Coronavirus vaccine

Abstract

The present invention is directed to a nucleic acid suitable for use in treatment or prophylaxis of an infection with a coronavirus, preferably with a Coronavirus SARS-CoV-2, or a disorder related to such an infection, preferably COVID-19. The present invention is also directed to compositions, polypeptides, and vaccines. The compositions and vaccines preferably comprise at least one of said nucleic acid sequences, preferably nucleic acid sequences in association a lipid nanoparticle (LNP). The invention is also directed to first and second medical uses of the nucleic acid, the composition, the polypeptide, the combination, the vaccine, and the kit, and to methods of treating or preventing a coronavirus infection, preferably a Coronavirus infection.

Claims

1. A composition comprising a mRNA comprising: (a) at least one coding sequence encoding a SARS-CoV-2 spike protein (S) at least 95% identical to SEQ ID NO: 10 that is a pre-fusion stabilized spike protein (S_stab) comprising K986P and V987P stabilizing mutations and H69del, V70del, S477N, T478K, E484A, N501Y, and D614G amino acid substitutions relative to SEQ ID NO: 10; (b) at least one heterologous untranslated region (UTR); and (c) at least one pharmaceutically acceptable carrier, wherein the mRNA is complexed or associated with lipid nanoparticles (LNP) and wherein the LNP comprises: (i) at least one cationic lipid; (ii) at least one neutral lipid; (iii) at least one steroid or steroid analogue; and (iv) at least one PEG-lipid, wherein (i) to (iv) are in a molar ratio of about 20-60% cationic lipid, 5-25% neutral lipid, 25-55% sterol, and 0.5-10% PEG-lipid.

2. The composition of claim 1, wherein the mRNA comprises at least one poly(A) sequence comprising 30 to 200 adenosine nucleotides and a 5′-cap structure.

3. The composition of claim 2, wherein the at least one PEG lipid is present in the LNP in a molar ratio of about 0.5% to 5%.

4. The composition of claim 1, wherein the at least one coding sequence of the mRNA has a G/C content of at least about 50%.

5. The composition of claim 1, wherein the mRNA comprises a sequence at least 80% identical to SEQ ID NO: 137.

6. The composition of claim 1, wherein the at least one heterologous untranslated region is selected from at least one heterologous 5′-UTR and/or at least one heterologous 3′-UTR.

7. The composition of claim 1, wherein the mRNA comprises a nucleotide analog.

8. The composition of claim 7, wherein the mRNA comprises a 1-methylpseudouridine substitution.

9. The composition of claim 8, wherein 100% of the uracil positions in the coding sequence are replaced with 1-methylpseudouridine.

10. The composition of claim 1, wherein the mRNA has an RNA integrity of at least about 50%.

11. The composition of claim 1, wherein the mRNA is a purified mRNA that has been purified by RP-HPLC and/or TFF.

12. The composition of claim 11, wherein the mRNA is a purified mRNA that hasbeen purified by RP-HPLC and/or TFF and comprises about 5%, 10%, or 20% less double stranded RNA side products as an RNA that has not been purified with RP-HPLC and/or TFF.

13. The composition of claim 1, further comprising a lyoprotectant, comprising sucrose.

14. The composition of claim 1, wherein at least 80% of the mRNA is intact at least about two weeks after storage as a liquid at temperatures of about 5° C.

15. The composition of claim 1, wherein the composition comprises less than about 20% free mRNA.

16. The composition of claim 1, wherein the LNPs have a mean diameter of from about 60 nm to 200 nm.

17. The composition of claim 1, wherein the composition has a lipid to RNA molar ratio (N/P ratio) of from about 2 to about 12.

18. The composition of claim 1, wherein the at least one coding sequence encoding a SARS-CoV-2 protein is at least 95% identical to SEQ ID NO: 10 and additionally comprises Y144del P681H, H655Y and Q493R amino acid changes relative to SEQ ID NO: 10.

19. The composition of claim 1, wherein the at least one coding sequence encoding a SARS-CoV-2 S protein is at least 95% identical to SEQ ID NO: 10 and additionally comprises a G446S and/or K417N amino acid change relative to SEQ ID NO: 10.

20. The composition of claim 9, wherein the LNP comprises: (i) at least one cationic lipid; (ii) at least one neutral lipid comprising 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); (iii) at least one sterol comprising cholesterol; and (iv) at least one PEG-lipid, wherein (i) to (iv) are in a molar ratio of about 45-65% cationic lipid, 5-25% neutral lipid, 25-55% sterol, and 0.5-5% PEG-lipid.

21. The composition of claim 20, wherein the at least one PEG-lipid comprises PEG-DMG or PEG-cDMA.

22. The composition of claim 21, wherein the at least one PEG-lipid comprises PEG-2000-DMG.

23. The composition of claim 22, wherein the composition has a lipid to RNA molar ratio (N/P ratio) of from about 2 to about 12.

24. The composition of claim 23, wherein the LNPs have a mean diameter of from about 60 nm to 200 nm.

25. The composition of claim 24, wherein the mRNA comprises at least one poly(A) sequence comprising 30 to 200 adenosine nucleotides and a 5′-cap structure.

26. A composition comprising a mRNA comprising: (a) at least one coding sequence encoding a SARS-CoV-2 spike protein (S) at least 90% identical to SEQ ID NO: 10 that is a pre-fusion stabilized spike protein (S_stab) comprising K986P and V987P stabilizing mutations and K417N, S477N, T478K, E484A, D614G, N501Y, P681H, H655Y and Q493R amino acid changes relative to SEQ ID NO: 10; (b) at least one heterologous untranslated region (UTR); and (c) at least one pharmaceutically acceptable carrier, wherein the mRNA is complexed or associated with lipid nanoparticles (LNP) and wherein the LNP comprises: (i) at least one cationic lipid; (ii) at least one neutral lipid; (iii) at least one steroid or steroid analogue; and (iv) at least one PEG-lipid, wherein (i) to (iv) are in a molar ratio of about 20-60% cationic lipid, 5-25% neutral lipid, 25-55% sterol, and 0.5-10% PEG-lipid.

27. A method of inducing an immune response against SARS-CoV-2 in a subject comprising administering to the subject an effective amount of a composition according to claim 20.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows that mRNA constructs encoding different SARS-CoV-2 S protein designs led to a detectable protein expression using an in vitro translation system. Further details provided in Example 2a and Table 5.

(2) FIG. 2 shows that mRNA constructs encoding different SARS-CoV-2 S protein designs are expressed on the cell surface of mammalian cells using FACS analysis. Further details provided in Example 2b and Table 6.

(3) FIG. 3 shows that mRNA constructs encoding different SARS-CoV-2 S proteins are expressed in mammalian cells using western blot analysis. Further details provided in Example 2c and Table 7.

(4) FIG. 4 shows significant IgG1 and IgG2a responses for group vaccinated with the mRNA vaccine encoding full length stabilized S protein. FIG. 4 shows comparable IgG1 response for the mRNA vaccine and the rec. SARS-CoV-S protein and higher IgG2a titers for the mRNA vaccine compared to the rec. SARS—CoV-S protein. IgG1 and IgG2a antibody titers assessed by ELISA using rec. SARS-CoV-2 S protein as a coating reagent. The experiment was performed as described in Example 5. Further construct details are provided in Table 10.

(5) FIGS. 5A-C show significant IgG1 and IgG2a responses for group vaccinated with the mRNA vaccine encoding full length stabilized S protein and full length wildtype S protein. FIG. 5 A shows comparable IgG1 response for both full length S protein designs and FIG. 5 B shows comparable IgG2a titers for both full length S protein designs. FIG. 5 C shows high and comparable virus neutralizing titers for both full-length S protein designs at day 42. The experiments were performed as described in Example 6. Further construct details are provided in Table 11.

(6) FIG. 6 shows that LNP formulated mRNA encoding full length stabilized S protein and full length S protein induces cellular immune responses in mice (CD8+ and/or CD4+ T cell responses), using an intracellular cytokine staining assay. Groups A-C LNP formulated mRNA encoding different full-length S protein designs; Group D negative control. Vaccination scheme see Table 11. Further details provided in Example 6.

(7) FIG. 7 shows innate immune responses after vaccination with LNP formulated mRNA encoding full-length S protein (S_stab) (group A). The dotted lines indicate the lower limit of detection. The experiment was performed as described in Example 7. Further construct details are provided in Table 12.

(8) FIG. 8A shows significant IgG1 and IgG2a responses for groups vaccinated with the mRNA vaccine encoding full length stabilized S protein. FIG. 8A shows high IgG1 responses and high IgG2a responses after first vaccination. Groups A-D: one vaccination with LNP formulated mRNA encoding full-length S protein (S_stab); Group I: adjuvanted recombinant spike protein and Group J: negative control. The experiments were performed as described in Example 7. Further construct details are provided in Table 12.

(9) FIG. 8B shows significant IgG1 and IgG2a responses for all groups vaccinated with the mRNA vaccine encoding full length stabilized S protein (s_stab). FIG. 8B (A) shows IgG1 response at day 28 (after first vaccination) and at day 35 (after second vaccination) and FIG. 8 B (B) shows IgG2a response at day 28 (after first vaccination) and at day 35 (after second vaccination). Groups A-H: LNP formulated full-length S protein mRNA with different vaccination intervals; Group I: adjuvanted recombinant spike protein and Group J: negative control. The experiments were performed as described in Example 7. Further construct details are provided in Table 12.

(10) FIGS. 9A-B show significant induction of virus neutralizing titers (VNT) for all groups vaccinated with the mRNA vaccine encoding full length stabilized S protein (S_stab). FIG. 9 A shows VNT at day 28 (after first vaccination) and at day 35 and at day 49 (FIG. 9B) (after second vaccination) Groups A-H: LNP formulated full length S protein mRNA with different vaccination intervals; Group I: adjuvanted recombinant spike protein and Group J: negative control. The experiments were performed as described in Example 7. Further construct details are provided in Table 12.

(11) FIG. 10 shows that LNP formulated mRNA encoding full length stabilized S protein (S_stab) induces cellular immune responses in mice (CD8+ and/or CD4+ T-cell responses) after second vaccination with different time intervals between prime and boost vaccination, using an intracellular cytokine staining assay. Groups A-H: LNP formulated full length S protein mRNA with different vaccination intervals; Group I: adjuvanted recombinant spike protein and Group J: negative control. The experiments were performed as described in Example 7. Further construct details are provided in Table 12.

(12) FIGS. 11A-G show significant antibody responses in rats for groups vaccinated with different doses of the mRNA vaccine encoding full length stabilized S protein (S_stab). FIG. 11 A shows high IgG1 responses for groups C-F, FIG. 11 B shows high IgG2a responses for groups D-F and FIG. 11 C shows high total IgG response for groups C-E. Groups B-F: different doses of LNP formulated full length S protein mRNA and group A: negative control. FIG. 11 D shows further increased IgG1 antibody responses and FIG. 11 E shows further increased IgG2a antibody titers for all groups after second vaccination at day 42. FIG. 11 F and G show that vaccination with mRNA full length S stabilized protein formulated in LNPs induced in rats dose dependent levels of VNTs. The experiments were performed as described in Example 8. Further construct details are provided in Table 13.

(13) FIGS. 12A-F show protection of hamsters from SARS-CoV-2 challenge vaccinated with different the inventive mRNA vaccine encoding full length stabilized S protein (S_stab). FIG. 12 A shows the induction of high total IgG antibodies for vaccinated groups E and F and FIG. 12 B shows the dose-dependent induction of VNTs upon one (day 28) or two vaccinations (day 42 and day 56). FIGS. 12 C-E show detectable levels of replication competent virus in throat swabs on days 56 to day 60 (FIG. 12 C), nasal turbinate on day 60 (FIG. 12 D) and lung tissues on day 60 (FIG. 12 F). Each dot represents an individual animal, bars depict the median. Statistical analysis was performed using Mann-Whitney testing. FIG. 12 F shows the protection of the respiratory tract of vaccinated hamsters from challenge infection in the absence of signs of vaccine enhanced disease. Histopathological analysis was performed on day 60, four days post challenge infection, on formalin-fixed, paraffin embedded tissues sections. Histopathological assessment scoring was performed according to severity of inspected parameter. Each dot represents an individual animal, bars depict the median, Statistical analysis was performed using Mann-Whitney testing. The experiments were performed as described in Example 9. Further details are provided in Table 14 and Table 15.

(14) FIGS. 13A-K show the results of a phase I clinical trial in healthy human subjects. In FIG. 13 A systemic adverse events are shown in the different dose cohorts after the first dose and after the second dose. In FIG. 13 B local adverse events are shown in the different dose cohorts after the first dose and after the second dose. In FIG. 13 C the specific systemic adverse events are shown, such as fatigue, headache, myalgia, chills, arthralgia, fever, nausea and diarrhea. In FIG. 13 D the specific local adverse events are shown, such as pain, itching, swelling and redness. In FIG. 13 E induction of Spike protein specific IgG antibodies on day 1, 29, 36, 43 and 57 is shown for the different dose cohorts. In the table of FIG. 13 E percentage of seroconversion of the vaccinated subjects is shown. In FIG. 13 F induction of RBD-specific IgG antibodies on day 1, 36, and 43 is shown for the different dose cohorts. In the table of FIG. 13 F percentage of seroconversion of the vaccinated subjects is shown. In FIG. 13 G induction of virus neutralizing antibodies is shown. In the table of FIG. 13 G percentage of seroconversion of the vaccinated subjects is shown. In FIG. 13 H the ratios of the level of Spike protein or RBD binding antibodies to the level of neutralizing antibodies are shown. FIG. 13 I shows induction of CD4+ T cells against Spike protein S1 after the first dose (day 29) and the second dose (day 36). FIG. 13 J shows induction of CD4+ T cells against Spike protein S2 after the first dose (day 29) and the second dose (day 36). In FIG. 13 K induction of virus neutralizing titers and RBD specific antibodies in SARS-CoV-2 seropositive subjects after vaccination with 2 μg and 4 μg CvnCoV is shown.

(15) FIGS. 14A-C show significant IgG1 and IgG2a responses after the vaccination with mRNA encoding full length S stabilized protein (S_stab) after a single vaccination (d21) and more increased after a second vaccination (d42) (FIG. 14 A). Vaccine composition comprising mRNA encoding SARS-CoV-2 S_stab comprising hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) (group C) shows an improved and stronger induction of binding antibodies (shown by IgG1 and IgG2a endpoint titers). The induction of VNT is shown in FIG. 14 B. Mice of group C showed an early increased level of VNTs already on d21 after first vaccination compared to group B. The induction of T-cell immunity is shown in FIG. 14 C. Vaccine composition comprising mRNA encoding SARS-CoV-2 S_stab comprising hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) (group C) shows surprisingly a ramarkable stronger induction of CD8.sup.+ IFNγ/TNF double positive T cells.

(16) FIGS. 15A-B show significant antibody responses in rats for groups vaccinated with different doses of the mRNA vaccine encoding full length stabilized S protein (S_stab) comprising the alternative non-coding region with 3′end hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) formulated in LNPs. FIG. 15 A shows a robust induction of IgG1 and IgG2a binding antibodies and FIG. 15 B the induction of VNTs in a dose-dependent manner. The experiments were performed as described in Example 12. Further construct details are provided in Table 17.

(17) FIGS. 16A-C show significant antibody responses in rats for groups vaccinated with different doses of the mRNA vaccine encoding full length stabilized S protein (S_stab) comprising different non-coding regions formulated in LNPs. FIG. 16 A shows a robust and dose-dependent induction of IgG1 and IgG2a binding antibodies and FIG. 16 B the early induction of VNTs after only one dose of vaccination in a dose-dependent manner for the mRNA vaccine encoding full length stabilized S protein (S_stab) comprising the non-coding region with 3′end hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) formulated in LNPs. FIG. 16 C shows the induction of VNTs after two doses of vaccination on day 42. The experiments were performed as described in Example 14. Further construct details are provided in Table 20.

(18) FIGS. 17A-D show that CVnCoV (mRNA vaccine encoding full length stabilized S protein (S_stab) formulated in LNPs) induces humoral response in non-human primates. (FIG. 17 A) Schematic drawing of study setup. Rhesus macaques (n=6; 3 male, 3 female/group) were vaccinated IM on day 0 and day 28 with 0.5 μg or 8 μg of CVnCoV or remained unvaccinated. All animals were challenge with 5.0×10.sup.6 PFU of SARS-CoV-2 on d56. Two animals of each group were terminated on d62, d63 and d64, respectively. (FIG. 17 B) Trimeric Spike protein or (FIG. 17 C) RBD specific binding IgG antibodies, displayed as endpoint titres at different time points as indicated. (FIG. 17 D) Virus neutralising antibodies determined via focus reduction neutralisation test at different time points as indicated. All values are displayed as median with range. Dotted lines represent vaccinations and challenge infection, respectively. RBD receptor binding domain; VNT virus neutralising titre. The experiment was performed as described in Example 15. Further construct details are provided in Table 21.

(19) FIGS. 18A-B show that CVnCoV (mRNA vaccine encoding full length stabilized S protein (S_stab) formulated in LNPs) induces cellular responses in non-human primates. PBMCs from 0.5 μg or 8 μg CVnCoV vaccinated or from untreated animals isolated at different time points were re-stimulated with S specific peptide pools ex vivo followed by IFNγ ELISpot analysis. (FIG. 18 A) IFNγ ELISpot before challenge infection on d56. Panel 1 represent results of stimulation with a single peptide pool covering the whole S protein, panels 2-4 depict stimulation results of ten individual pools covering the entire S protein in each group. (FIG. 18 B) IFNγ ELISpot until termination on d62-d64. Panel 1 represent results of stimulation with three megapools and shows the mummed response covering the whole S protein, panels 2-4 depict stimulation results of ten individual pools covering the entire S protein in each group. SFU spot forming unit; PP peptide pool. The experiment was performed as described in Example 15. Further construct details are provided in Table 21.

(20) FIGS. 19A-F show that CVnCoV (mRNA vaccine encoding full length stabilized S protein (S_stab) formulated in LNPs) protects non-human primates from challenge infection (FIG. 19 A) Nasal swabs taken at different time points post challenge (FIG. 19 B) in life BAL samples taken on d59 and at termination on d62-64 and (FIG. 19 C) lung tissue homogenates from d62-64 were analysed for copies of total viral RNA via RT-qPCR. (FIG. 19 D) Nasal swabs taken at different time points past challenge (FIG. 19 E) in life BAL samples taken on d59 and at termination on d62-64 and (FIG. 19 F) lung tissue homogenates from d62-64 were analysed for copies of subgenomic viral RNA via RT-qPCR. Values are depicted as medians with range. Lower and upper dotted lines represent LLOD and LLOQ, respectively. Kruskall-Wallis ANOVA followed by Dunn's test was used to compare groups and P values are shown. LLOD lower limit of detection, LLOQ lower limit of quantification, RT-qPCR Reverse transcription-quantitative polymerase chain reaction. The experiment was performed as described in Example 15. Further construct details are provided in Table 21.

(21) FIGS. 20A-1 show that CVnCoV (mRNA vaccine encoding full length stabilized S protein (S_stab) formulated in LNPs) protects non-human primates from challenge infection (FIG. 20 A) Throat swabs taken at different time points past challenge were analysed for copies of total viral RNA via RT-qPCR (FIG. 20 B) Throat swabs taken at different time points past challenge analysed for copies of subgenomic RNA via RT-qPCR. Homogenised tissue derived from (FIG. 20 C) tonsils (FIG. 20 D) trachea (FIG. 20 E) spleen (FIG. 20 F) duodenum (FIG. 20 G) colon (FIG. 20 H) liver (FIG. 20 I) kidney were analysed for copies of total viral RNA via RT-qPCR. (RT-qPCR Reverse transcription-quantitative polymerase chain reaction, sg subgenomic). The experiment was performed as described in Example 15. Further construct details are provided in Table 21.

(22) FIGS. 21A-F Exemplary sections showing histopathology (H&E) and SARS-CoV-2 in situ hybridisation (ISH). FIG. 21 A: Alveolar necrosis and inflammatory exudates (*) in the alveolar spaces and type II pneumocyte hyperplasia (arrows). FIG. 21 B: Mild perivascular cuffing (arrow). FIG. 21 C: Inflammatory cell infiltration in the alveolar spaces and the interalveolar septa (*) and type II pneumocyte hyperplasia (arrows). FIG. 21 D: SARS-CoV-2 ISH staining in abundant cell within inflammatory foci (arrows). FIG. 21 E: SARS-CoV-2 ISH staining in a single cell within an interalveolar septum (arrow). FIG. 21 F: Abundant foci of SARS-CoV-2 ISH stained cells within the alveolar lining and the interalveolar septa (arrows) (Bar=100 μm. ISH in situ hybridisations). The experiment was performed as described in Example 15. Further construct details are provided in Table 21.

(23) FIGS. 22A-D show that vaccination with 8 μg of CVnCoV (mRNA vaccine encoding full length stabilized S protein (S_stab) formulated in LNPs) protects the lungs from pathological changes upon viral challenge (FIG. 22 A) Heat map showing scores for each lung pathology parameter and the average score for each animal from all groups as indicated. Severity ranges from 0 to 4:0=none; 1=minimal; 2=mild; 3=moderate and 4=marked/severe. (FIG. 22 B) Graph representing the cumulative score for all the lung histopathology parameters from each animal. (FIG. 22 C) Presence of viral RNA in lung tissue sections from all animals expressed as percentage of ISH (RNAScope, in situ hybridisation) positive staining area of lung section. (FIG. 22 D) Cumulative score of lung pathology detected via CT radiology. Box and whiskers indicate median with range. Kruskall-Wallis ANOVA followed by Dunn's test was used to compare groups and P values are shown. The experiment was performed as described in Example 15. Further construct details are provided in Table 21.

(24) FIGS. 23A-C show induction of IFNa in human PBMCs (FIG. 23 A) stimulated with mRNA vaccine compositions. Induction of VNTs after one vaccination only (on day 21) and after two vaccination (on day 42) is shown in FIGS. 23 B and C. All of the mRNA vaccine compositions with mRNAs comprising a 3′ end “hSL-A100” or “A-100” (groups C-G, I-M) showed improved, early and strong induction of VNTs. In these constructs, the poly(A) sequence is located directly at the 3′ terminus of the RNA.

(25) FIGS. 24A-B FIG. 24 A shows the induction of VNTs after only one vaccination. mRNA vaccine compositions with mRNAs comprising a 3′ end “hSL-A100” or “A-100” showed improved, early and strong induction of VNTs. In these constructs, the poly(A) sequence is located directly at the 3′ terminus of the RNA. FIG. 24 B demonstrate the induction of VNTs after only one vaccination (group A-E) or after two vaccination (group F-J) at a later timepoint on day 42. mRNA vaccine composition comprising R9709 (group B) induced most prominent titers of VNTs between the groups receiving only one vaccination.

EXAMPLES

(26) In the following, particular examples illustrating various embodiments and aspects of the invention are presented. However, the present invention shall not to be limited in scope by the specific embodiments described herein. The following preparations and examples are given to enable those skilled in the art to more clearly understand and to practice the present invention. The present invention, however, is not limited in scope by the exemplified embodiments, which are intended as illustrations of single aspects of the invention only, and methods, which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those described herein will become readily apparent to those skilled in the art from the foregoing description, accompanying figures and the examples below. All such modifications fall within the scope of the appended claims.

Example 1: Preparation of DNA and RNA Constructs, Compositions, and Vaccines

(27) The present Example provides methods of obtaining the RNA of the invention as well as methods of generating a composition or a vaccine of the invention.

(28) 1.1. Preparation of DNA and RNA Constructs:

(29) DNA sequences encoding different SARS-CoV-2 S protein designs were prepared and used for subsequent RNA in vitro transcription reactions. Said DNA sequences were prepared by modifying the wild type or reference encoding DNA sequences by introducing a G/C optimized or modified coding sequence (e.g., “cds opt1”) for stabilization and expression optimization. Sequences were introduced into a pUC derived DNA vector to comprise stabilizing 3′-UTR sequences and 5′-UTR sequences, additionally comprising a stretch of adenosines (e.g. A64 or A100), and optionally a histone-stem-loop (hSL) structure, and optionally a stretch of 30 cytosines (e.g. C30) (see Table 4, for an overview of coronavirus antigen designs see List 1 or Table 1).

(30) The obtained plasmid DNA constructs were transformed and propagated in bacteria using common protocols known in the art. Eventually, the plasmid DNA constructs were extracted, purified, and used for subsequent RNA in vitro transcription (see section 1.2.).

(31) Alternatively, DNA plasmids can be used as template for PCR-amplification (see section 1.3.).

(32) 1.2. RNA In Vitro Transcription from Plasmid DNA Templates:

(33) DNA plasmids prepared according to section 1.1 were enzymatically linearized using a restriction enzyme and used for DNA dependent RNA in vitro transcription using T7 RNA polymerase in the presence of a nucleotide mixture (ATP/GTP/CTP/UTP) and cap analog (e.g. m7GpppG, m7G(5′)ppp(5′)(2′OMeA)pG,m7G(5′)ppp(5′)(2′OMeG)pG), or 3′OMe-m7G(5′)ppp(5′)(2′OMeA)pG.) under suitable buffer conditions.. The obtained RNA constructs were purified using RP-HPLC (PureMessenger®, CureVac AG, Tübingen, Germany; WO2008/077592) and used for in vitro and in vivo experiments. DNA templates may also be generated using PCR. Such PCR templates can be used for DNA dependent RNA in vitro transcription using an RNA polymerase as outlined herein.

(34) To obtain chemically modified mRNA, RNA in vitro transcription was performed in the presence of a modified nucleotide mixture comprising pseudouridine N(1)-methylpseudouridine (m1ψ) instead of uracil. The obtained ml P chemically modified RNA was purified using RP-HPLC (PureMessenger®, CureVac AG, Tübingen, Germany; WO2008/077592) and used for further experiments (see e.g. Example 16 or 17).

(35) Generation of Capped RNA Using Enzymatic Capping (Prophetic):

(36) Some RNA constructs are in vitro transcribed in the absence of a cap analog. The cap-structure (cap0 or cap1) is then added enzymatically using capping enzymes as commonly known in the art. In short, in vitro transcribed RNA is capped using a capping kit to obtain cap0-RNA. cap0-RNA is additionally modified using cap specific 2′-O-methyltransferase to obtain cap1-RNA. cap1-RNA is purified e.g. as explained above and used for further experiments.

(37) RNA for clinical development is produced under current good manufacturing practice e.g. according to WO2016/180430, implementing various quality control steps on DNA and RNA level.

(38) The RNA Constructs of the Examples:

(39) The generated RNA sequences/constructs are provided in Table 4 with the encoded antigenic protein and the respective UTR elements indicated therein. If not indicated otherwise, the RNA sequences/constructs of Table 4 have been produced using RNA in vitro transcription in the presence of a m7GpppG, m7G(5′)ppp(5′)(2′OMeA)pG; accordingly, the RNA sequences/constructs comprise a 5′ Cap1 structure. If not indicated otherwise, the RNA sequences/constructs of Table 4 have been produced in the absence of chemically modified nucleotides (e.g. pseudouridine (ψ) or N(1)-methylpseudouridine (m1ψ)).

(40) 1.3. RNA In Vitro Transcription from PCR Amplified DNA Templates (Prophetic):

(41) Purified PCR amplified DNA templates prepared according to paragraph 1.1 is transcribed in vitro using DNA dependent T7 RNA polymerase in the presence of a nucleotide mixture (ATP/GTP/CTP/UTP) and cap analog (m7GpppG or 3′-O-Me-m7G(5′)ppp(5′)G)) under suitable buffer conditions. Alternatively, PCR amplified DNA is transcribed in vitro using DNA dependent T7 RNA polymerase in the presence of a modified nucleotide mixture (ATP, GTP, CTP, N1-methylpseudouridine (m1ψ) or pseudouridine (ψ) and cap analogue (m7GpppG, m7G(5′)ppp(5′)(2′OMeA)pG or m7G(5′)ppp(5′)(2′OMeG)pG) under suitable buffer conditions. Some RNA constructs are in vitro transcribed in the absence of a cap analog and the cap-structure (cap0 or cap1) is added enzymatically using capping enzymes as commonly known in the art. The obtained RNA is purified e.g. as explained above and used for further experiments. The obtained mRNAs are purified e.g. using RP-HPLC (PureMessenger®, CureVac AG, Tübingen, Germany; WO2008/077592) and used for in vitro and in vivo experiments.

