis become less and less specific and sensitive when tumors tend to be poorly differentiated (increasing tumor grade) and may even escape diagnosis.

[0151] On the other hand, PCA3 is strongly over expressed in prostate cancer when compared to non malignant prostate epithelial cells and the expression of PCA3 is restricted to the prostate, due to a unique mechanism of transcriptional regulation (Vearhaegh et al., 2000, J Biol. Chem. 275:37496-37503). It is differentially expressed in cancerous and normal prostate cells, and its expression does not significantly decrease with increasing tumor grade. PCA3 could therefore be a useful tool, which may overcome the drawbacks of PSA and PSM in the diagnosis, staging and treatment of prostate cancer patients.

[0152] Although PCA3 has been demonstrated to be a very specific and sensitive diagnosis tool, its value as a prognostic and theranostic tool had never been established prior to the present invention. The present invention demonstrates that PCA3 expression correlates with biological aggressiveness and may therefore be used as prognostic and/or theranostic marker. Moreover, the present invention establishes the utility of the PCA3/PSA expression level ratio as a very efficient prognostic/theranostic factor. In addition, the inventors have discovered that the value of the PCA3/PSA expression ratio in a sample is a very sensible and specific prognostic/theranostic tool that correlates with tumor grade, tumor volume and aggressiveness of cancer. The use of PCA3 and PSA prostate markers and the fact that PSA expression levels tend to decline with aggressiveness of prostate cancer, (which would increase the value of the ratio, a fact that is still contested in the art) contribute to the sensibility and specificity of the diagnostic and prognosis methods of the present invention.

[0153] Therefore, the present invention describes for the first time specific and sensitive methods for prognosis of prostate cancer in a patient by detecting the level of expression (amount) of RNA encoded by the PCA3 gene relatively to the level of expression of RNA encoded by the PSA gene in a sample. The value of the PCA3/PSA expression level ratio is correlated with the presence or absence of prostate cancer and enables to establish the stage or aggressiveness of the disease in order to determine cancer prognosis. This is particularly useful to determine the degree of severity of the disease, to predict its evolution and most importantly to immediately choose the appropriate type of therapy for the patient in order to increase its chances of recovery.

[0154] In general, the predisposition to develop prostate cancer, presence of prostate cancer or aggressiveness of prostate cancer may be detected in patients based on the presence of an elevated amount of PCA3 polynucleotides in a biological sample (e.g., urine sample after DRE) relatively to the amount of PSA polynucleotides (PCA3/PSA ratio). Polynucleotides primers and probes may be used to detect the level of mRNAs encoding PCA3 and PSA, the ratio of which is indicative of the predisposition, presence, absence and aggressiveness (stage) of prostate cancer. In general, the elevated expression of a PCA3 marker relatively to a PSA marker in a biological sample as compared to normal control samples indicates that the sample contains prostate cancer or is susceptible to develop prostate cancer. In the specific case where the sample is positive for prostate cancer, the value of the ratio between PCA3 and PSA expression levels correlates with a particular stage of progression or aggressiveness of prostate cancer (e.g., particular Gleason score, tumor volume etc.).

[0155] In one embodiment, the PCA3 and PSA markers of the present invention are nucleic acids such as PCA3 and PSA mRNA or fragment thereof associated with prostate cancer. The PCA3 nucleic acid may have the nucleotide sequence disclosed in SEQ ID NO: 1 or 2. However, the terminology PCA3 nucleic acids or the like is not limited to the sequences in SEQ ID NO:1 or 2, or to fragments or complements thereof. For example, PCA3 nucleic acid sequences are also found under GenBank's accession number AF103907. In addition, sequences which are highly homologous to such sequences, fragments or complements thereof can also be used in accordance with the present invention. The PSA nucleotide sequence may have the nucleotide sequence disclosed in SEQ ID NO 38. Of course it will be understood that portions or fragments of PCA3 and PSA (e.g., PCA3 and PSA nucleic acids) may be used in accordance with the present invention and are thus also considered as PCA3 and PSA markers.

[0156] One non-limiting example of a diagnostic and prognostic/theranostic method for prostate cancer comprises: (a) contacting a biological sample with at least one oligonucleotide probe or primer that hybridizes to PCA3 nucleic acid and detecting a level of oligonucleotide that hybridizes therewith; (b) contacting the biological sample with at least one oligonucleotide probe or primer that hybridizes with PSA nucleic acid and detecting a level of oligonucleotide that hybridizes therewith; and (c) determining the ratio between the level of oligonucleotide that hybridizes with PCA3 and the level of oligonucleotide that hybridizes with PSA. The value of the ratio between PCA3 and PSA detected can be compared with a predetermined cut-off value and therefrom, the predisposition, presence, absence and stage of prostate cancer as well as the approximate tumor volume in the patient can be established.

[0157] In general, prognosis of a subject is determined to be poor (i.e. very aggressive cancer) when the value of the PCA3/PSA mRNA ratio is superior to 20010.sup.3. Intermediate prognosis refers to a PCA3/PSA mRNA ratio between 7510.sup.3 and 20010.sup.3 and good prognosis or low risk corresponds to a value of PCA3/PSA mRNA ratio between 0 and 7510.sup.3. The Gleason scores which are associated with these ratios are >7; 6-7; and 0-5, respectively. Of course the above mentioned ranges of ratio values could differ depending on the desired sensitivity and specificity of the test and on the chosen second prostate specific marker. Thus, skilled artisan would use (and adapt) different threshold or cut-off values depending on the particular requirements of the test.

[0158] In a particular embodiment, the polypeptide level of a second prostate specific marker (e.g., PSA) can be used in determining a PCA3/second prostate specific marker ratio. Thus, a diagnostic, prognostic and theranostic method for prostate cancer may also comprise: (a) contacting a biological sample with at least one oligonucleotide probe or primer that hybridizes to a PCA3 nucleic acid and detecting a level of oligonucleotide that hybridizes therewith; (b) contacting the biological sample with at least one antibody that hybridizes with PSA polypeptide and detecting a level of polypeptide that hybridizes therewith; and (c) determining the ratio between the level of oligonucleotide that hybridizes with PCA3 and the level of antibody that hybridizes with PSA polypeptide (i.e. determining PCA3/PSA expression level ratio). The value of the ratio between PCA3 and PSA detected can be compared with a predetermined cut-off value and therefrom, the predisposition, presence, absence and stage of prostate cancer as well as the approximate tumor volume in the patient can be established. Of course, and as exemplified hereinbelow the PCA3/PSA ratio can be determined based on the detection of PCA3 and PSA mRNA.

[0159] In a further embodiment, the methods of the present invention can also be used for monitoring the progression of prostate cancer in a patient. In this particular embodiment, the assays described above are performed over time and the variation in the ratio between the expression level of PCA3 and PSA nucleic acids or proteins present in the sample (e.g., urine sample) is evaluated. In general, prostate cancer is considered as progressing when the ratio between PCA3 and PSA expression level detected increases with time. In contrast a cancer is not considered as progressing when the ratio between PCA3 and PSA expression level either decreases or remains constant over time.

[0160] In a related aspect, it is possible to verify the efficiency of nucleic acid amplification and/or detection only, by performing external control reaction(s) using highly purified control target nucleic acids added to the amplification and/or detection reaction mixture. Alternatively, the efficiency of nucleic acid recovery from cells and/or organelles, the level of nucleic acid amplification and/or detection inhibition (if present) can be verified and estimated by adding to each test sample control cells or organelles (e.g., a define number of cells from a prostate cancer cell line expressing PCA3 and second marker) by comparison with external control reaction(s). To verify the efficiency of both, sample preparation and amplification and/or detection, such external control reaction(s) may be performed using a reference test sample or a blank sample spiked with cells, organelles and/or viral particles carrying the control nucleic acid sequence(s). For example, a signal from the internal control (IC) sequences present into the cells, viruses and/or organelles added to each test sample that is lower than the signal observed with the external control reaction(s) may be explained by incomplete lysis and/or inhibition of the amplification and/or detection processes for a given test sample. On the other hand, a signal from the IC sequences that is similar to the signal observed with the external control reaction(s), would confirm that the sample preparation including cell lysis is efficient and that there is no significant inhibition of the amplification and/or detection processes for a given test sample. Alternatively, verification of the efficiency of sample preparation only may be performed using external control(s) analyzed by methods other than nucleic acid testing (e.g., analysis using microscopy, mass spectrometry or immunological assays).

[0161] Therefore, in one particular embodiment, the methods of the present invention uses purified nucleic acids, prostate cells or viral particles containing nucleic acid sequences serving as targets for an internal control (IC) in nucleic acid test assays to verify the efficiency of cell lysis and of sample preparation as well as the performance of nucleic acid amplification and/or detection. More broadly, the IC serves to verify any chosen step of the process of the present invention.

[0162] IC in PCR or related amplification techniques can be highly purified plasmid DNA either supercoiled, or linearized by digestion with a restriction endonuclease and repurified. Supercoiled IC templates are amplified much less efficiently (about 100 fold) and in a less reproducible manner than linearized and repurified IC nucleic acid templates. Consequently, IC controls for amplification and detection of the present invention are preferably performed with linearized and repurified IC nucleic acid templates when such types of IC are used.

[0163] The nucleic acids, cells, and/or organelles are incorporated into each test sample at the appropriate concentration to obtain an efficient and reproducible amplification/detection of the IC, based on testing during the assay optimization. The optimal number of control cells added, which is dependent on the assay, is preferentially the minimal number of cells which allows a highly reproducible IC detection signal without having any significant detrimental effect on the amplification and/or detection of the other genetic target(s) of the nucleic acid-based assay. A sample to which is added the purified linearized nucleic acids, cells, viral particles or organelles is generally referred to as a spiked sample.

[0164] Within certain embodiments, the amount of mRNA may be detected via a RT-PCR based assay. In RT-PCR, the polymerase chain reaction (PCR) is applied in conjunction with reverse transcription. In such an assay, at least two oligonucleotide primers may be used to amplify a portion of PCA3 or PSA cDNA derived from a biological sample, wherein at least one oligonucleotide is specific for (i.e. hybridizes to) a polynucleotide encoding PCA3 or PSA RNA. The amplified cDNAs may then be separated and detected using techniques that are well known in the art such as gel electrophoresis and ethidium bromide staining. Amplification may be performed on biological samples taken from a test patient and an individual who is not afflicted with a prostate cancer (control sample), or using other types of control samples. The amplification reaction may be performed on several dilutions of cDNA (or directly on several dilutions of the biological sample) spanning, for example, two order of magnitude. A ratio value above a predetermined cut-off value is indicative of the presence, predisposition to develop prostate cancer or to a specific stage of progression (aggressiveness) of prostate cancer. In general, the elevated expression of PCA3 nucleic acid relatively to the expression of PSA nucleic acid in a biological sample as compared to control samples indicates the presence or alternatively, the predisposition to develop lung cancer. A characteristic ratio value is also indicative of the stage and aggressiveness of the prostate cancer detected.

[0165] In further embodiments, PCA3 and PSA mRNAs are detected in a nucleic acid extract from a biological sample by an in vitro RNA amplification method named Nucleic Acid Sequence-Based Amplification (NASBA). Numerous amplification techniques have been described and can be readily adapted to suit particular needs of a person of ordinary skill. Non-limiting examples of amplification techniques include strand displacement amplification (SDA), transcription-based amplification, the Q replicase system and NASBA (U.S. Pat. No. 6,124,120; Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1177; Lizardi et al., 1988, BioTechnology 6:1197-1202; Malek et al., 1994, Methods Mol. Biol., 28:253-260; and Sambrook et al., 2000, supra). Other non-limiting examples of amplification methods include rolling circle amplification (RCA); signal mediated amplification of RNA technology (SMART); split complex amplification reaction (SCAR); split promoter amplification of RNA (SPAR).

[0166] The amplification and/or detection of PCA3 and PSA RNA sequences can be carried out simultaneously (e.g., multiplex real-time amplification assays.). Alternatively, oligonucleotide probes that specifically hybridize under stringent conditions to a PCA3 or PSA nucleic acid may be used in a nucleic acid hybridization assay (e.g., Southern and Northern blots, dot blot, slot blot, in situ hybridization and the like) to determine the presence and/or amount of PCA3 and PSA polynucleotide in a biological sample.

[0167] Alternatively, oligonucleotides and primers could be designed to directly sequence and assess the presence of prostate cancer specific PCA3 sequences and PSA in the patient sample following an amplification step. Such sequencing-based diagnostic methods are automatable and are encompassed by the present invention.