(42) TABLE-US-00007 TABLE 4 RNA constructs encoding different SARS-CoV-2 S antigen designs 5′-UTR/ 3′-UTR; SEQ ID SEQ ID SEQ ID CDS UTR NO: NO: NO: RNA ID Name Short name opt. Design 3′-end Protein CDS RNA R9488, Spike S opt1 H5D17B4/ hSL-A100 1 136 148 R9492, protein (gc) PSMB3; R10161* a-1 R9514 Spike S opt1 -/muag; A64-N5- 1 136 162 protein (gc) i-3 C30-hSL- N5 R9487, Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 10 137 149 R9491, fusion (K986P_V987P) (gc) PSMB3; R9709, stabilized a-1 R10159**, protein R10160* R9515, Spike pre- S_stab_PP opt1 -/muag; A64-N5- 10 137 163 R10157** fusion (K986P_V987P) (gc) i-3 C30-hSL- stabilized N5 protein R9486, Spike pre- S_stab_PP opt3 HSD17B4/ hSL-A100 10 142 150 R9490 fusion (K986P_V987P) (human) PSMB3; stabilized a-1 protein R9517 Spike pre- S_stab_PP opt3 -/muag; A64-N5- 10 142 164 fusion (K986P_V987P) (human) i-3 C30-hSL- stabilized N5 protein R9519 Spike pre- S_stab_PP opt10 -/muag; A64-N5- 10 146 165 fusion (K986P_V987P) (gc i-3 C30-hSL- stabilized mod) N5 protein R9489, S fragment S1 opt1 HSD17B4/ hSL-A100 27 138 152 R9493 (1-681) (gc) PSMB3; spike a-1 protein R9506, S fragment S1 opt1 -/muag; A64-N5- 27 138 166 R9513 (1-681) (gc) i-3 C30-hSL- spike N5 protein R9516 S fragment S1 opt3 -/muag; A64-N5- 27 143 167 (1-681) (human) 1-3 C30-hSL- spike N5 protein R9518 S fragment S1 opt10 -/muag; A64-N5- 27 147 168 (1-681) (gc i-3 C30-hSL- spike mod) N5 protein R9561 Spike pre- S_stab_disul opt1 -/muag; A64-N5- 21 11804 12816 fusion (P715C_P1069C) (gc) i-3 C30-hSL- stabilized N5 protein R9564 Spike pre- S_stab_disul opt1 -/muag; A64-N5- 22 11805 12817 fusion (G889C_L1034C) (gc) i-3 C30-hSL- stabilized N5 protein R9562 Spike pre- S_stab_disul opt1 -/muag; A64-N5- 25 11808 12820 fusion (F970C_G999C) (gc) i-3 C30-hSL- stabilized N5 protein R9560 Spike pre- S_stab_disul opt1 -/muag; A64-N5- 1145 11810 12822 fusion (A890C_V1040C) (gc) i-3 C30-hSL- stabilized N5 protein R9563 Spike pre- S_stab_disul opt1 -/muag; A64-N5- 1212 11811 12823 fusion (T874C_S1055C) (gc) i-3 C30-hSL- stabilized N5 protein R9641 Spike pre- S_stab_PP_cav opt1 -/muag; A64-N5- 408 11799 12811 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized T887W_A1020W) N5 protein R9660 Spike pre- S_stab_PP_cav opt1 -/muag; A64-N5- 475 11800 12812 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized P1069F) N5 protein R9661 Spike pre- S_stab_PP_prot opt1 -/muag; A64-N5- 542 11801 12813 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized H1048Q_H1064N_ N5 protein H1083N_H1101N) R9663 Spike pre- S_stab_PP_ opt1 -/muag; A64-N5- 10726 11953 12931 fusion delTMflex_WhcAg (gc) i-3 C30-hSL- stabilized (K986P_V987P) N5 protein R9664 Spike pre- S_stab_PP_ opt1 -/muag; A64-N5- 8716 11923 12901 fusion delTMflex_Ferritin (gc) i-3 C30-hSL- stabilized (K986P_V987P) N5 protein R9848 Spike pre- S_stab_PP_hex opt1 -/muag; A64-N5- 22732 22759 22813 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized F817P_A892P_ N5 protein A899P_A942P) R9926 RBD RBD_Foldon opt1 -/muag; A64-N5- 22734 22761 22815 fragment (gc) i-3 C30-hSL- (334-528) N5 spike protein R9927 RBD RBD_Foldon opt1 HSD17B4/ hSL-A100 22734 22761 22788 fragment (gc) PSMB3; (334-528) a-1 spike protein R10335 RBD RBD_LumSynth opt1 -/muag; A64-N5- 22735 22762 22816 fragment (gc) i-3 C30-hSL- (334-528) N5 spike protein R10338 RBD RBD_LumSynth opt1 HSD17B4/ hSL-A100 22735 22762 22789 fragment (gc) PSMB3; (334-528) a-1 spike protein R10336 RBD LumSynth_RBD opt1 -/muag; A64-N5- 22736 22763 22817 fragment (gc) i-3 C30-hSL- (334-528) N5 spike protein R10339 RBD LumSynth_RBD opt1 HSD17B4/ hSL-A100 22736 22763 22790 fragment (gc) PSMB3; (334-528) a-1 spike protein R10337 RBD RBD_Ferritin opt1 -/muag; A64-N5- 22733 22760 22814 fragment (gc) i-3 C30-hSL- (334-528) N5 spike protein R10340 RBD RBD_Ferritin opt1 HSD17B4/ hSL-A100 22733 22760 22787 fragment (gc) PSMB3; (334-528) a-1 spike protein R10182 S(D614G) S (D614G) opt1 HSD17B4/ hSL-A100 22737 22764 22791 (gc) PSMB3; a-1 R10165 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22738 22765 22819 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized D614G) N5 protein R10166 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22738 22765 22792 fusion (K986P_V987P_ (gc) PSMB3; stabilized D614G) a-1 protein R10276 Spike S opt1 -/muag; A64-N5- 22739 22766 22820 protein (A222V_D614G) (gc) i-3 C30-hSL- N5 R10278 Spike S opt1 HSD17B4/ hSL-A100 22739 22766 22793 protein (A222V_D614G) (gc) PSMB3; a-1 R10277 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22740 22767 22821 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized A222V_D614G) N5 protein R10279 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22740 22767 22794 fusion (K986P_V987P_ (gc) PSMB3; stabilized A222V_D614G) a-1 protein R10296 Spike S opt1 -/muag; A64-N5- 22741 22768 22822 protein (N439K_D614G) (gc) i-3 C30-hSL- N5 R10298 Spike S opt1 HSD17B4/ hSL-A100 22741 22768 22795 protein (N439K_D614G) (gc) PSMB3; a-1 R10297 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22742 22769 22823 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized N439K_D614G) N5 protein R10299 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22742 22769 22796 fusion (K986P_V987P_ (gc) PSMB3; stabilized N439K_D614G) a-1 protein R10284 Spike S opt1 -/muag; A64-N5- 22743 22770 22824 protein (S477N_D614G) (gc) i-3 C30-hSL- N5 R10287 Spike S opt1 HSD17B4/ hSL-A100 22743 22770 22797 protein (S477N_D614G) (gc) PSMB3; a-1 R10285 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22744 22771 22825 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized S477N_D614G) N5 protein R10286 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22744 22771 22798 fusion (K986P_V987P_ (gc) PSMB3; stabilized S477N_D614G) a-1 protein R10350 Spike S opt1 -/muag; A64-N5- 22745 22772 22826 protein (N501Y_D614G) (gc) i-3 C30-hSL- N5 R10351 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22746 22773 22827 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized N501Y_D614G) N5 protein R10272 Spike S (H69del_V70del_ opt1 -/muag; A64-N5- 22747 22774 22828 protein D614G) (gc) i-3 C30-hSL- N5 R10274 Spike S (H69del_V70del_ opt1 HSD17B4/ hSL-A100 22747 22774 22801 protein D614G) (gc) PSMB3; a-1 R10273 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22748 22775 22829 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized H69del_V70del_ N5 protein D614G) R10275 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22748 22775 22802 fusion (K986P_V987P_ (gc) PSMB3; stabilized H69del_V70del_ a-1 protein D614G) R10280 Spike S opt1 -/muag; A64-N5- 22749 22776 22830 protein (Y453F_D614G) (gc) i-3 C30-hSL- N5 R10282 Spike S opt1 HSD17B4/ hSL-A100 22749 22776 22803 protein (Y453F_D614G) (gc) PSMB3; a-1 R10281 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22750 22777 22831 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized Y453F_D614G) N5 protein R10283 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22750 22777 22804 fusion (K986P_V987P_ (gc) PSMB3; stabilized Y453F_D614G) a-1 protein R10288 Spike S (D614G_I692V) opt1 -/muag; A64-N5- 22751 22778 22832 protein (gc) i-3 C30-hSL- N5 R10290 Spike S (D614G_I692V) opt1 HSD17B4/ hSL-A100 22751 22778 22805 protein (gc) PSMB3; a-1 R10289 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22752 22779 22833 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized D614G_I692V) N5 protein R10291 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22752 22779 22806 fusion (K986P_V987P_ (gc) PSMB3; stabilized D614G_I692V) a-1 protein R10344 Spike S opt1 -/muag; A64-N5- 22753 22780 22834 protein (D614G_M1229I) (gc) i-3 C30-hSL- N5 R10345 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22754 22781 22835 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized D614G_M1229I) N5 protein R10292 Spike S (H69del_V70del_ opt1 -/muag; A64-N5- 22755 22782 22836 protein A222V_Y453F_ (gc) i-3 C30-hSL- S477N_D614G_ N5 I692V) R10294 Spike S (H69del_V70del_ opt1 HSD17B4/ hSL-A100 22755 22782 22809 protein A222V_Y453F_ (gc) PSMB3; S477N_D614G_ a-1 I692V) R10293 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22756 22783 22837 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized H69del_V70del_ N5 protein A222V_Y453F_ S477N_D614G_ I692V) R10295 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22756 22783 22810 fusion (K986P_V987P_ (gc) PSMB3; stabilized H69del_V70del_ a-1 protein A222V_Y453F_ S477N_D614G I692V) R10346 Spike S (H69del_V70del_ opt1 -/muag; A64-N5- 22757 22784 22838 protein Y453F_D614G_ (gc) i-3 C30-hSL- I692V_M1229I) N5 R10347 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22758 22785 22839 fusion (K986P_V987P_ (gc) i-3 C30-hSL- stabilized H69del_V70del_ N5 protein Y453F_D614G_ I692V_M1229I) R10136, Spike pre- S_stab_PP opt1 -/muag; hSL-A100 10 137 24397 R10158** fusion (K986P_V987P) (gc) i-3 stabilized protein R10154 Spike pre- S_stab_PP opt1 -/muag; A100 10 137 25717 fusion (K986P_V987P) (gc) i-3 stabilized protein R10153 Spike pre- S_stab_PP opt1 H5D17B4/ A100 10 137 24837 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10155 Spike pre- S_stab_PP opt1 Rpl31/ hSL-A100 10 137 23957 fusion (K986P_V987P) (gc) RPS9; e-2 stabilized protein R10156 Spike pre- S_stab_PP opt1 Rpl31/ A100 10 137 25277 fusion (K986P_V987P) (gc) RPS9; e-2 stabilized protein R10183 Spike pre- S_stab_PP opt1 Slc7a3/ hSL-A100 10 137 23737 fusion (K986P_V987P) (gc) PSMB3; stabilized a-3 protein R10184 Spike pre- S_stab_PP opt1 Slc7a3/ A100 10 137 25057 fusion (K986P_V987P) (gc) PSMB3; stabilized a-3 protein R10300 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A25 10 137 26925 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10301 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A60 10 137 26926 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10302 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A80 10 137 26927 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10303 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A90 10 137 26928 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10304 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A110 10 137 26929 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10305 Spike pre- S_stab_PP opt1 H5D17B4/ hSL-A120 10 137 26930 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10306 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A140 10 137 26931 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10307 Spike pre- S_stab_PP opt1 HSD17B4/ hSL 10 137 26932 fusion (K986P_V987P) (gc) PSMB3; stabilized a-1 protein R10308 Spike pre- S_stab_PP opt1 -/muag; A50-N5- 10 137 26933 fusion (K986P_V987P) (gc) i-3 C30-hSL- stabilized N5 protein R10309 Spike pre- S_stab_PP opt1 -/muag; A35-N5- 10 137 26934 fusion (K986P_V987P) (gc) i-3 C30-hSL- stabilized N5 protein R10310 Spike pre- S_stab_PP opt1 -/muag; A25-N5- 10 137 26935 fusion (K986P_V987P) (gc) i-3 C30-hSL- stabilized N5 protein R10311 Spike pre- S_stab_PP opt1 -/muag; A73-N5- 10 137 26936 fusion (K986P_V987P) (gc) i-3 C30-hSL- stabilized N5 protein R10312 Spike pre- S_stab_PP opt1 -/muag; hSL-N5 10 137 26937 fusion (K986P_V987P) (gc) i-3 stabilized protein R10162** Spike pre- S_stab_PP opt10 HSD17B4/ hSL-A100 10 146 151 fusion (K986P_V987P) (gc PSMB3; stabilized mod) a-1 protein R10352 Spike S opt1 -/muag; A64-N5- 22941 22981 23201 protein (H69del_V70del_ (gc) i-3 C30-hSL- Y144del_N501Y_ N5 A570D_D614G_P 681H_T7161_S98 2A_D1118H) R10356 Spike S opt1 HSD17B4/ hSL-A100 22941 22981 23421 protein (H69del_V70del_ (gc) PSMB3; Y144del_N501Y_ a-1 A570D_D614G_P 681H_T7161_S98 2A_D1118H) R10353 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22959 23089 23309 fusion (K986P_V987P_H (gc) i-3 C30-hSL- stabilized 69del_V70del_Y1 N5 protein 44del_N501Y_A5 70D_D614G_P68 1H_T7161_S982A_ D1118H) R10357 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22959 23089 23529 fusion (K986P_V987P_H (gc) PSMB3; stabilized 69de1_V70del_Y1 a-1 protein 44de1 N501Y_A5 70D_D614G_P68 1H_T7161_S982A_ D1118H) R10358 Spike S opt1 -/muag; A64-N5- 22942 22982 23202 protein (K417N_E484K_N (gc) i-3 C30-hSL- 501Y_D614G) N5 R10359 Spike S opt1 HSD17B4/ hSL-A100 22942 22982 23422 protein (K417N_E484K_N (gc) PSMB3; 501Y_D614G) a-1 R10360 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22960 23090 23310 fusion (K986P_V987P_K (gc) i-3 C30-hSL- stabilized 417N_E484K_N5 N5 protein 01Y_D614G) R10361 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22960 23090 23530 fusion (K986P_V987P_K (gc) PSMB3; stabilized 417N_E484K_N5 a-1 protein 01Y_D614G) R10379 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22961 23091 23311 fusion (K986P_V987P_L (gc) i-3 C30-hSL- stabilized 18F_D80A_D215 N5 protein G_L242del_A243 del_L244del_R24 6I_K417N_E484K_ N501Y_D614G_ A701V) R10384 Spike pre- S_stab_PP opt1 H5D17B4/ hSL-A100 22961 23091 23531 fusion (K986P_V987P_L (gc) PSMB3; stabilized 18F_D80A_D215 a-1 protein G_L242del_A243 del_L244del_R24 6I_K417N_E484K_ N501Y_D614G_ A701V) R10378 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22962 23092 23312 fusion (K986P_V987P_E (gc) i-3 C30-hSL- stabilized 484K_D614G) N5 protein R10380 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22963 23093 23313 fusion (K986P_V987P_L (gc) i-3 C30-hSL- stabilized 18F_T20N_P26S_ N5 protein D138Y_R190S_ K417T_E484K_N 501Y_D614G_H6 55Y_T1027I) R10385 Spike pre- S_stab_PP opt1 HSD17B4/ hSL-A100 22963 23093 23533 fusion (K986P_V987P_L (gc) PSMB3; stabilized 18F_T20N_P26S_ a-1 protein D138Y_R190S_ K417T_E484K_N 501Y_D614G_H6 55Y_T10271) R10381 Spike pre- S_stab_PP opt1 -/muag; A64-N5- 22964 23094 23314 fusion (K986P_V987P_S (gc) i-3 C30-hSL- stabilized 13I_W1520_L452 N5 protein R_D614G) *mRNA R10160 and R10161 were produced with 3′OME Clean Cap. **mRNA R10157, R10158, R10159, R10162 were produced with N(1)-methylpseudouridine (m1ψ)
1.4. Preparation of an LNP Formulated mRNA Composition:

(43) LNPs were prepared using cationic lipids, structural lipids, a PEG-lipids, and cholesterol. Lipid solution (in ethanol) was mixed with RNA solution (aqueous buffer) using a microfluidic mixing device. Obtained LNPs were re-buffered in a carbohydrate buffer via dialysis, and up-concentrated to a target concentration using ultracentrifugation tubes. LNP-formulated mRNA was stored at −80° C. prior to use in in vitro or in vivo experiments.

(44) Preferably, lipid nanoparticles were prepared and tested according to the general procedures described in POT Pub. Nos. WO 2015/199952, WO 2017/004143 and WO 2017/075531, the full disclosures of which are incorporated herein by reference. Lipid nanoparticle (LNP)-formulated mRNA was prepared using an ionizable amino lipid (cationic lipid), phospholipid, cholesterol and a PEGylated lipid. LNPs were prepared as follows. Cationic lipid according to formula III-3 (ALC-0315), DSPC, cholesterol and PEG-lipid according to formula IVa (ALC-0159) were solubilized in ethanol at a molar ratio of approximately 47.5:10:40.8:1.7 (see Table A). Lipid nanoparticles (LNP) comprising compound III-3 were prepared at a ratio of mRNA (sequences see Table 4) to Total Lipid of 0.03-0.04 w/w. Briefly, the mRNA was diluted to 0.05 to 0.2 mg/mL in 10 to 50 mM citrate buffer, pH 4. Syringe pumps were used to mix the ethanolic lipid solution with the mRNA aqueous solution at a ratio of about 1:5 to 1:3 (vol/vol) with total flow rates above 15 ml/min. The ethanol was then removed and the external buffer replaced with PBS by dialysis. Finally, the lipid nanoparticles were filtered through a 0.2 μm pore sterile filter. Lipid nanoparticle particle diameter size was 60-90 nm as determined by quasi-elastic light scattering using a Malvern Zetasizer Nano (Malvern, UK).

(45) TABLE-US-00008 TABLE A Lipid-based carrier composition of the examples Compounds Ratio (mol %) Structure Mass 1 Cholesterol 40.9 embedded image 386.4 2 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC) 10 0 789.6 3 Cationic Lipid 47.4 765.7 4 PEG Lipid 1.7 2010.1
1.5. Preparation of a Protamine Complexed mRNA Composition (Prophetic):

(46) RNA constructs are complexed with protamine prior to use in in vivo immunization experiments. The RNA formulation consists of a mixture of 50% free RNA and 50% RNA complexed with protamine at a weight ratio of 2:1. First, mRNA is complexed with protamine by addition of protamine-Ringer's lactate solution to mRNA. After incubation for 10 minutes, when the complexes are stably generated, free mRNA is added, and the final concentration is adjusted with Ringer's lactate solution.

(47) 1.6. Expression Analysis of Designed mRNA Constructs:

(48) The mRNA constructs as shown in Table 4 were tested for their expression via in vitro translation using Rabbit Reticulocte Lysate System as well as in cell culture followed by detection via western blot, or FACS analysis as commonly known in the art (see for further details and exemplary results Example 2).

Example 2a: Expression Analysis of mRNA Constructs Encoding SARS-CoV-2 Proteins (S, S_Stab, S1)

(49) To determine in vitro protein expression of the mRNA constructs, the constructs encoding SARS-CoV-2 Spike proteins or fragments (S, S_stab, S1) were mixed with components of Promega Rabbit Reticulocyte Lysate System according to manufacturer's protocol. The lysate contains the cellular components necessary for protein synthesis (tRNA, ribosomes, amino acids, initiation, elongation and termination factors). As positive control, Luciferase RNA from Lysate System Kit was used. The translation result was analyzed by SDS-Page and Western Blot analysis (IRDye 800CW streptavidin antibody (1:2000)). Table 5 summarizes the tested RNA constructs.

(50) TABLE-US-00009 TABLE 5 Overview of mRNA constructs used in Example 2a SEQ Short CDS mRNA ID NO: Lane Name name opt. ID RNA 1 Spike protein S opt1 R9514 162, 12743 2 Spike pre-fusion S_stab opt10 R9519 165, 13013 stabilized protein 3 Spike pre-fusion S_stab opt1 R9515 163, 12810 stabilized protein 4 S fragment (1-681) S1 opt10 R9518 168, 13027 spike protein 5 S fragment (1-681) S1 opt1 R9513 166, 12824 spike protein 6 RNAse free water 7 Positive control, control RNA from Lysate System Kit
Results:

(51) As shown in FIG. 1 the used mRNA constructs led to a detectable protein expression of the expected size (S or S_stab: 140 kDa, S1: 75 kDa), which is a prerequisite for an mRNA-based SARS-CoV-2 vaccine.

Example 2b: Expression of SARS-CoV-2 Proteins (S, S_Stab, S1) in HeLa Cells and Analysis by FACS

(52) To determine in vitro protein expression of the mRNA constructs, HeLa cells were transiently transfected with mRNA encoding SARS-CoV-2 proteins (S, S_stab, S1) and stained using suitable anti-spike protein antibodies (raised in mouse), counterstained with a FITC-coupled secondary antibody. HeLa cells were seeded in a 6-well plate at a density of 400,000 cells/well in cell culture medium (RPMI, 10% FCS, 1% L-Glutamine, 1% Pen/Strep), 24h prior to transfection. HeLa cells were transfected with 2 μg unformulated mRNA using Lipofectamine 2000 (Invitrogen). The mRNA constructs prepared according to Example 1 and listed in Table 6 were used in the experiment, including a negative control (water for injection). 24 hours post transfection, HeLa cells were stained with suitable anti-spike protein (S specific antibodies raised against SARS S, cross-reactive against SARS-Cov-2 S) antibodies (raised in mouse; 1:250) and anti-mouse FITC labelled secondary antibody (1:500) and subsequently were analyzed by flow cytometry (FACS) on a BD FACS Canto II using the FACS Diva software. Quantitative analysis of the fluorescent FITC signal was performed using the FlowJo software package (Tree Star, Inc.).

(53) TABLE-US-00010 TABLE 6 Overview of mRNA constructs used in Example 2b Short CDS mRNA SEQ ID Lane Name name opt. ID NO: RNA 1 Spike protein S opt1 R9514 162, 12743 2 Spike pre-fusion S_stab opt1 R9515 163, 12810 stabilized protein 3 Spike pre-fusion S_stab opt10 R9519 165, 13013 stabilized protein 4 S fragment (1-681) S1 opt1 R9513 166, 12824 spike protein 5 S fragment (1-681) S1 opt10 R9518 168, 13027 spike protein 6 RNAse free water
Results:

(54) As shown in FIG. 2 the used mRNA constructs led to a detectable cell surface expression for full length S (S and S_stab). Since the S1 fragments lack a transmembrane domain, their expression is not detectable on the cell surface (FIG. 2).

Example 2c: Expression Analysis of SARS-CoV-2 Proteins (S, S_Stab, S1) Using Western Blot

(55) For the analysis of SARS-CoV-2 S expression, HeLa cells were transfected with unformulated mRNA using Lipofectamine as the transfection agent. HeLa cells were seeded in a 6-well plate at a density of 300,000 cells/well. HeLa cells were transfected with 2 μg unformulated mRNA using Lipofectamine 2000 (Invitrogen). The mRNA constructs prepared according to Example 1 and listed in Table 7 were used in the experiment, including a negative control (water for injection). 24h post transfection, HeLa cells are detached by trypsin-free/EDTA buffer, harvested, and cell lysates are prepared. Cell lysates were subjected to SDS-PAGE followed by western blot detection. Western blot analysis was performed using an anti-spike protein (SARS S, cross-reactive against SARS-CoV-2 S) antibody used in combination with a suitable secondary antibody.

(56) TABLE-US-00011 TABLE 7 Overview of mRNA constructs used in Example 2c Short CDS mRNA SEQ ID Lane Name name opt. ID NO: RNA 1 S fragment (1-681) S1 opt1 R9513 166, 12824 spike protein 2 Spike protein S opt1 R9514 162, 12743 3 S fragment (1-681) S1 opt10 R9518 168, 13027 spike protein 4 Spike pre-fusion S_stab opt10 R9519 165, 13013 stabilized protein 5 Spike pre-fusion S_stab opt1 R9515 163, 12810 stabilized protein 6 RNAse free water
Results:

(57) Expression was detectable for all analyzed mRNAs in cell lysates (FIG. 3), full length S: expected size 140 kDa, two main bands of approx. 90 kDA and 180 kDa, likely reflecting glycosylated forms of unprocessed S protein (S0) and the cleaved S2 subunit, S1: 70 kDa, likely glycosylated).

Example 3: Vaccination of Mice with mRNA Encoding SARS-CoV-2 Protein Designs Antigens (S, S_Stab)

(58) Preparation of LNP Formulated mRNA Vaccine:

(59) SARS-CoV-2mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA is formulated with LNPs according to Example 1.4 prior to use in in vivo vaccination experiments.

(60) Immunization:

(61) Female BALB/c mice (6-8 weeks old) are injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 5. As a negative control, one group of mice is vaccinated with buffer. All animals are vaccinated on day 0 and 21. Blood samples are collected on day 21 (post prime) and 42 (post boost) for the determination of antibody titers.

(62) TABLE-US-00012 TABLE 8 Vaccination regimen (Example 3): CDS SARS-CoV-2 spike protein optimi- Formu- Group SEQ ID NO: zation lation Dose 1 S opt1 LNP 5 μg SEQ ID NO: 148, 155, 162, or 169 2 S opt1 LNP 2.5 μg SEQ ID NO: 148, 155, 162, or 169 3 S opt1 LNP 1.25 μg SEQ ID NO: 148, 155, 162, or 169 4 S stabilized (S_stab) opt1 LNP 5 μg SEQ ID NO: 149, 156, 163, or 170 5 S stabilized (S_stab) opt1 LNP 2.5 μg SEQ ID NO: 149, 156, 163, or 170 6 S stabilized (S_stab) opt1 LNP 1.25 μg SEQ ID NO: 149, 156, 163, or 170 7 S stabilized (S_stab) opt3 LNP 5 μg SEQ ID NO: 150, 157, 164, or 171 8 S stabilized (S_stab) opt3 LNP 2.5 μg SEQ ID NO: 150, 157, 164, or 171 9 S stabilized (S_stab) opt3 LNP 1.25 μg SEQ ID NO: 150, 157, 164, or 171 7 S stabilized (S_stab) opt10 LNP 5 μg SEQ ID NO: 151, 158, 165, or 172 8 S stabilized (S_stab) opt10 LNP 2.5 μg SEQ ID NO: 151, 158, 165, or 172 9 S stabilized (S_stab) opt10 LNP 1.25 μg SEQ ID NO: 151, 158, 165, or 172 10 buffer
Determination of IqG1 and IgG2 Antibody Titers Using ELISA:

(63) ELISA is performed using recombinant SARS-CoV-2 S (extracellular domain) protein for coating. Coated plates are incubated using respective serum dilutions, and binding of specific antibodies to the SARS-CoV-2 S are detected using biotinylated isotype specific anti-mouse antibodies followed by streptavidin-HRP (horse radish peroxidase) with Amplex as substrate. Endpoint titers of antibodies (IgG1, IgG2a) are measured by ELISA on day 21, and 42 post vaccinations.

(64) Detection of Spike Protein-Specific Immune Responses:

(65) Hela cells are transfected with 2 μg of mRNA encoding spike protein using lipofectamine. The cells are harvested 20h post transfection, and seeded at 1×105 per well into a 96 well plate. The cells are incubated with serum samples of vaccinated mice (diluted 1:50) followed by a FITC-conjugated anti-mouse IgG antibody. Cells were acquired on BD FACS Canto II using DIVA software and analyzed by FlowJo.

(66) Intracellular Cytokine Staining:

(67) Splenocytes from vaccinated mice are isolated according to a standard protocol known in the art. Briefly, isolated spleens are grinded through a cell strainer and washed in PBS/1% FBS followed by red blood cell lysis. After an extensive washing step with PBS/1% FBS, splenocytes are seeded into 96-well plates (2×10.sup.6 cells per well). Cells are stimulated with a mixture of SARS-CoV-2 S protein specific peptide epitopes (5 μg/ml of each peptide) in the presence of 2.5 μg/ml of an anti-CD28 antibody (BD Biosciences) for 6 hours at 37° C. in the presence of a protein transport inhibitor. After stimulation, cells are washed and stained for intracellular cytokines using the Cytofix/Cytoperm reagent (BD Biosciences) according to the manufacturer's instructions. The following antibodies are used for staining: Thy1.2-FITC (1:200), CD8-APC-H7 (1:100), TNF-PE (1:100), IFNγ-APC (1:100) (eBioscience), CD4-BD Horizon V450 (1:200) (BD Biosciences) and incubated with Fcγ-block diluted 1:100. Aqua Dye is used to distinguish live/dead cells (Invitrogen). Cells are acquired using a Canto II flow cytometer (Beckton Dickinson). Flow cytometry data is analyzed using FlowJo software package (Tree Star, Inc.)

(68) Determination of Virus Neutralization Titers:

(69) Serum is collected for determination of SARS-CoV-2 neutralization titers (VNTs) detected via CPE (cytopathic effect) or via a pseudotyped particle-based assay.

Example 4: Vaccination of Mice with mRNA Encoding SARS-CoV-2 Antigen S1

(70) Preparation of LNP Formulated mRNA Vaccine:

(71) SARS-CoV-2 mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA is formulated with LNPs according to Example 1.4 prior to use in in vivo vaccination experiments.

(72) Immunization:

(73) Female BALB/c mice (6-8 weeks old) are injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 6. As a negative control, one group of mice is vaccinated with buffer. All animals are vaccinated on day 0 and 21. Blood samples are collected on day 21 (post prime) and 42 (post boost) for the determination of antibody titers.

(74) TABLE-US-00013 TABLE 9 Vaccination regimen (Example 4) CDS SARS-CoV-2 spike protein optimi- Formu- Group SEQ ID NO: zation lation Dose 1 Spike S1 opt1 LNP 5 μg SEQ ID NO: 152, 159, 166, or 173 2 Spike S1 opt1 LNP 2.5 μg SEQ ID NO: 152, 159, 166, or 173 3 Spike S1 opt1 LNP 1.25 μg SEQ ID NO: 152, 159, 166, or 173 1 Spike S1 opt3 LNP 5 μg SEQ ID NO: 153, 160, 167, or 161 2 Spike S1 opt3 LNP 2.5 μg SEQ ID NO: 153, 160, 167, or 161 3 Spike S1 opt3 LNP 1.25 μg SEQ ID NO: 153, 160, 167, or 161 1 Spike S1 opt10 LNP 5 μg SEQ ID NO: 154, 161, 168, or 175 2 Spike S1 opt10 LNP 2.5 μg SEQ ID NO: 154, 161, 168, or 175 3 Spike S1 opt10 LNP 1.25 μg SEQ ID NO: 154, 161, 168, or 175 4 buffer

(75) The induction of specific immune responses via ELISA, ICS and VNTs are determined as described before (see Example 3).

Example 5: Vaccination of Mice with mRNA Encoding SARS-CoV-2 Antigen Design (S_Stab)

(76) Preparation of LNP Formulated mRNA Vaccine:

(77) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4.

(78) Immunization:

(79) Female BALB/c mice (6-8 weeks old) were injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 10. As a negative control, one group of mice was vaccinated with buffer. All animals were vaccinated on day 0. Blood samples were collected on day 21 for the determination of antibody titers.

(80) TABLE-US-00014 TABLE 10 Vaccination regimen (Example 5): mRNA CDS SEQ ID NO: SEQ ID NO: Group Vaccine composition ID opt. Protein RNA Dose A mRNA encoding S_stab formulated in R9519 opt10 10, 341 165, 13013 2 μg LNPs B Rec. protein SARS-CoV-2 S ECD — — 1.5 μg (extracellular domain) + alum C buffer — — —
Determination of IgG1 and IgG2 Antibody Titers Using ELISA:

(81) ELISA was performed using recombinant SARS-CoV-2 S protein for coating. Coated plates were incubated using respective serum dilutions, and binding of specific antibodies to SARS-CoV-2 S were detected using biotinylated isotype specific anti-mouse antibodies followed by streptavidin-HRP (horse radish peroxidase) with Amplex as substrate. Endpoint titers of antibodies (IgG1, IgG2a) were measured by ELISA on day 21, after one single prime vaccination.

(82) Results:

(83) As shown in FIG. 4 the vaccination with mRNA encoding for full length S stabilized protein induced high titers of S specific binding antibody after a single vaccination (d21). Compared to the adjuvanted recombinant S protein the mRNA vaccine induced comparable IgG1 titers and higher IgG2a titers.

Example 6: Vaccination of Mice with mRNA Encoding SARS-CoV-2 Antigen Designs

(84) Preparation of LNP Formulated mRNA Vaccine:

(85) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4.

(86) Immunization:

(87) Female BALB/c mice (6-8 weeks old) were injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 11. As a negative control, one group of mice was vaccinated with buffer. All animals were vaccinated on day 0 and 21. Blood samples were collected on day 21 (post prime) and 42 (post boost) for the determination of antibody titers.

(88) TABLE-US-00015 TABLE 11 Vaccination regimen (Example 6): mRNA CDS SEQ ID NO: SEQ ID NO: Group Vaccine composition ID opt. Protein RNA Dose A mRNA encoding S_full length R9514 opt1 1 162 2 μg formulated in LNPs B mRNA encoding S_stab formulated in R9515 opt1 10 163 2 μg LN Ps C mRNA encoding S_stab formulated in R9519 opt10 10 165 2 μg LN Ps D buffer — — —
Determination of IqG1 and IqG2 Antibody Titers Using ELISA:

(89) ELISA was performed using recombinant SARS-CoV-2 S (extracellular domain) protein for coating. Coated plates were incubated using respective serum dilutions, and binding of specific antibodies to SARS-CoV-2 S were detected using biotinylated isotype specific anti-mouse antibodies followed by streptavidin-HRP (horse radish peroxidase) with Amplex as substrate. Endpoint titers of antibodies (IgG1, IgG2a) were measured by ELISA on day 21, and 42 post prime vaccination.

(90) Determination of Virus Neutralization Titers:

(91) Serum was collected for determination of SARS-CoV-2 neutralization titers (VNTs) detected via CPE (cytopathic effect). Serial dilutions of heat-inactivated sera (56° C. for 30 min) tested in duplicates with a starting dilution of 1:10 followed by 1:2 serial dilutions were incubated with 100 TCID.sub.50 of wild type SARS-CoV-2 (strain 2019-nCov/Italy-INM11) for 1 hour at 37° C. Every plate contained a dedicated row (8 wells) for cell control which contains only cells and medium, and a dedicated row of virus control which contain only cells and virus. Infectious virus was quantified upon incubation of 100 μl of virus-serum mixture with a confluent layer of Vero E6 cells (ATCC, Cat.1586) followed by incubation for 3 days at 37° C. and microscopical scoring for CPE formation. A back titration was performed for each run in order to verify the correct range of TCID50 of the working virus solution. VN titres were calculated according to the method described by Reed & Muench. If no neutralization was observed (MNt<10), an arbitrary value of 5 was reported. Analyses were carried out at VisMederi srl (Siena, Italy).

(92) Intracellular Cytokine Staining:

(93) Splenocytes from vaccinated mice were isolated according to a standard protocol known in the art. Briefly, isolated spleens were grinded through a cell strainer and washed in PBS/1% FBS followed by red blood cell lysis. After an extensive washing step with PBS/1% FBS, splenocytes were seeded into 96-well plates (2×10.sup.6 cells per well). Cells were stimulated with a mixture of SARS-CoV-2 S protein specific peptide epitopes (5 μg/ml of each peptide) in the presence of 2.5 μg/ml of an anti-CD28 antibody (BD Biosciences) for 6 hours at 37° C. in the presence of a protein transport inhibitor. After stimulation, cells were washed and stained for intracellular cytokines using the Cytofix/Cytoperm reagent (BD Biosciences) according to the manufacturer's instructions. The following antibodies were used for staining: Thy1.2-FITC (1:200), CD8-APC-H7 (1:100), TNF-PE (1:100), IFNγ-APC (1:100) (eBioscience), CD4-BD Horizon V450 (1:200) (BD Biosciences) and incubated with Fcγ-block diluted 1:100. Aqua Dye was used to distinguish live/dead cells (Invitrogen). Cells were acquired using a Canto II flow cytometer (Beckton Dickinson). Flow cytometry data was analyzed using FlowJo software package (Tree Star, Inc.) Results:

(94) As shown in FIGS. 5 A and B the vaccination with mRNA encoding full length S protein and full length S stabilized protein (S_stab) induced high titers of S specific binding antibody after a single vaccination (d21) (FIG. 5 A: IgG1, FIG. 5 B: IgG2a). The titers increased after a second vaccination (d42). All mRNA designs induced more or less comparable antibody titers, whereas mice of group C showed a decreased level of IgG2a antibodies on d21 compared to other groups. As shown in FIG. 5 C the vaccination with mRNA encoding for full length S protein and full length S stabilized protein induced robust levels of virus neutralizing antibodies after two vaccinations.

(95) As shown in FIG. 6 the vaccination with mRNA encoding for full length S protein and full length S stabilized (S_stab) protein induced both CD4.sup.+ and CD8.sup.+ IFNγ/TNF double positive T cells.

Example 7: In Vivo Immunogenicity of SARS-CoV-2 Vaccine Composition Following Different Vaccination Schedules

(96) Preparation of LNP Formulated mRNA Vaccine:

(97) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA were formulated with LNPs according to Example 1.4.

(98) Immunization:

(99) Female BALB/c mice (6-8 weeks old) were injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 12. Group I was vaccinated with Alum adjuvanted SARS-CoV2 spike protein (S extracellular domain) (1.5 μg in 5.6 μl Alhydrogel buffered in phosphate buffered saline [PBS]). As a negative control, one group of mice was vaccinated with buffer (0.9% NaCl).

(100) Animals received their first vaccination on day 0, day 7, day 14 or day 21. All animals received a second vaccination on day 28. The presence of SARS-CoV 2 S binding antibodies was analyzed on day 28 and day 35, the presence of virus-neutralizing titers (VNTs) was analyzed on day 28, 35 and 49. The induction of T cell responses after vaccination was assessed on day 49 of the experiment. This experimental setup was chosen to determine the onset of the specific immune responses and to ascertain which vaccination interval from first to second immunization yields the highest immune responses in mice.

(101) TABLE-US-00016 TABLE 12 Vaccination regimen (Example 7). mRNA CDS SEQ ID NO: SEQ ID Group Vaccine composition ID vaccination opt. Protein NO: RNA Dose A mRNA encoding S_stab R9515 d21, d28 opt1 10 163 2 μg formulated in LNPs (CVnCoV) B mRNA encoding S_stab R9515 d14, d28 opt1 10 163 2 μg formulated in LNPs (CVnCoV) C mRNA encoding S_stab R9515 d7, d28 opt1 10 163 2 μg formulated in LNPs (CVnCoV) D mRNA encoding S_stab R9515 d0, d28 opt1 10 163 2 μg formulated in LNPs (CVnCoV) E mRNA encoding S_stab R9519 d21, d28 opt10 10 165 2 μg formulated in LNPs F mRNA encoding S_stab R9519 d14, d28 opt10 10 165 2 μg formulated in LNPs G mRNA encoding S_stab R9519 d7, d28 opt10 10 165 2 μg formulated in LNPs H mRNA encoding S_stab R9519 d0, d28 opt10 10 165 2 μg formulated in LNPs I Pos. control (alum adjuvanted — d0, d28 — — — — S protein) J Buffer — d0, d28 — — — —
Characterisation of RNA-Induced Innate Immune Responses:

(102) Blood samples were taken via retro-orbital bleeding 14h after administration of mRNA encoding S_stab formulated in LNPs (exemplarily shown for group A), positive control, or buffer. Serum cytokines (IFN-γ, IL-1β TNF, IL-6, IL-4, IL-5 and IL-13) were assessed using cytometric bead array (CBA) using the BD FACS CANTO II. Serum was diluted 1:4 and BD Bioscience mouse cytokine flex sets were used according to manufacturer's protocol to determine serum cytokine levels.

(103) The following flex set were used: Mouse IFN-γ Flex Set RUO (A4) (BD Bioscience, Cat. 558296); Mouse II-13 Flex Set RUO (B8) (BD Bioscience, Cat. 558349); Mouse IL-1 Flex Set RUO (E5) (BD Bioscience, Cat. 560232); Mouse II-4 Flex Set RUO (A7) (BD Bioscience, Cat. 558298); Mouse II-5 Flex Set RUO (A6) (BD Bioscience, Cat. 558302); Mouse IL-6 Flex Set RUO (B4) (BD Bioscience, Cat. 558301); Mouse TNF Flex Set RUO (C8) (BD Bioscience, Cat. 558299). IFN-α was quantified using VeriKine-HS Mouse IFN-α Serum ELISA Kit (pbl, Cat. 42115-1) according to manufacturer's instructions. Sera were diluted 1:100 and 50 μl of the dilution was tested.

(104) Determination of IqG1 and IgG2 Antibody Titers Using ELISA:

(105) ELISA was performed using recombinant SARS-CoV-2 S (extracellular domain) protein for coating. Coated plates were incubated using respective serum dilutions, and binding of specific antibodies to SARS-CoV-2 S were detected using biotinylated isotype specific anti-mouse antibodies followed by streptavidin-HRP (horse radish peroxidase) with Amplex as substrate.

(106) Determination of Virus Neutralization Titers:

(107) Serum was collected for determination of SARS-CoV-2 neutralization titers (VNTs) detected via CPE (cytopathic effect) using wild type SARS-CoV-2 virus. For the analysis of virus neutralizing titres of mouse sera, serial dilutions of heat-inactivated sera (56° C. for 30 min) tested in duplicates with a starting dilution of 1:10 followed by 1:2 serial dilutions were incubated with 100 TCID.sub.50 of wild type SARS-CoV-2 (strain 2019-nCov/Italy-INM11) for 1 hour at 37° C. Every plate contained a dedicated row (8 wells) for cell control which contains only cells and medium, and a dedicated row of virus control which contain only cells and virus. Infectious virus was quantified upon incubation of 100 μl of virus-serum mixture with a confluent layer of Vero E6 cells (ATCC, Cat.1586) followed by incubation for 3 days at 37° C. and microscopical scoring for CPE formation. A back titration was performed for each run in order to verify the correct range of TCID.sub.50 of the working virus solution. VN titres were calculated according to the method described by Reed & Muench. If no neutralization was observed (MNt<10), an arbitrary value of 5 was reported. Analyses were carried out at VisMederi srl (Siena, Italy).

(108) Intracellular Cytokine Staining:

(109) Splenocytes were isolated and stimulated with SARS-CoV-2 spike specific peptide library for 24 hours. Subsequently cells were stained for cluster of differentiation 8 (CD8) and CD4 T cells (surface) and for INF-y and TNF (intracellular) to evaluate the induction of multifunctional T cells specifically activated by vaccine-specific peptides. Cells incubated with dimethyl sulfoxide (DMSO) served as negative controls. Cells were acquired using a Canto II flow cytometer (Beckton Dickinson). Flow cytometry data was analyzed using FlowJo software package (Tree Star, Inc.)

(110) Results

(111) As shown in FIG. 7 the cytokine analyses demonstrated the induction of a balanced immune response upon mRNA encoding S_stab formulated in LNPs (CVnCoV) injection that exhibited no bias towards IFNγ or IL4, IL-5 and IL-13, indicative of a T.sub.H1 and T.sub.H2 response, respectively. Low levels of pro-inflammatory cytokines IL-6, IFNα were detectable in serum, while TNF and IL1β remained undetectable.

(112) As shown in FIG. 8A the vaccination with mRNA R9515 encoding full length S stabilized protein (S_stab) induced a fast onset of immune response upon first vaccination. A single i.m. administration of the vaccine composition was sufficient to induce binding antibodies seven days post-injection.

(113) As shown in FIG. 8B the vaccination with mRNA encoding full length S stabilized protein (S_stab) induced comparable antibody titers independently of CDS optimization. Levels of binding antibodies increased with longer intervals between vaccination and serum sampling (FIG. 8A+B). A second immunization was able to increase the overall titers of binding antibodies one week post-injection (day 35). Higher levels of binding antibody titers were observed on day 35 in groups featuring longer intervals between first and second immunization. Adjuvanted recombinant spike protein vaccine (group I) induced comparable levels of binding IgG1 antibodies, but IgG2a titers were statistically significantly lower compared to all mRNA groups.

(114) As shown in FIG. 9A+B, low, but detectable levels of VNTs were present 28 days post first vaccination (group D and H). VNT levels increased after the second immunization across all groups analyzed on day 35 and day 49 of the study. In line with the increased binding antibodies, VNTs increased over time and for groups with longer intervals between first and second vaccination.

(115) As shown in FIG. 10, a strong increase in multifunctional CD8+ and CD4+ T cells was observed in vaccinated animals.

(116) Strong induction of multifunctional T cells as well as binding and, more importantly, of functional antibodies suggest that the mRNA vaccine encoding the SARS-CoV-2 spike protein elicits potent immune responses in mice. The vaccine elicited a balanced Th1/Th2 profile, indicated by the induction of comparable levels of IgG1 and IgG2a antibodies as well as a cytokine profile that gives no indication of a T.sub.H2 bias, i.e. induction of IL4, IL5 and IL13.

Example 8: Vaccination of Rats with mRNA Encoding SARS-CoV-2 Antigen

(117) Preparation of LNP Formulated mRNA Vaccine:

(118) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4 prior to use in in vivo vaccination experiments.

(119) Immunization:

(120) Rats were injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 13. As a negative control, one group of rats was vaccinated with buffer (group A). All animals were vaccinated on day 0 and day 21. Blood samples were collected on day 21 (post prime) and 42 (post boost) for the determination of antibody titers.

(121) TABLE-US-00017 TABLE 13 Vaccination regimen (Example 8): mRNA CDS SEQ ID NO: SEQ ID Group Vaccine composition ID opt. Protein NO: RNA Dose A buffer — — — — B mRNA encoding S_stab formulated in LNPs R9515 opt1 10 163 0.5 μg C mRNA encoding S_stab formulated in LNPs R9515 opt1 10 163 2 μg D mRNA encoding S_stab formulated in LNPs R9515 opt1 10 163 10 μg E mRNA encoding S_stab formulated in LNPs R9515 opt1 10 163 40 μg F mRNA encoding S_stab formulated in LNPs R9515 opt1 10 163 80 μg
Determination of IgG1 and IgG2 Antibody Titers Using ELISA:

(122) ELISA was performed using recombinant SARS-CoV-2 S (extracellular domain) protein for coating. Coated plates were incubated using respective serum dilutions, and binding of specific antibodies to SARS-CoV-2 S were detected directly with labeled HRP antibody instead of a secondary HRP antibody used for mouse ELISA. The lack of signal amplification in rat ELISA might account for lower titers, therefore ELISA titers between rat and mouse studies are currently not comparable.

(123) Determination of Virus Neutralizing Antibody Titers (VNT)

(124) Virus neutralizing antibody titers (VNT) of rat serum samples were analyzed as previously described in Example 6 with mouse serum.

(125) Results:

(126) As shown in FIG. 11 A-C the vaccination with mRNA full length S stabilized protein formulated in LNPs induced in rats dose dependent levels of binding antibody titers at day 21 using doses of 0.5 μg, 2 μg and 10 μg and reached saturation in groups vaccinated with 40 μg and 80 μg. FIGS. 11 D and E show levels of binding antibody titers at day 42 after the first vaccination. The second vaccination led to a further increase of antibody titers.

(127) As shown in FIGS. 11 F and G the vaccination with mRNA full length S stabilized protein formulated in LNPs induced in rats dose dependent levels of VNTs.

Example 9: Challenge Study of Hamsters with SARS-CoV-2

(128) The protective efficacy of mRNA encoding S_stab formulated in LNPs (CVnCoV) was addressed in Syrian hamsters. This model represents mild to moderate human lung disease pathology and is one of the recognized and accepted models to investigate human-relevant immunogenicity and pathogenesis (Muñoz-Fontela et al, PMID 32967005). Hamsters are susceptible to wild-type SARS-CoV-2 infection, resulting in high levels of virus replication and histopathological changes in viral target organs.

(129) Preparation of LNP Formulated mRNA Vaccine:

(130) SARS-CoV-2 S mRNA construct was prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4 prior to use in in vivo vaccination experiments.

(131) Immunization and Challenge:

(132) Syrian golden hamsters (n=5/group, 11 to 13 weeks old) were injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 14 (see e.g. group E and F). As negative controls, one group of hamsters was not treated and mock infected (with buffer) (group A), another group was injected with NaCl as a buffer control. As a positive control, group C was infected intranasally with 10.sup.2TCID50/dose of SARS CoV-2 isolate BetaCoV/Munich/BavPat1/2020 (containing a D614G substitution) in 0.1 ml on day 0. As an additional positive control, group D was injected intramuscularly with 5 μg of recombinant SARS-CoV-2 spike protein (S1+S2 ECD, His tag; Sino Biological, Cat. 40589-V08B1) adjuvanted in Alhydrogel (Brenntag) 2%. Blood samples were collected on day 28 (post prime) and day 42 and 56 (post boost) for the determination of antibody titers. The animals were challenged intranasally with 10.sup.2 TCID50/dose of SARS CoV-2 in a total dose volume of 0.1 ml at day 56. Animals were followed for four days post challenge (p.c.) and euthanized on day 60 of the experiment.

(133) TABLE-US-00018 TABLE 14 Vaccination regimen (Example 9). mRNA CDS SEQ ID NO: SEQ ID Group Vaccine composition ID dose vaccination opt. Protein NO: RNA A Untreated/mock infected B NaCl d0, d28 — — — C SARS-CoV-2 infected 10.sup.2 d0 — — — TCID.sub.50 D Pos. control (alum adjuvanted 1.5 μg d0, d28 — — — S protein) E mRNA encoding S_stab R9515 2 μg d0, d28 opt1 10 163 formulated in LNPs (CVnCoV) F mRNA encoding S_stab R9515 10 μg d0, d28 opt1 10 163 formulated in LNPs (CVnCoV)
Antibody Analysis

(134) Blood samples were taken at day 28, 42, and 56 for the determination of total IgG antibodies via ELISA. Plates were coated with 1 μg/ml of SARS-CoV-2 spike S (extracellular domain) protein for 4-5h at 37° C. Plates were blocked overnight in 10% milk, washed and incubated with serum for 2h at room temperature. For detection, hamster sera were incubated with biotin goat anti-hamster (Syrian) IgG antibody (BioLegend, Cat: 405601) followed by incubation with HRP-Streptavidin (BD, Cat: 554066). Detection of specific signals was performed in a BioTek SynergyHTX plate reader, with excitation 530/25, emission detection 590/35 and a sensitivity of 45. IgG antibody titers via ELISA for infected animals (group C) were not analyzed.

(135) Virus neutralizing antibody titers (VNT) of hamster serum samples were analysed upon heat inactivation of samples for 30 min at 56° C. Triplicate, serial two-fold dilutions were incubated with 10.sup.2 TCID50/well SARS-CoV-2 virus (featuring the mutation D614G) for one hour at 37° C. leading to a sample starting dilution of 1:10. The virus-serum mixtures were transferred to 96 well plates with Vero E6 cell culture monolayers and incubated for five days at 37° C. Plates were then scored using the vitality marker WST8 and (100% endpoint) VN titers were calculated according to the method described by Reed & Muench.

(136) Viral Load in the Respiratory Tract

(137) Detectable levels of replication competent virus in throat swabs, lung and nasal turbinate tissues post challenge were analysed. Quadruplicate, 10-fold serial dilutions were transferred to 96 well plates with Vero E6 cell culture monolayers and incubated for one hour at 37° C. Cell monolayers were washed prior to incubation for five days at 37° C. Plates were then scored using the vitality marker WST8 and viral titers (Log 10 TCID50/ml or/g) were calculated using the method of Spearman-Karber.

(138) Histopathology Upon Challenge in Hamsters

(139) Histopathological analysis was performed on tissues sampled on day 4 post challenge. After fixation with 10% formalin, sections were embedded in paraffin and the tissue sections were stained with haematoxylin and eosin for histological examination. Histopathological assessment scoring is as follows: Alveolitis severity, bronchitis/bronchiolitis severity: 0=no inflammatory cells, 1=few inflammatory cells, 2=moderate number of inflammatory cells, 3=many inflammatory cells. Alveolitis extent, 0=0%, 1=<25%, 2=25-50%, 3=>50%. Alveolar oedema presence, alveolar haemorrhage presence, type II pneumocyte hyperplasia presence, 0=no, 1=yes. Extent of peribronchial/perivascular cuffing, 0=none, 1=1-2 cells thick, 2=3-10 cells thick, 3=>10 cells thick.

(140) Results

(141) As shown in FIG. 12A hamsters vaccinated with two CVnCoV doses of 2 μg or 10 μg in a 4-week interval developed dose-dependent S binding IgG antibodies after the first vaccination that increased upon the second. Median endpoint titres of animals vaccinated with 10 μg of CVnCoV were 1.6×10.sup.5 after one dose and peaked at 7.8×10.sup.5 on day 42. IgG antibody titers via ELISA for infected animals (group C) were not analyzed.

(142) As shown in FIG. 12B, detectable levels of VNTs were present 28 days post first vaccination. VNT levels increased after the second immunization across both dose groups (group E and F) analyzed on day 42 and day 56 of the study. Virus employed for this assay featured the D614D mutation, while CVnCoV encoded S_stab does not include this mutation. Of note, a control group that received Alum-adjuvanted SECD protein developed IgG antibodies without inducing detectable levels of VNTs.

(143) On day 56, four weeks after second vaccination, all animals were challenged with SARS-CoV-2 featuring D614G (10.sup.2 TCID.sub.50/dose). In buffer control animals, levels of replication-competent virus from throat swaps, taken daily from day 56 to termination on day 60, showed peak viral titres of approximately 103 TCID50/ml two days post challenge that returned to nearly undetectable levels on day 60. Animals previously infected with SARS-CoV-2 remained negative throughout the experiment. Viral levels were significantly reduced in throat swabs of both CVnCoV vaccinated groups. Vaccination with 10 μg of CVnCoV resulted in significantly diminished and delayed viral peaks at 10.sup.1.5 TCID50/ml three days post challenge. At least 2 out of 5 animals in this group remained negative throughout the testing period (see FIG. 12C).

(144) Viral levels in nasal turbinates revealed less pronounced, but detectable dose-dependent reduction of viral replication (FIG. 12D). Importantly, animals vaccinated with 10 μg of CVnCoV exhibited no detectable viral levels in the lungs, proving the ability of CVnCoV to protect animals from viral replication in the lower respiratory tract (FIG. 12E).

(145) Histopathological analyses demonstrated the occurrence of alveolar damage and inflammation of alveoli, bronchi and trachea in the buffer control group upon SARS-CoV-2 infection. Consistent with protection from viral replication in the lungs, CVnCoV significantly reduced histopathological changes upon two vaccinations with 10 μg. Importantly, a dose of 2 μg, which lead to the induction of binding antibodies but only elicited low levels of VNTs, did not induce increased histopathology scores. Group comparisons for differential gene expression in lung homogenates showed no significant change in the induction of IL-4 or IL-5 in the mRNA groups compared to buffer or mock infection groups (data not shown). Therefore, the inventors conclude that CVnCoV does not induce enhanced disease in hamsters, (e.g. via antibody dependent enhancement) even under conditions where breakthrough viral replication occurs. The presented data indicates that vaccination with Alum-adjuvanted protein vaccine, that elicits no detectable levels of VNTs but high levels of binding antibodies, causes increased histopathology scores in hamsters (FIG. 12F, Table 14).

(146) TABLE-US-00019 TABLE 15 List of histopathological analysis indicated in FIG. 12F: Histopathological analysis 1 Extend of alveolitis/alveolar damage 2 Severity of alveolitis 3 Sum of extend + severity alveolitis 4 Alveolar oedema presence 5 Alevolar haemorrhage presence 6 Type II pneumocytehyperplasia presence 7 Severity of bronchitis 8 Severity of bronchiolitis 9 Degree of peribronchial/perivascular cuffing 10 Severity of tracheitis 11 Severity of rhinitis

(147) Consistent with robust immune responses, CVnCoV protected hamsters from SARS-CoV-2 viral challenge featuring the D614G mutation in S, proving CVnCoV's ability to protect against the most prevalent form of the virus. These experiments showed significant reduction in replicating virus levels in the upper respiratory tract and the absence of detectable live virus in the lungs of animals upon two vaccinations with 10 μg of CVnCoV.

Example 10: Clinical Development of a SARS-CoV-2 mRNA Vaccine Composition

(148) To demonstrate safety and immunogenicity of the mRNA vaccine composition(s), clinical trials (phase 1, 2a) were initiated. In the phase 1 clinical trial, cohorts of human volunteers (18-60 years) were intramuscularly injected for at least two times (e.g. day 1 and day 29 with a dose of 2 μg, 4 μg, 8 μg, 12 μg, 16 μg, or 20 μg mRNA encoding SARS-CoV-2 spike protein (R9515, SEQ ID No. 163) formulated in LNPs (as described in Example 1.4) according to the invention (CVnCoV)). In order to assess the safety profile of the vaccine compositions according to the invention, subjects are monitored after administration (vital signs, vaccination site and systemic reactogenicity assessments, hematologic analysis). The immunogenicity of the immunization is analyzed by determination of antibodies against SARS-CoV-2, virus neutralizing titers (VNT) and SARS-CoV-2 specific T cells in sera from vaccinated subjects. Blood samples are collected on day 1 as baseline, after each vaccination and during long-term follow-up.

(149) TABLE-US-00020 Cohorts: 2 μg 4 μg 6 μg 8 μg 12 μg 16 μg 20 μg Total N Sero- 46 46 46 46 24 12 12 232 negatives N Sero- 10 10 10 6 4 1 41 positives Total CVnCoV + 56 56 56 52 28 13 12 273 N placebo

(150) On Day 8, Day 15, Day 29, Day 36, Day 43, Day 57, Day 120, Day 211 and Day 393 the following was determined: a.) The proportion of subjects seroconverting for SARS-CoV-2 spike protein antibodies, as measured by ELISA. In subjects who did not get exposed to SARS-CoV-2 before the trial, or during the trial before the applicable sample was collected, as measured by ELISA to SARS-CoV-2 N-antigen, seroconversion is defined as an increase in titer in antibodies against SARS-CoV-2 spike protein versus baseline. In subjects seropositive for SARS-CoV-2 at baseline, seroconversion is defined as a 2-fold increase in titer in antibodies against SARS-CoV-2 spike protein versus baseline. b.) Individual SARS-CoV-2 spike protein-specific antibody levels in serum, as measured by ELISA. c.) Geometric mean titers (GMTs) of serum SARS-CoV-2 spike protein antibodies, as measured by ELISA, in subjects who did not get exposed to SARS-CoV-2 before the trial or during the trial before the applicable sample was collected, as measured by ELISA to SARS-CoV-2 N-antigen. d.) The proportion of subjects seroconverting for SARS-CoV-2 neutralizing antibodies, as measured by an activity assay. In subjects who did not get exposed to SARS-CoV-2 before the trial or during the trial before the applicable sample was collected, as measured by ELISA to SARS-CoV-2 N-antigen, seroconversion is defined as an increase in titer in SARS-CoV-2 neutralizing antibodies versus baseline. In subjects seropositive for SARS-CoV-2 at baseline, seroconversion is defined as a 2-fold increase in titer in SARS-CoV-2 neutralizing antibodies versus baseline. e.) Individual SARS-CoV-2 neutralizing antibody levels in serum. f.) GMTs of serum SARS-CoV-2 neutralizing antibodies, as measured by an activity assay, in subjects who did not get exposed to SARS-CoV-2 before the trial or during the trial before the applicable sample was collected, as measured by ELISA to SARS-CoV-2 N-antigen.
Cell-Mediated Immune Response

(151) On Day 29, Day 36 and Day 211 in peripheral blood mononuclear cells (PBMCs) from all subjects at the assigned site(s) the following was determined: a.) The frequency and functionality of SARS-CoV-2 spike-specific T-cell response after antigen stimulation. b.) Intracellular cytokine staining (ICS) to investigate Th1 response and production of Th2 markers c.) The proportion of subjects with a detectable increase in SARS-CoV-2 spike-specific T-cell response.
Innate Immune Response

(152) On Day 2, Day 8, Day 29, Day 30 and Day 36 in all open-label sentinel subjects the following was determined: a.) Serum cytokine concentrations, including but not limited to interferon (IFN)-α, IFN-γ, interleukin (IL)-δ, chemokine ligand (CCL) 2 and IFN-γ-induced protein 10 (IP 10). b.) Gene expression profiling.
Evaluation of Infection a.) Number of subjects with virologically-confirmed SARS-CoV-2 infection as measured by reverse transcription (RT)-PCR at clinically was determined time points throughout the trial. b.) Number of subjects with asymptomatic SARS-CoV-2 infection as measured by retrospective serology at predefined time points was determined.
Virus Neutralization:

(153) Neutralizing activity of induced antibodies was determined by a cytopathic effect (CPE)-based micro-neutralization assay looking at 50% CPE by a viral infective dose 25 (MN 25 TCID50/well), using a wild-type viral strain (SARS-CoV-2 2019 nCOV ITALY/INM11) on a VERO E6 cell line. The assays were performed in a 96-well plate format, human serum was diluted in a 1:2 serial dilution. The Micro-neutralization titre is the reciprocal of the highest sample dilution that protects from CPE at least 50% of cells and reported as the geometric mean of duplicates.

(154) Elisa:

(155) Antibody titres were measured with Elisa Assays using as target antigen either the extra cellular domain (ECD) of Spike or to the receptor binding domain (RBD). The antigen recombinant proteins used for coating were expressed in eukaryotic cells. Human serum were diluted 1:2 in a serial dilution, the titre is the reciprocal of the highest sample dilution over a cut-point defined as blank plus matrix effect. Titres are reported as geometric mean of duplicates.

(156) T Cell Responses:

(157) As an exploratory endpoint of this clinical trial, cell-mediated immune responses were evaluated by assessment of frequency and functionality of SARS-CoV-2 Spike-specific CD4+ Th1 and cytotoxic CD8+ T cell responses after antigen stimulation. Moreover the proportion of subjects with a detectable increase in SARS-CoV-2 spike-specific T-cell responses after vaccination were determined.

(158) Functional T cell responses were determined and quantified ex vivo by flow cytometry-based intracellular cytokine staining (ICS) of T cell activation markers and effector cytokines (CD40L, IFN-gamma, IL-2 and TNF-alpha) after stimulation of SARS-CoV-2 Spike-specific CD4+ Th1 and cytotoxic CD8+ T cells with overlapping Spike peptide pools.

(159) Results:

(160) In FIG. 13A systemic adverse events are shown in the different dose cohorts after the first dose and after the second dose.

(161) In FIG. 13B local adverse events are shown in the different dose cohorts after the first dose and after the second dose.

(162) In FIG. 13C the specific systemic adverse events are shown, such as fatigue, headache, myalgia, chills, arthralgia, fever, nausea and diarrhea.

(163) In FIG. 13D the specific local adverse events are shown, such as pain, itching, swelling and redness.

(164) In summary the CvnCoV vaccine showed good safety properties and acceptable reactogenicity.

(165) In FIG. 13E induction of Spike protein specific IgG antibodies on day 1, 29, 36, 43 and 57 is shown for the different dose cohorts. All vaccinated subjects showed good induction of Spike-specific antibodies, wherein the 12 μg cohort showed the same level of antibodies as seroconverted patients (HCS). In the table of FIG. 13E percentage of seroconversion of the vaccinated subjects is shown. In most of the cases more than 90% of the vaccinated subjects showed a more than 2fold increase in Spike protein-specific antibodies compared to baseline on day 43. In all dose groups at least 70% of the vaccinated subjects showed a more than 4fold increase in Spike protein-specific antibodies compared to baseline. In the 12 μg even more than 90% of the subjects showed a more than 4fold increase in antibodies.

(166) In FIG. 13F induction of RBD-specific IgG antibodies on day 1, 36, and 43 is shown for the different dose cohorts. All vaccinated subjects showed good induction of RBD-specific antibodies, wherein the 12 μg cohort showed the same level of antibodies as seroconverted patients (HCS). In the table of FIG. 13F percentage of seroconversion of the vaccinated subjects is shown. In most of the cases more than 80% of the vaccinated subjects showed a more than 2fold increase in RBD-specific antibodies compared to baseline on day 43. In the 8 μg and the 12 μg groups more than 80% of the subjects showed a more than 4fold increase in antibodies.

(167) In FIG. 13G induction of virus neutralizing antibodies is shown. All dose groups showed good induction of virus neutralizing titers wherein the highest dose of 12 μg induced the same level of neutralizing antibodies as present in seroconverted patients (HCS). In the table of FIG. 13G percentage of seroconversion of the vaccinated subjects is shown. In all dose groups more than 70% of the vaccinated subjects showed a more than 2fold increase in virus neutralizing antibodies compared to baseline on day 43. In the 8 μg and 12 μg dose groups at least 70% of the vaccinated subjects showed a more than 4fold increase in virus neutralizing antibodies compared to baseline. In the 12 μg even 100% of the subjects showed a more than 4fold increase in virus neutralizing antibodies.

(168) In FIG. 13H the ratios of the level of Spike protein or RBD binding antibodies to the level of neutralizing antibodies are shown. Importantly, the CVnCoV induced ratio is about the same as from convalescent subjects, which implies that the induced level of antibodies is sufficient to neutralize SARS-CoV-2.

(169) FIG. 13I shows induction of CD4+ T cells against Spike protein S1 after the first dose (day 29) and the second dose (day 36). Both dose groups (4 μg and 8 μg) show good induction of CD4+ T cells against Spike protein S1.

(170) FIG. 13J shows induction of CD4+ T cells against Spike protein S2 after the first dose (day 29) and the second dose (day 36). Both dose groups (4 μg and 8 μg) show good induction of CD4+ T cells against Spike protein S comparable to convalescent patients.

(171) In FIG. 13K induction of virus neutralizing titers in SARS-CoV-2 seropositive subjects (upper part) after vaccination with 2 μg (left) and 4 μg (right) CvnCoV is shown. Remarkably, virus neutralizing antibodies could be boosted in both dose groups in seropositive patients already expressing virus neutralizing antibodies.

(172) In the lower part induction of RBD specific antibodies in SARS-CoV-2 seropositive subjects after vaccination with 2 μg (left) and 4 μg (right) CvnCoV is shown. Remarkably, RBD specific antibodies could be boosted in both dose groups in seropositive patients already expressing RBD specific antibodies.

Example 11: Vaccination of Mice with mRNA Encoding SARS-CoV-2 Antigen S_Stab Formulated in LNPs

(173) The present example shows that SARS-CoV-2 S mRNA vaccines with mRNA comprising alternative forms of the 3′end (A64-N5-C30-hSL-N5 or hSL-A100) and UTR combinations (i-3 (−/muag) or a-1 (HSD17B4/PSMB3)) induce strong humoral as well as cellular immune response in mice. mRNA encoding SARS-CoV-2 S_stab comprising hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) shows stronger induction of immune responses, demonstrated by a stronger induction of binding and neutralizing antibodies as well as by a stronger induction of CD8+ T-cells.

(174) Preparation of LNP Formulated mRNA Vaccine:

(175) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4.

(176) Immunization:

(177) Female BALB/c mice (6-8 weeks old, n=8) were injected intramuscularly (i.m.) with mRNA vaccine compositions at dosages indicated in Table 16. As a negative control, one group of mice was vaccinated with buffer. All animals were vaccinated on day 0 and 21. Blood samples were collected on day 21 (post prime) and 42 (post boost) for the determination of antibody titers, splenocytes were isolated on day 42 for T-cell analysis.

(178) TABLE-US-00021 TABLE 16 Vaccination regimen (Example 11): 5′-UTR/ SEQ ID SEQ ID mRNA CDS 3′-UTR; NO: NO: Group Vaccine composition ID opt. UTR Design 3′-end Protein RNA Dose A buffer — — — — — B mRNA encoding R9515 opt1 -/muag; A64-N5- 10 163 1 μg S_stab formulated C30-hSL- in LNPs N5 C mRNA encoding R9709 opt1 HSD17B4/ hSL- 10 149 1 μg S_stab formulated PSMB3 A100 in LNPs

(179) Determination of IgG1 and IgG2 antibody titers using ELISA, determination of virus neutralizing titers via CPE (cytopathic effect) and T-cell analysis by Intracellular cytokine staining (ICS) was performed as described in Example 6.

(180) Results:

(181) As shown in FIG. 14A the vaccination with mRNA encoding full length S stabilized protein (S_stab) induced high titers of S specific binding antibody (IgG1 and IgG2a) after a single vaccination (d21). The titers increased after a second vaccination (d42). Vaccine composition comprising mRNA encoding SARS-CoV-2 S_stab comprising hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) (group C) showed an improved and stronger induction of binding antibodies (shown by IgG1 and IgG2a endpoint titers).

(182) Both mRNA designs induced more or less comparable virus neutralization antibody titers after second vaccination (day 42), whereas mice of group C showed an early increased level of VNTs already on d21 after first vaccination compared to group B (shown in FIG. 14B).

(183) As shown in FIG. 14C the vaccination with mRNA encoding full length S stabilized protein with both alternative forms of the 3′end (A64-N5-C30-hSL-N5 or hSL-A100) and UTR combinations (i-3 (−/muag) or a-1 (HSD17B4/PSMB3)) induced robust levels of antigen-specific CD4.sup.+ and CD8.sup.+ IFNγ/TNF double positive T cells after two vaccinations. Vaccine composition comprising mRNA encoding SARS-CoV-2 S_stab comprising hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) (group C) showed surprisingly a ramarkable stronger induction of CD8.sup.+ IFNγ/TNF double positive T cells.

Example 12: Vaccination of Rats with mRNA Encoding SARS-CoV-2 Antigen S_Stab Formulated in LNPs

(184) The present example shows that SARS-CoV-2 S mRNA vaccines with mRNA comprising the inventive alternative form of the 3′end (hSL-A100) and UTR combination (α-1 (HSD17B4/PSMB3)) induce strong humoral immune response in rats.

(185) Preparation of LNP Formulated mRNA Vaccine:

(186) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4 prior to use in in vivo vaccination experiments.

(187) Immunization:

(188) Rats were injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 17. As a negative control, one group of rats was vaccinated with buffer (group A). All animals were vaccinated on day 0 and day 21. Blood samples were collected on day 21 (post prime) and 42 (post boost) for the determination of antibody titers.

(189) TABLE-US-00022 TABLE 17 Vaccination regimen (Example 12): 5′-UTR/ SEQ ID SEQ ID mRNA CDS 3′-UTR; NO: NO: Group Vaccine composition ID opt. UTR\Design 3′-end Protein RNA Dose A buffer — — — — — B mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL- 10 149 0.5 μg formulated in LNPs PSMB3 A100 C mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL- 10 149 2 μg formulated in LNPs PSMB3 A100 C mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL- 10 149 8 μg formulated in LNPs PSMB3 A100
Determination of IgG1 and IgG2 Antibody Titers Using ELISA:

(190) ELISA was performed using recombinant SARS-CoV-2 S (receptor binding domains RBD) protein for coating. Coated plates were incubated using respective serum dilutions, and binding of specific antibodies to SARS-CoV-2 S were detected directly with labeled HRP antibody instead of a secondary HRP antibody used for mouse ELISA. The lack of signal amplification in rat ELISA might account for lower titers, therefore ELISA titers between rat and mouse studies are currently not comparable.

(191) Determination of Virus Neutralizing Antibody Titers (VNT)

(192) Virus neutralizing antibody titers (VNT) of rat serum samples were analyzed as previously described in Example 6 with mouse serum.

(193) Results:

(194) As shown in FIG. 15 A the vaccination with mRNA full length S stabilized protein comprising the alternative non-coding region with 3′end hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) formulated in LNPs induced in rats robust and dose dependent levels of binding antibody titers at day 21 after first vaccination and at day 42 after second vaccination using doses of 0.5 μg, 2 μg and 8 μg. The second vaccination led to a further increase of antibody titers.

(195) As shown in FIG. 15 B vaccination with mRNA comprising the alternative and inventive non-coding region with 3′end hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) encoding full length S stabilized protein and formulated in LNPs induced in rats dose dependent and very high levels of VNT. The humoral immune responses shown by ELISA (binding antibodies IgG1 and IgG2a) and VNTS are remarkably increased compared to the immune responses elicited with mRNA comprising non-coding region with 3′end A64-N5-C30-hSL-N5 and UTR combination i-3 (−/muag) (see for comparison Example 8 FIG. 11A-F).

Example 13: Clinical Development of SARS-CoV-2 (CVnCoV) Vaccine

(196) 1 Trial Protocol for Human Vaccination

(197) 2 Summary

(198) The trial is designed as a Phase 2b/3 pivotal efficacy and safety trial in adults 18 years of age and older. The trial will have a randomized, observer-blinded, placebo-controlled design. Subjects will be enrolled at multiple sites globally and will be randomized in a 1:1 ratio to receive a 2-dose schedule of either CVnCoV at a dose level of 12 μg mRNA or placebo {normal saline (0.9% NaCl)} as the control.

(199) 3 Extension

(200) Following completion of Trial CV-NCOV-004 on Day 393, subjects will continue to participate in a 1 year extension of the trial. At the time of consent for Trial CV-NCOV-004, subjects will also be consented for participation in the 1 year extension. The Extension Study will collect additional data to evaluate long term safety {serious adverse events (SAEs)}, persistence of antibodies to SARS-CoV-2, and the occurrence of COVID-19 cases to assess duration of vaccine efficacy (VE).