[0168] Aggressiveness of carcinomas is associated with an increase invasive potential of the cancer cells (confirmed by down regulation of the invasion suppressor gene E-cadherin in high grade aggressiveness prostate cancer). These invasive cells are more likely to mobilize and shed into the ductal system. The present invention takes advantages of the fact that the fraction of invasive cells in urinary sediment would increase after extended DRE. Therefore according to the present invention, a preferred sample to be tested is urine obtained after digital rectal examination or any other methods that enable to increase the number of prostate cells in the sample. Of course other samples such as semen, mixed urine and semen and bladder washings may be used according to the present invention, as long as the sample contains sufficient material to enable the detection of PCA3 and PSA nucleic acids (or other second prostate-specific marker).

Synthesis of Nucleic Acid

[0169] The nucleic acid (e.g., DNA or RNA) for practicing the present invention may be obtained according to well known methods.

[0170] Isolated nucleic acid molecules of the present invention are meant to include those obtained by cloning as well as those chemically synthesized. Similarly, an oligomer which corresponds to the nucleic acid molecule, or to each of the divided fragments, can be synthesized. Such synthetic oligonucleotides can be prepared, for example, by the triester method of Matteucci et al., J. Am. Chem. Soc. 103:3185-3191 (1981) or by using an automated DNA synthesizer.

[0171] An oligonucleotide can be derived synthetically or by cloning. If necessary, the 5-ends of the oligomers can be phosphorylated using T4 polynucleotide kinase. Kinasing of single strands prior to annealing or for labeling can be achieved using an excess of the enzyme. If kinasing is for the labeling of probe, the ATP can contain high specific activity radioisotopes. Then, the DNA oligomer can be subjected to annealing and ligation with T4 ligase or the like. Of course the labeling of a nucleic acid sequence can be carried out by other methods known in the art.

Primers and Probes

[0172] One skilled in the art can select the nucleic acid primers according to techniques known in the art. Samples to be tested include but should not be limited to RNA samples from human tissue.

[0173] In one embodiment, the present invention relates to nucleic acid primers and probes which are complementary to a nucleotide sequence consisting of at least 10 consecutive nucleotides (preferably, 12, 15, 18, 20, 22, 25, or 30 [of course, the sequence could be longer, see below]) from the nucleic acid molecule comprising a polynucleotide sequence at least 90% identical to a sequence selected from the group consisting of: [0174] (a) a nucleotide sequence encoding the PCA3 mRNA comprising the nucleotide sequence in SEQ ID NO 1 or 2; [0175] (b) a nucleotide sequence encoding the PSA mRNA comprising the nucleotide sequence in SEQ ID NO 38; and [0176] (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b).

[0177] The present invention relates to a nucleic acid for the specific detection and quantification, in a sample, of the presence of PCA3 nucleic acid sequences which are associated with prostate cancer, comprising the above-described nucleic acid molecules or at least a fragment thereof which binds under stringent conditions to PCA3 nucleic acid. In a related aspect, the present invention features nucleic acid for the specific detection and quantification, in a sample, of the presence of PSA nucleic acid sequences, comprising the above-described nucleic acid molecules or at least a fragment thereof which binds under stringent conditions to PSA nucleic acids.

[0178] In one preferred embodiment, the present invention relates to oligos which specifically target and enable amplification (i.e. at least one primer for each target) of PSA and PCA3 RNA sequences associated with prostate cancer.

[0179] Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted sequences employed. In a preferred embodiment, the oligonucleotide probes or primers are at least 10 nucleotides in length (preferably, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 . . . ) and they may be adapted to be especially suited for a chosen nucleic acid amplification system. Longer probes and primers are also within the scope of the present invention as well known in the art. Primers having more than 30, more than 40, more than 50 nucleotides and probes having more than 100, more than 200, more than 300, more than 500 more than 800 and more than 1000 nucleotides in length are also covered by the present invention. Of course, longer primers have the disadvantage of being more expensive and thus, primers having between 12 and 30 nucleotides in length are usually designed and used in the art. As well known in the art, probes ranging from 10 to more than 2000 nucleotides in length can be used in the methods of the present invention. As for the % of identity described above, non-specifically described sizes of probes and primers (e.g., 16, 17, 31, 24, 39, 350, 450, 550, 900, 1240 nucleotides, . . . ) are also within the scope of the present invention. In one embodiment, the oligonucleotide probes or primers of the present invention specifically hybridize with a PCA3 RNA (or its complementary sequence) or a PSA mRNA. More preferably, the PCA3 primers and probes will be chosen to detect a PCA3 RNA which is associated with prostate cancer. In one embodiment, the probes and primers used in the present invention do not hybridize with the PCA3 or PSA genes (i.e. enable the distinction gene and expressed PCA3 or PSA nucleic acid). Because of the structural and sequence similarities of the PSA gene with other members of the kallikrein gene family, the appropriate selection of PSA sequences to serve as PSA-specific probes or primers is important to methods of amplification and/or detection of PSA specific nucleic acids.

[0180] In a further embodiment, other prostate specific markers may be used in accordance with the present invention. Useful Examples of suitable primers for PSA, hK2/KLK2, PSMA, amplification and detection (e.g., U.S. Pat. No. 6,551,778) are well known in the art as well as for transglutaminase 4, acid phosphatase and PCGEM1. In one embodiment, the PSA oligonucleotide may also hybridize to other kallikrein family members such as kallikrein 2 (hK2/hKLK2). One example of such oligonucleotide is SEQ ID NO 39. Of course, PSA oligonucleotides which are specific to PSA (i.e. designed not to hybridize to other kallikrein family members) can also be used. Skilled artisan can easily assess the specificity of selected primers or probes by performing computer alignments/searches using well known databases (e.g., Genbank).

[0181] As commonly known in the art, the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hybridization thereof with its targeted sequence (see below and in Sambrook et al., 1989, Molecular CloningA Laboratory Manual, 2nd Edition, CSH Laboratories; Ausubel et al., 1994, in Current Protocols in Molecular Biology, John Wiley & Sons Inc., N.Y.).

[0182] To enable hybridization to occur under the assay conditions of the present invention, oligonucleotide primers and probes should comprise an oligonucleotide sequence that has at least 70% (at least 71%, 72%, 73%, 74%), preferably at least 75% (75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%) and more preferably at least 90% (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) identity to a portion of a PCA3 or PSA polynucleotide. Probes and primers of the present invention are those that hybridize to PCA3 or PSA nucleic acid (e.g., cDNA or mRNA) sequence under stringent hybridization conditions and those that hybridize to PCA3 and PSA gene homologs under at least moderately stringent conditions. In certain embodiments probes and primers of the present invention have complete sequence identity to PCA3 or PSA gene sequences (e.g., cDNA or mRNA). However, probes and primers differing from the native PCA3 or PSA gene sequences that keep the ability to hybridize to native PCA3 or PSA gene sequence under stringent conditions may also be used in the present invention. It should be understood that other probes and primers could be easily designed and used in the present invention based on the PCA3 and PSA nucleic acid sequence disclosed herein (SEQ ID NOs:1, 2 and 36) by using methods of computer alignment and sequence analysis known in the art (cf. Molecular Cloning: A Laboratory Manual, Third Edition, edited by Cold Spring Harbor Laboratory, 2000).

[0183] For example, a primer can be designed so as to be complementary to a short PCA3 RNA which is associated with a malignant state of the prostate cancer, whereas a long PCA3 RNA is associated with a non-malignant state (benign) thereof (PCT/CA00/01154 published under No. WO 01/23550). In accordance with the present invention, the use of such a primer with the other necessary reagents would give rise to an amplification product only when a short PCA3 RNA) associated with prostate cancer is present in the sample. The longer PCA3 (e.g., having an intervening sequence) would not give rise to an amplicon. Of course, the amplification could be designed so as to amplify a short (lacking all or most introns) and a long PCA3 mRNA (having at least one intron or part thereof). In such a format, the long PCA3 mRNA could be used as the second prostate specific marker.

[0184] In another embodiment, primer pairs (or probes) specific for PCA3 or PSA could be designed to avoid the detection of the PCA3 or PSA genes or of unspliced PCA3 or PSA RNAs. For example, the primers sequences to be used in the present invention could span two contiguous exons so that it cannot hybridize to an exon/intron junction of the PCA3 or PSA genes. The amplification product obtained by the use of such primer would be intron less between two chosen exons (for examples of such primers and probes see tables 2 to 4 below). Therefore, unspliced variants and genomic DNA would not be amplified. It will be recognized by the person of ordinary skill that numerous probes can be designed and used in accordance with a number of embodiments of the present invention. Such tests can be adapted using the sequence of PCA3 and that of the second prostate-specific marker. Of course, different primer pairs (and probes) can be designed from any part of the PCA3 sequences (SEQ ID NOs: 1, 2; see Tables 1-3 for non-limiting examples of primers and probes which can be used to amplify or detect PCA3). Of course, primers and probes could also be designed based on the sequence of PSA shown in SEQ ID NO:38 (GenBank accession number M27274), as well as the sequence of other members of the kallikrein family, which are well-known in the art, or any other chosen second prostate specific marker (e.g., KLK2 (GenBank acc. No. NM005551), PSMA (GenBank acc. No. BCO25672), transglutaminase 4 (GenBank acc. No. BC007003), acid phosphatase (GenBank acc. No. BC016344), PCGEM 1 (GenBank acc. No. AF223389).

[0185] Probes of the invention can be utilized with naturally occurring sugar phosphate backbones as well as modified backbones including phosphorothioates, dithionates, alkyl phosphonates and a nucleotides and the like. Modified sugar phosphate backbones are generally taught by Miller, 1988, Ann. Reports Med. Chem. 23:295 and Moran et al., 1987, Nucleic Acids Res., 14:5019. Probes of the invention can be constructed of either ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and preferably of DNA.

[0186] Although the present invention is not specifically dependent on the use of a label for the detection of a particular nucleic acid sequence, such a label might be beneficial, by increasing the sensitivity of the detection. Furthermore, it enables automation. Probes can be labeled according to numerous well-known methods (Sambrook et al., 2000, supra). Non-limiting examples of detectable markers and labels include .sup.3H, .sup.14C, .sup.32P, and .sup.35S, ligands, fluorophores, chemiluminescent agents, enzymes, and antibodies. Other detectable markers for use with probes, which can enable an increase in sensitivity of the method of the invention, include biotin and radionucleotides. It will become evident to the person of ordinary skill that the choice of a particular label dictates the manner in which it is bound to the probe.

[0187] As commonly known, radioactive nucleotides can be incorporated into probes of the invention by several methods. Non-limiting examples thereof include kinasing the 5 ends of the probes using gamma .sup.32P ATP and polynucleotide kinase, using the Klenow fragment of Pol I of E. coli in the presence of radioactive dNTP (e.g., uniformly labeled DNA probe using random oligonucleotide primers), using the SP6/T7 system to transcribe a DNA segment in the presence of one or more radioactive NTP, and the like.

[0188] In one embodiment, the label used in a homogenous detection assay is a chemiluminescent compound (e.g., U.S. Pat. Nos. 5,656,207; 5,658,737 and 5,639,604), more preferably an acridinium ester (AE) compound, such as standard AE or derivatives thereof. Methods of attaching labels to nucleic acids and detecting labels are well known (e.g., see Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), Chapt. 10; U.S. Pat. Nos. 5,658,737, 5,656,207, 5,547,842; 5,283,174 and 4,581,333; and European Pat. App. No. 0 747 706). Preferred methods of labeling a probe with an AE compound attached via a linker have been previously described in detail (e.g., see U.S. Pat. No. 5,639,604, see in Example 8, thereof).

[0189] Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, Am. Biotechnol. Lab. 8:14 25. Numerous amplification techniques have been described and can be readily adapted to suit particular needs of a person of ordinary skill. Non-limiting examples of amplification techniques include polymerase chain reaction (PCR, RT PCR, real-time RT-PCR, etc.), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription based amplification, the Q replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86: 1173-1177; Lizardi et al., 1988, BioTechnology 6:1197-1202; Malek et al., 1994, Methods Mol. Biol., 28:253 260; and Sambrook et al., 2000, supra). Other non-limiting examples of amplification methods have been listed above.

[0190] Non-limiting examples of suitable methods to detect the presence of the amplified products include the followings: agarose or polyacrylamide gel, addition of DNA labelling dye in the amplification reaction (such as ethidium bromide, Picogreen, SYBER green, etc.) and detection with suitable apparatus (fluorometer in most cases). Other suitable methods include sequencing reaction (either manual or automated); restriction analysis (provided restriction sites were built into the amplified sequences), or any method involving hybridization with a sequence specific probe (Southern or Northern blot, TaqMan probes, molecular beacons, and the like). Of course, other amplification methods are encompassed by the present invention. Molecular beacons are exemplified herein as one method for detecting the amplified products according to the present invention (see below).