(201) 4 Trial Objectives, Endpoints, and Estimands

(202) 4.1 Objectives

(203) 4.1.1 Primary Objectives

(204) Co-Primary Efficacy Objectives

(205) To demonstrate the efficacy of a 2-dose schedule of CVnCoV in the prevention of first episodes of virologically-confirmed cases of COVID-19 of any severity in SARS CoV 2 naïve subjects. To demonstrate the efficacy of a 2-dose schedule of CVnCoV in the prevention of first episodes of virologically-confirmed moderate to severe cases of COVID-19 in SARS CoV-2 naïve subjects.
Primary Safety Objective To evaluate the safety of CVnCoV administered as a 2-dose schedule to subjects 18 years of age and older.
4.1.2 Secondary Objectives
Key Secondary Efficacy Objectives To demonstrate the efficacy of a 2-dose schedule of CVnCoV in the prevention of first episodes of virologically-confirmed severe cases of COVID-19 in SARS-CoV-2 naïve subjects. To demonstrate the efficacy of a 2-dose schedule of CVnCoV in the prevention or reduction of asymptomatic infection by SARS-CoV-2 in seronegative subjects, as measured by seroconversion to the N protein of the virus.
Other Secondary Efficacy Objectives
To Evaluate in SARS-CoV-2 Naïve Subjects: The efficacy of a 2-dose schedule of CVnCoV in the prevention of first episodes of virologically-confirmed cases of COVID-19 of any severity in subjects≥61 years of age. The efficacy of a 2-dose schedule of CVnCoV in the prevention of first episodes of virologically-confirmed cases of SARS-CoV-2 infection, with or without symptoms. The efficacy of a 2-dose schedule of CVnCoV in reducing the Burden of disease (BoD) from COVID-19. The efficacy of CVnCoV after the first dose in the prevention of first episodes of virologically-confirmed cases of COVID-19 of any severity.
Secondary Immunogenicity Objectives To assess antibody responses to the RBD of S protein of SARS-CoV-2 after 1 and 2 doses of CVnCoV in a subset of subjects participating in Phase 2b of the trial. To assess SARS-CoV-2 viral neutralizing antibody responses after 1 and 2 doses of CVnCoV in a subset of subjects participating in Phase 2b of the trial.
Secondary Safety Objective To evaluate the reactogenicity and tolerability of CVnCoV administered as a 2-dose schedule to subjects 18 years of age and older participating in Phase 2b of the trial.
4.1.3 Exploratory Objectives
Exploratory Efficacy Objectives
To Investigate in SARS-CoV-2 Naïve Subjects: If cases of COVID-19 are milder in severity in subjects receiving a 2-dose schedule of CVnCoV compared to those administered placebo. If the need for supplemental oxygenation due to COVID-19 is reduced in subjects receiving a 2-dose schedule of CVnCoV compared to those administered placebo. If the need for mechanical ventilation due to COVID-19 is reduced in subjects receiving a 2-dose schedule of CVnCoV compared to those administered placebo. If hospitalization due to COVID-19 is reduced in subjects receiving a 2-dose schedule of CVnCoV compared to those administered placebo. If mortality due to COVID-19 is reduced in subjects receiving a 2-dose schedule of CVnCoV compared to those administered placebo. If all-cause mortality is reduced in subjects receiving a 2-dose schedule of CVnCoV compared to those administered placebo. To investigate the cell-mediated immune (CMI) response of a 2-dose schedule of CVnCoV from up to 400 subjects at selected site(s).
To Investigate in SARS-CoV-2 Naïve and Non-Naïve Subjects: The efficacy of a 2-dose schedule of CVnCoV in the prevention of first episodes of virologically-confirmed cases of COVID-19 of any severity in all subjects, regardless of SARS-CoV-2 serological status at baseline. The efficacy of CVnCoV after the first dose in the prevention of first episodes of virologically-confirmed cases of COVID-19 of any severity in all subjects, regardless of SARS-CoV-2 serological status at baseline.
To Investigate in Subjects with First Episodes of Virologically-Confirmed COVID-19 During the Trial: The occurrence of second episodes of COVID-19 in subjects receiving a 2-dose schedule of CVnCoV compared to those administered placebo.
4.2 Endpoints
4.2.1 Primary Endpoints
Co-Primary Efficacy Endpoints Occurrence of first episodes of virologically-confirmed {reverse transcription polymerase chain reaction (RT-PCR) positive} cases of COVID-19 of any severity meeting the case definition for the primary efficacy analysis. Occurrence of first episodes of virologically-confirmed (RT-PCR positive) cases of moderate to severe COVID-19 meeting the case definition for the primary efficacy analysis (moderate and severe COVID-19 disease defined herein).
Primary Safety Endpoints Occurrence, intensity and relationship of medically-attended AEs collected through 6 months after the second trial vaccination in all subjects. Occurrence, intensity and relationship of SAEs and AESIs collected through 1 year after the second trial vaccination in all subjects. Occurrence of fatal SAEs through 1 year after the second trial vaccination in all subjects.
4.2.2 Secondary Endpoints
Key Secondary Efficacy Endpoints Occurrence of first episodes of virologically-confirmed (RT-PCR positive) severe cases of COVID-19 meeting the case definition for the primary efficacy analysis (severe COVID-19 disease defined in herein). Occurrence of seroconversion to the N protein of SARS-CoV-2≥15 days following the second trial vaccination in asymptomatic seronegative subjects.
Seroconversion is defined as detectable SARS-CoV-2 N protein antibodies in the serum of subjects on Day 211 and/or Day 393 of the trial, who tested seronegative at Day 1 (baseline) and Day 43 (i.e. at the 2 testing time points prior to 15 days following the second trial vaccination).
Other Secondary Efficacy Endpoints In subjects ≥61 years of age, occurrence of first episodes of virologically-confirmed (RT-PCR positive) cases of COVID-19 of any severity meeting the case definition for the primary efficacy analysis. Occurrence of virologically-confirmed (RT-PCR positive) SARS-CoV-2 infection, with or without symptoms.
If subject was symptomatic, onset of symptoms must have occurred ≥15 days following the second trial vaccination;
if subject was asymptomatic, the positive RT PCR test must have occurred ≥15 days following the second trial vaccination. BoD scores calculated based on first episodes of virologically-confirmed (RT-PCR positive) cases of COVID-19 of any severity meeting the case definition for the primary efficacy analysis. BoD #1—no disease (not infected or asymptomatic infection)=0; mild or moderate disease=1; severe disease=2. BoD #2—no disease (not infected or asymptomatic infection)=0; disease without hospitalization=1; disease with hospitalization=2; death=3. Occurrence of first episodes of virologically-confirmed (RT-PCR positive) cases of COVID-19 of any severity with symptom onset at any time after the first trial vaccination.
Secondary Immunogenicity Endpoints (Phase 2b Immunogenicity Subset)
SARS-CoV-2 RBD of S protein antibody responses
On Days 1, 29, 43, 57, 120, 211 and 393: Serum antibodies to SARS-CoV-2 RBD of S protein. Occurrence of seroconversion to SARS-CoV-2 RBD of S protein.
Seroconversion is defined as detectable SARS-CoV-2 RBD of S protein antibodies in the serum of subjects who tested seronegative at baseline.
SARS-CoV-2 viral neutralizing antibody responses
On Days 1, 29, 43, 57, 120, 211, and 393: Serum viral neutralizing antibodies to SARS-CoV-2 virus, as measured by a viral neutralizing antibody assay. Occurrence of seroconversion to SARS-CoV-2 virus, as measured by a viral neutralizing antibody assay.
Seroconversion is defined as detectable SARS-CoV-2 viral neutralizing antibodies in the serum of subjects who tested seronegative at baseline.
Secondary Safety Endpoints Occurrence, intensity and duration of each solicited local AE within 7 days after each trial vaccination in Phase 2b subjects. Occurrence, intensity, duration of each solicited systemic AE within 7 days after each trial vaccination in Phase 2b subjects. Occurrence, intensity and relationship of unsolicited AEs occurring within 28 days after each trial vaccination in Phase 2b subjects. Occurrence of AEs leading to vaccine withdrawal or trial discontinuation through 1 year after the second trial vaccination in all subjects.
4.2.3 Exploratory Endpoints
Exploratory Efficacy Endpoints Severity assessment of first episodes of virologically-confirmed (RT-PCR positive) cases of COVID-19 meeting the case definition for the primary efficacy analysis.

(206) The following endpoints will be analyzed as occurring ≥15 days following the second trial vaccination (full VE) and at any time after the first trial vaccination.

(207) In SARS-CoV-2 naïve subjects:

(208) Occurrence of supplemental oxygenation due to COVID-19 disease. Occurrence of mechanical ventilation due to COVID-19 disease. Occurrence of hospitalization due to COVID-19 disease. Occurrence of death due to COVID-19 disease. Occurrence of death due to any cause.
In SARS-CoV-2 naïve and non-naïve subjects: In all subjects regardless of their baseline serostatus, occurrence of first episodes of virologically-confirmed (RT-PCR positive) cases of COVID-19 of any severity.
The following endpoint will be analyzed in subjects who had a first episode of a virologically-confirmed (RT-PCR positive) case of COVID-19 of any severity meeting the case definition for the primary efficacy analysis. Occurrence of second episodes of virologically-confirmed (RT-PCR positive) cases of COVID-19 of any severity.
Exploratory Immunogenicity Endpoints (Phase 2b Immunogenicity Subset)
On Days 1, 29, 43, 120**, and 211** in peripheral blood mononuclear cells (PBMCs) from up to 400 subjects at selected site(s): The frequency and functionality of SARS-CoV-2 RBD of S-specific T-cell response after antigen stimulation by intracellular cytokine staining (ICS) to investigate Th1 response and expression of Th2 markers. The proportion of subjects with a detectable increase in SARS-CoV 2 RBD of S specific T cell response.
** Testing of samples collected on Day 120 and Day 211 will be done only in subjects categorized as T-cell responders on Day 29 and/or Day 43.
4.3 Estimands

(209) TABLE-US-00023 ENDPOINTS (subject level) ESTIMANDS (population level) Co-Primary Efficacy Occurrence of first episodes of virologically-confirmed In naïve evaluable subjects (complying with the definition (RT-PCR positive) cases of COVID-19 of any severity of Efficacy Analysis Set) at least 15 days following meeting the case definition for the primary efficacy second vaccination: analysis. VE = 1 − RR with exact 97.5% CI Occurrence of first episodes of virologically-confirmed Where RR (relative risk) is the ratio of attack rates of (RT-PCR positive) cases of moderate to severe COVID- COVID-19 cases per 100 person-month in the CVnCoV 19 meeting the case definition for the primary efficacy vaccine group over the placebo group. analysis. Primary Safety Occurrence, intensity and relationship of medically- In subjects who received at least one dose of CVnCoV attended AEs collected through 6 months after the or placebo vaccine, the number and percentage of second trial vaccination in all subjects. subjects by group reporting at least 1 and at each type Occurrence, intensity and relationship of SAEs and (by SOC/PT) of: AESIs collected through 1 year after the second trial Medically-attended AE in the 6 months after the last vaccination in all subjects. vaccination overall, by intensity and by causal Occurrence of fatal SAEs through 1 year after the relationship to trial vaccine. second trial vaccination in all subjects. SAE in the year after the last vaccination overall and by causal relationship to trial vaccine. AESI in the year after the last vaccination overall, by intensity and by causal relationship to trial vaccine. Fatal SAE in the year after the last vaccination. Key Secondary Efficacy Occurrence of first episodes of virologically-confirmed In naïve evaluable subjects (complying with the definition (RT-PCR positive) severe cases of COVID-19 meeting of Efficacy Analysis Set) at least 15 days following the case definition for the primary efficacy analysis. second vaccination: VE = 1 − RR with exact 95% CI Where RR (relative risk) is the ratio of attack rates of severe COVID-19 cases per 100 person-month in the CVnCoV vaccine group over the placebo group. Occurrence of seroconversion to the N protein of SARS- In naïve evaluable subjects (complying with the definition CoV-2 ≥ 15 days following the second trial vaccination of Efficacy Analysis Set) who tested seronegative at in asymptomatic seronegative subjects. baseline and Day 43 for the N protein of SARS-COV-2 Seroconversion is defined as detectable SARS- and with at least 1 of Day 211 or Day 393 serology done: CoV-2 N protein antibodies in the serum of subjects VE = 1 − RR with exact 95% CI on Day 211 and/or Day 393 of the trial, who tested Where RR (relative risk) is the ratio of attack rates of seronegative at Day 1 (baseline) and Day 43 (i.e. Asymptomatic infections (Seroconversion to the N at the 2 testing time points prior to 15 days following protein at Day 211 and then seroconversion to the N the second trial vaccination). protein at either Day 211 or Day 393) in the CVnCoV vaccine group over the placebo group. Other Secondary Efficacy In subjects ≥ 61 years of age, occurrence of first In naïve evaluable subjects ≥ 61 years of age at episodes of virologically-confirmed (RT-PCR positive) randomization (complying with the definition of Efficacy cases of COVID-19 of any severity meeting the case Analysis Set) at least 15 days following second definition for the primary efficacy analysis. vaccination: VE = 1 − RR with exact 95% CI Where RR (relative risk) is the ratio of attack rates of COVID-19 cases per 100 person-month in the CVnCoV vaccine group over the placebo group. Occurrence of virologically-confirmed (RT-PCR In naïve evaluable subjects (complying with the definition positive) SARS-CoV-2 infection, with or without of Efficacy Analysis Set) at least 15 days following symptoms. second trial vaccination: If subject was symptomatic, onset of symptoms VE = 1 − RR with exact 95% CI must have occurred ≥ 15 days following the second Where RR (relative risk) is the ratio of attack rates of trial vaccination; if subject was asymptomatic, the virologically-confirmed (RT-PCR positive) SARS-CoV-2 positive RT-PCR test must have occurred ≥ 15 infection per 100 person-month in the CVnCoV vaccine days following the second trial vaccination. group over the placebo group. BoD scores calculated based on first episodes of In naïve evaluable subjects (complying with the definition virologically-confirmed (RT-PCR positive) cases of of Efficacy Analysis Set) at least 15 days following COVID-19 of any severity meeting the case definition second trial vaccination: for the primary efficacy analysis. VE = 1 − RR with exact 95% CI BoD #1 - no disease (not infected or Where RR (relative risk) is the ratio of attack rates of asymptomatic infection) = 0; mild or moderate virologically-confirmed (RT-PCR positive) SARS-CoV-2 disease = 1; severe disease = 2. infection per 100 person-month in the CVnCoV vaccine BoD #2 - no disease (not infected or group over the placebo group asymptomatic infection) = 0; disease without hospitalization = 1; disease with hospitalization = 2; death = 3. Occurrence of first episodes of virologically-confirmed In naïve subjects who received at least one dose of (RT-PCR positive) cases of COVID-19 of any severity CVnCoV or placebo vaccine at any time after the first with symptom onset at any time after the first trial vaccination: vaccination. VE = 1 − RR with exact 95% CI Where RR (relative risk) is the ratio of attack rates of COVID-19 cases per 100 person-month in the CVnCoV vaccine group over the placebo group Secondary Immunogenicity SARS-CoV-2 RBD of S protein antibody responses In phase 2b subjects belonging to the Immunogenicity On Days 1, 29, 43, 57, 120, 211 and 393: subset and evaluable (complying with the definition of Serum antibodies to SARS-CoV-2 RBD of spike (S) per-protocol immunogenicity set): protein, as measured by enzyme-linked immunosorbent On Days 1, 29, 43, 57, 120, 211 and 393: assay (ELISA). Geometric mean of titers (GMT) with 95% CI of SARS-CoV-2 RBD of S protein antibody responses SARS-CoV-2 RBD of spike (S) protein antibody On Days 1, 29, 43, 57, 120, 211 and 393: responses by group and by baseline sero-status Occurrence of seroconversion to SARS-CoV-2 RBD of and group spike (S) protein, as measured by ELISA. On Days 29, 43, 57, 120, 211 and 393 for subjects Seroconversion is defined as detectable SARS- seropositive at baseline: CoV-2 RBD of spike (S) protein antibodies in the Geometric mean of Fold Change from baseline serum of subjects who tested seronegative at (GMFC) with 95% CI of SARS-CoV-2 RBD of spike baseline. (S) protein antibody responses by group. On Days 29, 43, 57, 120, 211 and 393 for subjects seronegative at baseline: Number and percentage with exact 95% CI of subjects by group for who a seroconversion is observed (detectable SARS-CoV-2 RBD of S protein antibodies in the serum). SARS-CoV-2 viral neutralizing antibody responses (subset In phase 2b subjects belonging to the Immunogenicity of subjects analyzed) subset and evaluable (complying with the definition of On Days 1, 29, 43, 57, 120, 211 and 393: per-protocol immunogenicity set): Serum viral neutralizing antibodies to SARS-CoV-2 On Days 1, 29, 43, 57, 120, 211 and 393: virus, as measured by a viral neutralizing antibody Geometric mean of titers (GMT) with 95% CI of assay. neutralizing antibodies to SARS-CoV-2 virus by SARS-CoV-2 viral neutralizing antibody responses (subset group and by baseline serostatus and group of subjects analyzed) On Days 29, 43, 57, 120, 211 and 393 for subjects On Days 1, 29, 43, 57, 120, 211 and 393: seropositive at baseline: Occurrence of seroconversion to SARS-CoV-2 virus, as Geometric mean of Fold Change from baseline measured by a viral neutralizing antibody assay. (GMFC) with 95% CI of neutralizing antibodies to Seroconversion is defined as detectable SARS- SARS-CoV-2 virus by group. CoV-2 viral neutralizing antibodies in the serum of On Days 29, 43, 57, 120, 211 and 393 for subjects subjects who tested seronegative at baseline. seronegative at baseline: Number and percentage with exact 95% CI of subjects by group for who a seroconversion is observed (detectable neutralizing antibodies to SARS-CoV-2 virus in the serum). Secondary Safety Occurrence, intensity and duration of each solicited In phase 2b subjects who received at least one dose of local AE within 7 days after each trial vaccination in CVnCoV or placebo vaccine: Phase 2b subjects. The number and percentage of subjects by group Occurrence, intensity, duration of each solicited reporting: systemic AE within 7 days after each trial vaccination in Each solicited local AE within 7 days (after each trial Phase 2b subjects. vaccination by intensity and overall Occurrence, intensity and relationship of unsolicited Each solicited systemic AE within 7 days after each AEs occurring within 28 days after each trial vaccination trial vaccination by intensity, by relationship to trial in Phase 2b subjects. vaccine and overall. Occurrence of AEs leading to vaccine withdrawal or trial At least 1 unsolicited AEs, at least 1 grade 3 discontinuation through 1 year after the second trial unsolicited AEs and each unsolicited AEs by vaccination in all subjects. SOC/PT occurring within 28 days after each trial vaccination and overall by causal relationship to trial vaccine and overall At least 1 AEs leading to vaccine withdrawal or trial discontinuation in the year after the last trial vaccination The mean duration in days by group with standard deviation of solicited AEs (within the solicited period, total duration). Exploratory Efficacy Severity assessment of first episodes of virologically- In naïve evaluable subjects (complying with the definition confirmed (RT-PCR positive) cases of COVID-19 of Efficacy Analysis Set) who had a first episode of a meeting the case definition for the primary efficacy virologically-confirmed (RT-PCR positive) case of analysis COVID-19 of any severity meeting the case definition for the primary efficacy analysis: The proportions of mild and severe COVID-19 cases among all cases by group The following endpoints will be analyzed as occurring ≥ 15 In naïve evaluable subjects (complying with the definition days following the second trial vaccination (full vaccine of Efficacy Analysis Set) at least 15 days following efficacy) and at any time after the first trial vaccination. second vaccination AND In subjects who received at Occurrence of supplemental oxygenation due to least one dose of CVnCoV or placebo vaccine at any COVID-19 disease. time after the first trial vaccination: Occurrence of mechanical ventilation due to COVID-19 Number and percentages by group of subjects who: disease. Need for supplemental oxygenation due to COVID- Occurrence of hospitalization due to COVID-19 19. disease. Need for mechanical ventilation due to COVID-19. Occurrence of death due to COVID-19 disease. Hospitalized due to COVID-19. Occurrence of death due to any cause. Deceased due to COVID-19. Deceased due to any cause. In all subjects regardless of their baseline serostatus, In subjects who received at least one dose of CVnCoV occurrence of first episodes of virologically-confirmed or placebo vaccine, at any time after the first trial (RT-PCR positive) cases of COVID-19 of any severity. vaccination: VE = 1 − RR with exact 95% CI Where RR (relative risk) is the ratio of attack rates of COVID-19 cases per 100 person-month in the CVnCoV vaccine group over the placebo group The following endpoint will be analyzed in subjects who had In naïve evaluable subjects (complying with the definition a first episode of a virologically-confirmed (RT-PCR positive) of Efficacy Analysis Set) who had a first episode of a case of COVID-19 of any severity meeting the case virologically-confirmed (RT-PCR positive) case of definition for the primary efficacy analysis. COVID-19 of any severity meeting the case definition for Occurrence of second episodes of virologically- the primary efficacy analysis, at least 15 days following confirmed (RT-PCR positive) cases of COVID-19 of any second vaccination: severity. The number and percentage of subjects who developed a second episode of COVID-19. Exploratory Immunogenicity On Days 1, 29, 43, 120**, and 211** in peripheral blood Exploratory immunogenicity estimands will be described mononuclear cells (PBMCs) from up to 400 subjects at in the Statistical Analysis Plan, as applicable. selected site(s): The frequency and functionality of SARS-CoV-2 RBD of S-specific T-cell response after antigen stimulation by intracellular cytokine staining (ICS) to investigate Th1 response and expression of Th2 markers. The proportion of subjects with a detectable increase in SARS-CoV-2 RBD of S-specific T-cell response. **Testing of samples collected on Day 120 and Day 211 will be done only in subjects categorized as T-cell responders on Day 29 and/or Day 43.
5 TRIAL DESIGN
5.1 Overall Design

(210) Trial CV-NCOV-004 will be conducted in 2 parts: an initial Phase 2b trial followed by transition to a large Phase 3 efficacy trial. Both Phase 2b and Phase 3 will be conducted as randomized, observer-blinded, placebo-controlled trials. Subjects 18 years of age or older will be enrolled at multiple sites globally and will receive a 2-dose schedule of either CVnCoV at a dose level of 12 μg mRNA or placebo {normal saline (0.9% NaCl)} in a 1:1 ratio. Both Phase 2b and Phase 3 parts of the trial are consistent in design (e.g., for COVID-19 case ascertainment and case definition) so that cases of COVID-19 occurring in Phase 2b can be pooled with those in Phase 3 for the primary analysis of VE.

(211) Subjects will also participate in a 1-year extension of the Phase 2b and Phase 3 parts of the trial.

(212) Phase 2b Design and Objectives

(213) The objective of Phase 2b is to further characterize the safety, reactogenicity, and immunogenicity of CVnCoV prior to initiating Phase 3. CVnCoV will be administered at the 12 μg dose level selected for Phase 3 investigation informed by the safety and immunogenicity data from the initial Phase 1 and 2a trials. Phase 2b will be conducted in 2 age groups of adults: 18 to 60 and ≥61 years of age, which represent the age range of the intended Phase 3 trial population.

(214) Approximately 4,000 subjects will be enrolled and randomized in a 1:1 ratio to receive 2 doses of either CVnCoV at a dose level of 12 μg mRNA or placebo, administered 28 days apart. Of the 4,000 subjects enrolled, approximately 800 to 1,000 (20% to 25%) will be ≥61 years of age. Phase 2b will be performed in an observer-blinded manner to reduce any potential bias in the safety assessments. The sample size of 4,000 subjects is based on generating a robust and detailed dataset characterizing the safety, reactogenicity, and immunogenicity of CVnCoV prior to entering Phase 3. Furthermore, the data generated in Phase 2b will be the main dataset to be submitted in support of early conditional approval of CVnCoV.

(215) In Phase 2b, the safety and reactogenicity of a 2-dose schedule of CVnCoV will be assessed in detail by measuring the frequency and severity of the following AEs: solicited local and systemic reactions for 7 days after each vaccination; unsolicited AEs for 28 days after each vaccination; medically-attended AEs through 6 months after the second trial vaccination; and AESIs and SAEs through 1 year after the second trial vaccination. The immunogenicity of CVnCoV will be evaluated after 1 and 2 doses in a subset of subjects (first 600 subjects enrolled in each of the 2 age groups; a total of 1,200 subjects in the Immunogenicity Subset) by measuring binding antibodies to the SARS-CoV-2 RBD of S protein and viral neutralizing antibodies. Antibody persistence will be evaluated in this trial as well as in the Extension Study.

(216) Cases of COVID-19 occurring in Phase 2b subjects will be collected and pooled with those occurring in Phase 3 and the total number of cases will be used for the primary analysis of efficacy. In addition, the DSMB will periodically monitor COVID-19 cases for signals of VDE.

(217) Subjects participating in Phase 2b will also be evaluated for asymptomatic SARS-CoV-2 infection during the trial, as measured by the development of antibodies to the N protein of SARS-CoV-2 (i.e. seroconversion). These data will be combined with those from Phase 3 to determine if vaccination with CVnCoV can prevent or reduce the rate of asymptomatic infection by SARS-CoV-2 (one of the key secondary efficacy objectives).

(218) Initiation of subject enrollment of the 2 target age groups into Phase 2b will be flexible. Depending on the timing of data from the Phase 1 and Phase 2a trials, enrollment of the 2 age groups into Phase 2b may be staggered, initially starting with subjects 18 to 60 years of age followed by subjects ≥61 years of age. As the older age group will comprise 20% to 25% of the total number of subjects in Phase 2b, this staggered start is not expected to impact overall enrollment of the Phase 2b cohort.

(219) An early safety review of the Phase 2b data will be performed by the DSMB (see Section 9.3.9.1). The safety review will be conducted when approximately 1,000 subjects have been enrolled in Phase 2b (25% of subjects enrolled; 500 recipients of CVnCoV and 500 recipients of placebo) and have at least 1 week of safety follow-up after the first trial vaccination. If the safety profile is judged to be acceptable and there are no safety or tolerability concerns, it is anticipated that enrollment of subjects into Phase 3 can begin without interruption from Phase 2b. Another safety review by the DSMB will be conducted when approximately 1,000 Phase 2b subjects have received their second trial vaccination and have at least week of safety follow-up. All available first dose safety data from the Phase 2b subjects will also be reviewed at this time.

(220) Phase 3 Design and Objectives

(221) The co-primary objectives of the combined Phase 2b/3 trial are to demonstrate the efficacy of a 2-dose schedule of CVnCoV in the prevention of COVID-19 cases of any severity or COVID-19 cases of moderate or higher severity. Similar to Phase 2b, Phase 3 will be conducted as a randomized, observer-blinded, placebo controlled trial. Approximately 32,500 subjects, 18 years of age or older, will be enrolled at multiple sites globally in Phase 3 and will receive a 2-dose schedule of either CVnCoV at the 12 μg dose level or placebo in a 1:1 ratio (see FIG. 2). Similar to Phase 2b, enrollment will target subjects ≥61 years of age to be approximately 20% to 25% of the Phase 3 trial population (6,500 to 8,125 subjects). The total enrollment of the combined Phase 2b and Phase 3 parts of the trial will be 36,500 subjects.

(222) Subjects will undergo active surveillance for COVID-19. During all site visits and phone calls, subjects will be reminded to contact the site if they have an acute illness with any symptoms clinically consistent with COVID-19. In addition, subjects will be messaged up to twice a week and will provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for a follow-up interview and assessment. If a subject is suspected of having COVID-19 illness, he/she will undergo testing for SARS-CoV-2 infection with samples collected at the site or at a home visit. If the subject is confirmed to have COVID-19, all subjects will be followed until resolution of their disease. If the subject is hospitalized, the subject's progress must continue to be followed by the Investigator and a discharge summary obtained at the end of the hospitalization. Information on clinical symptoms and signs, their duration and severity, and treatment and outcome of the COVID-19 episode will be documented by trial staff and recorded in the electronic case report form (eCRF). Upon resolution, subjects will continue to be followed through the trial end in the same manner as those who have not presented with COVID-19. A second episode of COVID-19 in a subject with prior disease will not be counted as a primary efficacy case, but will be counted for the exploratory objective assessing the reoccurrence of COVID-19 in vaccinated subjects.

(223) Due to the uncertain incidence rate of COVID-19 cases in a pandemic setting, the trial will be conducted as a case-driven trial based on the any severity COVID-19 endpoint, which will include a two interim analyses and a final analysis both triggered by achieving a predefined number of cases for each analysis. As described above, cases of COVID-19 occurring in Phase 2b will be pooled with those in Phase 3 for the primary analysis of VE. As such, subjects participating in Phase 2b will contribute to the total sample size for the primary analysis of VE (N=36,500).

(224) For the primary analysis of efficacy, the case must meet the following criteria (moderate and severe COVID-19 disease is defined herein): Must be a virologically-confirmed case of COVID-19 defined as a positive SARS CoV 2 specific RT-PCR test in a person with clinically symptomatic COVID-19 (see Section 9.2). Symptom onset must have occurred ≥15 days following the second trial vaccination. The subject must not have a history of virologically-confirmed COVID-19 at enrollment (based on exclusion criterion 1) or have developed a case of virologically-confirmed COVID-19 before 15 days following the second trial vaccination. The subject must have been demonstrated to be SARS-CoV-2 naïve at baseline and at Day 43 (seronegative to N protein).

(225) Primary efficacy cases must be confirmed by the Adjudication Committee.

(226) This trial will utilize a group sequential design with 2 interim analyses for high efficacy or futility using the O'Brien and Fleming error spending function for the co-primary endpoint of virologically-confirmed COVID-19 cases of any severity. With an overall 2-sided alpha of 2.5% and a total of 185 COVID-19 cases of any severity meeting the primary efficacy case definition at the final analysis, the trial will have an overall power of 90% to demonstrate a VE greater than 30% {based on a margin of 30% for the lower bound of the 97.5% confidence interval (CI) for VE} when considering VE is 60%. Two interim analyses of high efficacy or futility will be performed once 56/111 cases meeting the primary case definition have been accrued (30%/60% of final case number). These points were chosen based on 2 criteria: i) the robustness of 56/111 cases to support the decision of high efficacy or futility and ii) if high efficacy, this would shorten the duration of the trial and potentially allow the vaccine to be available earlier. For the co-primary endpoint of virologically-confirmed moderate to severe COVID-19 cases, with an overall 2-sided alpha of 2.5% and a total of 60 severe to moderate COVID 19 cases meeting the primary efficacy case definition at the final analysis, the trial will have an overall power of 90% to demonstrate a VE greater than 20% {based on a margin of 20% for the lower bound of the 97.5% confidence interval (CI) for VE} when considering VE is 70%. Assuming that ⅓ of COVID-19 cases are moderate to severe, 60 moderate to severe cases will be obtained when the total number of COVID-19 cases is 180. There will be no interim analysis for this co-primary endpoint. Assuming an incidence rate of COVID-19 of 0.15% per month (1.5 cases/1000/month) in placebo subjects; a VE of 60%; and a non-evaluable rate of 20% during the trial which includes ˜5% seropositivity of enrollees at baseline (i.e. non-naïve subjects), follow-up of 36,500 subjects enrolled over 3 months (18,250 per vaccine group) will accrue the target 185 COVID-19 cases of any severity approximately 9 months after the first vaccination.

(227) At or near the completion of enrollment, an unblinded review of the incidence rate of cases will be performed by the DSMB. If the case accrual rate is lower than expected, the DSMB may recommend an increase in sample size. If needed, another unblinded review by the DSMB may be performed later in the trial to further adjust the sample size. The trial events are shown in the timeline below (the 1-year Extension Study is discussed below).

(228) With an equal follow-up time of evaluable subjects in both groups, efficacy would be demonstrated at the final analysis if 60 cases or less of the 185 total cases are in the CVnCoV group (estimated VE≥52.0%). Two interim analyses for high efficacy or futility will be performed when 56/111 cases meeting the primary case definition have been accrued (approximately 5/6.5 months after trial start). If the follow-up time of evaluable subjects is equal in both groups, early high efficacy would be demonstrated if 7/29 cases or less of the 56/111 cases are in the CVnCoV group (estimated VE at interim≥85.7%/64.6%); conversely, futility would be reached if 26/41 cases or more are in the CVnCoV group (estimated VE at interim≤13.3%/41.4%). The assessment of the interim analyses will be performed by the DSMB and the outcome will be communicated without unblinding the Trial Team or the Sponsor.

(229) Similar to Phase 2b, subjects participating in Phase 3 will be evaluated for SARS-CoV-2 infection during the trial, as measured by the development of antibodies to the N protein of SARS-CoV-2 in seronegative subjects.

(230) The safety objective of Phase 3 is to generate a large-scale safety database that will demonstrate the safety of CVnCoV. All subjects participating in the Phase 2b and Phase 3 parts of the trial will have medically-attended AEs collected for 6 months after the second vaccination; and AESIs and SAEs collected for 1 year after the second vaccination.

(231) Independent of the demonstration of CVnCoV efficacy at either of the interim analyses or at the final analysis, HERALD Trial CV-NCOV-004 will continue and remain observer blinded until the end of the trial {when the last subject has completed the last visit on Day 393 (see Section 5.4)}. During this period, collection of placebo-controlled safety data and accrual of COVID-19 cases will continue.

(232) Extension Study

(233) Following completion of the trial on Day 393, subjects will continue participating in the 1 year (12-month) extension of HERALD Trial CV-NCOV-004. During the Extension Study, blinding at the site level will be maintained for the collection of additional placebo controlled data for safety (SAEs), persistence of antibodies to SARS-CoV-2, and occurrence of COVID-19 cases to assess duration of efficacy. The Extension Study may be terminated upon approval of CVnCoV, at which time control subjects may be offered vaccination with CVnCoV as soon as feasible. The Extension Study may also be terminated upon deployment of an effective vaccine locally. Before terminating the Extension Study, this will be discussed with the DSMB and Investigators as well as with the relevant regulatory agencies.

(234) 5.2 Scientific Rationale for Trial Design

(235) HERALD Trial CV-NCOV-004 will be conducted in 2 parts: an initial Phase 2b trial followed by transition to a large Phase 3 efficacy trial. Both Phase 2 and Phase 3 parts of the trial are consistent in design, so that cases of COVID-19 occurring in Phase 2 can be pooled with those in Phase 3 for the primary analysis of VE. Combining COVID-19 cases in Phase 2 and 3 to expedite an efficacy outcome was considered warranted in a pandemic setting.

(236) Both Phase 2b and Phase 3 will be randomized, observer-blinded, and placebo-controlled. The difference in appearance and presentation of the investigational CVnCoV vaccine and placebo requires the trial to be conducted in an observer-blinded manner, which is a commonly used and well-accepted method for trial blinding. The randomized, observer blinded, and placebo-controlled design will reduce the risk of bias in the safety and efficacy outcomes of the trial (see also Section 7.3).

(237) As the elderly are affected most by SARS CoV 2 and have a high risk for severe disease and mortality, it is critical to investigate CVnCoV in this population and therefore subjects ≥61 years of age will be included.

(238) The sample size of 4,000 subjects in Phase 2b is based on generating a robust and detailed dataset characterizing the safety, reactogenicity, and immunogenicity of CVnCoV prior to entering Phase 3. Furthermore, the data generated in Phase 2b will be the main dataset to be submitted in support of early conditional approval of CVnCoV. The total sample size of 36,500 subjects for the combined Phase 2b/3 trial is based on demonstrating VE above 30% (based on a margin of 30% for the lower bound of the 97.5% CI for VE) when considering VE is 60%. With a 2-sided alpha of 2.5% and a total of 185 COVID-19 cases, the trial will have a 90% power to demonstrate a VE above 30%. Assuming an incidence rate of COVID-19 of 0.15% per month in control subjects; and a non-evaluable rate of 20% during the trial which includes 5% seropositivity of enrollees at baseline (i.e. non-naïve subjects), follow-up of 36,500 subjects enrolled over 3 months (18,250 per vaccine group) will accrue the target 185 COVID-19 cases approximately 9 months after the first vaccination.

(239) For the co-primary analyses of efficacy, COVID-19 case ascertainment begins at ≥15 days following the second vaccination of CVnCoV. This time point allows the immune response to mature and reach its full height following the second dose. As such, case ascertainment starting at this time point represents the evaluation of full VE of CVnCoV against COVID 19.

(240) The safety objective of Phase 3 is to generate a large-scale safety database that will demonstrate the safety of CVnCoV. All subjects participating in the Phase 2b and Phase 3 parts of the trial will have medically-attended AEs collected for 6 months after the second vaccination; and AESIs and SAEs collected for 1 year after the second vaccination. As such, each subject will participate in the trial for approximately 13.5 months for the safety follow-up. Individuals with history of virologically-confirmed COVID-19 illness will be excluded from participating in this trial. However, this trial will not screen for or exclude participants with history or laboratory evidence of prior SARS-CoV-2 infection, many of which might have been asymptomatic. Because pre-vaccination screening for prior infection is unlikely to occur in practice, it is important to understand vaccine safety and COVID-19 outcomes in in individuals with prior infection with SARS-CoV-2 virus.

(241) 5.3 Justification for Dose

(242) Selection of the 12 μg mRNA dose level of CVnCOV for Trial CV-NCOV-004 was based on the safety, tolerability and immunogenicity results from Trials CV-NCOV-001 and CV NCOV-002.

(243) 5.4 End of Trial Definition

(244) A subject is considered to have completed the trial when he/she has completed all visits, and procedures and tests applicable for the group to which he/she was randomized to.

(245) End of Trial CV-NCOV-004 is defined as when the last subject has completed the last visit on Day 393 or prematurely discontinued the trial.

(246) All subjects are expected to continue in the 1 year Extension Study in which the end of the trial is defined as when the last subject has completed the last visit on Day 757.

(247) 5.5 Stopping/Pausing Rules for Safety

(248) 5.5.1 Individual Subject Stopping Rules

(249) The individual subject stopping rules are met in case any of the following events occur after the first trial vaccination: An allergic/anaphylactic reaction considered as related to the trial vaccine Any SAE considered as related to the trial vaccine
If any of these rules are met, the subject must not receive the second vaccine dose. The subject will be encouraged to continue participation until the end of the trial for safety.
5.5.2 Pausing of the Trial

(250) The decision to pause the trial (i.e. temporary stopping of enrollment and vaccinations) due to a safety signal will be based on a recommendation from the DSMB in consultation with the Sponsor (see Section 9.3.9.1). The DSMB may recommend pausing the trial for a safety concern following a review of accumulating safety data presented at the regularly scheduled DSMB meetings or from an ongoing review of AEs, which include but are not limited to, suspected unexpected serious adverse reactions (SUSARs); all SAEs judged as related to trial vaccine; concerning SAEs (e.g., AESIs); and all life-threatening AEs and deaths. These events will be monitored by the DSMB on a regular basis during the trial. The selected AEs and procedures for the safety review are described in detail in the DSMB Charter.

(251) To ensure subject safety on an ongoing basis, a blinded listing of the AEs as described above will be routinely monitored by the Chair of the DSMB (or designee) at regular intervals. For each review, the Chair {or designee(s)} will determine whether any single event or group of events constitute a new safety signal. If not, the Chair will inform the Study Team that there are no safety concerns. Conversely, if there is a safety concern, the Chair may unblind the AE or AEs and, if necessary, convene an ad-hoc DSMB meeting for further assessment of the event(s).

(252) Based on the assessment of the benefit-risk ratio and biologic plausibility of a causal relationship of the AE(s) to the trial vaccine, the DSMB will make a recommendation to the Sponsor to either continue the trial as planned, modify its conduct, or pause the trial to allow further evaluation of the AE. If the latter, the Sponsor will make the decision to pause the study in consultation with the DSMB.

(253) Please refer to the DSMB Charter for additional discussion of the DSMB's role and responsibilities.

(254) 6 TRIAL POPULATION

(255) The criteria for enrollment are to be followed explicitly. If it is noted that a subject who does not meet one or more of the inclusion criteria and/or meets one or more of the exclusion criteria is inadvertently enrolled and dosed, the Sponsor must be contacted immediately.

(256) In this trial, individuals with a history of virologically-confirmed COVID-19 illness will be excluded from the trial. However, this trial will not screen for or exclude individuals with a history or laboratory evidence of prior SARS-CoV-2 infection. In addition, routine RT PCR testing will not be performed at screening to exclude individuals with SARS CoV 2 infection at the time of enrollment. Any country specific regulation(s) will be adhered to in addition.

(257) 6.1 Inclusion Criteria for All Subjects Subjects will be enrolled in this trial only if they meet all of the following criteria:

(258) 1. Male or female subjects 18 years of age or older.

(259) 2. Provide written informed consent prior to initiation of any trial procedures.

(260) 3. Expected compliance with protocol procedures and availability for clinical follow-up through the last planned visit.

(261) 4. Females of non-childbearing potential defined as follows: surgically sterile (history of bilateral tubal ligation, bilateral oophorectomy or hysterectomy) or postmenopausal {defined as amenorrhea for ≥12 consecutive months prior to screening (Day 1) without an alternative medical cause}. A follicle-stimulating hormone (FSH) level may be measured at the discretion of the Investigator to confirm postmenopausal status.
5. Females of childbearing potential: negative urine pregnancy test {human chorionic gonatropin {hCG}} within 24 hours prior to each trial vaccination on Day 1 and Day 29.
6. Females of childbearing potential must use highly effective methods of birth control from 2 weeks before the first administration of the trial vaccine until 3 months following the last administration. The following methods of birth control are considered highly effective when used consistently and correctly: Combined (estrogen and progestogen containing) hormonal contraception associated with inhibition of ovulation (oral, intravaginal or transdermal); Progestogen-only hormonal contraception associated with inhibition of ovulation (oral, injectable or implantable); Intrauterine devices (IUDs); Intrauterine hormone-releasing systems (IUSs); Bilateral tubal occlusion; Vasectomized partner or infertile partner; Sexual abstinence {periodic abstinence (e.g., calendar, ovulation, symptothermal and post-ovulation methods) and withdrawal are not acceptable}.
6.2 Exclusion Criteria
Subjects will not be enrolled in this trial if they meet any of the following criteria:
1. History of virologically-confirmed COVID-19 illness.
2. For females: pregnancy or lactation.
3. Use of any investigational or non-registered product (vaccine or drug) within 28 days preceding the administration of the first trial vaccine or planned use during the trial.
4. Receipt of licensed vaccines within 28 days (for live vaccines) or 14 days (for inactivated vaccines) prior to the administration of the first trial vaccine.
5. Prior administration of any investigational SARS-CoV-2 vaccine or another coronavirus (SARS-CoV, MERS-CoV) vaccine or planned use during the trial.
6. Any treatment with immunosuppressants or other immune-modifying drugs (including but not limited to corticosteroids, biologicals and methotrexate) for >14 days total within 6 months preceding the administration of trial vaccine or planned use during the trial. For corticosteroid use, this means prednisone or equivalent, 0.5 mg/kg/day for 14 days or more. The use of inhaled, topical, or localized injections of corticosteroids (e.g., for joint pain/inflammation) is permitted.
7. Any medically diagnosed or suspected immunosuppressive or immunodeficient condition based on medical history and physical examination including known infection with human immunodeficiency virus (HIV), hepatitis B virus (HBV) or hepatitis C virus (HCV); current diagnosis of or treatment for cancer including leukemia, lymphoma, Hodgkin disease, multiple myeloma, or generalized malignancy; chronic renal failure or nephrotic syndrome; and receipt of an organ or bone marrow transplant.
8. History of angioedema (hereditary or idiopathic), or history of any anaphylactic reaction or pIMD.
9. History of allergy to any component of CVnCoV vaccine.
10. Administration of immunoglobulins or any blood products within 3 months prior to the administration of trial vaccine or planned receipt during the trial.
11. Subjects with a significant acute or chronic medical or psychiatric illness that, in the opinion of the Investigator, precludes trial participation (e.g., may increase the risk of trial participation, render the subject unable to meet the requirements of the trial, or may interfere with the subject's trial evaluations). These include severe and/or uncontrolled cardiovascular disease, gastrointestinal disease, liver disease, renal disease, respiratory disease, endocrine disorder, and neurological and psychiatric illnesses. However, those with controlled and stable cases can be included in the trial.
12. Subjects with impaired coagulation or any bleeding disorder in whom an intramuscular injection or a blood draw is contraindicated.
13. Foreseeable non-compliance with the trial procedures as judged by the Investigator.
6.3 Vaccine Delay Recommendations

(262) After enrollment, subjects may encounter clinical circumstances that could warrant a delay of trial vaccine administration as described below. Subjects with a clinically significant (≥Grade 2) active infection or other acute disease (as assessed by the Investigator) or temperature ≥38.0° C. (≥100.4° F.), within 3 days of intended trial vaccination on Day 1 or Day 29. This includes symptoms that could represent COVID-19 illness. Trial vaccination should be delayed until the active infection or other acute disease has recovered to <Grade 1 or the subject's temperature has decreased to <38.0° C. (<100.4° F.). Following resolution of the illness, the subject may be rescheduled for trial vaccination based on the judgment of the Investigator. Afebrile subjects with a minor illness may be vaccinated at the discretion of the Investigator. Receipt of a licensed vaccine within 28 days (for live vaccines) or 14 days (for inactivated vaccines) prior to or after scheduled administration of trial vaccine. As these are recommended windows, rescheduling trial vaccination to be compliant with these windows should only be done if practical.
6.4 Failure to Meet Eligibility Criteria

(263) The Investigator must account for all subjects who sign an informed consent. If the subject is found to be not eligible (i.e., did not meet all inclusion criteria or met one or more exclusion criteria), the Investigator should document this in the subject's source documents.

(264) 7 TRIAL VACCINE

(265) 7.1 Trial Vaccine Administration

(266) 7.1.1 Description of the Trial Vaccines

(267) CVnCoV is an investigational LNP-formulated RNActive® SARS-CoV-2 vaccine. The IMP is composed of the active pharmaceutical ingredient, an mRNA that encodes Wsmpv-SP, and 4 lipid components: cholesterol, 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), PEG-ylated lipid and a cationic lipid. It is supplied as a concentrate at 1 mg/mL of mRNA drug substance.

(268) The placebo vaccine will be sterile normal saline (0.9% NaCl) for injection.

(269) 7.1.2 Dosing and Administration

(270) 7.1.2.1 CVnCoV

(271) Subjects randomized to CVnCoV will receive 2 injections of CVnCoV at a dose level of 12 μg mRNA, administered 28 days apart.

(272) Administration of CVnCoV must be performed by intramuscular (IM) injection in the deltoid area, preferably in the non-dominant arm. CVnCoV is intended strictly for IM injection and must not be injected subcutaneously, intradermally, or intravenously. The instructions for injection as described in the Pharmacy Manual must be followed.

(273) 7.1.2.2 Placebo Control (Normal Saline)

(274) Subjects randomized to the control arm of the trial will receive 2 doses of saline placebo {normal saline (0.9% NaCl) for injection}, administered 28 days apart.

(275) Administration of saline placebo must be performed by IM injection in the deltoid area, preferably in the non-dominant arm. The instructions for injection described in the Pharmacy Manual must be followed.

(276) 7.1.2.3 Hypersensitivity Reactions to Vaccination

(277) CVnCoV should not be administered to subjects with a known hypersensitivity to any of the components of the vaccine.

(278) Since there is a theoretical risk of anaphylactic reactions, trial vaccine must only be administered if emergency equipment for the treatment of anaphylactic reactions (intravenous fluids, corticosteroids, H1 and H2 blocking agents, epinephrine, equipment for cardiopulmonary resuscitation) is readily available. All subjects must remain under direct supervision of personnel trained in the treatment of these reactions for at least 30 minutes following administration of trial vaccine.

(279) If anaphylaxis or severe hypersensitivity reactions occur following trial vaccine administration, no further doses should be given (see Sections 5.5.1 and 8.1).

(280) 7.2 Preparation/Handling/Storage/Accountability

(281) Refer to the Pharmacy Manual for detailed information on the preparation, handling, storage and blinding of CVnCoV and saline placebo.

(282) 7.2.1 CVnCoV Preparation

(283) The concentrated CVnCoV must be diluted in the provided sterile normal saline (0.9% NaCl) diluent containing preservative to produce the dose solution for IM injection. This will be prepared by an unblinded qualified pharmacist according to the Handling Manual for the IMP provided by CureVac AG. The pharmacist will have no other trial function following vaccination and will maintain the treatment assignments in strict confidence.

(284) 7.2.2 CVnCoV Product Storage and Stability

(285) Concentrated CVnCoV will be shipped to the site frozen at below −60° C.

(286) Once at the site, concentrated CVnCoV should be stored frozen at below −60° C.

(287) 7.2.3 Placebo Control (Normal Saline)

(288) The normal saline placebo control vaccine should be stored according to the Summary of Product Characteristics.

(289) 7.2.4 Accountability

(290) It is the responsibility of the Investigator to ensure that the current and accurate records of trial supplies received, stored, and dispensed at the site are maintained using appropriate forms according to applicable regulations and guidelines. The trial supplies must be stored under the recommended storage conditions, locked with restricted access (refer to the Pharmacy Manual). Authorized personnel must dispense the vaccine at the trial site and in accordance with the protocol and applicable regulations and guidelines.

(291) IMP accountability and inventory logs must be kept up-to-date at the trial site with the following information: Dates and quantities of CVnCoV received from CureVac. Unique subject identifier. Date and quantity of trial vaccine dispensed to each subject. Initials of the person preparing the dose. Initials of the person administering the vaccine.

(292) These logs must be readily available for inspections and are open to regulatory inspection at any time.

(293) 7.3 Randomization and Blinding

(294) Both Phase 2b and Phase 3 will be randomized, observer-blinded, and placebo-controlled. The difference in appearance of the investigational CVnCoV vaccine and placebo required the trial to be conducted in an observer-blinded manner, which is a well-accepted method for blinding.

(295) 7.3.1 Randomization

(296) Subjects 18 years of age or older will be enrolled at multiple sites globally and will be randomized in a 1:1 ratio to receive either CVnCoV or placebo. The randomization will be performed centrally and stratified by country and age group (18 to 60 and 61 years of age). The randomization scheme will be generated and maintained by an Independent Statistical group at the contract research organization (CRO), PRA. Subjects will be enrolled into the trial online and randomized using an interactive web response system (IWRS). After demographic and eligibility criteria are entered into the system, each subject enrolled into the trial will be assigned their treatment assignment.

(297) 7.3.2 Blinding

(298) Subjects will be randomized and vaccinated with CVnCoV or placebo in an observer blinded manner (due to the difference in appearance and presentation of the investigational CVnCoV vaccine and placebo). The pharmacist at the site will not be blinded to the identity of the trial vaccine being administered to the subject. However, the vaccinator, Investigator and all site personnel involved in the conduct of the trial (including follow-up of safety and COVID-19 case ascertainment) will be blinded to trial vaccine and subject treatment assignments. To maintain the blinding of the vaccinator, the pharmacist will provide the dose of trial vaccine to the vaccinator prefilled in a syringe with a label covering the liquid contents so that it is not visible. All personnel at the CRO and Sponsor directly involved in the conduct of the trial will also be blinded. There will be certain individuals at the CRO and Sponsor whose function requires them to be unblinded during the trial {e.g., unblinded monitoring for trial vaccine accountability in the pharmacy; unblinded independent statistician assisting the DSMB; review of immunogenicity data (see next paragraph)}. These unblinded individuals will be identified and their responsibilities documented. Because the immunogenicity results would unblind the subject's treatment assignment, the independent laboratory performing the assays will keep the results in strict confidence. An unblinded person, named at the start of the trial and independent of the conduct of the trial, will have the responsibility of reviewing the quality of the immunogenicity data as it is being generated. This person will maintain the results in strict confidence. To maintain the blind, the immunogenicity data will only be merged with the clinical database following unblinding of the trial.

(299) It will be at the discretion of the DSMB members whether or not safety data reviewed at the DSMB meetings will be unblinded. If there are any safety concerns, the DSMB may request unblinding of an individual subject or a specific dataset at any time. In addition, the DSMB will periodically monitor COVID-19 cases by vaccine group for signals of VDE. At the interim analyses, the DSMB will review cases of COVID-19 cases by vaccine group for efficacy or futility, and will communicate the outcome to the Sponsor in a blinded manner.

(300) For the submission of documents for regulatory approval during the ongoing conduct of Trial CV-NCOV-004 (e.g., if efficacy is demonstrated at one of the interim analyses), an unblinded Submission Team will be formed which will be completely independent of the team conducting the trial. The Submission Team will comprise individuals from the Sponsor and CRO, and their roles and responsibilities on the unblinded team will be clearly defined.

(301) 7.3.3 Emergency Unblinding

(302) Individual unblinding should only occur in emergency situations for reasons of subject safety when knowledge of the trial vaccine is essential for the clinical management or welfare of the subject. Unblinding in this situation will be based on the judgment of the Investigator, ideally in discussion with the Sponsor.

(303) In general, the identity of the trial vaccine should not affect the clinical management of any SAE/AE. Whenever possible, the Investigator should attempt to contact the Sponsor before breaking the blind to discuss the need for emergency unblinding. Once agreed, code-breaking will be carried out via the IWRS.

(304) When the blind is broken, the date, exact timing, and reason must be fully documented in the source documents. The Investigator should not inform other blinded trial staff of the identity of the IMP.

(305) If the code has been broken and there are no medical reasons for discontinuation, the subject may continue in the trial. If the subject has received at least 1 dose of trial vaccine, it will be the judgment of the Investigator, in consultation with the Sponsor, whether the subject will be vaccinated with the second dose. If the subject is discontinued from the trial, every effort should be made to continue safety follow-up of the subject until the end of the trial.

(306) 7.4 Vaccine Compliance

(307) The Investigator must record all trial vaccinations administered in the subject's eCRF page.

(308) 7.5 Misuse and Overdose

(309) Definition of misuse: Situations where the trial vaccine is intentionally and inappropriately used not in accordance with the protocol dosing instructions or authorized product information.

(310) Definition of overdose: Administration of a quantity of the trial vaccine given per administration or cumulatively which is above the maximum recommended dose according to the protocol dosing instructions or authorized product information.

(311) No toxic effects are expected from current clinical and non-clinical experience. Possible local reactions (pain) or systemic AEs (fever, headache, fatigue, chills, myalgia, arthralgia, nausea/vomiting and diarrhea) may be treated symptomatically with physical measures, paracetamol, or non-steroidal anti-inflammatory drugs.

(312) 7.6 Concomitant Therapy and Vaccines

(313) Concomitant medication and vaccines including the reason for administration must be recorded in the subject's eCRF.

(314) 7.6.1 Permitted Medications/Vaccines During the Trial

(315) Subjects are permitted to use antipyretics and other pain medications to treat any ongoing condition(s) the subject may have. Antipyretics (e.g., paracetamol) or other pain medication may be used to treat any local and/or systemic reactions associated with trial vaccination. Paracetamol taken prophylactically for potential vaccine-associated reactions is also permitted in this trial. For example, if a subject experiences adverse reactions following the first trial vaccination, paracetamol may be taken prophylactically for these reactions for the second trial vaccination. In this case, paracetamol (up to 1 gram dose) may be taken after trial vaccination and at bedtime, and then in the morning and at bedtime during the next day. Alternatively, a 500 mg dose of paracetamol may be taken every 6 hours after trial vaccination for up to 36 hours. The dose and dosing schedule of paracetamol should be discussed with the Investigator.

(316) Paracetamol administered as a treatment for vaccine-associated reactions or for prophylaxis, along with timing of administration with respect to trial vaccination must be documented in the eCRF.

(317) Other than the prohibited medications and vaccines described in Section 6.2 and listed below in Section 7.6.2, medications that are required for the treatment of the subject's pre existing medical conditions are permitted.

(318) 7.6.2 Prohibited Medications/Vaccines During the Trial

(319) Use of any investigational or non-registered product (vaccine or drug) is prohibited during the trial. Licensed vaccines should not be administered within 28 days (for live vaccines) or 14 days (for inactivated vaccines) of trial vaccine administration during the trial. Receipt of any other investigational SARS-CoV-2 vaccine or other coronavirus vaccine is prohibited during the trial. Any treatment with immunosuppressants or other immune-modifying drugs (including but not limited to corticosteroids, biologicals and methotrexate) is prohibited during the trial. For corticosteroid use, this means prednisone or equivalent, 0.5 mg/kg/day for 14 days or more. The use of inhaled, topical, or localized injections of corticosteroids (e.g., for joint pain/inflammation) is permitted. Administration of immunoglobulins or any blood products is prohibited during the trial.
7.7 Therapy Leading to Discontinuation

(320) If a subject requires therapy listed as an exclusion criterion in Section 6.2 and which cannot be delayed, discontinuation would be considered to ensure integrity of the trial data, following individual case review. Every effort should be made to continue safety follow-up of the subject until the end of the trial.

(321) 7.8 Treatment After the End of Trial No post-trial care will be provided.

(322) 8 Discontinuation/Withdrawal Criteria

(323) Participation in the trial is strictly voluntary. A subject has the right to withdraw from the trial at any time and for any reason. The Investigator has the right to withdraw a subject from further trial vaccine administration and/or the trial if this is considered in the subject's best interest or as a result of a protocol deviation.

(324) For discontinuations due to an AE, every effort should be made to document the outcome of the event.

(325) Subjects who received at least 1 dose of trial vaccine will be encouraged to continue participation until the end of the trial for safety assessments.

(326) 8.1 Discontinuation of Trial Vaccine Administration

(327) The primary reason for discontinuation of further administration of trial vaccine will be recorded in the subject's eCRF according to the following categories: Consent withdrawal by the subject.

(328) The reason for withdrawal, if provided, should be recorded in the eCRF.

(329) Note: All attempts should be made to determine the underlying reason for the withdrawal and, where possible, the primary underlying reason should be recorded (i.e., withdrawal due to an AE should not be recorded in the “voluntary withdrawal” category). AE (including known side effects of the trial vaccine).
If discontinuation is due to an AE possibly related to the trial vaccine or trial procedures, the subject must be followed-up by additional examinations according to the medical judgment of the Investigator until the condition is resolved or the Investigator deems further observations or examinations to be no longer medically indicated. Change in the subject's overall medical status prohibiting further participation. Pregnancy (see Section 9.3.5).

(330) Any subject who, despite the requirement for adequate contraception, becomes pregnant during the trial will not receive further trial vaccine doses. The site should maintain contact with the pregnant subject and complete a “Clinical Trial Pregnancy Form” as soon as possible. In addition, the subject should be followed-up until the birth of the child, or spontaneous or voluntary termination. When pregnancy outcome information becomes available, the information should be captured using the same form. The subject should be reported as an IMP discontinuation and the reason (i.e. pregnancy) should be given. Trial terminated by the Sponsor (in which case the minimum safety follow-up conducted at the end of trial visit on Day 393 would be performed). Major protocol deviation. Other.

(331) Note: The specific reasons should be recorded in the “specify” field of the eCRF.

(332) 8.2 Withdrawal from the Trial

(333) Subjects should be withdrawn from the trial in case any of the following situations occur: Continued participation jeopardizes the subject's health, safety, or rights. The subject has experienced an AE that requires early termination because continued participation imposes an unacceptable risk to the subject's health or the subject is unwilling to continue because of the AE. The reasons for not performing further safety or immunogenicity assessments should be documented. The subject did not return to the site and multiple attempts (a minimum of 3 attempts) to contact the subject were unsuccessful (lost to follow-up). The subject wishes to withdraw from the trial. The reason for withdrawal, if provided, should be recorded.

(334) All attempts should be made to determine the underlying reason for the withdrawal and, where possible, the primary underlying reason should be recorded (i.e., withdrawal due to an AE should not be recorded in the “voluntary withdrawal” category).

(335) Any subject who prematurely terminates participation and who has received at least one trial vaccine dose will undergo the same procedures as for the end of trial visit, unless such procedures are considered to pose unacceptable risk to the subject.

(336) Discontinued or withdrawn subjects will not be replaced.

(337) 8.3 Trial Termination

(338) The Sponsor reserves the right to terminate the trial at any time. Possible reasons for trial termination include the following: Outcome of the interim analysis may show high VE or futility. Safety reasons: the incidence of AEs in this or any other trial using a related vaccine indicates a potential health risk for the subjects. New scientific knowledge becomes known that makes the objectives of the trial no longer feasible/valid. The site is unlikely to be able to recruit sufficient subjects within the agreed time frame. The site does not respond to trial management requests. Repeated protocol deviations. Unsafe or unethical practices. Administrative decision.

(339) Following a trial termination decision, the Investigator must contact all subjects within a time period set by the Sponsor. All trial materials must be collected and relevant documentation completed to the greatest extent possible. The trial can also be terminated by the Regulatory Authority for any reason or if recommended by the DSMB, or at a site level by the Independent Ethics Committee or Institutional Review Board (IEC/IRB). The Sponsor may close an individual site prematurely for reasons such as poor protocol compliance or unsatisfactory recruitment of subjects.

(340) 8.4 Lost to Follow-Up

(341) All efforts should be made to contact subjects who have not returned for the scheduled trial visit or who are unable to be contacted for a scheduled phone call. A minimum of 3 attempts should be made and documented. If a subject is lost to follow-up before resolution of related SAEs or AEs, the Sponsor may consider further attempts to contact the subject in order to collect follow-up safety information.

(342) 9 Trial Assessments and Procedures

(343) The trial assessments and procedures are discussed in this section.

(344) For subjects who are unable to come to the site for protocol-specified site visits (e.g., due to the public health emergency related to COVID-19), safety assessments may be performed using alternative methods (e.g., phone contact, virtual visit, alternative location for assessment).

(345) For further flexibility in trial conduct in the pandemic setting, home visits will be allowed to perform safety assessments and procedures including the collection of blood and any bio samples. If site visits, phone contacts or sample collection cannot be performed within the protocol defined windows, in such unique circumstances as a public health emergency, it will be acceptable to perform these tasks outside of these windows. In the pandemic setting, the protocol-defined windows for site visits and phone contacts are provided for guidance and will not be considered deviations, if not strictly adhered to.

(346) An electronic diary (eDiary) will be used during the trial for efficient collection of safety related information. However, paper diaries may be substituted for some subjects during the trial.

(347) Initiation of subject enrollment of the 2 target age groups into Phase 2b will be flexible. Depending on the timing of data from the Phase 1 and Phase 2a trials, enrollment of the 2 age groups into Phase 2b may be staggered, initially starting with subjects 18 to 60 years of age followed by subjects ≥61 years of age. As the older age group will comprise 20% to 25% of the total number of subjects in Phase 2b, this staggered start is not expected to impact overall enrollment of the Phase 2b cohort.

(348) 9.1 Schedule of Trial Assessments and Procedures

(349) By signing the informed consent form, subjects will be consenting to participate in both Trial CV-NCOV-004 and its 1 year Extension Study for a total of approximately 2.1 years of participation.

(350) The trial assessments and procedures apply to all subjects, independent if they had known SARS CoV-2 positive serology before the trial or independent of the serology status at baseline as per retrospective analysis.

(351) Subjects participating in Phase 2b will be given a thermometer to measure body temperature orally and a measuring tape to determine the size of local injection site reactions. Subjects will be instructed on how to enter the solicited AEs daily for 7 days in the eDiary.

(352) During the conduct of the trial and interactions with subjects, any person with early warning signs of COVID-19 should be referred to emergency medical care immediately. These signs include, but are not limited to, the following: difficulty breathing, persistent pain or pressure in the chest, new confusion, inability to awake or stay awake, or bluish lips or face.

(353) 9.1.1 Phase 2b: Immunogenicity Subset

(354) The Immunogenicity Subset of Phase 2b will include the first 600 subjects enrolled into each of the 2 age groups, 18-60 and ≥61 years of age, into Phase 2b. As such, the target total enrollment will be approximately 1,200 subjects.

(355) 9.1.1.1 Clinic Visit 1: Day 1—First Trial Vaccination

(356) Note that procedures to establish subject eligibility, recording of demographic information and medical history may be performed within 21 days prior to trial vaccine administration, i.e., spread out over more than 1 day. However, if all information is available and assessments and procedures can be performed, eligibility can be established on the same day of trial vaccine administration. All eligibility criteria must be reviewed prior to trial vaccine administration on Day 1.

(357) Pre-vaccination Procedures

(358) Obtain signed informed consent form. Signed informed consent must be obtained prior to the subject entering into the trial, and before any protocol-directed procedures are performed. By signing the informed consent form, the subject voluntarily agrees to participate in the HERALD Trial CV-NCOV-004 and its 1 year Extension Study for a total of approximately 2 years. Review inclusion/exclusion criteria (see Section 6.1 and 6.2) and review prohibited medications listed as an exclusion criterion (see Section 6.2). Record demographic information. Record medical history. Record concomitant medications and vaccinations, including recurring medications for intermittent conditions, if taken within 6 months prior to enrollment in this trial. Perform a complete physical examination, including height and weight (see Section 9.3.7). If the complete physical examination to establish eligibility was performed within 21 days prior to trial vaccine administration, a symptom-directed physical examination should be performed on the day of vaccination prior to trial vaccine administration. Measure vital signs (body temperature, pulse, blood pressure; see Section 9.3.7). Perform urine pregnancy test in females of childbearing potential. Collect pre-vaccination blood samples for binding antibody testing to RBD of S protein of SARS-CoV-2 (˜6 mL blood); SARS-CoV-2 viral neutralizing activity (˜6 mL blood); and binding antibody testing to N protein of SARS CoV 2 (˜6 mL blood). Collect pre-vaccination blood samples for genomic biomarkers (˜6 mL blood) from subjects at selected site(s). Collect pre-vaccination blood samples for CMI (˜32 mL blood) from subjects at selected site(s).
Vaccination Procedure Review criteria for delay or cancellation of vaccination. See Sections 6.3 and 8.1 for an overview of the criteria leading to delay or cancellation of vaccine administration. In case of delay, the vaccination should take place within the allowed time windows. The reasons for delay or cancellation should be documented in the subject's chart. Administer the trial vaccine dose according to the subject's assignment.
Post-vaccination Procedures Observe the subject on site for at least 30 minutes following vaccination for safety monitoring. At the end of the observation period: Measure vital signs (body temperature, pulse, blood pressure; see Section 9.3.7). The subject may not be discharged until vital signs are within normal range or have returned to pre-vaccination levels. Record the occurrence of any AEs following trial vaccination. Instructions for the subject: Instruct the subject how to measure solicited AEs and how to complete the eDiary. The subject should record solicited local and systemic AEs occurring on the day of vaccination and the following 7 days, and unsolicited AEs (i.e., the occurrence of all other AEs) occurring on the day of vaccination and the following 28 days. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.

(359) Note: Subjects without symptoms may have been tested for several reasons, for example, close exposure to a known person with SARS-CoV-2 infection or as part of their routine screening as a healthcare provider.

(360) 9.1.1.2 Phone Call: Day 2 (˜0/+0 day)

(361) The purpose of this phone contact is to inquire about the subject's general well-being and to assess safety 1 day after the first trial vaccination. During the phone call: Review and record any newly reported safety data including solicited and unsolicited AEs, or other AEs (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. If the subject reports any concerning local or systemic reactions, or other AEs (e.g., medically-attended AEs, SAEs), these should be followed-up either by a phone call(s) or by an unscheduled site visit based on the judgment of the Investigator. Instructions for the subject: Remind the subject to continue recording solicited and unsolicited AEs (i.e., the occurrence of all other AEs) in the eDiary. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.1.3 Clinic Visit 2: Day 29—Second Trial Vaccination (˜3/+7 days)
Pre-vaccination Procedures Review and record any newly reported safety data including solicited and unsolicited AEs, or other AEs (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Perform urine pregnancy test in females of childbearing potential. Collect pre-vaccination blood samples for binding antibody testing to RBD of S protein of SARS-CoV-2 (˜6 mL blood) and SARS-CoV-2 viral neutralizing activity (˜6 mL blood). No testing of antibody to N protein of SARS-CoV-2 will performed at this time point. Collect pre-vaccination blood samples for genomic biomarkers (˜6 mL blood) from subjects at selected site(s). Collect pre-vaccination blood samples for CMI (˜32 mL blood) from subjects at selected site(s).
Vaccination Procedure Review criteria for delay or cancellation of vaccination. See Sections 6.3 and 8.1 for an overview of the criteria leading to delay or cancellation of vaccine administration. In case of delay, the vaccination should take place within the allowed time windows. The reasons for delay or cancellation should be documented in the subject's chart. Administer the trial vaccine dose according to the subject's assignment.
Post-vaccination Procedures Observe the subject on site for at least 30 minutes following vaccination for safety monitoring. At the end of the observation period: Measure vital signs (body temperature, pulse, blood pressure; see Section 9.3.7). The subject may not be discharged until vital signs are within normal range or have returned to pre-vaccination levels. Record the occurrence of any AEs following trial vaccination. Instructions for the subject: Re-instruct the subject how to measure solicited AEs and how to complete the eDiary. The subject should record solicited local and systemic AEs occurring on the day of vaccination and the following 7 days, and unsolicited AEs (i.e., the occurrence of all other AEs) occurring on the day of vaccination and the following 28 days. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.1.4 Phone Call: Day 30 (˜0/+0 day)

(362) The purpose of this phone contact is to inquire about the subject's general well-being and to assess safety 1 day after the second trial vaccination.

(363) The assessments and procedures are identical to those performed during the phone call on Day 2.

(364) 9.1.1.5 Clinic Visit 3: Day 43 (˜3/+3 days)

(365) Review and record any newly reported safety data including solicited and unsolicited AEs, or other AEs (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Collect blood samples for binding antibody testing to RBD of S protein of SARS CoV-2 (˜6 mL blood); SARS-CoV-2 viral neutralizing activity (˜6 mL blood); and binding antibody testing to N protein of SARS-CoV-2 (˜6 mL blood). Collect blood samples for genomic biomarkers (˜6 mL blood) from subjects at selected site(s). Collect blood samples for CMI (˜32 mL blood) from subjects at selected site(s). Instructions for the subject: Inform the subject that recording of solicited local and systemic reactions in the eDiary is complete. Remind the subject to continue recording unsolicited AEs (all AEs). Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported, regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.1.6 Clinic Visit 4: Day 57 (˜3/+7 days) Review and record any newly reported safety data including unsolicited AEs or other AEs (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Collect a blood sample for immunogenicity assessment for binding antibody testing to RBD of S protein of SARS-CoV-2 (˜6 mL blood) and SARS-CoV-2 viral neutralizing activity (˜6 mL blood). (No testing of binding antibody to N protein of SARS CoV 2 will performed at this time point). Instructions for the subject: Inform the subject that reporting of unsolicited AEs is complete. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.1.7 Clinic Visit 5: Day 120 (−7/+7 days) Review and record any newly reported AEs since the site visit on Day 57 (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Collect blood samples for binding antibody testing to RBD of S protein of SARS CoV-2 (˜6 mL blood) and SARS-CoV-2 viral neutralizing activity (˜6 mL blood). (No testing of binding antibody to N protein of SARS CoV 2 will performed at this time point). Collect blood samples for genomic biomarkers (˜6 mL blood) from subjects at selected site(s). Collect blood samples for CMI (˜32 mL blood) from subjects at selected site(s). Instructions for the subject: Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.1.8 Clinic Visit 6: Day 211 (−7/+7 days)

(366) The assessments and procedures are identical to those performed during Clinic Visit 5 on Day 120, except for the below. Collect blood samples for binding antibody testing to RBD of S protein of SARS CoV-2 (˜6 mL blood); SARS-CoV-2 viral neutralizing activity (˜6 mL blood); and binding antibody testing to N (nucleocapsid) protein of SARS-CoV-2 (˜6 mL blood). Collect blood samples for genomic biomarkers (˜6 mL blood) from subjects at selected site(s).
9.1.1.9 Phone Call: Day 302 (−7/+7 days)

(367) The purpose of this phone contact is to inquire about the subject's general well-being and to assess safety since the site visit on Day 211. During the phone call: Review and record any newly reported AEs since the site visit on Day 211 (SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. If the subject reports by phone any concerning AEs, these should be followed-up either by a phone call(s) or by an unscheduled site visit based on the judgment of the investigator. Instructions for the subject: Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.1.10 End of Trial Visit: Day 393 (˜0/+21 days)

(368) The end of trial visit will be performed on Day 393, 1 year after the last trial vaccine administration. If possible, this visit should include subjects who prematurely discontinued vaccination during the trial. The following assessments should be performed: Review and record any newly reported AEs since the phone contact on Day 302 (SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a complete physical examination, including height and weight (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Collect blood samples for binding antibody testing to RBD of S protein of SARS CoV-2 (˜6 mL blood); SARS-CoV-2 viral neutralizing activity (˜6 mL blood); and binding antibody testing to N protein of SARS-CoV-2 (˜6 mL blood).