[0191] Of course in some embodiment direct detection (e.g., sequencing) of PCA3 cancer specific sequences as well as that of another prostate specific marker (e.g., PSA) in a sample may be performed using specific probes or primers.

[0192] In one embodiment, the present invention has taken advantage of technological advances in methods for detecting and identifying nucleic acids. Therefore, the present invention is suitable for detection by one of these tools called molecular beacons.

[0193] Molecular beacons are single-stranded oligonucleotide hybridization probes/primers that form a stem loop structure. The loop contains a probe sequence that is complementary to a target sequence, and the stem is formed by the annealing of complementary arm sequences that are located on either side of the probe/primer sequence. A fluorophore is covalently linked to the end of one arm and a quencher is covalently linked to the end of the other arm. Molecular beacons do not fluoresce when they are free in solution. However, when they hybridize to a nucleic acid strand containing a target sequence they undergo conformational change that enables them to fluoresce brightly (see U.S. Pat. Nos. 5,925,517, and 6,037,130). Molecular beacons can be used as amplicon detector probes/primers in diagnostic assays. Because nonhybridized molecular beacons are dark, it is not necessary to isolate the probe-target hybrids to determine for example, the number of amplicons synthesized during an assay. Therefore, molecular beacons simplify the manipulations that are often required when traditional detection and identifications means are used.

[0194] By using different colored fluorophores, molecular beacons can also be used in multiplex amplification assays such as assays that target the simultaneous amplification and detection of PCA3 nucleic acid and of the second specific prostate nucleic acid (e.g., PSA, [GenBank acc. No. M27274, SEQ ID NO 38] hK2/KLK2 [GenBank acc. No. NM005551], PSMA [GenBank acc. No. BCO25672], transglutaminase 4 [GenBank acc. No. BC007003], acid phosphatase [GenBank acc. No. BC016344], and PCGEM1 [GenBank acc. No. AF223389]). The design of molecular beacons probes/primers is well known in the art and softwares dedicated to help their design are commercially available (e.g., Beacon designer from Premier Biosoft International). Molecular beacon probes/primers can be used in a variety of hybridization and amplification assays (e.g., NASBA and PCR).

[0195] In accordance with one embodiment of the present invention, the amplified product can either be directly detected using molecular beacons as primers for the amplification assay (e.g., real-time multiplex NASBA or PCR assays) or indirectly using, internal to the primer pair binding sites, a molecular beacon probe of 18 to 25 nucleotides long (e.g., 18, 19, 20, 21, 22, 23, 24, 25) which specifically hybridizes to the amplification product. Molecular beacons probes or primers having a length comprised between 18 and 25 nucleotides are preferred when used according to the present invention (Tyagi et al., 1996, Nature Biotechnol. 14: 303-308). Shorter fragments could result in a less fluorescent signal, whereas longer fragments often do not increase significantly the signal. Of course shorter or longer probes and primers could nevertheless be used.

[0196] Examples of nucleic acid primers which can be derived from PCA3 RNA sequences are shown hereinbelow in Tables 2-4.

[0197] Examples of nucleic acid primers which can be derived from PSA (e.g., SEQ ID NO 11), RNA sequences are shown hereinbelow. Other primers of the present invention can be derived from PSA. Of course other variants well known in the art can also be used (U.S. Pat. Nos. 6,479,263 and 5,674,682) as second prostate specific marker. Because of the structural and sequence similarities of the PSA gene with other members of the kallikrein gene family, the appropriate selection of PSA sequences to serve as PSA-specific probes or primers is important to methods of amplification and/or detection of PSA specific nucleic acids. Examples of suitable primers for PSA, hK2/KLK2, PSMA, amplification and detection (e.g., U.S. Pat. No. 6,551,778) are well known in the art as well as for transglutaminase 4, acid phosphatase and PCGEM1. In one embodiment, the PSA oligonucleotide may also hybridize to other kallikrein family members such as kallikrein 2 (hK2/hKLK2). One example of such an oligonucleotide is SEQ ID NO 12.

[0198] It should be understood that the sequences and sizes of the primers taught in Tables 2-4 are arbitrary and that a multitude of other sequences can be designed and used in accordance with the present invention.

[0199] While the present invention can be carried out without the use of a probe which targets PCA3 sequences, such as the exon junctions of PCA3 in accordance with the present invention, such probes can add a further specificity to the methods and kits of the present invention. Non-limiting examples of specific nucleic acid probes which can be used in the present invention (and designed based on the exonic sequences shown in Table 2) are set forth in Table 3, below.

[0200] Generally, one primer in the amplification reaction hybridizes specifically to a sequence in a first exon (or upstream exon) and the other primer used in the amplification reaction hybridizes specifically to a sequence in a second exon (or downstream exon), and the probe hybridizes to a sequence that spans the 3 region of the first exon and the 5 region of the second exon. That is, the probe is specific for a chosen exon-exon junction in an amplified sequence made from a spliced PCA3 RNA that lacks at least one intron between the upstream and downstream exon sequences to which the primers hybridize. Primers for use in amplifying sequences of the spliced RNA that contain a chosen exon-exon junction can readily be determined by using standard methods, so long as the region amplified by the primer pair contains the exon-exon junction sequence or its complementary sequence. Any method of nucleic acid amplification may be used to amplify the sequence that contains the chosen exon-exon junction and procedures for using any of a variety of well-known amplification methods can readily be determined by those skilled in the art.

[0201] Probes that detect a chosen exon-exon junction may be labeled with any of a variety of labels that can, directly or indirectly, result in a signal when the probe is hybridized to the amplified sequence that contains the exon-exon junction. For example, a label may be any moiety that produces a colorimetric, luminescent, fluorescent, radioactive, or enzymatic signal that can be detected by using methods well known in the art. A probe need not be labeled with a label moiety if binding of the probe specifically to the amplified nucleic acid containing the exon-exon junction results in a detectable signal, such as, for example a detectable electrical impulse.

[0202] Examples of amplification primer pair combinations that amplify nucleic acid sequence that includes an exon-exon junction and embodiments of some exon-exon junction probe sequences are shown in Table 4. It will be understood by those skilled in the art that the probe sequences shown below also include the complementary sequences of the sequences shown, and sequences that include insignificant changes to the specific sequences shown (i.e., the changes do not affect the ability of a probe to hybridize specifically to the chosen exon-exon junction sequence, under standard hybridization conditions). Furthermore, although the probe sequences are shown as DNA sequences, those skilled in the art will understand that the corresponding RNA sequences or their complementary sequences may be used as probes. Also, the backbone linkages of the probe base sequences may include one or more standard RNA linkages, DNA linkages, mixed RNA-DNA linkages, or other linkages such as 2-O-methyl linkages or peptide nucleic acid linkages, all of which are well known to those skilled in the art.

[0203] As shown in Table 4 (first column), the chosen exon-exon junction to be detected may join exons 1 and 2 (exon 1/exon 2), exons 1 and 3 (exon 1/exon 3), exons 2 and 3 (exon 2/exon 3), or exons 3 and 4 (exon 3/exon 4). Primer pairs are sequences located in two different exons that directly or indirectly flank the chosen exon-exon junction (Table 4, second column). Thus, for an exon 1/exon 2 junction, the primer pairs are one primer specific for a sequence contained in exon 1 and another primer specific for a sequence contained in exon 2. But for detecting an exon 2/exon 3 junction or an exon 3/exon 4 junction, the primer pairs may be selected from more than two different exons (see below in column 2) so long as the amplified sequence contains the chosen exon-exon junction region. The exon 4 primers include primers specific for a sequence contained in any sequence of exons 4a, 4b, 4c, or 4d.

[0204] Of course, as will be understood by the person of ordinary skill, a multitude of additional probes can be designed from the same or other region of SEQ ID NO. 1 as well as from SEQ ID NO. 2 and 38 and other sequences of the present invention, whether they target exon junctions or not. It will be clear that the sizes of the probes taught in Tables 2 and 3 are arbitrary and that a multitude of other sequences can be designed and used in accordance with the present invention.

[0205] It will be readily recognized by the person of ordinary skill, that the nucleic acid sequences of the present invention (e.g., probes and primers) can be incorporated into anyone of numerous established kit formats which are well known in the art.

[0206] In one embodiment of the above-described method, a nucleic acid probe is immobilized on a solid support. Examples of such solid supports include, but are not limited to, plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, and acrylic resins, such as polyacrylamide and latex beads. Techniques for coupling nucleic acid probes to such solid supports are well known in the art.

[0207] The test samples suitable for nucleic acid probing methods of the present invention include, for example, cells or nucleic acid extracts of cells, or biological fluids (e.g., urine). The sample used in the above-described methods will vary based on the assay format, the detection method and the nature of the tissues, cells or extracts to be assayed. Methods for preparing nucleic acid extracts of cells are well known in the art and can be readily adapted in order to obtain a sample which is compatible with the method utilized. Preferably the sample is a urine sample. When the urine sample is used, it should contain at least one prostate cell in order to enable the identification of the prostate specific markers (e.g., PCA3 and PSA) of the present invention. In fact, assuming that the half-life of PCA3 mRNA in an untreated biological sample is not suitable for easily enabling the preservation of the integrity of its sequence, the collected sample, whether urine or otherwise, should, prior to a treatment thereof contain at least one prostate cell. It will be recognized that the number of cells in the sample will have an impact on the validation of the test and on the relative level of measured PCA3 (or PSA or other prostate specific marker).

Kits for the Detection of PCA3 and PSA mRNA

[0208] In another embodiment, the present invention relates to a kit for diagnosing prostate cancer in a manner which is both sensitive and specific (i.e., lowering the number of false positives). Such kit generally comprises a first container means having disposed therein at least one oligonucleotide probe or primer that hybridizes to a prostate cancer-specific PCA3 nucleic acid sequence. In one embodiment, the present invention also relates to a kit further comprising in a second container means oligonucleotide probes or primers which are specific to a further prostate specific marker (e.g., PSA), thereby enabling the determination of a ratio as well as validating a negative result with PCA3. In another embodiment, the present invention relates to a kit further comprising in a second container means, antibodies which are specific to a further prostate specific marker, thereby validating the presence of prostate cells in a sample.

[0209] In a particular embodiment of the present invention, this kit comprises a primer pair which enables the amplification of PCA3 and at least one prostate specific marker selected from PSA, hK2/KLK2, PSMA, transglutaminase 4, acid phosphatase and PCGEM1. In a preferred embodiment the prostate specific marker is PSA nucleic acid or PSA protein. Of course the present invention also encompasses the use of a third prostate specific marker.

[0210] Oligonucleotides (probes or primers) of the kit may be used, for example, within a NASBA, PCR or hybridization assay. Amplification assays may be adapted for real time detection of multiple amplification products (i.e., multiplex real time amplification assays).

[0211] In a related particular embodiment, the kit further includes other containers comprising additional components such as additional oligonucleotide or primer and/or one or more of the following: buffers, reagents to be used in the assay (e.g., wash reagents, polymerases or internal control nucleic acid or cells or else) and reagents capable of detecting the presence of bound nucleic acid probe or primers. Examples of detection reagents include, but are not limited to radiolabelled probes, enzymatic labeled probes (horse radish peroxidase, alkaline phosphatase), and affinity labeled probes (biotin, avidin, or steptavidin). Of course the separation or assembly of reagents in same or different container means is dictated by the types of extraction, amplification or hybridization methods, and detection methods used as well as other parameters including stability, need for preservation etc. It will be understood that different permutations of containers and reagents of the above and foregoing are also covered by the present invention. The kit may also include instructions regarding each particular possible diagnosis, prognosis, theranosis or use, by correlating a corresponding ratio of PCA3 mRNA level over PSA mRNA level with a particular diagnosis, prognosis, theranosis or use, as well as information on the experimental protocol to be used.

[0212] In one embodiment, the detection reagents are molecular beacon probes which specifically hybridizes to the amplification products. In another embodiment, the detection reagents are chemiluminescent compounds such as Acridinium Ester (AE).

[0213] For example, a compartmentalized kit in accordance with the present invention includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers will include a container which will accept the test sample (e.g., an RNA extract from a biological sample or cells), a container which contains the primers used in the assay, containers which contain enzymes, containers which contain wash reagents, and containers which contain the reagents used to detect the extension products. As mentioned above, the separation or combination of reagents can be adapted by the person of ordinary skill to which this invention pertain, according to the type of kit which is preferred (e.g., a diagnostic kit based on amplification or hybridization methods or both), the types of reagents used and their stability or other intrinsic properties. In one embodiment, one container contains the amplification reagents and a separate container contains the detection reagent. In another embodiment, amplification and detection reagents are contained in the same container.

[0214] Kits may also contain oligonucleotides that serve as capture oligomers for purifying the target nucleic acids from a sample. Examples of capture oligomers have sequences of at least 15 nucleotides complementary to a portion of the PCA3 target nucleic acid. Embodiments of capture oligomers may have additional bases attached to a 3 or 5 end the sequence that is complementary to the PCA3 target sequence which may act functionally in a hybridization step for capturing the target nucleic acid. Such additional sequences are preferably a homopolymeric tail sequence, such as a poly-A or poly-T sequence, although other embodiments of tail sequences are included in capture oligomers of the present invention. In one embodiment, CAP binding protein (e.g., eIF4G-4E) or part thereof may be used to capture cap-structure containing mRNAs (Edery et al., 1987, Gene 74(2): 517-525). In another embodiment, a non specific capture reagent is used (e.g., silica beads).

[0215] Kits useful for practicing the methods of the present invention may include those that include any of the amplification oligonucleotides and/or detection probes disclosed herein which are packaged in combination with each other. Kits may also include capture oligomers for purifying the PCA3 target nucleic acid from a sample, which capture oligomers may be packaged in combination with the amplification oligonucleotides and/or detection probes. Finally, the kits may further include instructions for practicing the diagnostic, theranostic and/or prognostic methods of the present invention. Such instructions can concern details relating to the experimental protocol as well as to the cut-off values that may be used.

[0216] In a further embodiment, cells contained in voided urine samples obtained after an attentive digital rectal examination are harvested and lysed in a lysis buffer. Nucleic acids are extracted (e.g., from the lysate by solid phase extraction on silica beads for example). Detection of the presence of RNA encoded by the PCA3 gene in the nucleic acid extract is done by an in vitro specific RNA amplification coupled to real-time detection of amplified products by fluorescent specific probes. In this method, simultaneously to the amplification of the PCA3 prostate cancer specific RNA undergoes the amplification of the second prostate-specific marker (such as the PSA RNA) as a control for the presence in the urine sample of prostate cells.

[0217] The screening and diagnostic methods of the invention do not require that the entire PCA3 RNA sequence be detected. Rather, it is only necessary to detect a fragment or length of nucleic acid that is sufficient to detect the presence of the PCA3 nucleic acid from a normal or affected individual, the absence of such nucleic acid, or an altered structure of such nucleic acid (such as an aberrant splicing pattern). For this purpose, any of the probes or primers as described above is used, and many more can be designed as conventionally known in the art based on the sequences described herein and others known in the art.

[0218] It is to be understood that although the following discussion is specifically directed to human patients, the teachings are also applicable to any animal that expresses PCA3.

[0219] The method of the present invention may also be used to monitor the progression of prostate cancer in patient as described above.

[0220] The present invention is illustrated in further details by the following non-limiting example. The examples are provided for illustration only and should not be construed as limiting the scope of the invention.

Example 1

The PCA3/PSA mRNA Ratios Correlate with Histological Grade in the Biopsy

[0221] In order to determine if the expression level ratio between PCA and PSA would be a good prognostic and theranostic tool, a study on 150 patients presenting elevated serum PSA levels (>3 ng/ml), as an indication for ultrasound guided biopsy and histological assessment of presence/absence of malignancy was conducted. Patients received study information and informed consent was required to enter into the study. Cancer was identified and confirmed in 49 patients by guided biopsy and histological grade analysis. The number of events, with histology in the GS area now considered to be the most difficult to assess biological aggressiveness in (38 cases with a biopsy GS of 6 and 7).

[0222] In urinary sediments, following extended DRE, the ratio PCA3/PSA mRNA was evaluated in view of assessing whether this ratio could be correlated with biological aggressiveness. PSA mRNA levels were used to normalize the test, to correct for total number of prostate born cells in the specimen.

[0223] In FIG. 3, the PCA3/PSA mRNA ratio is confronted with the histological grade. There is a clear correlation with Gleason score and the level of PCA3/PSA mRNA ratios between GS 5-8. The mean value of the PCA3/PSA ratio in case of Gleason IV and V is 41, in case of Gleason VI it is 163, in case of Gleason VII it is 193 and in case of Gleason VIII it is 577 (FIG. 3). Note, that in the three GS 9 cases there seems to be a decrease.

[0224] The distribution of Gleason Grades in cases in which the test was positive (true positive) and in the ones in which the test was negative (false negative) was then analyzed (FIG. 4). The results demonstrate that the PCA3/PSA mRNA ratio test using urinary sediments after extended DRE is significantly more positive in the high grade cancers. This study corroborates the hypothesis that PCA3/PSA mRNA ratios can serve as a prognostic factor.

Example 2

PCA3 Gene Based Analysis of Urinary Sediments has Prognostic Value

[0225] A new cohort of approximately 300 patients with elevated serum levels (>3 ng/ml) was tested as in Example 1. The patients received study information and signed informed consent in order to enter the study. For histological assessment ultrasound guided biopsy for the presence or absence of malignancy was performed. In 108 patients cancer was identified by histopathological evaluation of the biopsies. We compared the histology with the PCA3/PSA mRNA ratio obtained immediately before the biopsies.

[0226] As seen in FIGS. 5-6, a clear correlation was seen between Gleason (sum) score and the level of PCA3/PSA mRNA ratios. Subsequently, the distribution of Gleason grades, in cases of which the test was positive/true positive and the ones in which the test was negative, was analyzed. The sensitivity per grade is given using a threshold of 132.10.sup.3. The sensitivity to detect high grade (aggressive) cancers is higher. In other words, the false negatives were of significant lower grade than the true positive (FIGS. 7 and 8).

[0227] In view of the above it can be concluded that the PCA3/PSA mRNA ratio, analyzed in urinary sediments after extended DRE, constitutes a strong theranostic, diagnostic and prognostic tool.

Example 3

Detailed Analysis of Histopathological Parameters and PCA3 Test Results

[0228] PCA3 gene expression is prostate-specific and is strongly up-regulated in prostate cancer cells compared to non-malignant prostate cells. It was successfully demonstrated that PCA3 gene-based analysis can detect prostate cancer cells in urinary sediments after extended DRE 1 and 2 above. Consequently PCA3 has been shown to have tremendous potential in prostate cancer diagnosis. Having now demonstrated that more aggressive tumors could grow in a more invasive manner and shed more cancer cells in the prostatic ducts, it was also demonstrated that PCA3 gene-based analysis correlates with increasing Gleason score in biopsies and therefore has potential as a prognostic parameter (see Examples 1 and 2 above). In this subgroup analysis, the histopathological parameters of the radical prostatectomy specimens were correlated to the results of PCA3 gene-based analysis.

[0229] In the clinic, a cohort of prostate cancer patients received information and signed informed consent in order to enter the study. 48 of these patients were treated by radical prostatectomy. The histopathological parameters of the radical prostatectomy specimens were compared to the ratio of PCA3/PSA mRNA in urinary sediments obtained before the surgery. All prognostic parameters were compared.

[0230] As seen in FIG. 9, a correlation between the total tumor volume in the radical prostatectomy specimens and the level of the ratio PCA3/PSA mRNA was observed.

[0231] Thus, the PCA3/PSA mRNA ratio has prognostic value with respect to the total tumor volume in prostate cancer patients and therefore to the stage/grade and aggressiveness of prostate cancer. By using the PCA3/PSA mRNA ratio, it is thus possible not only to determine tumor grade, but also to evaluate tumor size. As a result of the PCA3/PSA mRNA ratio analysis, an appropriate treatment regimen adapted for each patient can be established. In addition, the use of the PCA3/PSA mRNA ratio allows to more accurately prognose the outcome of the disease.

Example 4

Quantitative RT-PCR Assay for PCA3 and PSA mRNAs

Materials and Methods

Tissue Specimens

[0232] Radical prostatectomy specimens were obtained from the Canisius Wilhelmina Hospital Nijmegen and the University Medical Center Nijmegen. Normal prostate, BPH and prostate tumor specimens were freshly obtained, snap frozen in liquid nitrogen and processed by step sectioning. At regular intervals a Hematoxilin & Eosin staining was performed to determine the percentage of normal, BPH and tumor cells in the tissue sections. Gleason scores and TNM classification of these tumors were determined at the department of Pathology of both hospitals. Total RNA was extracted from these tissue specimens using the LiCl-urea method (22).

Production of PCA3 and IS-PCA3 RNA

[0233] The internal standard (IS-PCA3) was constructed using the GeneEditor in vitro site-directed mutagenesis system (Promega). Three substitutions (TCC to CGT) at positions 416 to 418 of the PCA3 cDNA (GenBank #AF103907) were introduced in the PCA3 cDNA construct (pMB45). Mutations were confirmed by DNA sequence analysis.

[0234] Linearized pMB45 and pMB45-mutant plasmid DNA served as a template for in vitro transcription reactions using T3 RNA polymerase (Roche Diagnostics). In vitro produced RNAs were DNase-I treated, purified by phenol extraction, precipitated and dissolved in diethylpyrocarbonate-treated water. The concentration and integrity of the RNAs were determined by agarose gel electrophoresis using RNA standards. The RNAs were stored in aliquots at 70 C.

Reverse Transcriptase Reaction

[0235] In vitro produced PCA3 RNA and IS-PCA3 RNA as well as tissue RNA were used as templates for cDNA synthesis using the first-strand cDNA synthesis Kit (Amersham Biosciences). PCA3 and IS-PCA3 RNAs were diluted in 0.2 mg/ml E. coli tRNA (Roche Diagnostics) which was used as a carrier RNA solution. For the preparation of an extended calibration curve, 5.Math.10.sup.3 copies of IS-PCA3 RNA were mixed with a variable amount (50 to 1.Math.10.sup.7 copies) of PCA3 RNA. For the determination of PCA3 in a tissue sample, total RNA was mixed with 5.Math.10.sup.3 copies of IS-PCA3 RNA. The RNA mixtures were heated for 10 minutes at 65 C., followed by quenching on ice. To the RNA, 0.2 g of universal oligo-d(T).sub.18 primer, 2 mM DTT and 5 l of a Bulk 1.sup.st strand reaction mixture (Amersham Biosciences) were added, in a final reaction volume of 15 l. The samples were incubated for 1 hour at 37 C. and the obtained cDNA samples were heated for 5 minutes at 95 C.

PCR Amplification

[0236] For PCR amplifications, the following PCA3-specific primers were used: forward 5-TGGGAAGGACCTGATGATACA-3 (SEQ ID NO: 40 nucleotides 97-108 of exon 1 of the PCA3 cDNA, GenBank #AF103907) and reverse 5-CCCAGGGATCTCTGTGCTT-3 (SEQ ID NO: 41 nucleotides 459-477, spanning exons 3 and 4 of the PCA3 cDNA). The reverse primer was biotinylated. Five microliters of cDNA sample was amplified in a 100 l PCR reaction containing: 0.133 M reverse primer, 0.065 M biotinylated reverse primer, 0.2 M forward primer, 250 mM deoxynucleotide triphosphates (Roche Diagnostics), 2 Units of Super Taq polymerase (HT Biotechnology LTD) in buffer containing 1.5 mM magnesium chloride, 10 mM Tris-HCl (pH 8.3), 50 mM potassium chloride and 0.1% Triton X-100. The reaction mixtures were overlaid with mineral oil and thermocycling was performed on a Thermal Cycler (PerkinElmer Lifesciences Inc.) as follows: 95 C. for 2 minutes followed by 35 cycles of 95 C. for 1 minute, 60 C. for 1 minute, 72 C. for 1 minute; followed by a final extension of 72 C. for 10 minutes.