(369) Inform the subject that they have completed the main part of the trial and that the extension part of the trial will now begin (see Section 9.1.4).

(370) 9.1.2 Phase 2b: Non-Immunogenicity Subjects

(371) Following enrollment of subjects into the Immunogenicity Subset of Phase 2b (n=1,200), the remaining 2,800 subjects, 18 years of age and older, will be enrolled into Phase 2b.

(372) 9.1.2.1 Clinic Visit 1: Day 1—First Trial Vaccination

(373) Note that procedures to establish subject eligibility, recording of demographic information and medical history may be performed within 21 days prior to trial vaccine administration, i.e., spread out over more than 1 day. However, if all information is available and assessments and procedures can be performed, eligibility can be established on the same day of trial vaccine administration. All eligibility criteria must be reviewed prior to trial vaccine administration on Day 1.

(374) Pre-vaccination Procedures

(375) Obtain the signed informed consent form. Signed informed consent must be obtained prior to the subject entering into the trial, and before any protocol-directed procedures are performed (see Section 12.4). By signing the informed consent form, the subject voluntarily agrees to participate in the HERALD Trial CV-NCOV-004 and its 1 year Extension Study for a total of approximately 2 years. Review inclusion/exclusion criteria (see Section 6.1 and 6.2) and review prohibited medications listed as an exclusion criterion (see Section 6.2). Record demographic information. Record medical history. Record concomitant medication and vaccination, including recurring medication for intermittent conditions, if taken within 6 months prior to enrollment in this trial. Perform a complete physical examination, including height and weight (see Section 9.3.7). If the complete physical examination to establish eligibility was performed within 21 days prior to trial vaccine administration, a symptom-directed physical examination should be performed on the day of vaccination prior to trial vaccine administration. Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Perform urine pregnancy test in females of childbearing potential. Collect pre-vaccination blood sample) for binding antibody testing to N protein of SARS-CoV-2 (˜6 mL blood).
Vaccination Procedure Review criteria for delay or cancellation of vaccination. See Sections 6.3 and 8.1 for an overview of the criteria leading to delay or cancellation of vaccine administration. In case of delay, the vaccination should take place within the allowed time windows. The reasons for delay or cancellation should be documented in the subject chart. Administer the trial vaccine dose according to the subject's assignment.
Post-vaccination Procedures Observe the subject on site for at least 30 minutes following vaccination for safety monitoring. At the end of the observation period: Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). The subject may not be discharged until vital signs are within normal range or have returned to pre-vaccination levels. Record the occurrence of any AEs following trial vaccination. Instructions for the subject: Instruct the subject how to measure solicited AEs and how to complete the eDiary. The subject should record solicited local and systemic AEs occurring on the day of vaccination and the following 7 days, and unsolicited AEs (i.e., the occurrence of all other AEs) occurring on the day of vaccination and the following 28 days. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.

(376) Note: Subjects without symptoms may have been tested for several reasons, for example, close exposure to a known person with SARS-CoV-2 infection or as part of their routine screening as a healthcare provider.

(377) 9.1.2.2 Phone Call: Day 2 (˜0/+0 day)

(378) The purpose of this phone contact is to inquire about the subject's general well-being and to assess safety 1 day after the first trial vaccination. During the phone call: Review and record any newly reported safety data including solicited and unsolicited AEs, or other AEs (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. If the subject reports any concerning local or systemic reactions, or other AEs (e.g., medically-attended AEs, SAEs), these should be followed-up either by a phone call(s) or by an unscheduled site visit based on the judgment of the investigator. Instructions for the subject: Remind the subject to continue recording solicited and unsolicited AEs (i.e., the occurrence of all other AEs) in the eDiary. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.2.3 Clinic Visit 2: Day 29—Second Trial Vaccination (˜3/+7 days) Pre-vaccination Procedures Review and record any newly reported safety data including solicited and unsolicited AEs, or other AEs (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Perform urine pregnancy test in females of childbearing potential.
Vaccination Procedure Review criteria for delay or cancellation of vaccination. See Sections 6.3 and 8.1 for an overview of the criteria leading to delay or cancellation of vaccine administration. In case of delay, the vaccination should take place within the allowed time windows. The reasons for delay or cancellation should be documented in the subject chart. Administer the trial vaccine dose according to the subject's assignment.
Post-vaccination Procedures Observe the subject on site for at least 30 minutes following vaccination for safety monitoring. At the end of the observation period: Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). The subject may not be discharged until vital signs are within normal range or have returned to pre-vaccination levels. Record the occurrence of any AEs following trial vaccination. Instructions for the subject: Re-instruct the subject how to measure solicited AEs and how to complete the eDiary. The subject should record solicited local and systemic AEs occurring on the day of vaccination and the following 7 days, and unsolicited AEs (i.e. the occurrence of all other AEs) occurring on the day of vaccination and the following 28 days. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.2.4 Phone Call: Day 30 (0/+0 day)

(379) The purpose of this phone contact is to inquire about the subject's general well-being and to assess safety 1 day after the second trial vaccination.

(380) The assessments and procedures are identical to those performed during the phone call on Day 2.

(381) 9.1.2.5 Clinic Visit 3: Day 43 (˜3/+3 days)

(382) Review and record any newly reported safety data including solicited and unsolicited AEs, or other AEs (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Collect blood sample for binding antibody testing to N protein of SARS-CoV-2 (˜6 mL blood). Instructions for the subject: Inform the subject that recording of solicited local and systemic reactions in the eDiary is complete. Remind the subject to continue recording unsolicited AEs (all AEs). Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported, regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.2.6 Phone Call: Day 57 (˜3/+7)

(383) The purpose of this phone contact is to inquire about the subject's general well-being and to assess safety since site visit on Day 43. During the phone call: Review and record any newly reported safety data including unsolicited AEs or other AEs (medically-attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. If the subject reports any concerning local or systemic reactions, or other AEs (e.g., medically-attended AEs, SAEs), these should be followed-up either by a phone call(s) or by an unscheduled site visit based on the judgment of the investigator. Instructions for the subject: Inform the subject that reporting of unsolicited AEs is complete. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.2.7 Clinic Visit 4: Day 120 (−7/+7) Review and record any newly reported AEs since the phone call on Day 57 (medically attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Instructions for the subject: Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported, regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.2.8 Clinic Visit 5: Day 211 (−7/+7)

(384) The assessments and procedures are identical to those performed during Clinic Visit 4 on Day 120, except for the below. Collect a blood sample for binding antibody testing to N protein of SARS CoV-2 (˜6 mL blood).
9.1.2.9 Phone Call: Day 302 (−7/+7)

(385) The purpose of this phone contact is to inquire about the subject's general well-being and to assess safety since the site visit on Day 211. During the phone call: Review and record any newly reported AEs since the site visit on Day 211 (SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. If the subject reports by phone any concerning AEs, these should be followed-up either by a phone call(s) or by an unscheduled site visit based on the judgment of the investigator. Instructions for the subject: Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.2.10 End of Trial Clinic Visit: Day 393 (˜0/+21 days)

(386) The end of trial visit will be performed on Day 393, 1 year after the last trial vaccine administration. If possible, this visit should include subjects who prematurely discontinued vaccination during the trial. The following assessments should be performed: Review and record any newly reported AEs since the phone contact on Day 302 (SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a complete physical examination, including height and weight (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Collect a blood sample for binding antibody testing to N protein of SARS CoV-2 (˜6 mL blood).

(387) Inform the subject that they have completed the main part of the trial and that the extension part of the trial will now begin (see Section 9.1.4).

(388) 9.1.3 Phase 3 Subjects

(389) Approximately 32,500 subjects, 18 years of age and older, will be enrolled into Phase 3.

(390) 9.1.3.1 Clinic Visit 1: Day 1—First Trial Vaccination

(391) Note that procedures to establish subject eligibility, recording of demographic information and medical history may be performed within 21 days prior to trial vaccine administration, i.e., spread out over more than 1 day. However, if all information is available and assessments and procedures can be performed, eligibility can be established on the same day of trial vaccine administration. All eligibility criteria must be reviewed prior to trial vaccine administration on Day 1.

(392) Pre-vaccination Procedures

(393) Obtain the signed informed consent form. Signed informed consent must be obtained prior to the subject entering into the trial, and before any protocol-directed procedures are performed (see Section 12.4). By signing the informed consent form, the subject voluntarily agrees to participate in the HERALD Trial CV-NCOV-004 and its 1 year Extension Study for a total of approximately 2 years.

(394) Review inclusion/exclusion criteria (see Section 6.1 and 6.2) and review prohibited medications listed as an exclusion criterion (see Section 6.2). Record demographic information. Record medical history. Record concomitant medications and vaccinations, including recurring medications for intermittent conditions, if taken within 6 months prior to enrollment in this trial. Perform a complete physical examination, including height and weight (see Section 9.3.7). If the complete physical examination to establish eligibility was performed within 21 days prior to trial vaccine administration, a symptom-directed physical examination should be performed on the day of vaccination prior to trial vaccine administration. Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Perform urine pregnancy test in females of childbearing potential Collect a pre-vaccination blood sample for binding antibody testing to N protein of SARS-CoV-2 (˜6 mL blood).
Vaccination Procedure Review criteria for delay or cancellation of vaccination. See Sections 6.3 and 8.1 for an overview of the criteria leading to delay or cancellation of vaccine administration. In case of delay, the vaccination should take place within the allowed time windows. The reasons for delay or cancellation should be documented in the subject chart. Administer the trial vaccine dose according to the subject's assignment.
Post-vaccination Procedures Observe the subject on site for at least 30 minutes following vaccination for safety monitoring. At the end of the observation period: Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). The subject may not be discharged until vital signs are within normal range or have returned to pre-vaccination levels. Record the occurrence of any new AEs following trial vaccination. Instructions for the subject: Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.

(395) Note: Subjects without symptoms may have been tested for several reasons, for example, close exposure to a known person with SARS-CoV-2 infection or as part of their routine screening as a healthcare provider).

(396) 9.1.3.2 Clinic Visit 2: Day 29—Second Trial Vaccination (˜3/+7 days)

(397) Pre-vaccination Procedures

(398) Review and record any newly collected safety data including medically-attended AEs and SAEs. Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Perform urine pregnancy test in females of childbearing potential.
Vaccination Procedure Review criteria for delay or cancellation of vaccination. See Sections 6.3 and 8.1 for an overview of the criteria leading to delay or cancellation of vaccine administration. In case of delay, the vaccination should take place within the allowed time windows. The reasons for delay or cancellation should be documented in the subject chart. Administer the trial vaccine dose according to the subject's assignment.
Post-vaccination Procedures Observe the subject on site for at least 30 minutes following vaccination for safety monitoring. At the end of the observation period: Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). The subject may not be discharged until vital signs are within normal range or have returned to pre-vaccination levels. Record the occurrence of any new AEs following trial vaccination. Instructions for the subject: Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.3.3 Clinic Visit 3: Day 43 (˜3/+3 days) Review and record any newly collected safety data including medically-attended AEs and SAEs. Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a symptom-directed physical examination (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Collect a blood sample for binding antibody testing to N protein of SARS CoV-2 (˜6 mL blood). Instructions for the subject: Remind the subject to call the site immediately to report the following: If he/she experiences any concerning local or systemic reactions or other medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.3.4 Phone Call: Day 57 (˜3/+7 days) and Day 120 (−7/+7 days)

(399) The purpose of these phone contacts is to inquire on the subject's general well-being and to assess safety since the last phone contact or site visit. During the phone call: Review and record any newly reported AEs since the site visit or phone call (medically attended AEs, SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. If the subject reports by phone any concerning AEs, these should be followed-up either by a phone call(s) or by an unscheduled site visit based on the judgment of the investigator. Instructions for the subject: Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information (see Section 9.2.1 and Section 9.5). The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.1.3.5 Clinic Visit 4: Day 211 (−7/+7 days)

(400) The assessments and procedures are identical to those performed during the clinical visit on Day 43.

(401) 9.1.3.6 Phone Call: Day 302 (−7/+7 days)

(402) The purpose of this phone contact is to inquire on the subject's general well-being and to assess safety since the last site visit on Day 211.

(403) The assessments and procedures are identical to those performed during the phone calls on Day 57 and Day 120.

(404) 9.1.3.7 End of Trial Clinic Visit: Day 393 (˜0/+21 days)

(405) The end of trial visit will be performed on Day 393, 1 year after the last trial vaccine administration. If possible, this visit should include subjects who prematurely discontinued vaccination during the trial. The following assessments should be performed: Review and record any newly reported AEs since the phone contact on Day 302 (SAEs). Record concomitant medications and vaccinations, including recurring medications for intermittent conditions. Perform a complete physical examination, including height and weight (see Section 9.3.7). Measure vital signs (body temperature, pulse, blood pressure, see Section 9.3.7). Collect a blood sample for binding antibody testing to N protein of SARS CoV-2 (˜6 mL blood).

(406) Inform the subject that they have completed the main part of the trial and that the extension part of the trial will now begin (see Section 9.1.4).

(407) 9.1.4 Extension Study (Up to 1 Year Duration)

(408) General instructions for all subjects: Inform the subject that the Extension Study will begin on the last day (Day 393) of the main trial. Explain that the duration of the trial is planned for 1 year, but may terminate early if CVnCoV meets regulatory approval and subjects in the placebo group are offered vaccination with CVnCoV. The trial may also terminate early if another effective vaccine is deployed locally. Instructions for Phase 2b subjects who participated in the Immunogenicity Subset: Inform subjects that the following assessments and procedures will be performed: Return to the site every 3 months (Day 484, Day 575, Day 665, and Day 757) for blood samples to be taken for evaluation of long-term persistence of binding antibodies to the RBD of S protein of SARS-CoV-2 and SARS-CoV-2 viral neutralizing antibodies. COVID-19 case detection to assess long-term efficacy. Collection of AESIs and SAEs to assess long-term safety. Instructions for Phase 2b Non-Immunogenicity subjects and Phase 3 subjects. Inform subjects that the following assessments and procedures will be performed: Phone contact every 3 months (Day 484, Day 575, Day 665, and Day 757) to ensure collection of AESIs and SAEs to assess long-term safety. COVID-19 case detection to assess long-term efficacy. Remind the subject to call the site immediately to report the following: If he/she experiences any concerning medical event. Any medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason. Experience a serious medical event, have a change in overall health or be diagnosed with a new medical condition by a doctor. These should be reported regardless of the perceived relationship between the event and the trial vaccine. Remind the subject to contact the site immediately if he/she has any of the symptoms suggestive of COVID-19. In addition, subjects will be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. Those who respond “yes” will be contacted by trial staff for follow-up information. The subject should also be reminded to contact the site immediately if he/she had a positive SARS-CoV-2 test performed outside of the site, whether they were symptomatic (COVID-19 illness) or asymptomatic at the time of the test.
9.2 Efficacy Assessments
9.2.1 COVID-19 Cases

(409) COVID-19 case ascertainment will occur in identical manner in both the Phase 2b and Phase 3 parts of the trial. Case detection will begin with the identification of subjects reporting at least 1 symptom from a standardized list of symptoms consistent with COVID 19 disease. Based on a phone interview with trial staff, subjects suspected of having COVID-19 disease will undergo testing for SARS-CoV-2 infection, consisting of a rapid antigen test performed locally by the trial staff and a molecular-based RT-PCR test performed at a designated central laboratory. The testing strategy is described in Section 9.5. If the subject is confirmed to have COVID-19, subjects will be followed until resolution of their disease, even if the initial presentation is considered as mild. If the subject is hospitalized, the subject's progress must continue to be followed by the Investigator and a medical/discharge summary must be obtained at the end of the hospitalization.

(410) 9.2.1.1 Case Detection

(411) 9.2.1.1.1 Routine Surveillance for COVID-19

(412) During all site visits and phone calls, subjects will be reminded to contact the site if they have any of the following symptoms*: Fever or chills; Shortness of breath or difficulty breathing; New loss of taste or smell; Cough; Fatigue; Muscle or body aches; Headache; Sore throat; Congestion or runny nose; Nausea or vomiting; Diarrhea FDA Development and Licensure of Vaccines to Prevent COVID-19 guidance (US Department of Health and Human Services. Food and Drug Administration (FDA). Guidance for Industry. Development and Licensure of Vaccines to Prevent COVID 19. 2020. Available on the world wide web at fda.gov/regulatory-information/search-fda-guidance-documents/development-and-licensure-vaccines-prevent-covid-19; Accessed October 2020, incorporated herein by reference).

(413) Subjects will also be messaged up to twice a week to provide a yes or no response to having COVID-19 symptoms. For both of the trial vaccinations, messaging will not begin until 4 days after vaccination to avoid confusing vaccine-associated reactions occurring during this time period (e.g., fever, chills, headache, fatigue, myalgia) with potential COVID-19 symptoms.

(414) Those who report symptoms either at the site visit or by phone call, or respond “yes” to having symptoms by messaging will be contacted by trial staff for a follow-up phone interview. The trial staff will use a scripted interview (in which he/she has been trained on) to collect information about the subject's medical condition, which will be used to determine the probability of the subject having COVID-19. If the subject is suspected of having COVID-19 illness, he/she will undergo testing for SARS-CoV-2 infection (see next section). If suspicion is low, then a subsequent phone call(s) will be performed to assess whether the subject's illness and symptoms have progressed and if the suspicion of COVID-19 has reached a sufficient level to test the subject. Based on clinical judgment, phone contact may be made as frequently as daily. All symptomatic subjects will be provided a thermometer and oxygen saturation monitor for home use. Trial staff will instruct subjects to take their oral body temperature and oxygen saturation levels at least 3 to 4 times per day, or whenever they feel symptomatic.

(415) The testing strategy for SARS-CoV-2 infection is presented in Section 9.5. Testing will consist of 2 tests: a rapid antigen test performed locally by the trial staff and a molecular-based RT-PCR test performed at a designated central laboratory. Depending on the Investigator and his/her facility and trial staff, nasopharyngeal swab samples for testing will be collected either at the site or at a home visit. The visit to the site or home visit by trial staff will be considered an “Illness Visit” and documented as such in the eCRF.

(416) If the subject is virologically-confirmed to have COVID-19 by a positive RT-PCR test, subjects will be followed until resolution of their disease, even if the initial presentation is considered as mild. If the subject is hospitalized, the subject's progress must continue to be followed by the Investigator and a discharge summary must be obtained at the end of the hospitalization. Information on clinical symptoms and signs, their duration and severity, and treatment and outcome of the COVID-19 episode will be documented by trial staff and recorded in the eCRF.

(417) Upon resolution, subjects will continue to be followed in the same manner as those who have not presented with COVID-19 (i.e. they will return to routine case surveillance). A second episode of COVID-19 in a subject with prior disease will not be counted as a primary efficacy case, but will be included in the exploratory objective assessing the occurrence of second episodes of COVID-19 in vaccinated subjects.

(418) If the subject is not virologically-confirmed by RT-PCR testing, he/she will return to routine surveillance for COVID-19 disease as a subject who is naïve to SARS-CoV-2 infection (unless determined otherwise by a seropositive test to the N protein).

(419) 9.2.1.1.2Non-Routine Surveillance for COVID-19 (Positive Test Outside of the Site)

(420) Subjects will be reminded to contact the site immediately if he/she has a positive SARS CoV-2 test performed outside of the site, whether they were symptomatic (COVID 19 illness) or asymptomatic at the time of the test.

(421) If the subject was symptomatic, trial staff will use the scripted interview to collect information about the subject's COVID-19 symptoms and medical condition. The subject should be retested as soon as feasible to confirm the result.

(422) A nasopharyngeal swab sample should be sent to the Sponsor-designated central laboratory for RT-PCR testing; the RT-PCR test result will be considered definitive as a virologically-confirmed case of COVID-19. If the subject is confirmed to have COVID-19, subjects will be followed until resolution of their disease, as described above for subjects who were detected by routine surveillance.

(423) If the subject is not virologically-confirmed by RT-PCR testing, he/she will return to routine surveillance for COVID-19 disease as a subject who is naïve to SARS-CoV-2 infection (unless determined otherwise by a seropositive test to the N protein).

(424) 9.2.1.2 Definition of Virologically-Confirmed COVID-19 Case

(425) A virologically-confirmed case of COVID-19 is defined as a positive SARS-CoV-2 specific RT-PCR test in a person with clinically symptomatic disease consisting of 1 or more of the following symptoms (based on the same screening symptoms as above): Fever or chills; Shortness of breath or difficulty breathing; New loss of taste or smell; Cough; Fatigue; Muscle or body aches; Headache; Sore throat; Congestion or runny nose; Nausea or vomiting; Diarrhea

(426) This definition is intended to capture all severities of virologically-confirmed clinically symptomatic cases of COVID-19. As such, COVID-19 cases classified by severity (e.g., mild or severe) will be a subset of these cases.

(427) 9.2.1.3 COVID-19 Case Definition for Co-Primary Efficacy Analysis

(428) For the primary analysis of efficacy, the case must meet the following criteria: Must be a virologically-confirmed case of COVID-19 defined as a positive SARS CoV 2 specific RT-PCR test in a person with clinically symptomatic COVID-19, as defined above in Section 9.2.1.2. For the primary efficacy analyses, COVID-19 cases will be categorized as “any severity” or of “moderate to severe” severity. Symptom onset must have occurred ≥15 days following the second trial vaccination. The subject must not have a history of virologically-confirmed COVID-19 illness at enrollment or have developed a case of virologically-confirmed COVID-19 before 15 days following the second trial vaccination {see Section 10.2.3, Efficacy Analysis Set (EAS) for more details}. The subject must have been SARS-CoV-2 naïve at baseline and Day 43 (defined as seronegative to N protein in the blood samples collected at baseline and Day 43).

(429) The primary efficacy cases must be confirmed by the Adjudication Committee.

(430) Day 43 is 14 days post-second dose which allows the immune response to CVnCoV to mature and reach its height following the second dose. As such, COVID-19 case ascertainment starting the next day at ≥15 days represents the evaluation of full VE of CVnCoV against COVID-19 disease.

(431) 9.2.1.4 Adjudication of COVID-19 Cases

(432) An independent Committee of clinicians will be formed to adjudicate COVID-19 cases. The Committee will be blinded to the treatment assignment of the subject. The cases will be adjudicated by the members with respect to the following questions consistent with the endpoints of the trial. Is the case a virologically-confirmed case of COVID-19 defined as a positive SARS CoV-2 specific RT-PCR test in a person with clinically symptomatic COVID-19 with 1 or more of the symptoms listed above in Section 9.2.1.2. Was the RT-PCR test performed at the CureVac designated central laboratory? Was the symptom onset of the case ≥15 days following the second vaccination? Or did it occur before 15 days following the second trial vaccination? Was the subject naïve or non-naïve to SARS-CoV-2 at baseline and Day 43? (defined as being seronegative or seropositive to the SARS-CoV-2 N protein). Was the subject 18 to 60 years of age or ≥61 years of age? Was the subject asymptomatic? If asymptomatic, was the RT-PCR test positive ≥15 days following the second vaccination or before? Was it a mild or severe case of COVID-19 based on the provided clinical definitions? Did the subject require supplemental oxygenation? What type of oxygen support did the subject receive? Was the subject hospitalized? Was the subject admitted to the intensive care unit? Did the subject die? Due to COVID-19 or other cause?
9.2.2 Asymptomatic Cases of SARS-CoV-2 Infection

(433) There will be no active surveillance in this trial for asymptomatic SARS-CoV-2 infections. Subjects will be reminded to contact the site immediately if he/she had a positive SARS CoV-2 test performed outside of the site, whether they were symptomatic (COVID 19 illness) or asymptomatic at the time of the test. Subjects without symptoms may have been tested for several reasons, for example, close exposure to a known person with SARS-CoV-2 infection or as part of their routine screening as a healthcare provider.

(434) If the subject was asymptomatic, trial staff will contact the subject immediately to collect information about the positive SARS-CoV-2 test the subject reported for information to be collected). The subject should be retested as soon as feasible to confirm the result. A nasopharyngeal swab sample should be sent to the Sponsor-designated central laboratory for RT-PCR testing; a positive RT-PCR test result will be considered definitive as a virologically-confirmed case of SARS-CoV-2 infection.

(435) If the subject is confirmed to have SARS-CoV-2 infection, the subject will be followed by trial staff for at least 2 weeks for the development of any COVID-19 symptoms, to ensure that this is an asymptomatic infection. If the subject develops COVID-19, he/she will be followed-up as a COVID-19 case. If the subject is confirmed to be asymptomatic, information will be collected by the trial staff and documented on the appropriate eCRF page.

(436) If the subject is not virologically-confirmed by RT-PCR testing, he/she will return to routine surveillance for COVID-19 disease as a subject who is naïve to SARS-CoV-2 infection (unless determined otherwise by a seropositive test to the N protein).

(437) 9.3 Safety Assessments

(438) The safety, reactogenicity, and tolerability of a 2-dose schedule of CVnCoV will be assessed as described below.

(439) 9.3.1 Safety Assessments Specific for Subjects in Phase 2b

(440) Reactogenicity will be assessed daily on each vaccination day and the following 7 days by collection of solicited local AEs (injection site pain, redness, swelling, and itching) and systemic AEs (fever, headache, fatigue, chills, myalgia, arthralgia, nausea/vomiting, and diarrhea) using eDiaries. In addition, other indicators of safety will be collected (e.g., body temperature). The eDiary will also be used as a memory aid for the subject for the collection of unsolicited AEs on each vaccination day and the following 28 days.
9.3.2 Safety Assessments for All Subjects in Phase 2b and Phase 3 Medically-attended AEs will be collected through 6 months after the second trial vaccination. AESIs will be collected through 1 year after the second trial vaccination. AESIs to be monitored include pIMDs, AESIs for SARS-CoV-2 vaccines, and non-serious intercurrent medical conditions that may affect the immune response to vaccination. SAEs will be collected through 1 year after the second trial vaccination. AEs leading to vaccine withdrawal or trial discontinuation will be collected through 1 year after the second trial vaccination.
{lf the subject does not receive their second trial vaccination, the AE follow-up time (6 months or 1 year) will be determined based on the date scheduled for their second vaccination on Day 29}. The eDiary will be used as a memory aid for the subject for the collection of medically attended AEs, AESIs, and SAEs.
9.3.3 Safety Assessments for Subjects in the 1 Year Extension Study AESIs and SAEs will be collected for up to 1 additional year in the Extension Study. The eDiary will be used as a memory aid for the subject for the collection of AESIs and SAEs.
9.3.4 Adverse Events

(441) Definitions of AEs/SAEs, procedures for recording, evaluating, follow-up and reporting of AEs/SAEs/pregnancy/overdose, as well as assessments of intensity and causality of AEs.

(442) It is important to note that COVID-19 illness and its complications/sequelae are consistent with the efficacy endpoints of the trial and, as such, should not be recorded as AEs. These data will be captured on the relevant eCRF pages for cases of COVID-19 illness that occur in the trial, which are expected outcomes of the trial. Therefore, COVID-19 illness and its complications/sequelae will not be reported according to the standard expedited process for SAEs, even though the event may meet the criteria for an SAE.

(443) 9.3.4.1 Solicited Adverse Events

(444) An eDiary will be distributed to all subjects in Phase 2b for collection of solicited local AEs (injection site pain, redness, swelling and itching) and solicited systemic AEs (fever, headache, fatigue, chills, myalgia, arthralgia, nausea/vomiting and diarrhea) on the day of vaccination and the following 7 days. Subjects will be given a thermometer to measure body temperature orally and a measuring tape to determine the size of local injection-site reactions. Subjects will be instructed on how to enter the solicited AEs daily for 7 days in the eDiary.

(445) Solicited AEs will be assessed on an intensity scale of absent, mild, moderate and severe (Table A and Table B, above). By definition, all local solicited AEs are considered related to trial vaccination. For solicited systemic AEs, the Investigator will assess the relationship between trial vaccine and occurrence of each AE and make an assessment of intensity for each AE (Table B).

(446) If concerning to the subject or of prolonged duration, solicited Grade 3 AEs should be reported to the Investigator immediately. In case of related Grade 3 solicited AEs reported for more than 1 day on the eDiary, the subject will be questioned to establish the total duration of the AE as exactly as possible.

(447) 9.3.4.2 Unsolicited Adverse Events and Serious Adverse Events

(448) Unsolicited AEs occurring on the day of vaccination and the following 28 days will be recorded by Phase 2b subjects for each of the 2 trial vaccinations.

(449) For all subjects in Phase 2b and Phase 3, medically-attended AEs will be collected through 6 months after the second trial vaccination. AESIs will be collected through 1 year after the second trial vaccination (see Section 9.3.4.3). SAEs will be collected through 1 year after the second trial vaccination. In the Extension Study, AESIs and SAEs will continue to be collected for an additional 1 year.

(450) Medically-attended AEs are defined as AEs with medically-attended visits that are not routine visits for physical examination or vaccination, such as visits for hospitalization, an emergency room visit, or an otherwise unscheduled visit to or from medical personnel (medical doctor) for any reason.

(451) The occurrence of AEs (serious and non-serious) will be assessed by non-directive questioning of the subject at each visit. AEs volunteered by the subject during or between visits as eDiary entries or detected through observation, physical examination, laboratory test, or other assessments during the entire trial, will be recorded in the eCRF.

(452) Subjects should be instructed to report immediately any AEs with serious symptoms, subjective complaints or objective changes in their well-being to the Investigator or the site personnel, regardless of the perceived relationship between the event and the trial vaccine.

(453) The Investigator will assess the relationship between trial vaccine and occurrence of each AE/SAE.

(454) Non-serious intercurrent medical conditions that may affect the immune response to vaccination will also be collected throughout the trial.

(455) 9.3.4.3 Adverse Events of Special Interest

(456) AESIs will be collected through 1 year after the second trial vaccination in the HERALD Trial CV NCOV 004 and up to 1 additional year in the Extension Study. The following events will be considered as AESI during this trial: AEs with a suspected immune-medicated etiology of potential immune-mediated diseases (pIMDs) which are defined supra.

(457) Celiac disease; Crohn's disease; Ulcerative colitis; Ulcerative proctitis; Autoimmune cholangitis; Autoimmune hepatitis; Primary biliary cirrhosis; Primary sclerosing cholangitis; Addison's disease; Autoimmune thyroiditis (including Hashimoto thyroiditis; Diabetes mellitus type I; Grave's or Basedow's disease; Antisynthetase syndrome; Dermatomyositis; Juvenile chronic arthritis (including Still's disease); Mixed connective tissue disorder; Polymyalgia rheumatic; Polymyositis; Psoriatic arthropathy; Relapsing polychondritis; Rheumatoid arthritis; Scleroderma, (e.g., including diffuse systemic form and CREST syndrome); Spondyloarthritis, (e.g., including ankylosing spondylitis, reactive arthritis (Reiter's Syndrome) and undifferentiated spondyloarthritis); Systemic lupus erythematosus; Systemic sclerosis; Acute disseminated encephalomyelitis, (including site specific variants (e.g., non-infectious encephalitis, encephalomyelitis, myelitis, myeloradiculomyelitis)); Cranial nerve disorders,(e.g., including paralyses/paresis (e.g., Bell's palsy)); Guillain-Barré syndrome, (e.g., including Miller Fisher syndrome and other variants); Immune-mediated peripheral neuropathies, Parsonage-Turner syndrome and plexopathies, (e.g., including chronic inflammatory demyelinating polyneuropathy, multifocal motor neuropathy, and polyneuropathies associated with monoclonal gammopathy); Multiple sclerosis; Narcolepsy; Optic neuritis; Transverse Myelitis; Alopecia areata; Autoimmune bullous skin diseases, including pemphigus, pemphigoid and dermatitis herpetiformis; Cutaneous lupus erythematosus; Erythema nodosum; Morphoea; Lichen planus; Psoriasis; Sweet's syndrome; Vitiligo; Large vessels vasculitis (e.g., including: giant cell arteritis such as Takayasu's arteritis and temporal arteritis); Medium sized and/or small vessels vasculitis (e.g., including: polyarteritis nodosa, Kawasaki's disease, microscopic polyangiitis, Wegener's granulomatosis, Churg-Strauss syndrome (allergic granulomatous angiitis), Buerger's disease thromboangiitis obliterans, necrotizing vasculitis and anti-neutrophil cytoplasmic antibody (ANCA) positive vasculitis (type unspecified), Henoch-Schonlein purpura, Behcet's syndrome, leukocytoclastic vasculitis); Antiphospholipid syndrome; Autoimmune hemolytic anemia; Autoimmune glomerulonephritis (including IgA nephropathy, glomerulonephritis rapidly progressive, membranous glomerulonephritis, membranoproliferative glomerulonephritis, and mesangioproliferative glomerulonephritis); Autoimmune myocarditis/cardiomyopathy; Autoimmune thrombocytopenia; Goodpasture syndrome; Idiopathic pulmonary fibrosis; Pernicious anemia; Raynaud's phenomenon; Sarcoidosis; Sjögren's syndrome; Stevens-Johnson syndrome; Uveitis). Other AEs relevant to SARS-CoV-2 vaccine development or the target disease include: Anaphylaxis; Vasculitides; Enhanced disease following immunization; Multisystem inflammatory syndrome in children; Acute Respiratory Distress Syndrome; COVID-19 disease; Acute cardiac injury; Microangiopathy; Heart failure and cardiogenic shock; Stress cardiomyopathy; Coronary artery disease; Arrhythmia; Myocarditis, pericarditis; Thrombocytopenia; Deep vein thrombosis; Pulmonary embolus; Cerebrovascular stroke; Limb ischemia; Hemorrhagic disease; Acute kidney injury; Liver injury; Generalized convulsion; Guillain-Barré Syndrome; Acute disseminated encephalomyelitis; Anosmia, ageusia; Meningoencephalitis; Chilblain-like lesions; Single organ cutaneous vasculitis; Erythema multiforme; Serious local/systemic AR following immunization Non-serious intercurrent medical conditions that may affect the immune response to vaccination will also be collected throughout the trial.
9.3.5 Pregnancies

(458) Pregnancy is an exclusion criterion for enrollment in this trial, but subjects could potentially become pregnant during their active participation in this trial.

(459) 9.3.6 Safety Laboratory Assessments

(460) A urine sample for pregnancy testing will be taken from women of childbearing potential on Day 1 prior to trial vaccination to establish eligibility. A urine pregnancy test will also be performed before the second trial vaccination on Day 29 to continue to determine eligibility.

(461) 9.3.7 Vital Signs and Physical Examination

(462) At all trial visits for Phase 2b and Phase 3, vital signs (body temperature, systolic/diastolic blood pressure and pulse) will be recorded in a standardized manner after the subject has rested in the sitting position for 5 minutes.

(463) At the first trial visit on Day 1 and end of trial visit on Day 393 for all subjects in the HERALD Trial CV NCOV-004 a complete physical examination will be performed, including examination of general appearance, eyes/ears/nose/throat, head/neck/thyroid, lymph node areas, cardiovascular system, lung/chest, abdomen and genitourinary system, extremities and neurological examination, skin examination, measurement of weight and height. At all other trial visits, a symptom directed physical examination will be performed.

(464) 9.3.8 Medical and Surgical History

(465) All significant findings and pre-existing conditions present in a subject prior to enrollment must be reported on the relevant medical history/current medical conditions screen of the eCRF.

(466) Information should be provided on medical and surgical history and concomitant medical conditions specifying those ongoing on Day 1.

(467) 9.3.9 Monitoring Committees

(468) 9.3.9.1 Data and Safety Monitoring Board (DSMB)

(469) An independent DSMB will be convened to i) oversee the safety of subjects participating in this trial, HERALD: CV-NCOV-004; ii) to assess the progress and conduct of the trial; iii) to review the cumulative safety data from the trial; iv) to perform an ongoing review of AEs of potential safety concern (see Section 5.5.2); and v) to make recommendations to the Sponsor whether to continue, modify, or pause the trial (see Section 5.5.2).

(470) The DSMB will have regularly scheduled meetings to perform these responsibilities. During these meetings, the DSMB will also be informed of the safety data being generated in other ongoing clinical trials of CVnCoV. As described in Section 5.5.2, to further ensure subject safety on an ongoing basis, a listing of AEs of potential safety concern will be routinely monitored by the Chair of the DSMB (or designee) at regular intervals. As described in Section 7.3.2, the DSMB may request unblinding of an individual subject or a specific dataset at any time during the trial.

(471) In addition to safety data, the DSMB will be asked to review efficacy data at the interim analyses or possibly at other time points during the trial for a continued assessment of the risk-benefit of the trial. As part of the risk-benefit analysis, the DSMB will periodically monitor COVID-19 cases for signals of VDE. The DSMB will also be asked to perform an unblinded review(s) of the incidence rate of COVID-19 cases to recommend an increase(s) in sample size, if needed.

(472) The DSMB Charter will describe in detail the composition and objectives of the DSMB; the responsibilities of the DSMB, CureVac, and CRO; the schedule and conduct of the DSMB meetings; and the datasets to be reviewed. The Charter will contain the statistical analysis plan (SAP) for the DSMB.

(473) 9.3.9.2 Adjudication Committee

(474) An independent Committee of clinicians will be formed to adjudicate COVID-19 cases for assessment of the primary endpoint. The Committee will be blinded to the treatment assignment of the subject. The cases will be adjudicated by the members with respect to the questions presented in Section 9.2.1.4. The schedule of the meetings and approach to adjudication of cases will be defined in the Charter. The Committee Chair will attend the DSMB meetings as an ad hoc member.

(475) 9.4 Immunogenicity Assessments

(476) Because the immunogenicity results would unblind the subject's treatment assignment, the laboratory performing the assays will keep the results in strict confidence. An unblinded person, named at the start of the trial and independent of the conduct of the trial, will periodically review the quality of the immunogenicity data. This person will maintain the results in strict confidence.

(477) 9.4.1 Antibody Responses to CVnCoV Vaccination (RBD of S Protein and Viral Neutralizing Antibodies)

(478) Antibody responses to CVnCoV vaccination will only be evaluated in the Phase 2b part of the trial and only for subjects in the Immunogenicity Subset at the time points. In the Extension Study, antibody persistence will be evaluated every 3 months in the second year post-vaccination.

(479) The immune response induced by vaccination with CVnCoV will be evaluated by 2 assays: Binding antibodies to the SARS-CoV-2 RBD of the S protein measured in serum by immunoassay. Viral neutralizing antibodies directed against SARS-CoV-2 measured in serum by a functional activity assay.
9.4.2 Antibody Responses to SARS-CoV-2 (N Protein)

(480) Antibody responses to SARS-CoV-2 will be evaluated in all parts of the trial and for all subjects by measuring the binding antibodies to the SARS-CoV-2 N protein (virus antigen not contained in the vaccine construct) at the time points specified above and will be performed by immunoassay.

(481) As a measure of prior infection with SARS-CoV-2, serological status to the N protein will be used for the following:

(482) 1. To determine, retrospectively, if subjects were naïve or non-naïve to SARS-CoV-2 infection at trial entry and on Day 43.

(483) a. For evaluation of the efficacy of a 2-dose schedule of CVnCoV in naïve subjects, subjects would have to be seronegative to the N protein at baseline and Day 43.

(484) b. For evaluation of the efficacy after the first dose of CVnCoV in naïve subjects, subjects would have to be seronegative to the N protein at baseline only.

(485) 2. To determine if vaccination with a 2-dose schedule of CVnCoV can reduce infection with SARS-CoV-2 by measuring seroconversion to the N protein in seronegative subjects during the trial period. As described above in 1a, these subjects would have to be seronegative to the N protein at baseline and Day 43.
9.4.3 Antibody Responses to CVnCoV Vaccination in Subjects Who Develop a Case of COVID-19

(486) For all cases of COVID-19 that occur in the trial, the antibody response to trial vaccination will be determined in the subject's blood samples collected on Day 1 (pre vaccination baseline), Day 43, Day 211, and Day 393 of the trial.

(487) These assays will only need to be performed for subjects in the Phase 2b part who are not in the Immunogenicity Subset and for Phase 3 subjects. Subjects in the Phase 2b Immunogenicity Subset will already have these performed as part of the cohort. These results will be used to explore correlates of protective immunity induced by CvnCoV vaccination.

(488) 9.4.4 Cell-mediated Immunity

(489) CMI will be evaluated in 400 subjects: 200 who receive CVnCoV and 200 who receive placebo. In each CVnCoV and placebo group, 100 subjects will be 18 to 60 years of age and 100 subjects ≥61 years of age. This is intended to be carried out in one clinical site in Europe and another in Latin American country (approximately 100 CVnCoV+100 placebo subjects participating at each site).

(490) The frequency and functionality of SARS-CoV-2 RBD of S-specific T-cell response after antigen stimulation will be determined in PBMC in comparison to baseline. For example, ICS to investigate Th1 response and production of Th2 markers will be used to investigate whether vaccination induces a Th1 shift from the baseline. Further high profiling T cell immune responses may be investigated with other technologies such as ELISpot or CyTOF, analysis of genomic biomarkers or any other established assays. CMI assessment will be performed on Day 1 (baseline), Day 29, Day 43, Day 120 and Day 211. Note that testing on Day 120 and Day 211 will only be performed on subjects who are determined as T-cell responders on Day 29 and/or Day 43.

(491) 9.5 Testing for SARS-CoV-2 Infection

(492) 9.5.1 Virological Confirmation of COVID-19 Disease

(493) During the trial, subjects clinically suspected of having COVID-19 disease will undergo testing for the SARS-CoV-2 virus as described below. Sample collection for the tests may be performed at the site or at a home visit by trial staff. Ideally, samples should be collected within 5 days of symptom onset. The test results will be documented on the appropriate eCRF page. Subjects with a clinical suspicion of COVID-19 will undergo testing for SARS-CoV-2 infection using a rapid antigen test performed at the site with the results provided to the subject. Nasopharyngeal swabs will be used to collect samples for the rapid antigen test. Regardless of the result of the rapid antigen test, a nasopharyngeal swab sample collected at the same time will be sent to a central laboratory to perform a SARS CoV 2 specific RT-PCR test. The RT-PCR test result will be considered definitive for SARS-CoV-2 infection. In the unlikely event that only 1 sample can be collected from the subject, the sample should be tested by RT-PCR at the central laboratory. If the RT-PCR test is negative, but COVID-19 is still suspected based on the subject's exposure history and clinical presentation, another nasopharyngeal swab sample should be taken as soon as feasible and sent to the central laboratory for RT-PCR testing. The RT-PCR retest result will be considered definitive for SARS CoV-2 infection. Subjects who are negative for all testing will be considered naïve to SARS-CoV-2 infection. In the unlikely case that a subject tests positive by the rapid antigen test but negative by RT-PCR, the subject will still be considered naïve without a positive virological confirmation by RT-PCR (unless determined otherwise by a seropositive test to the N protein).
9.5.2 Confirmation of a Positive Test for SARS-CoV-2 Infection Performed Outside of the Site

(494) See Section 9.2.1.1.2 and Section 9.2.2 for follow-up of subjects who report a positive test for SARS-CoV-2 infection performed outside of the site.

(495) For subjects (symptomatic or asymptomatic) who report a positive test for SARS-CoV-2 infection which was performed outside of the site, regardless of the type of test, the subject should be retested as soon as feasible to confirm the result. A nasopharyngeal swab sample should be sent to the central laboratory for RT-PCR testing for confirmation. The retest result at the central laboratory will be considered definitive.

(496) 10 STATISTICAL CONSIDERATIONS

(497) 10.1 Sample Size Determination

(498) 10.1.1 Primary Efficacy Co-Objectives

(499) This is an event-driven trial. Sample size and power considerations are based on the co primary objectives for demonstrating efficacy of CVnCoV in the prevention of virologically confirmed cases of COVID-19 of any severity or COVID-19 cases of moderate or higher severity meeting the co-primary case definitions. A group sequential design with 2 interim analyses for cases of COVID-19 of any severity demonstrating a high level of efficacy or reaching futility is planned using O'Brien and Fleming type error spending-function (Lan et al.1983) and the sample size is based on the test for one single proportion (i.e. the proportion of cases in the CVnCoV group, among all cases). The group sequential design is based on the any severity COVID-19 endpoint, due to the higher case number required to meet this endpoint.

(500) To control the type one error for the 2 co-primary objectives, the overall 2-sided alpha of 5% has been equally split between the 2 co-primary objectives. With an overall 2-sided alpha of 2.5%, a total of 185 COVID-19 cases of any severity (meeting the co-primary efficacy case definition for COVID-19 of any severity) are needed at final analysis, to have a power of 90% to demonstrate the VE is above 30% based on the lower bound of the CI for VE, when considering the VE under the alternative hypothesis is 60% (i.e. equivalently to demonstrate the proportion of cases in the CVnCoV group is below 0.4118, based on the upper bound of the CI for proportion when considering the proportion under the alternative hypothesis is equal to 0.2857).

(501) With an overall 2-sided alpha of 2.5%, a total of 60 moderate to severe cases of COVID-19 (meeting the co-primary efficacy case definition of moderate or severe COVID-19) are needed at the final analysis, to have a power of 90% to demonstrate the VE is above 20% based on the lower bound of the CI for VE when considering the VE under the alternative hypothesis is 70% (i.e. equivalently to demonstrate the proportion of cases in the CVnCoV group is below 0.4444, based on the upper bound of the CI for proportion when considering the proportion under the alternative hypothesis is equal to 0.2308). If ⅓ of COVID-19 cases of any severity are moderate to severe, then 60 moderate to severe cases will be obtained when the total number of COVID-19 cases is 180. There is no interim analysis planned for this endpoint.

(502) The two interim analyses for high efficacy or futility of the co-primary objective of COVID 19 cases of any severity will be performed once 56/111 cases have been accrued (approximately 30%/60% of cases).

(503) Assuming an incidence rate of COVID-19 of 0.15% per month in placebo subjects, an overall non-evaluable rate of 20% (corresponding to subjects excluded from the EAS and drop-outs) and a VE of 60%, 36,500 subjects enrolled over approximately 3 months (18,250 per vaccine group) will accrue 185 COVID-19 cases of any severity at approximately 9 months after the first vaccination. A lower incidence rate, a longer enrollment duration, or a higher non evaluable rate or VE will delay the acquisition of the 185 cases and the time of final analysis. Subjects will be randomized to receive either CVnCoV or placebo in a 1:1 ratio, stratified by country and age group (18 to 60 and ≥61 years of age).

(504) 10.1.2 Key Secondary Efficacy Objectives

(505) For the key secondary efficacy objective evaluating the prevention of virologically confirmed severe cases of COVID-19, a lower number of cases will be collected at the time of final analysis compared to the primary endpoint. Based on an analysis of a large database by Verity et al. 2019, approximately 20% of COVID-19 cases can be clinically defined as severe or critical, the latter requiring intensive care.

(506) With 37 cases of severe COVID-19 (20% of 185 cases), the trial will have 88% power to detect a lower limit of the 95% CI of the VE above 10% when assuming the VE is 70%. The power increases to 90% if the VE against severe cases is 75%. With complete follow up of all evaluable subjects for 1 year in the HERALD Trial CV-NCOV-004, it is expected that the additional number of COVID-19 cases accrued post-second vaccination would permit a more robust evaluation of CVnCoV efficacy against severe disease. This analysis will be presented in the SAP.

(507) For the next key secondary efficacy objective, assuming that 45% of SARS-COV-2 infections are asymptomatic (Daniel et al. 2020), approximately 300 asymptomatic infections are expected after 1 complete year of follow-up post-second vaccination for all evaluable subjects. With this number of cases, the trial will have 80% power to detect a lower limit of the 95% CI of the VE above 0% when assuming the VE against asymptomatic infections is 28%.

(508) 10.2 Populations for Analyses

(509) In the Safety Analysis Set (SAS), Safety Analysis Set 2 (SAS 2), and the Solicited AEs Safety Analysis Set (SASsol), subjects will be analyzed in the group they actually received (as “treated”).

(510) Following the “intent to treat” principle in the Efficacy sets and Per-Protocol Sets, subjects will be analyzed in the group to which they were randomized (as “randomized”).

(511) 10.2.1 Safety Analysis Set (SAS)

(512) The SAS will include all subjects randomized in Phase 2b or 3 who received at least one dose of CVnCoV or placebo.

(513) The SAS will be the primary population for safety endpoints collected on all subjects (i.e. medically-attended AEs, AESI, AEs leading to withdrawal or trial discontinuation and SAEs) and for efficacy objectives assessing efficacy after the first dose.

(514) 10.2.2 Safety Analysis Sets 2 (SAS 2, SASsol)

(515) As solicited and unsolicited AEs are collected only for Phase 2b subjects, these analyses will then be restricted to the Phase 2b subjects.

(516) The SAS 2 population will include all Phase 2b subjects of the SAS and will be used for unsolicited AEs analysis. The SASsol population will include all Phase 2b subjects of the SAS with at least one diary collection indicating the occurrence or lack of occurrence of solicited AEs and will be used for solicited AEs analysis.

(517) 10.2.3 Efficacy Analysis Set (EAS)

(518) The EAS will include all subjects randomized in Phase 2b or Phase 3 who: Received both doses of trial vaccine according to their randomization (2 doses of CVnCoV or 2 doses of placebo). Had not developed a virologically-confirmed case of COVID-19 before trial entry (based on exclusion criteria 1) or before 15 days following the second vaccination. Had not stopped the trial before 15 days following the second vaccination. Were SARS-CoV-2 naïve at baseline (based on seronegativity to N protein in the blood sample taken at baseline).

(519) The EAS will be the primary analysis population for all efficacy endpoints (except for the key secondary efficacy endpoint related to seroconversion and for the efficacy endpoints evaluating efficacy starting after the first dose).

(520) 10.2.4 Efficacy Analysis Set for Seroconversion (EASS)

(521) The EASS population will include all subjects of the EAS who tested seronegative at baseline and Day 43 for the N protein of SARS-CoV-2 (i.e. at all the testing time points before 15 days following the second vaccination) and for whom at least one serological test result for N protein at ≥15 days following the second vaccination (Day 211 or 393) is available for analysis.

(522) The primary analysis of the key secondary efficacy endpoint related to seroconversion to the N protein of SARS-CoV-2 (asymptomatic infections) will be performed on this population.

(523) 10.2.5 Per Protocol Efficacy Set (PPE)

(524) The Per Protocol Efficacy set will include EAS subjects who meet all eligibility criteria at trial entry and who have no major protocol deviations that would impact the efficacy outcomes as specified in the SAP.

(525) The PPE will be a supportive population for efficacy endpoints (except for the key secondary efficacy endpoint related to seroconversion and for the efficacy secondary endpoint evaluating efficacy starting after the first dose).

(526) 10.2.6 Per Protocol Immunogenicity Set (PPI)

(527) The PPI set will include all Phase 2b subjects who belong to the Immunogenicity Subset (IS) {i.e. ˜first 600 subjects enrolled into each of the 2 age groups in Phase 2b (18-60 and ≥61 years of age)} and who: Received both doses as randomized and within the windows defined in the protocol. Have no major protocol deviations expecting to impact the immunogenicity outcomes as specified in the SAP. Have not received medical treatments (such as blood products, immunoglobulin therapy) that may interfere with one or both of the proposed immunogenicity measurements. Have at least one blood sample collected starting at 14 days (Day 43) post-second vaccination available for analysis.

(528) The PPI will be the primary analysis population for SARS-CoV-2 RBD of S protein antibody responses and SARS-CoV-2 viral neutralizing antibody.

(529) Subjects to be excluded from the PPE/PPI will be identified and reviewed at the Blinded Data Review Meeting held before unblinding of the trial. Major protocol deviations will be listed and summarized.

(530) Table 18 provides a summary of primary and supportive populations planned for analysis of each endpoint. Other analysis populations may be defined in the SAP.

(531) TABLE-US-00024 TABLE 18 Primary and Supportive Populations for the Analysis of Each Endpoint Endpoints Primary Population Supportive Population Primary Efficacy Endpoints EAS PPE Primary Safety Endpoints SAEs, AESI, medically-attended AEs SAS — Secondary Efficacy Endpoints: Severe COVID-19 EAS PPE Asymptomatic infections (Seroconversion to the N EASS protein) COVID-19 in ≥ 61 years of age EAS (≥61 years of age PPE (≥61 years of age subjects) subjects) All SARS-CoV-2 infection (RT-PCR positive) EAS PPE COVID-19 after first dose SAS (naïve subjects) — Secondary Immunogenicity Endpoints: SARS-CoV-2 RBD of spike (S) protein antibody PPI — responses SARS-CoV-2 viral neutralizing antibody PPI — Safety Endpoints: Solicited AEs SASsol — Unsolicited AEs SAS 2 — AE leading to vaccine withdrawal SAS — Exploratory Efficacy Endpoints: Severity of COVID-19 EAS — Supplemental oxygenation, hospitalization, EAS SAS mechanical ventilation, death COVID-19 after first dose SAS — Second episode of COVID-19 EAS — Exploratory Immunogenicity Endpoints: RBD of S-specific T-cell response after antigen PPI — stimulation by intracellular cytokine staining (ICS) to investigate Th1 response and expression of Th2 The proportion of subjects with a detectable increase PPI — in SARS-CoV-2 RBD of S-specific T-cell response
10.3 Statistical Analyses
10.3.1 General Considerations

(532) Five analyses are planned: 2 interim (when 56/111 cases are reached); the final (when 185 cases are reached); the 1 year follow-up (on all data up to Day 393 visit); and the 2 year follow-up (on all data up to end of Extension Study). An SAP for the interim and final analyses will be prepared and finalized at the latest prior to database locks. This document will provide further details regarding the definition of analysis variables and analysis methodology to address all trial objectives and the handling of missing data. All analyses planned for the final analysis will be regenerated for the 1 year follow-up and 2 year follow up analyses.

(533) 10.3.2 Demographic, Medical History, and Other Baseline Characteristics

(534) Data will be summarized with respect to demographic and baseline characteristics (e.g. age, gender, height, weight), medical history, baseline immune status, and all safety measurements using descriptive statistics (quantitative data) and contingency tables (qualitative data) overall, by vaccine group, and by age group and vaccine group.

(535) 10.3.3 Trial Vaccine Administration

(536) The administrations of CVnCoV or control will be listed and the number of subjects actually receiving the vaccination doses will be summarized by vaccine group.

(537) 10.3.4 Concomitant Medication and Vaccinations

(538) Concomitant medication/vaccination after the start of the trial will be listed and summarized by Anatomical Therapeutic Chemical term, overall and by vaccine group.

(539) 10.3.5 Efficacy Analyses

(540) 10.3.5.1 Co-Primary Efficacy Endpoint Analysis

(541) Primary Efficacy Analysis

(542) In primary efficacy analysis, the VE, defined as the percent reduction in the frequency of any and moderate to severe COVID-19 cases (according to primary case definitions) in vaccinated subjects compared with subjects who received placebo will be calculated with exact 95%* CI as follows:
VE=1−RR=1−(ARV/ARP)=1−{p/r(1−p)}
where
ARV=attack rate in vaccinated group=nv/Nv=number of subjects reporting at least one COVID-19 episode in the CVnCoV group/total follow-up time of evaluable subjects in the CVnCoV group (number of person-month).
ARP=attack rate in placebo group=np/Np=number of subjects reporting at least one COVID-19 episode in the placebo group/total follow-up time of evaluable subjects in the placebo group (number of person-month).
RR=relative risk=ARV/ARP
p=proportion of COVID-19 cases (according to primary case definition) coming from the CVnCoV group among all cases=nv/(nv+np).
r=ratio of total follow-up time of evaluable subjects in the CVnCoV group over total follow-up time of evaluable subjects in the placebo group=Nv/Np.
*Level of CI may be slightly adjusted due to the sequential design (see Section 10.3.8).

(543) The statistical hypotheses for the co-primary efficacy endpoints are:

(544) H0A: VE≤30% versus H1A: VE >30% and

(545) H0S: VE≤20% versus H1 S: VE >20%

(546) A is related to COVID-19 cases of any severity;

(547) S is related to moderate to severe cases of COVID-19;

(548) The trial will be successful if either the lower limit (LL) of the exact 2-sided 97.5% (to be slightly adjusted to consider the sequential design) CI of VE endpoint is >30% for all COVID-19 cases of any severity or if the lower limit (LL) of the exact 2-sided 97.5% CI of VE endpoint is >20% for severe to moderate COVID-19 cases.

(549) If the 2 interim analyses and the final analysis for COVID-19 cases of any severity are performed after 56/111 and 185 cases have been reported, respectively, the 1-sided α-risk to consider at the time of final analysis according to O'Brien Fleming type error spending function will be 0.01209 and efficacy will be demonstrated at the final analysis if 60 cases or less over 185 are in the CVnCoV group (observed VE ≥52.0%); and 0.025 for the final analysis for cases of moderate to severe COVID-19 and efficacy will be demonstrated if 17 cases or less over 60 are in the CVnCoV group (observed VE ≥60.5%). To note, the rule in terms of split of cases to demonstrate efficacy can slightly differ if r ≠1 (total follow-up time different in both groups).

(550) Sensitivity Analysis

(551) As a key sensitivity analysis, the time to first-occurrence of virologically-confirmed COVID 19 cases (according to primary case definitions) will be analyzed.

(552) The Kaplan-Meier curves will display the estimated probabilities of not developing COVID 19 and log-rank test will be performed.

(553) The time to first-occurrence of virologically-confirmed COVID-19 (date of symptoms onset) will start 15 days following the second vaccination.

(554) Subjects who do not develop COVID-19 will be censored at the date of trial termination or cut-off date for analysis whichever comes first.

(555) An additional sensitivity analysis may include a Cox proportional hazards regression model adjusted for relevant baseline covariates specified in the SAP.

(556) More details on the analysis methods will be described in the SAP.

(557) 10.3.5.2 Secondary Efficacy Endpoints Analyses

(558) Statistical testing of the 2 key secondary efficacy endpoints will be performed according to the conditional hierarchical testing procedure using the order defined in the objective/endpoints sections. Consequently: Efficacy of CVnCoV in regard to severe cases will be demonstrated only if there is successful demonstration of the primary efficacy objective. Efficacy of CVnCoV in regard to asymptomatic infection will be demonstrated only if there is successful demonstration of the primary efficacy objective and secondary objective on severe cases.

(559) Otherwise, these endpoints will be analyzed as exploratory endpoints without success criteria testing.

(560) To assess the efficacy in the prevention of severe disease and asymptomatic infections, similar analyses to those performed on the primary efficacy endpoint will be performed. The efficacy will be demonstrated if the LL of the exact 2-sided 95% CI of VE is above 10% for severe disease and above 0% for asymptomatic infections.

(561) Other secondary efficacy endpoints will be analyzed similarly to the primary efficacy endpoint but no formal testing will be performed for those endpoints. For efficacy after the first dose, the time to first-occurrence of virologically-confirmed COVID-19 (date of symptom onset) will start after the first vaccination. The BoD will be analyzed using 2 different scoring systems. Both BoD scoring systems place more weight on efficacy against severe COVID-19 disease or severe disease as reflected by hospitalization or death. In addition, VE and associated CI will be calculated for each of the BoD categories.

(562) 10.3.5.3 Exploratory Efficacy Endpoints Analyses

(563) The proportions of mild and severe COVID-19 cases (according to primary case definition) among all cases will be summarized by group.

(564) Description of frequencies and percentages will be provided by group for subjects who: Need supplemental oxygenation due to COVID-19. Need mechanical ventilation due to COVID-19. Are hospitalized due to COVID-19. Died due to COVID-19. Died due to any cause.

(565) This will be done for events occurring ≥15 days following the second trial vaccination (full VE) and then for events occurring at any time after the first trial vaccination.

(566) The VE in the prevention of first episodes of virologically-confirmed cases of COVID-19 of any severity will be reassessed on all subjects whatever their serological status at baseline for cases occurring ≥15 days following the second trial vaccination and then for all cases occurring after the first dose.

(567) Finally, the number and percentage of subjects who developed a second episode of COVID-19 will be displayed by group.

(568) 10.3.6 Secondary and Exploratory Immunogenicity Analysis

(569) No formal hypothesis on immunogenicity will be tested. Descriptive statistics for the immunogenicity endpoints will be provided for each vaccine group and overall, and by vaccine group and age groups. Data will be presented after each vaccine dose.

(570) The following analyses will be performed for antibody levels to the SARS-CoV-2 RBD of S protein and for neutralizing antibodies overall and separately in subjects seronegative at baseline and in subjects seropositive at baseline: Geometric mean titers (GMTs) will be summarized with their 95% CI at each blood sampling time point. The Fold Change (FC) from baseline will be computed for each subject and Geometric mean of FC (GMFC) will be displayed with their 95% CI at each blood sampling time point after baseline.

(571) Non detectable antibodies will be arbitrary replaced by half of the detection cut-off for GMT and GMFC computations purpose.

(572) For each readout, the number and percentage of subjects SARS CoV-2 seronegative at baseline for who a seroconversion is observed will be summarized and presented at each blood sampling time point after baseline with exact 95% C1. Seroconversion is defined as detectable antibodies in the serum.

(573) Percentages of subjects seroconverting for SARS CoV-2 RBD of S protein antibodies and SARS CoV-2 neutralizing antibodies will be summarized. The frequency of immunecell populations induced by the vaccine will be summarized.

(574) Further characterization of the T cell immune response may be done with other technologies like ELISpot, CyTOF and/or analysis of genomic biomarkers.

(575) Additional immunogenicity analyses including graphs will be described in the SAP as applicable.

(576) 10.3.7 Safety Analysis

(577) No formal statistical testing of safety data is planned.

(578) The descriptive safety analyses will be performed overall, by vaccine group and by age group and vaccine group.

(579) The following analyses will be done overall and separately in subjects seronegative at baseline and in subjects seropositive at baseline for SARS-CoV-2 N protein antibody levels:

(580) Solicited AEs: The frequencies and percentages of subjects experiencing each solicited local and systemic AE within 7 days after each vaccination will be presented by intensity and overall. For subjects with more than 1 episode of the same AE within 7 days after a vaccination, the maximum intensity will be used for tabulations. Similar tabulations will be performed for solicited systemic AEs by relationship to trial vaccination. Solicited local AEs will be by definition considered as related to the trial vaccine. Time to onset (in days) and duration (in days) will also be summarized for each solicited local and systemic AEs. Summary tables showing the occurrence of at least one local or systemic solicited AE within 7 days after each vaccination will also be presented.

(581) Unsolicited AEs: Unsolicited AEs including SAEs and AESIs will be coded using the Medical Dictionary for Regulatory Activities (MedDRA) by System Organ Class (SOC) and Preferred Term (PT).

(582) The frequency and percentage of subjects reporting each unsolicited AE within the 28 days after each vaccination and overall will be tabulated at the SOC and PT levels.

(583) Similar tables will be provided for: related unsolicited AEs, Grade 3 or higher unsolicited AEs, medically-attended AEs that occur within 6 months after the second trial vaccination, SAEs, related SAEs, AESIs, related AESIs, AEs leading to withdrawal or trial discontinuation and SAEs resulting in death through 1 year after the second trial vaccination. When an AE occurs more than once for a subject within the 28 days post 1 vaccination, the maximal severity and strongest relationship to the vaccine group will be counted.

(584) Only AE post first vaccination will be considered in the summary tables. AE starting prior to the first vaccination will be recorded as medical history.

(585) Data listings of fatal and SAEs will be provided by subject.

(586) Vital signs will be summarized by descriptive statistics at each visit, including change from baseline, and a listing will be provided.

(587) 10.3.8 Interim Analysis

(588) Two interim analyses will be performed for this trial by an unblinded independent statistician and reviewed by the DSMB when 56/111 cases of COVID-19 of any severity (meeting the co-primary efficacy case definition) are observed. This analysis will aim to assess early high efficacy or futility on the primary efficacy endpoint and will be done on the EAS population only. The safety data that is available at this time point will also be described.

(589) For the analysis of early demonstration of high efficacy or futility, cumulative O'Brien Fleming type error spending function (Lan et al.1983) is used to provide statistical stopping rules for high efficacy (α-boundaries) and futility (β-boundaries) for the interim analysis, based on the information accumulated until that specific interim stage.

(590) At the interim stage, if the p-value for the test of the primary objective is lower than the α boundary, a high level of efficacy for CVnCoV will be declared. Conversely, demonstration of futility will occur if the p-value is higher than the β-boundary.

(591) The interim analyses are planned to occur when 56/11 cases of COVID-19 of any severity have been observed. Table 19 below shows the boundaries for demonstrating high efficacy or futility, calculated on a 1 sided p-value scale using the cumulative error spending function.

(592) TABLE-US-00025 TABLE 19 Two Stage Group Sequential Design with Interim Analyses at 56 and 111 Cases and Final Analysis at 185 Cases Interim Analysis 1 Interim Analysis 2 Final Analysis Number of Cases 56 111 185 Efficacy α-Boundary on 0.00001 0.00126 0.01209 p-value scale (1-sided) Futility β-Boundary on p- 0.73596 0.15716 NA value scale (1-sided) Efficacy success criteria* Success if ≤ 7 cases Success if ≤ 29 cases in Success if ≤ 60 cases in CVnCoV group over 56 CVnCoV group over 111 in CVnCoV group over cases cases 185 cases (observed VE ≥ 85.7%) (observed VE ≥ 64.6%) (observed VE ≥ 52.0%) Futility* Futility if ≥ 26 cases in CVnCoV Futility if ≥ 41 cases NA group over 56 cases in CVnCoV group over 111 (observed VE ≤ 13.3%) cases (observed VE ≤ 41.4%) *Rules in terms of split of cases to demonstrate efficacy/futility can slightly differ if the total number of evaluable subjects is unequal in both groups (r ≠ 1).

(593) If the interim analysis is performed exactly after 56/111 cases have been reported, a 1 sided p-value lower than 0.00001/0.00126 (i.e. lower limit of the 2-sided 99.99%/99.99% CI>30%) will lead to the conclusion of high efficacy, while a 1-sided p-value higher than 0.73596/0.15716 will result in the demonstration of futility. Otherwise, the final analysis will be performed at 185 cases. Similarly, if the number of evaluable subjects is equal in both groups, it means that the trial will conclude early high efficacy if 7/29 cases or less over 56/111 are coming from the CVnCoV group, while futility of the trial will be demonstrated if 26/41 cases or more are coming from the CVnCoV group.

(594) Of note, the actual boundaries used for decision making would depend on the exact number of cases occurring and reported at each analysis (interim and final).

(595) The boundaries will be applied in a nonbinding way as there are many other factors that would be part of the decision-making process.

(596) 10.3.9 Missing Data and Discontinuation

(597) Analysis of vaccination variables will be done on a valid case basis, i.e., for missing observations, no imputation for missing data, such as last observation carried forward, will be applied.

(598) For SARS-CoV-2 RBD of S protein antibodies, concentration values marked as below the lower limit of quantification (LLOQ) will be set to 0.5*LLOQ.

(599) No imputation of missing values will be done for any analysis (except the imputation for missing partial dates of AEs and concomitant medication as specified in the SAP).

(600) Currently no replacement of drop-out subjects is foreseen.

Example 14: Vaccination of Rats with mRNA Encoding SARS-CoV-2 Antigen S_Stab Formulated in LNPs

(601) The present example shows that SARS-CoV-2 S mRNA vaccines with mRNA comprising alternative forms of the 3′end (A64-N5-C30-hSL-N5 or hSL-A100) and UTR combinations (i-3 (−/muag) or a-1 (HSD17B4/PSMB3)) induce strong humoral as well as cellular immune response in rats. mRNA encoding SARS-CoV-2 S_stab comprising hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) shows stronger and very early induction of immune responses, demonstrated by a stronger induction of binding and neutralizing antibodies even after one first vaccination.

(602) Preparation of LNP formulated mRNA vaccine:

(603) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4 prior to use in in vivo vaccination experiments.

(604) Immunization:

(605) Rats were injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 18. As a negative control, one group of rats was vaccinated with buffer (group A). All animals were vaccinated on day 0 and day 21. Blood samples were collected on day 14, day 21 (post prime) and 42 (post boost) for the determination of antibody titers.

(606) TABLE-US-00026 TABLE 20 Vaccination regimen (Example 14): 5′-UTR/ 3′-UTR; SEQ ID SEQ ID mRNA CDS UTR NO: NO: Group Vaccine composition ID opt. Design 3′-end Protein RNA Dose buffer — — — — — A mRNA encoding S_stab R9515 opt1 -/muag; A64-N5- 10 163 0.5 μg formulated in LNPs C30-hSL- N5 B mRNA encoding S_stab R9515 opt1 -/muag; A64-N5- 10 163 2 μg formulated in LNPs C30-hSL- N5 C mRNA encoding S_stab R9515 opt1 -/muag; A64-N5- 10 163 8 μg formulated in LNPs C30-hSL- N5 D mRNA encoding S_stab R9515 opt1 -/muag; A64-N5- 10 163 20 μg formulated in LNPs C30-hSL- N5 E mRNA encoding S_stab R9515 opt1 -/muag; A64-N5- 10 163 40 μg formulated in LNPs C30-hSL- N5 F mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL-A100 10 149 0.5 μg formulated in LNPs PSMB3 G mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL-A100 10 149 2 μg formulated in LNPs PSMB3 H mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL-A100 10 149 8 μg formulated in LNPs PSMB3 I mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL-A100 10 149 20 μg formulated in LNPs PSMB3 J mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL-A100 10 149 40 μg formulated in LNPs PSMB3
Determination of IgG1 and IgG2 antibody titers using ELISA:

(607) ELISA was performed as described before in Example 12.