Hybridization Assay

[0237] The PCR products obtained were purified from mineral oil. Ten microliters of each PCR product were added to a well of a streptavadin-coated microtitration plate (InnoTrac Diagnostics) in triplicate. Fifty microliters of DELFIA Assay buffer containing 1.5 M NaCl was added to each well. The biotinylated PCR products were captured to the streptavadin-coated well for 1 hour at room temperature under slow shaking. The samples were washed three times with DELFIA wash solution. The double-stranded PCR products were denatured using 100 l 50 mM NaOH solution, for 5 minutes at room temperature under slow shaking. The samples were washed three times with DELFIA wash solution to remove the denatured, non-bound, DNA strands. PCA3 detection probe (30 g/l) labeled with Eu.sup.3+ (SEQ ID NO: 42 5(modC).sub.20CACATTTCCAGCCCCT-3) and IS-PCA3 detection probe (30 g/l) labeled with Tb.sup.3+ (SEQ ID NO: 435(modC).sub.20CACATTCGTAGCCCCT-3) were added to each well in DELFIA Assay Buffer containing 1.5 M NaCl and 5 g/L non-fat milk powder. The detection probes were hybridized to the captured PCA3 and IS-PCA3 DNA strands for 2.5 hours at 37 C. The samples were washed six times with DELFIA wash solution at room temperature. Then 200 l of DELFIA Enhancement solution was added to each well. Free Eu.sup.3+ rapidly forms a highly fluorescent and stable chelate with the components of the DELFIA (Eu.sup.3+) Enhancement Solution. After incubation for 30 minutes at room temperature under slow shaking, the fluorescent signal obtained from the Eu.sup.3+ chelates was measured with a 1420 Victor Multilabel Counter. Then 50 l of DELFIA (Tb.sup.3+) Enhancer Solution was added to each well to form a highly fluorescent chelate with Tb.sup.3+. After incubation for 5 minutes at room temperature under slow shaking, the fluorescent signal obtained from the Tb.sup.3+ chelates was measured. All the DELFIA reagents and the 1420 Victor Multilabel Counter were obtained from PerkinElmer Life Sciences.

Statistical Analysis

[0238] Using the Statistical Package for Social Sciences (SPSS) the data were summarized in a Receiver Operating Characteristic Curve (ROC) to visualize the efficacy of PCA3 as a marker. In this curve the sensitivity (true positives) was plotted on the Y-axis against 1-specificity (false positives) on the X-axis. In this curve all observed values were considered as arbitrary cut-off values. The Area Under Curve (AUC) and its 95% confidence interval (CI) were calculated as a measure for the discriminative efficacy of the tested marker. If the marker has no discriminative value, the AUC value is close to 0.5. In this case the AUC will be close to the diagonal in the curve. If a marker has strong discriminative power, the ROC curve will be close to the upper left corner (AUC is close to 1).

[0239] FIGS. 2A and B show that the PCA3/PSA ratio is a powerful and validated marker for prostate cancer diagnosis.

Example 5

Time-Resolved Fluorescence-Based Quantitative Determination of PCA3 mRNA: A Sensitive Tool for Prostate Cancer Prognosis

[0240] For materials and methods see Example 4.

Optimization of the Hybridization Assay

[0241] Biotinylated PCR products of either PCA3 or IS-PCA3 were used for optimizing the reaction conditions of the hybridization assay. For both targets and their hybridization probes best fluorescent signals with high signal to background ratios were obtained after 150 minutes of incubation at 37 C. in the presence of 1.5 M NaCl and 5 g/L non-fat milk powder. Sodium chloride was used to enhance the hybridization and the function of non-fat milk powder was to block non-specific background signal. Under these stringent conditions, best efficiency of the hybridization assay was obtained using 30 g/l of each probe.

[0242] To verify the possibility of cross-hybridization between targets and probes, 1.Math.10.sup.2 to 1.Math.10.sup.7 molecules of either PCA3 or IS-PCA3 RNA were used as templates in RT-PCR. The biotinylated PCR products were then hybridized to both probes. Only after amplification of 1.Math.10.sup.6 IS-PCA3 RNA molecules, the PCA3 probe showed slight cross-reactivity (0.1%) with the IS-PCA3 target. Under these optimized conditions, the IS-PCA3 probe showed no detectable cross-reactivity with the PCA3 target. The slight cross-reactivity of the PCA3 probe is due to the stability of the mismatches. The binding of the PCA3 probe to the IS-PCA3 target is more stable than the binding of the IS-PCA3 probe to the PCA3 target.

PCR Amplification

[0243] The best efficiency of PCR amplification was obtained using 0.2 M of each primer. Ylikoski (1999) showed that large excess of biotinylated reverse primer competed with the biotinylated PCR product for streptavidin binding-sites (23). Therefore, a reduced amount of biotinylated reverse primer was used to avoid a dilution step of amplification products before the hybridization assay and to obtain a reliable detection of the amplification products. For optimal PCR amplification 0.133 M unlabeled reverse primer, 0.065 M biotinylated reverse primer, and 0.2 M forward primer were used.

[0244] To determine the amplification efficiency of both PCA3 and IS-PCA3 targets, 5.Math.10.sup.3 molecules of either PCA3 RNA or IS-PCA3 RNA were amplified by RT-PCR for different numbers of amplification cycles. Raeymaekers (1993) showed that the PCR efficiency was based on the equation for exponential growth: log Nc=log Ni+c[log(1+f)] in which Nc is the amount of product generated after c amplification cycles, Ni is the initial amount of target, c is the number of amplification cycles and f is the amplification efficiency (24). When log Nc is plotted against the number of amplification cycles, then the slope of the curve equals log(1+f). If the amplification efficiency is the same for both PCA3 and IS-PCA3 targets then the slope of both curves is the same. Both PCA3 (f=0.63) and IS-PCA3 (f=0.64) were reverse transcribed and amplified with identical efficiencies (data not shown). This was confirmed when the log of the PCA3/IS-PCA3 ratio was plotted against the number of amplification cycles. A horizontal line was generated indicating that the amplification efficiency is the same for both targets (data not shown).

[0245] The sensitivity and the analytical range of the PCA3-based assay may be affected by the amount of IS-PCA3 RNA that is added to each sample. For example, if the amount of internal standard amplified with varying amounts of PCA3 is too high, small amounts of PCA3 RNA cannot be amplified sufficiently by RT-PCR to generate a detectable signal. Consequently, the sensitivity of the technique becomes limited. The same holds true for the RT-PCR amplification of a too small amount of IS-PCA3 RNA in the presence of a high concentration of PCA3 RNA. Therefore, the interference between amplification of the PCA3 and IS-PCA3 targets was studied by RT-PCR amplification of varying amounts of PCA3 RNA with a constant amount of IS-PCA3 RNA. The fluorescent signals obtained for 5.Math.10.sup.3 or 5.Math.10.sup.4 IS-PCA3 molecules remained constant after co-amplification with 1.Math.10.sup.2 to 5.Math.10.sup.5 PCA3 molecules. Only after the co-amplification with more than 1.Math.10.sup.6 PCA3 molecules, did the fluorescent signals for both IS-PCA3 and PCA3 slightly decrease (data not shown). This phenomenon is due to competition of both target molecules during PCR as well as to the saturation phase of the PCR reaction. These data indicate that both concentrations of IS-PCA3 can be used for co-amplification of PCA3 to obtain a wide linear range for the quantification of PCA3. When variable amounts of IS-PCA3 were co-amplified with a constant amount of PCA3, similar results were obtained (data not shown).

Detection Limit and Reproducibility

[0246] To determine the sensitivity and linearity of the proposed quantitative RT-PCR technique for the detection and quantification of PCA3 RNA, a calibration curve was generated. Varying amounts of PCA3 RNA molecules (ranging from 50 to 1.Math.10.sup.7 PCA3 RNA molecules) were mixed with 5.Math.10.sup.3 IS-PCA3 RNA copies. As was shown before, this was the smallest amount of IS-PCA3 that allowed a wide linear range for quantification of PCA3. Furthermore, the slight cross-reactivity (0.1%) of the PCA3 probe with more than 5.Math.10.sup.5 IS-PCA3 copies could be avoided using this amount of IS-PCA3. The background signal was defined as the signal obtained when no PCA3 RNA or IS-PCA3 RNA was present. The detection limit of this quantitative RT-PCR assay was determined as two times the mean of the background signal. In this quantitative RT-PCR assay the detection limit corresponded to 50 PCA3 RNA copies using 35 PCR amplification cycles. Since the saturation phase had the same effect on both targets (as discussed before), a calibration curve with a wide linear range that extended from 50 to 1.Math.10.sup.7 PCA3 RNA molecules was obtained (data not shown).

[0247] The reproducibility of the PCA3-based RT-PCR assay was established by the comparison of four independent calibration curves. The dilution series of PCA3 and IS-PCA3 targets, the reverse transcription, PCR and hybridization assays of these four calibration curves were prepared and analyzed in four independent assays. As can be concluded from the combined calibration curve (data not shown), the overall intra-assay reproducibility is good with median coefficients of variation (CV) of 6% (range: 2-25%).

Quantification of PCA3 mRNA Expression in Tissue Specimens

[0248] The described PCA3-based RT-PCR assay was used to evaluate the potential usefulness of PCA3 as a diagnostic marker for prostate cancer. The prostate-specificity of PCA3 was determined by measuring the number of PCA3 RNA copies in the cDNA obtained from several normal tissues of breast, bladder, duodenum, heart, liver, lung, kidney, prostate, seminal vesicle, skin, stomach, testis and peripheral blood leukocytes. All samples, except prostate, were negative for PCA3 (data not shown) which was in concordance with earlier published data (20; 21).

[0249] Next, PCA3 RNA expression was determined in the following tissue specimens; BPH (n=8), normal prostate (n=4), prostate tumor containing equal or less than 10% of prostate cancer cells (n=13) and prostate tumor containing more than 10% of prostate cancer cells (n=27) in order to evaluate the usefulness of PCA3 as a prostate tumor marker. There was no difference in the expression of PCA3 RNA between non-malignant prostate tissue and BPH tissue and therefore both were included in the group of non-malignant controls. In prostate tumors containing more than 10% of prostate cancer cells, the median up-regulation of PCA3 was 66-fold (median, 158.4.Math.10.sup.5; range, 7.0.Math.10.sup.5-994.0.Math.10.sup.5) compared to the PCA3 expression in non-malignant controls (median, 2.4.Math.10.sup.5; range 0.2.Math.10.sup.5-10.1.Math.10.sup.5) (Table 4). Even in prostate tumors containing less than 10% of prostate cancer cells, the up-regulation of PCA3 expression was 11-fold (median 25.3.Math.10.sup.5; range 6.6.Math.10.sup.5-166.0.Math.10.sup.5), as compared to the expression in non-malignant controls. In 7 human radical prostatectomy specimens the PCA3 expression in tumor areas was compared to the PCA3 expression in the adjacent non-neoplastic prostate tissue from the same patients. Using the PCA3-based quantitative RT-PCR assay, 6 to 1500-fold up-regulation of PCA3 was found in these prostate tumors, as compared to the adjacent non-neoplastic prostate tissue (Table 6).

[0250] For the determination of the potential diagnostic efficacy of the PCA3-based quantitative RT-PCR assay, a Receiver Operating Characteristic (ROC) curve was constructed (data not shown). The Area Under the Curve (AUC) was 0.98 (95% confidence interval, 0.94-1.01), indicating that the PCA3-based assay is very specific and has strong diagnostic value.

DISCUSSION

[0251] Currently RT-PCR is the most widely used method in the detection of a small number of neoplastic cells in a large background of normal cells. In recent years, RT-PCR assays have been developed for the identification of prostate cancer cells using PSA mRNA and PSMA mRNA as the most commonly used targets for this technique (25; 26; 26-29). Many of these RT-PCR assays were qualitative, meaning that they provided information with respect to the presence or absence of these targets in the PCR reaction products. Like all PCR assays, RT-PCR is an extremely sensitive assay. However, after the introduction of the nested RT-PCR method, PSA and PSMA transcripts were also detected in peripheral blood leukocytes obtained from healthy donors (30; 31). This indicates that basal transcripts of prostate-specific genes that might be present at low background levels in non-prostate cells, could result in a false-positive signal if the sensitivity of the RT-PCR technique becomes too high. The background expression of many genes that earlier have been considered as tissue or tumor-specific has contributed to the wide range in sensitivity and specificity among the results of the RT-PCR studies. These contradictory results can be attributed to the lack of uniformity among the used RT-PCR protocols. The background expression of tissue-specific genes does not invalidate their clinical use. However, it does imply that the development of more quantitative RT-PCR techniques is necessary to obtain more reproducible and reliable results.

[0252] In the detection and analyzes of RT-PCR products Southern blot followed by hybridization with specific radioactive oligonucleotide probes dominated the field of hybridization assays for two decades. Although sensitive, this technique is qualitative and time-consuming. In the past decade there has been a transition to non-radioactive alternatives because of the health hazards and the problems associated with the use and disposal of radioisotopes.

[0253] One of new technologies in the field of RT-PCR is the real-time PCR detection of nucleic acids in a closed tube (32; 33). This technique decreases the risk of contamination and it also simplifies the analysis since post-PCR hybridization steps are not required. Moreover, a large number of samples can be analyzed simultaneously. The method most widely used for quantification is the generation of a calibration curve from a dilution series of linearized plasmid containing the cDNA insert of interest. This dilution series is amplified in the same run as the samples. Although widely used, this approach may have impact on the accuracy of the assay. The RNA samples may be more prone to variations in amplification efficiency that are caused by inhibitors present in the reverse transcribed sample compared to the amplification of the plasmid DNA (34). Because major variations are introduced in the reverse transcription step, the copy numbers obtained after real-time RT-PCR may not reflect the copy number in the sample before cDNA synthesis. The use of an exogenous internal standard in both calibration curve and the samples will correct for any differences that may occur during the cDNA synthesis and could overcome this problem. However, in real-time PCR assays such a competitive internal standard cannot be used. Both target and internal standard will compete for PCR reagents. If more than a 10-fold difference exists between target and internal standard, then the less abundant species will not be amplified sufficiently for detection. This is because the more abundant target will consume most of the PCR reagents, especially the primers (34; 35). To correct for these sample-to-sample variations in real-time PCR a cellular RNA is RT-amplified simultaneously with the target RNA. These so-called housekeeping genes are used as an endogenous internal standard and the expression of these genes should not vary in the tissues or cells under investigation or due to experimental treatment. These RNAs should also be expressed at about the same level as the target RNA. The number of target RNA copies is then normalized to the RNA expression of the abundant housekeeping gene. rRNAs may be useful as internal standards since they are generated by a distinct polymerase (36). Therefore, their expression levels are not likely to vary under conditions that affect the expression of RNAs (37). However, rRNAs are expressed at much higher levels than the target RNA. Therefore, normalization of low abundant target RNA to the abundant housekeeping gene (e.g., 18 Svedberg Units (S) rRNA) might be difficult. This 18S rRNA is highly abundant compared to the target mRNA transcripts. This makes it difficult to accurately subtract the baseline value in real-time RT-PCR data analysis (38). To overcome these problems, Nurmi developed a target-like, non-competitive, exogenous internal standard for a real-time quantitative PSA assay (34). Omitting the IS from the analysis of PSA mRNA using real-time PCR resulted in a 172-fold underestimation of PSA RNA amount in a sample. Additionally, by using lanthanide-labeled probes instead of conventional TaqMan probes, they were able to detect two separate targets even when the difference in their starting amounts is 100-fold. Due to the superior signal to noise ratio, the detection limit could be increased by 10-fold. Using normal TaqMan probes and labels with rapidly decaying or prompt fluorescence, the detection limit was 1000 target mRNA copies, whereas the lanthanide-based detection was able to detect 100 PSA mRNA copies. Although this development is still in a research-phase and there is no real-time PCR instrument yet available for time-resolved fluorescence detection this approach is a great improvement in real-time PCR for true quantifications of low expressed mRNAs.

[0254] In one embodiment it was decided not to use real-time PCR for quantification because of the earlier described problems in the correction for sample-to-sample preparation and accurate quantification. Therefore, a time-resolved fluorescence-based quantitative RT-PCR assay for PCA3 was developed. Currently, time-resolved fluorescence (TRF) is considered as one of the most sensitive non-radioactive techniques that allow to distinguish between the short lived prompt fluorescent signal obtained from the background of biological samples and the long fluorescent decay time of the lanthanide probes. Measurement of the lanthanide fluorescent signal does not occur until a certain time has elapsed from the moment of excitation. During this delay the short lived prompt fluorescent signal disappears, accounting for the high sensitivity of this technique (39). Ylikoski combined both techniques in their time-resolved fluorescence-based quantitative RT-PCR assay for PSA (23; 40). This provided a sensitive, quantitative and linear detection of PSA mRNA in biological samples. The described time-resolved fluorescence-based quantitative RT-PCR assay for PCA3 is based on the principle they have used.

[0255] As was discussed earlier, the most challenging problem associated with RT-PCR is the determination of the starting quantity of target RNA. For quantification of PCA3, a constant amount of exogenous internal RNA standard was added to each sample and to each of the calibrators covering the wide linear range of 50 to 1.Math.10.sup.7 PCA3 RNA copies. This IS-PCA3 only contained a 3 bp difference with respect to the PCA3 mRNA. The internal standard was added to the sample prior to cDNA synthesis. Therefore, it can correct for variations during the entire assay procedure from reverse transcription to the detection of amplification products by the hybridization assay. We have shown that both targets were equally co-amplified because of their resemblance in size and sequence. The small difference in sequence allowed the construction of two specific hybridization probes for the detection of PCA3 and IS-PCA3. The conditions for the hybridization have been optimized to avoid cross-hybridization between the probes and their targets. We have shown that the two targets were selectively detected by the probes in the hybridization assay. The probes were labelled with two different lanthanides, europium and terbium. The sharp emission peaks and the different decay times of Eu.sup.3+ and Tb.sup.3+ allow the simultaneous detection of both analytes in one microtiter well. To determine the starting quantity of PCA3 mRNA in a sample, the fluorescence PCA3/IS-PCA3 ratio obtained from the sample was compared to the ratios obtained for the calibrators. This dual-label TRF-based hybridization assay in microtiter plates allows the quantification of PCA3 mRNA in a large number of samples with only a single set of twelve calibrators. Moreover, the intra-assay reproducibility is good with median coefficients of variation (CV) of 6% (range 2-25%). Using this method, up to 50 PCA3 copies could be detected when they were co-amplified with 100-fold more (5000 copies) of internal standard. This would not have been possible using the conventional real-time PCR technique since a more than 10-fold difference between target and internal standard would lead to an insufficient amplification of the less abundant species. The sensitivity of this technique becomes important in a diagnostic setting where small quantities of the sequence of interest have to be detected. The time-resolved fluorescence-based quantitative RT-PCR method described is quantitative, more sensitive, faster and easier than the conventional analysis based on Southern blotting and membrane hybridization.

[0256] The herein described time-resolved fluorescence-based quantitative RT-PCR assay for PCA3 showed that PCA3 was exclusively expressed in the prostate. This was in concordance with earlier published data (20; 21). This quantitative RT-PCR assay obtained AUC-ROC values of 0.98 for PCA3. It demonstrates the high discrimination power of this transcript to differentiate between malignant and non-malignant prostate tissues. Bussemakers and colleagues found a 10-100 fold over-expression of PCA3 in tumor areas compared to adjacent non-neoplastic prostate tissue based on Northern blot analysis. Using this quantitative time-resolved fluorescence-based assay we showed that the PCA3 expression in tumor areas of the radical prostatectomy specimens of 7 patients was up-regulated 6 to 1500-fold compared to the adjacent non-neoplastic prostate tissue. In the non-matched group of tissue specimens a median 66-fold up regulation of PCA3 was found in the prostate tumors containing more than 10% of tumor cells. The median up-regulation of PCA3 of 11-fold in prostate tissue samples containing less than 10% of tumor cells indicates that the PCA3 assay is capable of detecting a few malignant cells in a background of predominantly non-malignant cells. These data were in concordance with the data obtained from the recently developed real-time PCR assay (21).

[0257] The combined data and the fact that PCA3 is not expressed in leukocytes (often present in bodily fluids) indicate that quantitative RT-PCR assay for PCA3 bears great promise as diagnostic tool. As such it could be applicable in the detection of malignant prostate cells in blood, urine or ejaculates obtained from patients who are suspected of having prostate cancer. Recently, this hypothesis was tested by Hessels (Eur. Urol. 2003 supra) using the herein described molecular test to analyze urinary sediments after thorough digital rectal examination of the prostate. The combined data showed that the quantitative determination of PCA3 transcripts in urinary sediments obtained after extensive prostate massage, has high specificity (83%) compared to serum PSA (20%) for the detection of prostate cancer. Moreover, the negative predictive value of this test was 90%. Therefore, it bears great potential in the reduction of the number of biopsies.

[0258] Herein a very sensitive time-resolved fluorescence-based quantitative RT-PCR assay with a wide linear detection range of 50 to 1.Math.10.sup.7 PCA3 copies was developed. In this assay, the target-like exogenous internal standard controls for sample-to-sample variations from the cDNA synthesis to the hybridization assay. This assay has shown that PCA3 can highly discriminate between malignant and non-malignant prostate tissues. We recently showed that this quantitative RT-PCR assay is applicable to the detection of prostate cancer cells in urine sediments. Thus, multicenter studies using validated PCA3 assays, can provide the first basis for the utility of molecular diagnostics in clinical urological practise.

[0259] The potential diagnostic efficacy of the PCA3-based assay was determined by quantitative measurement of PCA3 transcripts in non-malignant and malignant prostate specimens. Before the reverse-transcription reaction, total RNA obtained from normal prostate and prostate cancer tissue specimens was mixed with an exogenous PCA3-like internal RNA standard. This internal standard corrects for variations during the entire assay procedure. After RT-PCR co-amplification of PCA3 and the internal standard, the samples were immobilized on streptavidin-coated microtiter wells. Each target was hybridized to a specific probe, labeled with either europium or terbium. Time-resolved fluorometry was used for the measurement of these strongly fluorescent lanthanide chelates. The quantification of PCA3 mRNA copies in a sample was determined from a calibration curve covering the wide linear range of 50 to 1.Math.10.sup.7 PCA3 copies

[0260] Prostate tumors showed a 66-fold up-regulation of PCA3 (median 158.4.Math.10.sup.5 copies/g tissue RNA) when compared to benign prostate tissue (median 2.4.Math.10.sup.5 copies/g tissue RNA). This up-regulation was found in more than 95% of prostate cancer specimens studied. The herein presented data revealed that tissue specimens containing less than 10% of cancer cells could be accurately discriminated from non-malignant specimens. Hence, detection of a small fraction of prostate cancer cells in a background of normal cells seems feasible. The diagnostic efficacy of the PCA3-based assay was visualized in a receiver operating characteristic curve. The area under curve of 0.98 (95% Cl:0.94-1.01) confirmed the excellent discrimination power of this assay. The quantitative RT-PCR assay for PCA3 described, bears great promise as a tool to be used for prostate cancer prognosis (and diagnosis).

[0261] Recently, a number of prostate-specific genes have been identified such as prostate-specific membrane antigen (PSMA) (12), NKX3.1 (13), prostate stem cell antigen (PSCA) (14), prostate tumor inducing gene-1 (PTI-1) (15), PCGEM-1 (16), PDEF (17), TMPRSS2 (18) and Prostase (19). However, diagnoses based on the expression of these prostate-specific genes has not been described. In addition, the most promising candidate for a diagnostic screening test remains the prostate-specific PCA3 gene since its expression is restricted to the prostate and is strongly up-regulated in more than 95% of primary prostate cancers (20; 21). To further demonstrate the potential usefulness of PCA3 as a diagnostic marker for prostate cancer, a time-resolved fluorescence-based quantitative RT-PCR assay (using an exogenous internal standard and an external calibration curve) was developed. The sensitivity and specificity of this time-resolved fluorescence-based quantitative RT-PCR assay for PCA3 was validated using a large panel of well-characterized normal and malignant prostate specimens.

[0262] Although the present invention has been described hereinabove by way of preferred embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims.

TABLE-US-00002 TABLE 2 PCA3 NUCLEIC ACID PRIMERS Nucleic Acid Region Size Nucleotides Size Nucleotides Exon Sequence from Which to Derive Primers Exon 1 98 1-98 of SEQ ID NO: 1 120 1-120 of SEQ ID NO: 2 Exon 2 165 99-263 of SEQ ID NO: 1 165 121-285 of SEQ ID NO: 2 Exon 3 183 264-446 of SEQ ID NO: 1 183 286-468 of SEQ ID NO: 2 Exon 4a 539 447-985 of SEQ ID NO: 1 539 469-1007 of SEQ ID NO: 2 Exon 4b 1052 986-2037 of SEQ ID NO: 1 1059 1008-2066 of SEQ ID NO: 2 Exon 4c 556 2067-2622 of SEQ ID NO: 2 Exon 4d 960 2623-3582 of SEQ ID NO: 2 Exon Junction Specific Primers Exon Junction 1 20 89-108 of SEQ ID NO: 1 20 109-128 of SEQ ID NO: 2 (SEQ ID NO: 5) (SEQ ID NO: 6) Exon Junction 2 20 252-271 of SEQ ID NO: 1 20 274-293 of SEQ ID NO: 2 (SEQ ID NO: 7) (SEQ ID NO: 7) Exon Junction 3 20 435-454 of SEQ ID NO: 1 20 457-476 of SEQ ID NO: 2 (SEQ ID NO: 8) (SEQ ID NO: 8) Exon Junction 4 20 974-993 of SEQ ID NO: 1 20 996-1015 of SEQ ID NO: 2 (SEQ ID NO: 9) (SEQ ID NO: 9) Exon Junction 5 20 2055-2074 of SEQ ID NO: 2 (SEQ ID NO: 10) Exon Junction 6 20 2611-2630 of SEQ ID NO: 2 (SEQ ID NO: 11)

TABLE-US-00003 TABLE3 PCA3NUCLEICACIDPROBES SEQ ID Size Nucleotides Sequence NO: 20 1-20ofSEQIDNO:1 AGAAGCTGGCATCAGAAAAA 12 30 1-30ofSEQIDNO:1 AGAAGCTGGCATCAGAAAAA 13 CAGAGGGGAG 40 1-40ofofSEQIDNO:1 AGAAGCTGGCATCAGAAAAA 14 CAGAGGGGAGATTTGTGTGG 20 89-108ofSEQIDNO:1 TGATACAGAGGAATTACAAC 5 30 257-286ofSEQIDNO:1 GGCAGGGGTGAGAAATAAGA 15 AAGGCTGCTG 20 274-293ofSEQIDNO:1 AGAAAGGCTGCTGACTTTAC 16 20 1-20ofSEQIDNO:2 ACAGAAGAAATAGCAAGTGC 17 30 1-30ofSEQIDNO:2 ACAGAAGAAATAGCAAGTGC 18 CGAGAAGCTG 40 1-40ofSEQIDNO:2 ACAGAAGAAATAGCAAGTGC 19 CGAGAAGCTGGCATCAGAAA 30 114-143ofSEQIDNO:2 TACAGAGGAATTACAACACA 20 TATACTTAGT 20 284-303ofSEQIDNO:2 GGGTGAGAAATAAGAAAGGC 21

TABLE-US-00004 TABLE4 ExonJunction PrimerPairsin SEQID Detected PCA3Exons ExonJuncationProbes NO: Exon1/exon2 exon1andexon2 GGACCTGATGATACAGAGGAATTAC 22 Exon1/exon2 exon1andexon2 GAGGAATTACAACAC 23 Exon1/exon2 exon1andexon2 GATGATACAGAGGAATTACAACAC 24 Exon1/exon3 exon1andexon3 GATGATACAGAGGTGAGAAATAAG 25 Exon1/exon3 exon1andexon3 CAGAGGTGAGAAATAAGAAAGGC 26 Exon1/exon3 exon1andexon3 GATACAGAGGTGAGAAATAAG 27 Exon1/exon3 exon1andexon3 GATACAGAGGTGAGAAATAAGAAAGGCTGCTAC 28 Exon2/exon3 exon2andexon3,or GGCAGGGGTGAGAAATAAG 29 exon1andexon3 Exon2/exon3 exon2andexon3,or CTCAATGGCAGGGGTGAG 30 exon1andexon3 Exon2/exon3 exon2andexon3,or CTCAATGGCAGGGGTGAGAAATAAGAAAGGCTGCTGAC 31 exon1andexon3 Exon3/exon4 exon3andexon4,or GGAAGCACAGAGATCCCTGG 8 exon1andexon4,or exon2andexon4 exon3/exon4 exon3andexon4,or GCACAAAAGGAAGCACAGAGATCCCTGGGAG 32 exon1andexon4,or exon2andexon4 exon3/exon4 exon3andexon4,or GCACAGAGATCCCTGGGAG 33 exon1andexon4,or exon2andexon4 exon3/exon4 exon3andexon4,or GCACAGAGGACCCTTCGTG 34 exon1andexon4,or exon2andexon4 exon3/exon4 exon3andexon4,or GGAAGCACAAAAGGAAGCACAGAGATCCCTGGG 35 exon1andexon4,or exon2andexon4

TABLE-US-00005 TABLE 5 PCA3 mRNA expression in normal prostate, BPH and prostate tumor samples PCA3 mRNA Gleason copies/ug tissue Sample Pathology % PCa score RNA (1.Math.10.sup.5) non-malignant controls 198 BPH 0.15 162 BPH 0.20 124 BPH 0.34 153 BPH 0.39 127 BPH 0.72 120 NPr 1.79 669 BPH 3.03 663 NPr 3.14 327 BPH 7.12 234 BPH/NPr 7.39 674 NPr 7.56 128 NPr 10.06 median 2.41 10% PCa 193 Tumor 5 6 6.55 676 Tumor 6 6 7.23 328 Tumor focal 6 12.68 665 Tumor focal 6 14.05 161 Tumor focal 6 14.07 238 Tumor 5 7 19.87 122 Tumor 1 6 25.32 158 Tumor 10 6 32.01 668 Tumor 5 6 55.95 203 Tumor 5 7 60.56 195 Tumor focal 6 85.88 661 Tumor 5 6 114.19 675 Tumor 10 6 165.95 median 25.32 >10% Pca 715 Tumor 20 7 7.02 126 Tumor 40 6 11.32 143 Tumor >10% 7 16.30 707 Tumor 80 5 19.17 744 Tumor 30 7 34.16 129 Tumor 80 8 59.12 121 Tumor 90 8 61.55 673 Tumor 90 5 62.94 713 Tumor 70 3 75.62 29 Tumor 80 5 77.89 704 Tumor 85 6 89.20 237 Tumor 80 5 115.58 667 Tumor 65 6 138.50 717 Tumor 40 7 158.43 710 Tumor 20 7 215.89 48 Tumor 95 10 217.12 194 Tumor 80 6 221.17 147 Tumor >10% 6 249.99 118 Tumor 67 8 264.77 709 Tumor 30 6 270.77 664 Tumor 60 8 296.48 163 Tumor 90 6 297.25 145 Tumor >10% 7 305.98 662 Tumor 70 6 487.88 666 Tumor 60 5 536.21 141 Tumor >10% 7 663.86 235 Tumor 80 7 993.99 median 158.43 BPH: Benign Prostatic Hyperplasia PCa: prostate cancer NPr: normal prostate

TABLE-US-00006 TABLE 6 Comparison of PCA3 mRNA expression between non- malignant prostate and prostate tumor tissue of the same patient PCA3 mRNA copies/ g tissue RNA Sample code (x110.sup.4) Ratio Patient NPr PCa NPr PCa T/N 1 128 129 100 590 6 2 674 673 76 630 8 3 127 126 7 113 16 4 663 664 31 2965 96 5 234 235 74 9940 134 6 120 118 18 2648 147 7 162 163 2 2973 1487 NPr: normal prostate tissue PCa: prostate tumor tissue

TABLE-US-00007 TABLE 7 Conclusion patient PSA RNA PCA3 PSA Ratio PA biopsy Diagnosis PARRP RRP 1 4.23 946 974 12054 81 T03-11049 no malignancy , 87 6.68 1076 118 33359 4 T04-00507 no malignancy , 137 , 1166 211 5272 40 T03-05862 no malignancy , 164 4.6 1216 0 23003 0 T04-04972 no malignancy , 92 4.41 1081 82 936 87 T04-00521 no malignancy , 150 4.83 1184 68 151 451 T04-04416 no malignancy , 178 3.52 1242 0 9387 0 T04-05581 no malignancy , 118 6.07 1119 0 884 0 T04-01860 no malignancy , 196 7.91 1272 166 986 168 T04-07086 no malignancy , 11 , 923 168 1408 119 T03-09658 no malignancy , 11 , 926 166 16799 10 T03-09658 no malignancy , 12 23.28 1105 177 10414 17 T04-00849 no malignancy , 13 4.7 988 0 2926 0 T03-12238 no malignancy , 77 6.9 1050 133 3696 36 T03-14332 no malignancy , 113 , 1114 122 277 441 T03-03241 no malignancy , 14 5.9 997 23729 21318 1113 T03-12798 no malignancy , 127 4.92 1153 58 6128 9 T04-04409 no malignancy , 15 6.9 935 1239 13184 94 T03-09652 no malignancy , 151 5.1 1188 988 1580 625 T04-05305 no malignancy , 16 4.44 919 557 1888 295 T03-09660 no malignancy , 16 2.2 1276 128 635 202 T03-09660 no malignancy , 17 7.6 925 143 1333 107 T03-09656 no malignancy , 139 9.55 1169 98 1930 51 T03-08073 no malignancy , 18 26.8 985 177 2632 67 T03-12252 no malignancy , 68 17.9 1018 185 3008 62 T03-14038 no malignancy , 68 13.82 1044 267 5614 48 T03-14038 no malignancy , 112 7.17 1113 2145 10119 212 T04-00842 no malignancy , 111 9.46 1112 0 712 0 T04-01175 no malignancy , 200 17.7 1256 0 1318 0 T04-06474 no malignancy , 129 1.08 1158 0 1396 0 T04-02170 no malignancy , 149 8.1 1195 295 4992 59 T04-03473 no malignancy , 130 32 1159 78 1536 51 T04-04418 no malignancy , 97 7.86 1068 901 7204 125 T03-12795 no malignancy , 62 8.55 1010 0 1840 0 T03-13081 no malignancy , 20 0.93 942 1008 1960 518 T03-10730 no malignancy , 21 10 991 223 17451 13 T03-04605 no malignancy , 140 49.57 1170 283 5439 52 T03-03313 no malignancy , 23 5.68 992 0 3631 0 T03-12531 no malignancy , 26 1.19 989 922 19742 47 T03-12529 no malignancy , 27 5.4 960 222 1531 145 T03-11915 no malignancy , 29 5.41 993 102 11858 9 T03-12533 no malignancy , 31 6.71 940 4703 39511 120 T03-10448 no malignancy , 73 7.5 1024 372 20984 18 T03-14028 no malignancy , 76 8.35 1043 62 369 168 T03-14034 no malignancy , 198 6.74 1274 234 3066 76 T04-06256 no malignancy , 132 10.35 1161 121 1360 89 T04-02172 no malignancy , 64 14.14 1014 204 706 289 T04-04966 no malignancy , 64 14.14 1217 552 24878 22 T04-04966 no malignancy , 64 14.14 1244 1011 18431 55 T04-05575 no malignancy , 133 10.85 1162 7392 56456 131 T04-02178 no malignancy , 133 22.6 1167 2580 12569 205 T04-02178 no malignancy , 104 6.41 1104 780 1884 414 T04-00851 no malignancy , 33 11.3 938 0 1413 0 T03-10446 no malignancy , 93 7.18 1082 1824 6645 274 T04-00518 no malignancy , 110 8.12 1111 0 1686 0 T04-01183 no malignancy , 157 3.36 1209 0 23685 0 T04-04650 no malignancy , 119 11.74 1120 253 3352 75 T04-01539 no malignancy , 134 13.02 1163 1042 23137 45 T04-02176 no malignancy , 170 5.04 1225 107 5682 19 T04-04646 no malignancy , 82 5.07 1046 1048 1719 610 T03-14338 no malignancy , 59 4.79 1006 6989 37995 184 T03-13078 no malignancy , 182 6.8 1238 477 34720 14 T04-05369 no malignancy , 96 5.3 1071 4336 66786 65 T03-13415 no malignancy , 181 4.95 1239 0 10403 0 T04-05302 no malignancy , 98 5.57 1098 58 1293 44 T04-00820 no malignancy , 194 4.18 1270 120 14280 8 T04-06754 no malignancy , 201 4.8 1257 639 25343 25 T03-14641 no malignancy , 103 7.73 1103 0 550 0 T04-00846 no malignancy , 101 , 1277 0 505 0 T03-14040 no malignancy , 126 10.76 1152 0 11523 0 T04-01855 no malignancy , 46 12.91 983 235 14462 16 T03-14639 no malignancy , 47 13.9 944 7509 32691 230 T03-13435 no malignancy , 163 5.99 1215 0 41990 0 T04-04968 no malignancy , 147 16 1181 487 14526 34 T04-04422 no malignancy , 191 6.6 1267 511 2740 186 T04-00267 no malignancy , 171 6.82 1226 512 2647 193 T04-04643 no malignancy , 123 24 1138 0 8052 0 T04-03121 no malignancy , 50 5.17 941 780 7358 107 T03-10732 no malignancy , 52 , 996 609 17412 35 T03-12800 no malignancy , 80 3.53 1048 352 8416 42 T03-14330 no malignancy , 55 , 984 73 3419 21 T03-13126 no malignancy , 174 10.38 1230 960 22230 43 T04-04407 no malignancy , 70 , 1021 93 98251 1 T03-13720 no malignancy , 56 29 982 0 940 0 T03-14334 no malignancy , 56 29.08 1005 82 471 174 T04-04413 no malignancy , 75 8.68 1026 115 3118 37 T03-14030 no malignancy , 136 4.8 1165 0 22843 0 T04-02788 no malignancy , 193 4.21 1269 284 15158 19 T04-06729 Gleason 6 , 4 5 998 13549 37999 357 T04-06172 Gleason 7 Gleason pT2AN0R1 4 + 3 = 7 190 12.02 1265 55 845 65 T04-06728 Gleason 7 , 186 4.94 1261 48 129 372 T04-06470 Gleason 6 , 8 , 947 252 635 397 Gleason 5 , 122 6.24 1123 366 430 852 T04-01537 Gleason 6 Gleason pT2BN0R1 3 + 3 = 6 9 6.25 932 , , 136 T03-10189 Gleason 6 , 9 6.25 932 2141 8222 260 T03-10189 Gleason 6 , 91 4.49 1078 401 1689 237 T04-00510 Gleason 6 , 66 5.3 1016 534 6623 81 T03-13432 Gleason 6 Gleason pT2AN0R0 3 + 3 = 6 63 30.4 1012 1640 3781 434 T03-13436 Gleason 7 , 166 6.42 1221 116 6178 19 T04-04967 Gleason 6 , 19 62 933 , , 222 T03-09755 Gleason 8 Gleason pT4N1 4 + 4 = 8 19 62 933 392329 704960 577 T03-09755 Gleason 8 Gleason pT4N1 4 + 4 = 8 65 4.23 1015 103 1180 87 T04-02391 Gleason 6 Gleason pT2CN0R1 2 + 4 = 6 195 17.62 1271 137 402 340 T04-06731 Gleason 7 , 25 7.1 963 1031 1038 1012 T04-01468 Gleason 7 Gleason pT2AN0R1 3 + 4 = 7 192 8.93 1268 5610 37695 149 T04-06730 Gleason 7 , 120 9.77 1121 775 10035 77 T04-01533 Gleason 7 , 30 7.49 965 291 6414 46 T03-11922 Gleason 6 , 167 24 1222 395 2254 175 T04-06472 Gleason 7 , 32 , 928 102 429 243 T03-11626 Gleason 6 , 32 , 928 594 518 1147 T03-11626 Gleason 6 , 79 85.63 1049 122 223 547 T03-14340 Gleason 9 , 143 5.1 1219 0 7351 0 T04-06258 Gleason 6 , 109 30 1110 1072 6302 170 T04-06287 Gleason 9 Gleason pT3AN0R1 4 + 5 = 9 34 9.56 990 1375 12730 108 T03-12527 Gleason 6 169 3.52 1224 15610 23584 662 T04-04644 Gleason 6 172 11.53 1227 3409 7448 458 T04-04652 Gleason 6 142 9.06 1218 163 3924 41 T04-06400 Gleason 5 Gleason pT2CN0R0 2 + 3 = 5 57 7.55 1003 251 7094 35 T03-13075 Gleason 6 162 1 1214 109 578 189 T04-04964 Gleason 6 125 11.61 1151 228 564 404 T04-00822 Gleason 7 Gleason pT3AN0R1 4 + 3 = 7 154 6.9 1199 80 379 211 T04-04180 Gleason 6 , 154 6.9 1229 224 711 315 T04-04180 Gleason 6 , 155 5.38 1207 0 3913 0 T04-04877 Gleason 5 , 90 9.45 1077 3511 16621 211 T04-00516 Gleason 7 , 100 7.18 1100 404 9690 42 T04-01181 Gleason 6 , 156 5.52 1208 431 43117 10 T04-06076 Gleason 5 Gleason pt2AN0R0 2 + 3 = 5 153 10.33 1189 355 1549 229 T04-03468 Gleason 6 , 121 5.98 1122 424 3787 112 T04-01531 Gleason 4 , 121 5.98 1122 773 5508 140 T04-01531 Gleason 7 Gleason pT3BN0R0 4 + 3 = 7 173 6.66 1228 189 1684 112 T04-04183 Gleason 6 , 72 15.7 1023 209 1345 155 T04-03591 Gleason 7 Gleason pT3AN0R0 4 + 3 = 7 117 9.38 1118 6056 12872 470 T04-06788 Gleason 7 Gleason pT3AN0R1 3 + 4 = 7 183 21.24 1236 10259 121054 85 T04-05303 Gleason 6 , 94 12.28 1080 789 9888 80 T04-00527 Gleason 9 , 184 3.9 1259 57 57 1000 T04-07087 Gleason 8 , 61 25.27 1013 587 4354 135 T03-13417 Gleason 7 ,

REFERENCES

[0263] 1. Jensen O M, Esteve J, Moller H, Renard H. Cancer in the European Community and its member states. Eur J Cancer 1990; 26:1167-256. [0264] 2. Beduschi M C, Oesterling J E. Percent free prostate-specific antigen: the next frontier in prostate-specific antigen testing. Urology 1998; 51:98-109. [0265] 3. Brawer M K, Chetner M P, Beatie J, Buchner D M, Vessella R L, Lange P H. Screening for prostatic carcinoma with prostate specific antigen. J Urol 1992; 147:841-5. [0266] 4. Catalona W J, Smith D S, Ratliff T L, Dodds K M, Coplen D E, Yuan J J et al. Measurement of prostate-specific antigen in serum as a screening test for prostate cancer. N Engl J Med 1991; 324:1156-61. [0267] 5. Brawer MK. Prostate-specific antigen. Semin Surg Oncol 2000; 18:3-9. [0268] 6. Nixon R G, Brawer MK. Enhancing the specificity of prostate-specific antigen (PSA): an overview of PSA density, velocity and age-specific reference ranges. Br J Urol 1997; 79 Suppl 1:61-7.:61-7. [0269] 7. Polascik T J, Oesterling J E, Partin A W. Prostate specific antigen: a decade of discoverywhat we have learned and where we are going. J Urol 1999; 162:293-306. [0270] 8. Kamoi K, Babaian R J. Advances in the application of prostate-specific antigen in the detection of early-stage prostate cancer. Semin Oncol 1999; 26:140-9. [0271] 9. Nixon R G, Brawer MK. Enhancing the specificity of prostate-specific antigen (PSA): an overview of PSA density, velocity and age-specific reference ranges. Br J Urol 1997; 79 Suppl 1:61-7.:61-7. [0272] 10. Ukimura O, Durrani O, Babaian R J. Role of PSA and its indices in determining the need for repeat prostate biopsies. Urology 1997; 50:66-72. [0273] 11. Mettlin C J, Murphy G P, Ho R, Menck H R. The National Cancer Data Base report on longitudinal observations on prostate cancer. Cancer 1996; 77:2162-6. [0274] 12. Murphy G P, Barren R J, Erickson S J, Bowes V A, Wolfert R L, Bartsch G et al. Evaluation and comparison of two new prostate carcinoma markers. Free-prostate specific antigen and prostate specific membrane antigen. Cancer 1996; 78:809-18. [0275] 13. Xu L L, Srikantan V, Sesterhenn I A, Augustus M, Dean R, Moul J W et al. Expression profile of an androgen regulated prostate specific homeobox gene NKX3.1 in primary prostate cancer. J Urol 2000; 163:972-9. [0276] 14. Gu Z, Thomas G, Yamashiro J, Shintaku I P, Dorey F, Raitano A et al. Prostate stem cell antigen (PSCA) expression increases with high gleason score, advanced stage and bone metastasis in prostate cancer. Oncogene 2000; 19:1288-96. [0277] 15. Sun Y, Lin J, Katz A E, Fisher P B. Human prostatic carcinoma oncogene PTI-1 is expressed in human tumor cell lines and prostate carcinoma patient blood samples. Cancer Res 1997; 57:18-23. [0278] 16. Srikantan V, Zou Z, Petrovics G, Xu L, Augustus M, Davis L et al. PCGEM1, a prostate-specific gene, is overexpressed in prostate cancer. Proc Natl Acad Sci USA 2000 Oct. 24; 97(22):12216-21 2001; 97:12216-21. [0279] 17. Oettgen P, Finger E, Sun Z, Akbarali Y, Thamrongsak U, Boltax J et al. PDEF, a novel prostate epithelium-specific ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. J Biol Chem 2000; 275:1216-25. [0280] 18. Lin B, Ferguson C, White J T, Wang S, Vessella R, True L D et al. Prostate-localized and androgen-regulated expression of the membrane-bound serine protease TMPRSS2. Cancer Res 1999; 59:4180-4. [0281] 19. Nelson P S, Gan L, Ferguson C, Moss P, Gelinas R, Hood L, Wang K. Molecular cloning and characterization of prostase, an androgen-regulated serine protease with prostate-restricted expression. Proc Natl Acad Sci USA 1999; 96:3114-9. [0282] 20. Bussemakers M J, van Bokhoven A, Verhaegh G W, Smit F P, Karthaus H F, Schalken J A et al. DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res 1999; 59:5975-9. [0283] 21. de Kok J B, Verhaegh G W, Roelofs R W, Hessels D, Kiemeney L A, Aalders T W et al. DD3(PCA3), a very sensitive and specific marker to detect prostate tumors. Cancer Res 2002; 62:2695-8. [0284] 22. Auffray C, Rougeon F. Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumor RNA. Eur J Biochem 1980; 107:303-14. [0285] 23. Ylikoski A, Sjoroos M, Lundwall A, Karp M, Lovgren T, Lilja H, Iitia A. Quantitative reverse transcription-PCR assay with an internal standard for the detection of prostate-specific antigen mRNA. Clin Chem 1999; 45:1397-407. [0286] 24. Raeymaekers L. Quantitative PCR: theoretical considerations with practical implications. Anal Biochem 1993; 214:582-5. [0287] 25. Grasso Y Z, Gupta M K, Levin H S, Zippe C D, Klein E A. Combined nested RT-PCR assay for prostate-specific antigen and prostate-specific membrane antigen in prostate cancer patients: correlation with pathological stage. Cancer Res 1998; 58:1456-9. [0288] 26. Ferrari A C, Stone N N, Eyler J N, Gao M, Mandeli J, Unger P et al. Prospective analysis of prostate-specific markers in pelvic lymph nodes of patients with high-risk prostate cancer. J Natl Cancer Inst 1997; 89:1498-504. [0289] 27. Goldman H B, Israeli R S, Lu Y, Lerner J L, Hollabaugh R S, Steiner M S. Can prostate-specific antigen reverse transcriptase-polymerase chain reaction be used as a prospective test to diagnose prostate cancer? World J Urol 1997; 15:257-61. [0290] 28. Katz A E, de Vries G M, Begg M D, Raffo A J, Cama C, O'Toole K et al. Enhanced reverse transcriptase-polymerase chain reaction for prostate specific antigen as an indicator of true pathologic stage in patients with prostate cancer. Cancer 1995; 75:1642-8. [0291] 29. Katz A E, Olsson C A, Raffo A J, Cama C, Perlman H, Seaman E et al. Molecular staging of prostate cancer with the use of an enhanced reverse transcriptase-PCR assay. Urology 1994; 43:765-75. [0292] 30. Smith M R, Biggar S, Hussain M. Prostate-specific antigen messenger RNA is expressed in non-prostate cells: implications for detection of micrometastases. Cancer Res 1995; 55:2640-4. [0293] 31. Lintula S, Stenman U H. The expression of prostate-specific membrane antigen in peripheral blood leukocytes. J Urol 1997; 157:1969-72. [0294] 32. Bustin S A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000; 25:169-93. [0295] 33. Bernard P S, Wittwer C T. Real-time PCR technology for cancer diagnostics. Clin Chem 2002; 48:1178-85. [0296] 34. Nurmi J, Wikman T, Karp M, Lovgren T. High-performance real-time quantitative RT-PCR using lanthanide probes and a dual-temperature hybridization assay. Anal Chem 2002; 74:3525-32. [0297] 35. Gibson U E, Heid C A, Williams P M. A novel method for real time quantitative RT-PCR. Genome Res 1996; 6:995-1001. [0298] 36. Paule M R, White R J. Survey and summary: transcription by RNA polymerases I and III. Nucleic Acids Res 2000; 28:1283-98. [0299] 37. Barbu V, Dautry F. Northern blot normalization with a 28S rRNA oligonucleotide probe. Nucleic Acids Res 1989; 17:7115. [0300] 38. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002; 3: RESEARCH0034. [0301] 39. Soini E, Lovgren T. Time-resolved fluorescence of lanthanide probes and applications in biotechnology. CRC Crit Rev Anal Chem 1987; 18:105-54. [0302] 40. Ylikoski A, Karp M, Lilja H, Lovgren T. Dual-label detection of amplified products in quantitative RT-PCR assay using lanthanide-labeled probes. Biotechniques 2001; 30:832-6, 838, 840.