(608) Determination of Virus neutralizing antibody titers (VNT)

(609) Virus neutralizing antibody titers (VNT) of rat serum samples were analyzed as previously described in Example 6 with mouse serum.

(610) Results:

(611) As shown in FIG. 16 A the vaccination with mRNA full length S stabilized protein comprising the non-coding region with 3′end hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) formulated in LNPs (R9709) induced in rats robust and dose dependent levels of binding antibody titers (shown by IgG1 and IgG2a endpoint titers) at day 14 and day 21 already after one first vaccination using doses of 0.5 μg, 2 μg, 8 μg, 20 μg, and 40 μg. The vaccination with mRNA full length S stabilized protein comprising the non-coding region with 3′end A64-N5-C30-hSL-N5 and the UTR combination i-3 (−/muag;) formulated in LNPs (R9515, CVnCov) induced in rats dose dependent levels of binding antibody titers (shown by IgG1 and IgG2a endpoint titers) at day 14 and day 21 already after one first vaccination using the higher doses (8 μg, 20 μg, and 40 μg).

(612) As shown in FIG. 16 B vaccination with mRNA comprising the non-coding region with 3′end hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) encoding full length S stabilized protein formulated in LNPs (R9709) induced in rats dose dependent and very high levels of VNT, already after 14 days after one first vaccination with a dose of at least 2 μg.

(613) As shown in FIG. 16 C vaccination with both mRNA vaccine formats encoding full length S stabilized protein formulated in LNPs induce strong VNTs in a dose dependent manner. The induction of VNTs with mRNA encoding SARS-CoV-2 S_stab comprising hSL-A100 and the UTR combination a-1 (HSD17B4/PSMB3) shows a stronger and very robust induction of very high neutralizing antibody titers even at a dose of only 2 μg, when compared with mRNA encoding SARS-CoV-2 S_stab comprising A64-N5-C30-hSL-N5 and the UTR combination i-3 (−/muag). The titer of neutralizing antibodies raised by the vaccine composition comprising mRNA R9709 could be further notably increased by the second vaccination.

(614) The strength of vaccine composition comprising R9709 may support an immunization protocol for the treatment or prophylaxis of a subject against coronavirus, preferably SARS-CoV-2 coronavirus comprising only one single dose of the composition or the vaccine.

Example 15: Vaccination of NHP with mRNA Encoding SARS-CoV-2 Antigen S_Stab Formulated in LNPs and Challenge

(615) The protective efficacy of mRNA encoding S_stab formulated in LNPs (CVnCoV) was addressed in a rhesus macaque SARS-CoV-2 challenge model. Non-human primates develop mild clinical disease with high levels of viral replication in both the upper and lower respiratory tract and pathological changes indicative of viral pneumonia upon infection with SARS-CoV-2 (Munoz-Fontela et al., 2020). Results presented that CVnCoV had protective impact against challenge with 5×10.sup.6 PFU via the intra nasal (IN) and intra tracheal (IT) routes in an NHP in vivo model of COVID-19. Protective endpoints include significantly reduced virus load, in addition to protection against lung pathology.

(616) Preparation of LNP formulated mRNA vaccine:

(617) SARS-CoV-2 S mRNA construct was prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4 prior to use in in vivo vaccination experiments.

(618) Immunization and challenge:

(619) Eighteen rhesus macaques (Macaca mulatta), of Indian origin were divided into three groups of six, each comprising three males and three females (with a weight of >4.5 kg and an age of 3-6 years). Animals were vaccinated twice with either 0.5 μg or 8 μg LNP-formulated mRNA encoding SARS-CoV-2 antigen S_stab (SARS-CoV-2 S-2P (CVnCoV)) or remained unvaccinated prior to challenge with wild type SARS-CoV-2 four weeks after the second vaccination (see FIG. 17 A). The animals were injected intramuscularly (i.m.) in the bicep muscle of the upper arm with mRNA vaccine compositions, in a volume of 0.5 ml and doses as indicated in Table 21. As negative control, one group of NHPs was not treated/unvaccinated before challenge (group A). Blood samples were collected on day 0, 14, 28 (post first vaccination), on day 42 and 56 (post second vaccination), and on day 1, 3, 5, 7 after challenge for the determination of antibody titers. The animals were intranasally challenged on day 56 with a dose of 5.0×10.sup.6 PFU SARS-CoV-2 by applying 2 ml of virus preparation to the pre-carinal section of the trachea using a bronchoscope followed by 1 ml applied intranasally (0.5 ml/nostril). Two animals of each group were followed for 6, 7 or 8 days post challenge (p.c.) and euthanized on day 62, 63 or 63 of the experiment.

(620) TABLE-US-00027 TABLE 21 Vaccination regimen (Example 15): mRNA CDS SEQ ID NO: SEQ ID NO: Group Vaccine composition ID dose vaccination opt. Protein RNA A mRNA encoding S_stab R9515 0.5 μg d0, d28 opt1 10 163 formulated in LNPs (CVnCoV) B mRNA encoding S_stab R9515 8 μg d0, d28 opt1 10 163 formulated in LNPs (CVnCoV) C Unvaccinated
IqG ELISA

(621) A full-length trimeric and stabilised version of the SARS-CoV-2 Spike protein was supplied by Lake Pharma (#46328). Recombinant SARS-CoV-2 Receptor-Binding-Domain (319-541) Myc-His was developed and kindly provided by MassBiologics. Recombinant SARS-CoV-2 Spike- and RBD-specific IgG responses were determined by ELISA. High-binding 96-well plates (Nunc Maxisorp, 442404) were coated with 50 μl per well of 2 μg/ml Spike trimer or Spike RBD in 1×PBS (Gibco) and incubated overnight at 4° C. The ELISA plates were washed and blocked with 5% Foetal Bovine Serum (FBS, Sigma, F9665) in 1×PBS/0.1% Tween 20 for 1 hour at room temperature. Serum collected from animals after vaccination had a starting dilution of 1/50 followed by 8, two-fold serial dilutions. Post-challenge samples were inactivated in 0.5% triton and had a starting dilution of 1/100 followed by 8, three-fold serial dilutions. Serial dilutions were performed in 10% FBS in 1×PBS/0.1% Tween 20. After washing the plates, 50 μl/well of each serum dilution was added to the antigen-coated plate in duplicate and incubated for 2 hours at room temperature.

(622) Following washing, anti-monkey IgG conjugated to HRP (Invitrogen, PA1-84631) was diluted (1:10,000) in 10% FBS in 1×PBS/0.1% Tween 20 and 100 μl/well was added to the plate. Plates were then incubated for 1 hour at room temperature. After washing, 1 mg/ml O-Phenylenediamine dihydrochloride solution (Sigma P9187) was prepared and 100 μl per well were added. The development was stopped with 50 μl per well 1 M Hydrochloric acid (Fisher Chemical, J/4320/15) and the absorbance at 490 nm was read on a Molecular Devices versamax plate reader using Softmax (version 7.0). All test sample dose response curves were fitted to a 4PL model in Softmax Pro (version 7.0) and the endpoint titre at an OD of 0.5 (defined as reciprocal of the serum dilution required to give an absorbance response of 0.5) was interpolated from each curve. Where results were below the limit of detection, they were assigned a value of 25 for the post immunisation samples and 50 for the post challenge samples. For low samples where the absorbance never reached a value of 0.5, the titre was estimated from the extrapolated portion of the curve. The cut-off was set as the average titre of serum collected from naïve animals (day 0)+1 Standard Deviation. The cut off was calculated separately for each antigen.

(623) SARS-CoV-2 focus reduction neutralisation test

(624) Virus neutralising titres were measured in heat-inactivated serum samples (56° C. for 30 min). SARS-CoV-2 (Victoria/01/2020, Doherty Institute) at a concentration to give 100 to 250 foci per well in the virus only control wells was mixed 50:50 in 1% FCS MEM with 1× antibiotic/antimycotic (Gibco, 15240-062) with serum doubling dilutions from 1:20 to 1:640 (or higher dependent on antibody levels) in a 96-well V-bottomed plate. The plate was incubated at 37° C. in a humidified box for 1 hour to allow antibodies in the serum sample to bind to the virus. One hundred microlitres of the serum/virus mixture was then transferred to virus susceptible Vero/E6 monolayers in 96-well plates and incubated for a further 1 hour at 37° C. in a sealed humidified box. After adsorption, the virus/antibody mixture was removed and 100 μl of 1% w/v CMC in complete media overlay was added. The box was resealed and incubated at 37° C. for 24 hours prior to fixing with 100 μl of 20% formalin/PBS solution and fumigation of the plate overnight prior to immunostaining. Following washing with water using an ELISA washer (BioTek 405 TSUS), residual endogenous peroxidase activity was removed by the addition of 0.3% hydrogen peroxide for 20 min. Plates were then incubated for 1 h with primary/detection SARS-CoV-2 anti-RBD rabbit polyclonal antibody (SinoBiologicals; 40592-T62) diluted 1:2,000 in PBS. After washing, plates were incubated for 1 h with secondary anti-rabbit HRP-conjugate antibody (Invitrogen; G-21234) diluted 1:4,000 in PBS. After washing, foci were visualised using TrueBlue™ Peroxidase Substrate (KPL seracare; 5510-0030) after which plates were washed with water and dried. Foci were counted using an ImmunoSpot S6 Ultra-V analyser (CTL) and BioSpot software (7.0.28.4 Professional; CTL) and the results analysed in SoftMax Pro (Molecular Devices; v7.0.3 GxP). Briefly, the count data was expressed as percentage of VOC for each serum dilution, i.e. percentage foci reduction and plotted on a 4-Parameter logistic (4PL) curve. The virus neutralisation titre (VNT) is reported as serum dilution that neutralised 50% of the virus foci.

(625) Alternatively virus neutralizing titres were measured as previously described in Example 9 with a SARS-CoV-2 virus featuring the mutation D614G.

(626) ELISpot

(627) Peripheral Blood Mononuclear Cells (PBMCs) were isolated from whole heparinised blood by density gradient centrifugation using Ficoll-Paque Plus (GE Healthcare, USA). An IFN-7 ELISpot assay was used to estimate the frequency and IFN-7production capacity of SARS-CoV-2-specific T cells in PBMCs using a human/simian IFN-γkit (MabTech, Nacka, Sweden). The cells were assayed at 2×10.sup.5 cells per well. Cells were stimulated overnight with SARS-CoV-2 peptide pools and ‘megapools’ of the spike protein (Mimotopes, Australia). Peptide sequence was based on GenBank: MN908947.3. Ten peptide pools were used, comprised of 15 mer peptides, overlapping by 11 amino acids. The three megapools were made up as such: Megapool 1 (MP1) comprised peptide pools 1-3, Megapool 2 (MP2) comprised peptide pools 4-6 and Megapool 3 (MP3) comprised of peptide pools 7-10. All peptides were used at a final concentration of 1.7 μg/ml per peptide. Phorbol 12-myristate (Sigma-Aldrich Dorset, UK) (100 ng/ml) and ionomycin (CN Biosciences, Nottingham, UK) (1 mg/ml) were used as a positive control. Results were calculated to report as spot forming units (SFU) per million cells. All SARS-CoV-2 peptides and megapools were assayed in duplicate and media only wells subtracted to give the antigen-specific SFU. ELISpot plates were analysed using the CTL scanner and software (CTL, Germany) and further analysis carried out using GraphPad Prism (version 8.0.1) (GraphPad Software, USA).

(628) Bronchioalveolar lavage (BAL)

(629) In-life BAL washes were performed using 6 ml or 10 ml PBS using a bronchioscope inserted to the right side of the lung above the second bifurcation. BAL washes performed post-mortem were conducted on the right lung lobes, after ligation of the left primary bronchus using 20 ml PBS.

(630) Quantitative Polymerase Chain Reaction

(631) RNA was isolated from nasal swab, throat swabs, EDTA treated whole blood, BAL and tissue samples (spleen, kidney, liver, colon, duodenum, tonsil, trachea and lung). Tissue samples in RNAprotect (Qiagen), were homogenised in a Precellys 24 homogeniser with CK28 Hard tissue homogenizing 2.0 ml tubes (Bertin) and 1 ml of RLT buffer (Qiagen) supplemented with 1% (v/v) Beta-mercaptoethanol. Tissue homogenate was passed through a QIAshredder homogenizer (Qiagen) and a volume that equated to 17.5 mg of tissue was extracted using the BioSprint™96 One-For-All vet kit (Qiagen) and Kingfisher Flex platform as per manufacturer's instructions. Non-tissue samples were inactivated by placing samples into AVL buffer (Qiagen) and adding 100% ethanol. Extraction of these samples was performed using the BioSprint™96 One-For-All vet kit (Qiagen) and Kingfisher Flex platform as per manufacturer's instructions.

(632) Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies) and QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems™). PCR amplicons were quantified against in vitro transcribed RNA N gene fragment standard. Positive samples detected below the lower limit of quantification (LLOQ) of 10 copies/μl were assigned the value of 5 copies/μl, undetected samples were assigned the value of 2.3 copies/μl, equivalent to the assays LLOD. For nasal swab, throat swab, BAL and blood samples extracted samples this equates to an LLOQ of 1.29×10.sup.4 copies/ml and LLOD of 2.96×10.sup.3 copies/ml. For tissue samples this equates to an LLOQ of 5.71×10.sup.4 copies/g and LLOD of 1.31×10.sup.4 copies/g.

(633) Subgenomic RT-qPCR was performed on the QuantStudio™ 7 Flex Real-Time PCR System using TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) with forward primer, probe and reverse primer at a final concentration of 250 nM, 125 nM and 500 nM respectively. Sequences of the sgE primers and probe were: 2019-nCoV_sgE-forward, 5′ CGATCTCTTGTAGATCTGTTCTC 3′ (SEQ ID NO: 22729); 2019-nCoV_sgE-reverse, 5′ ATATTGCAGCAGTACGCACACA 3′ (SEQ ID NO: 22730); 2019-nCoV_sgE-probe, 5′ FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 3′ (SEQ ID NO: 22731). Cycling conditions were 50° C. for 10 minutes, 95° C. for 2 minutes, followed by 45 cycles of 95° C. for 10 seconds and 60° C. for 30 seconds. RT-qPCR amplicons were quantified against an in vitro transcribed RNA standard of the full-length SARS-CoV-2 E ORF (accession number NC_045512.2) preceded by the UTR leader sequence and putative E gene transcription regulatory sequence. Positive samples detected below the lower limit of quantification (LLOQ) were assigned the value of 5 copies/μl, whilst undetected samples were assigned the value of 50.9 copies/μl, equivalent to the assays lower limit of detection (LLOD). For nasal swab, throat swab, BAL and blood samples extracted samples this equates to an LLOQ of 1.29×10.sup.4 copies/ml and LLOD of 1.16×10.sup.3 copies/ml. For tissue samples this equates to an LLOQ of 5.71×10.sup.4 copies/g and LLOD of 5.14×10.sup.3 copies/g.

(634) Histopathology

(635) Tissue samples from left cranial and caudal lung lobes, trachea, larynx, mediastinal lymph node, tonsil, heart, thymus, pancreas, spleen, liver, kidney, duodenum, colon, brain, vaccinating site (skin including subcutis and underlying muscle) and draining lymph node (left and right) were fixed in 10% neutral-buffered formalin and embedded into paraffin wax. 4 μm thick sections were cut and stained with haematoxylin and eosin (HE). Tissue slides were scanned and examined independently by two veterinary pathologists blinded to the treatment and group details.

(636) For the lung, three sections from each left lung lobe were sampled from different locations: proximal, medial and distal to the primary lobar bronchus. A scoring system (Salguero et al., 2020) was used to evaluate objectively the histopathological lesions observed in the lung tissue sections. The scores for each histopathological parameter were calculated as the average of the scores observed in the six lung tissue sections evaluated per animal.

(637) Additionally, RNAscope in-situ hybridisation (ISH) technique was used to identify the SARS-CoV-2 virus in both lung lobes. Briefly, tissues were pre-treated with hydrogen peroxide for 10 mins (RT), target retrieval for 15 mins (98-101° C.) and protease plus for 30 mins (40° C.) (all Advanced Cell Diagnostics). A V-nCoV2019-S probe (Advanced Cell Diagnostics) targeting the S-protein gene was incubated on the tissues for 2 hours at 40° C. Amplification of the signal was carried out following the RNAscope protocol (RNAscope 2.5 HD Detection Reagent—Red) using the RNAscope 2.5 HD red kit (Advanced Cell Diagnostics). Appropriate controls were included in each ISH run. Digital image analysis was carried out with Nikon NIS-Ar software in order to calculate the total area of the lung section positive for viral RNA.

(638) Computed Tomography (CT) Radiology

(639) CT scans were collected from sedated animals using a 16 slice Lightspeed CT scanner (General Electric Healthcare, Milwaukee, Wis., USA) in the prone and supine position. All axial scans were performed at 120KVp, with Auto mA (ranging between 10 and 120) and were acquired using a small scan field of view. Rotation speed was 0.8s. Images were displayed as an 11 cm field of view.

(640) To facilitate full examination of the cardiac/pulmonary vasculature, lymph nodes and extrapulmonary tissues post-challenge, Niopam 300 (Bracco, Milan, Italy), a non-ionic, iodinated contrast medium, was administered intravenously (IV) at 2 ml/kg body weight and scans collected immediately after injection and ninety seconds from the mid-point of injection.

(641) Scans were evaluated for the presence of COVID disease features: ground glass opacity (GGO), consolidation, crazy paving, nodules, peri-lobular consolidation; distribution—upper, middle, lower, central 2/3, peripheral, bronchocentric) and for pulmonary embolus. The extent of lung involvement was estimated (<25%, 25-50%, 51-75%, 76-100%) and quantified using a scoring system developed for COVID disease.

(642) Results

(643) Analysis of binding titres to either a trimeric form of the S protein or the isolated receptor binding domain (RBD) showed a small increase in spike (FIG. 17B) and RBD-specific IgG titres (FIG. 17C) in animals vaccinated with 8 μg after a single vaccination. A greater increase was observed in IgG titres after the second vaccination on study day 42, where animals exhibited significant increases with median endpoint titres of 1.6×10.sup.3 and 3.2×10.sup.3 for S and RBD reactive antibodies, respectively (FIGS. 17 B and C). An increase of spike- and RBD specific IgG titres was seen upon challenge in this group, particularly in serum collected at the time of termination (study days 62, 63 and 64).

(644) As expected, no significant increase in spike or RBD-specific IgG antibodies was seen in the 0.5 μg CVnCoV (intentional sub-optimal dose) or the unvaccinated control group during the vaccination phase. However, a gradual increase in spike- and RBD specific IgG titre was observed at each of the sampling points in animals vaccinated with 0.5 μg CVnCoV after challenge (FIGS. 17 B and C). No increase in spike- or RBD specific IgG titres was observed in the unvaccinated controls (FIGS. 17 B and C).

(645) In agreement with the induction of binding antibodies, robust levels of virus neutralising titres (VNTs) were detectable after the second vaccination in the 8 μg group (FIG. 17 D). VNTs peaked on day 42 at median titres of 2.7×10.sup.4. Neutralising antibody titres remained relatively unchanged upon challenge until day 62, 63 and 64 of the experiment. Animals in the 0.5 μg and unvaccinated control groups remained negative before challenge, while SARS-CoV-2 infection induced small increases in antibody titres in 4/6 and 5/6 animals in the 0.5 μg and unvaccinated group, respectively. Similar results were achieved with a SARS-CoV-2 virus featuring the mutation D614G.

(646) In order to assess CVnCoV induced cellular responses, peripheral blood mononuclear cells (PBMCs) isolated at different time points post vaccination and challenge were stimulated with pools of peptides spanning the SARS-CoV-2 spike protein. IFN-7 release of stimulated cells was measured by ELISpot. Analysis of responses to summed pools in the vaccination phase showed increases in spike-specific IFN-7 in 8 μg CVnCoV vaccinated animals, two weeks after the first and, more pronounced, two weeks after the second vaccination (FIG. 18 A panel 1). Stimulation with ten individual pools each covering approx. 140 amino acids of the S protein demonstrated the induction of cells reactive to peptides across the whole length of S upon vaccination with 8 μg of CVnCoV (FIG. 18 A panel 3).

(647) There were no clear responses in 0.5 μg CVnCoV or unvaccinated animals in the vaccination phase (FIG. 18A panels 1, 2 and 4). One of the female animals in the negative control group showed particularly high IFN-7secretion after stimulation with peptide pool 2 (covering part of the N-terminal domain (NTD)) throughout the experiment and peptide pool 3 (covering part of the NTD and RBD) on d56 (FIG. 18 A panel 1 and 4).

(648) The data demonstrate the strong induction of S specific cellular responses in CVnCoV vaccinated animals. In animals vaccinated with 8 μg of CVnCoV, increasing responses against peptides covering the whole length of the S protein were elicited after first and second vaccination. These data are in line with previous data in mice that demonstrated the ability of CVnCoV to induce high S-specific CD4+ and CD8+ T cell responses (e.g. Example 6 and 7). The generation of robust T cell responses is likely to support vaccine efficacy against SARS-CoV-2. Recent data have demonstrated that CD8+ T contribute to viral control in a rhesus macaque model (McMahan et al., 2020). T cell responses to SARS-CoV-2 are readily detectable in humans and may play a role in long term protection (Grifoni et al., 2020) (Sekine et al., 2020) (Ni et al., 2020).

(649) Increased spike-specific IFN-7 responses were detectable in all animals on day 62-64 post challenge (FIG. 18 B panels 1-4). Of note, increases of cellular responses in animals vaccinated with 8 μg of CVnCoV were less pronounced than in the other groups, likely indicative of lower levels of viral replication in these animals (FIG. 18 B panel 3).

(650) Quantification of viral RNA copies upon challenge infection demonstrated a reduction of viral replication in the upper respiratory tract in 8 μg CVnCoV vaccinated animals. Importantly, this vaccine dose was able to protect the lungs of challenged animals. Protection was both demonstrated by undetectable levels of viral RNA and by reduced pathological changes upon challenge infection compared to unvaccinated animals. Better protection of the lower than of the upper respiratory tract in the presence of robust immune responses is in line with the results in hamsters (Example 9) and with results of other mRNA based SARS-CoV-2 vaccines in NHP challenge models (Corbett et al., 2020) (Vogel et al., 2020).

(651) Presence or SARS-CoV-2 total RNA in the upper and lower respiratory tract post-challenge was monitored via qRT-PCR (FIG. 19). Viral replication in the upper respiratory tract peaked on day 59 in unvaccinated animals, which reached median values of 2.7×107 cp/ml in nasal swabs (FIG. 19 A) and remained detectable until termination on day 62-64. No significant difference between viral replication in animals vaccinated with 0.5 μg CVnCoV and unvaccinated control animals was measured in nose swabs. Overall, 8 μg CVnCoV vaccination induced the lowest number of viral RNA copies in the upper respiratory tract, where median values of 2.9×10.sup.6 cp/ml in nasal swabs, respectively, were detectable on day 59. However, the difference between the study groups was not statistically significant. Comparable results were generated in throat swabs (FIG. 20 A).

(652) Additional analyses assessing subgenomic (sg) RNA via qRT PCR indicative of viral replication yielded overall low sgRNA levels in the upper respiratory tract. Values peaked on day 59 and returned to baseline on day 62 in all animals. In nasal swabs, sg RNA levels were lowest in CVnCoV vaccinated animals with values of 0.4×10.sup.4 compared to 3.7×10.sup.4 cp/ml in unvaccinated control animals. 3 of 6 animals in the 8 μg CVnCoV vaccinated group remained negative at all time points while 5/6 animals in the unvaccinated group had detectable levels of subgenomic viral RNA (FIG. 19 D). Analyses of throat swabs showed no significant difference of subgenomic RNA between the groups and median values remained below the lower limit of quantification in all animals (FIG. 20 B).

(653) Parallel analyses of the lower respiratory tract of in life (d59) and post-mortem (d62-d64) bronchoalveolar lavage (BAL) samples showed significantly reduced levels of total viral RNA upon 8 μg CVnCoV vaccination at both time points (FIG. 19 B). Median values of total RNA on day 59 and day 62-64 were 4.3×10.sup.6 and 1.1×10.sup.5 cp/ml in the control group, while animals vaccinated with 8 μg of CVnCoV featured median titres of 0.6×10.sup.4 and 0.3×10.sup.4, respectively. RNA levels in BAL were below the lower limit of quantification for all but one animal in the 8 μg CVnCoV group on day 59, which featured low RNA counts. Total viral RNA levels in 0.5 μg CVnCoV vaccinated animals were comparable to the control group. Of note, BAL analyses on day 59 only depict female animals and one male animal of the unvaccinated group. The remaining animals were excluded from this analysis since suboptimal BAL sampling conditions had been chosen that prevented further evaluation.

(654) The analysis of lung tissue collected at necropsy confirmed results gained in BAL samples. Median titres of 2.9×10.sup.8 cp/g were detectable in the unvaccinated group while all animals in the CVnCoV 8 μg vaccinated groups remained below the lower limit of quantification (FIG. 19 C). There was no statistically significant difference between animals in the 0.5 μg CVnCoV and the unvaccinated group.

(655) In terms of vaccine safety, the injection of 0.5 μg or 8 μg of CVnCoV elicited no adverse reactions to vaccination and no differences in weight or temperature were observed between groups during the vaccination phase of the study (data not shown), supporting a favourable safety profile of the vaccine in rhesus macaques at the doses used. Furthermore, no signs of vaccine enhanced disease were detectable in this study.

(656) Subgenomic viral RNA analysis in BAL and lung tissue samples yielded comparable results: RNA indicative of replicating virus were detectable in BAL and lung samples of unvaccinated and 0.5 μg CVnCoV vaccinated animals on day 59 and day 62-64, respectively. All animals in the 8 μg CVnCoV group were negative in these analyses (FIGS. 19 E and F).

(657) Evaluation of further tissue samples collected at necropsy revealed low but detectable signals of SARS-CoV-2 total RNA in trachea and tonsils of 0.5 μg CVnCoV and unvaccinated animals, while 8 μg CVnCoV vaccinated animals remained negative (FIGS. 20 C and D). No viral RNA was detectable in spleen, duodenum, colon, liver or kidney in any group (FIG. 20 E-I).

(658) Histopathological analyses of lung samples taken at necropsy showed lesions consistent with infection with SARS-CoV-2 in the lungs of challenged animals (FIG. 21). Briefly, the lung parenchyma showed multifocal to coalescing areas of pneumonia surrounded by unaffected parenchyma. Alveolar damage, with necrosis of pneumocytes was a prominent feature in the affected areas. The alveolar spaces within these areas were often thickened and damaged alveolar walls contained mixed inflammatory cells (including macrophages, lymphocytes, viable and degenerated neutrophils, and occasional eosinophils). Alveolar oedema and alveolar type II pneumocyte hyperplasia was also observed. In distal bronchioles and bronchiolo-alveolar junctions, degeneration and sloughing of epithelial cells was present. In the larger airways occasional, focal, epithelial degeneration and sloughing was observed in the respiratory epithelium. Low numbers of mixed inflammatory cells, comprising neutrophils, lymphoid cells, and occasional eosinophils, infiltrated bronchial and bronchiolar walls. In the lumen of some airways, mucus admixed with degenerated cells, mainly neutrophils and epithelial cells, was seen. Within the parenchyma, perivascular and peribronchiolar cuffing was also observed, being mostly lymphoid cells comprising the infiltrates. No remarkable changes were observed in non-pulmonary tissues.

(659) In agreement with reduced levels of viral RNA, the evaluation of lung samples using a histopathology scoring system showed a significant reduction in severity of lung lesions in CVnCoV vaccinated animals compared to 0.5 μg CVnCoV vaccinated and unvaccinated groups (FIGS. 22 A and B).

(660) Viral RNA was observed in alveolar epithelia cells and within the inflammatory cell infiltrates (FIG. 21). The quantity of virus RNA observed by in situ hybridisation (ISH) was also significantly reduced in 8 μg CVnCoV vaccinated animals when compared to 0.5 μg CVnCoV and unvaccinated (FIG. 22 C).

(661) In order to gain an in-life view of pathological changes induced upon SARS-CoV-2 infection in the complete lung, CT scanning was performed prior to challenge and post-challenge on study day 61. Overall, the apparent level of disease was relatively mild and only affected less than 25% of the lung. Post-challenge, abnormalities in the lung were detected in 6 of 6 animals the 0.5 μg CVnCoV group, and 5 of 6 in the unvaccinated control group, while only 3/6 animals vaccinated with 8 μg CVnCoV exhibited detectable changes. Lowest levels of total scoring in CT scans were seen in animals vaccinated with 8 μg of CVnCoV (FIG. 22 D). Of note, highest scores were seen in the 0.5 μg CVnCoV group in this analysis. However, values were not statistically different to the control group.

(662) No indication of enhanced disease was detectable upon assessment of clinical signs post-challenge and the compositions were found to be highly immunogenic in rhesus macaques. There were no clear differences in body weight or temperature between groups post-challenge or any signs of fever. Vaccine enhanced disease can be caused by antibodies (antibody-dependent enhanced disease, ADE (reviewed in (Lee et al., 2020)) as previously described for a feline coronavirus (Olsen et al., 1992). Such antibodies most likely possess non-neutralising activity, and enhance viral entry causing increased viral replication and disease exacerbation. Results presented here give no indication of increased viral replication in animals vaccinated with CVnCoV. Importantly, enhanced replication in the respiratory tract or distal organs such as spleen, duodenum, colon, liver or kidney was also not detectable in the 0.5 μg group of the study. These animals featured low levels of S binding but undetectable levels of VNTs upon challenge infection, creating conditions under which ADE could hypothetically can occur.

(663) Another cause of disease enhancement may be vaccine-associated enhanced respiratory disease (VAERD) that is hallmarked by increased inflammation due to T.sub.H2-biased immune responses and high ratios of non-neutralising to neutralising antibodies (reviewed in (Graham, 2020), (Lee et al., 2020), (Smatti et al., 2018). Analysis of lung pathology in CVnCoV vaccinated animals demonstrated protectivity of 8 μg CVnCoV and gave no indication for increased inflammation and pathological changes in suboptimally dosed animals.

(664) The results extend our knowledge of CVnCoV safety, immunogenicity and protective efficacy in a highly relevant model system for SARS-CoV-2. The overall outcome of the study in non-human primates in terms of immunogenicity, protective efficacy and pathology are comparable to results in the hamster model (see Example 9), providing support for hamsters as a models system for SARS-CoV. Therefore, CVnCoV is highly efficacious at a low dose of 8 μg in a COVID-19 NHP challenge model while being safe at both doses tested with lack of any indication of disease enhancement.

(665) In another similar NHP study vaccine composition comprising mRNA encoding S_stab formulated in LNPs comprising the inventive form of the 3′end (hSL-A100) and UTR combination (α-1 (HSD17B4/PSMB3)) (R9709) is analysed and compared to CVnCoV (R9515).

Example 16: Vaccination of Mice with mRNA Encoding SARS-CoV-2 Antigen S_Stab Formulated in LNPs

(666) The present example shows that SARS-CoV-2 S mRNA vaccines with mRNA comprising improved non coding regions induce strong immune responses. Some further groups of mice received mRNA vaccine composition comprising chemically modified nucleotides (N(1)-methylpseudouridine, m1t p). One group of mice received an mRNA vaccine composition comprising mRNA produced with an alternative Cap (3′OME Clean Cap). More details are indicated in Table 22.

(667) Preparation of LNP formulated mRNA vaccine:

(668) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4.

(669) Immunostimulation of human peripheral blood mononuclear cells (PBMCs)

(670) Preparation of human PBMCs

(671) Human peripheral blood mononuclear cells (PBMCs) were isolated from whole blood of anonymous donors by standard Ficoll-Hypaque density gradient centrifugation (Ficoll 1.078 g/ml). PBMCs were washed with PBS and re-suspended in RPMI 1640 supplemented with 20% heat-inactivated FCS, 1% Penicillin/Streptomycin and 1% L-Glutamine. After counting, cells are re-suspended at 50 million cells per ml in fetal calf serum, 10% DMSO, and frozen. Before usage, the cells are thawed.

(672) PBMC stimulation PBMC were stimulated with 10 μg/ml of LNP-formulated mRNA (Table 22, row B-M) at a density of 4×10.sup.5 cells in a total volume of 200 μl in a humidified 5% 002 atmosphere at 37° C. To quantify background stimulation, PBMC were incubated with medium only (Table 22, row A). 24 hours after transfection, supernatants were collected.
Quantification of Cytokine Levels

(673) Human IFNα was quantified using an IFNα ELISA from PBL according to manufacturer's instructions. PBMC supernatants were used in a 1:20 or 1:40 dilution and 50 μl of the dilution are added to 50 μl prefilled buffer.

(674) Immunization:

(675) Female BALB/c mice (6-8 weeks old, n=8) were injected intramuscularly (i.m.) with mRNA vaccine compositions indicated in Table 22. As a negative control, one group of mice was vaccinated with buffer (group A). All animals were vaccinated on day 0 and 21. Blood samples were collected on day 21 (post prime) and 42 (post boost) for the determination of antibody titers, splenocytes were isolated on day 42 for T-cell analysis.

(676) TABLE-US-00028 TABLE 22 Vaccination regimen (Example 16): 5′-UTR/ SEQ 3′-UTR; SEQ ID ID Vaccine mRNA CDS UTR NO: NO: Mod. Group composition ID opt. Design 3′-end Protein RNA Dose nucleotides A buffer — — — — — B mRNA encoding R9515 opt1 -/muag A64-N5- 10 163 1 μg — S_stab formulated C30-hSL-N5 in LNPs C mRNA encoding R9709 opt1 HSD17B4/ hSL-A100 10 149 1 μg — S_stab formulated PSMB3 in LNPs D mRNA encoding R10153 opt1 HSD17B4/ A100 10 24837 1 μg — S_stab formulated PSMB3 in LNPs E mRNA encoding R10154 opt1 -/muag A100 10 25717 1 μg — S_stab formulated in LNPs F mRNA encoding R10155 opt1 RpI31/RPS9 hSL-A100 10 23957 1 μg — S_stab formulated in LNPs G mRNA encoding R10156 opt1 RpI31/RPS9 A100 10 25277 1 μg — S_stab formulated in LNPs H mRNA encoding R10157 opt1 -/muag A64-N5- 10 163 1 μg m1ψ S_stab formulated c30-hSL-N5 in LNPs I mRNA encoding R10158 opt1 -/muag hSL-A100 10 24397 1 μg m1ψ S_stab formulated in LNPs J mRNA encoding R10159 opt1 HSD17B4/ hSL-A100 10 149 1 μg m1ψ S_stab formulated PSMB3 in LNPs K mRNA encoding R10160* opt1 HSD17B4/ hSL-A100 10 149 1 μg — S_stab formulated PSMB3 in LNPs L mRNA encoding S R10161* opt1 HSD17B4/ hSL-A100 1 148 1 μg — formulated in PSMB3 LNPs M mRNA encoding R10162 opt10 HSD17B4/ hSL-A100 10 151 1 μg m1ψ S_stab formulated PSMB3 in LNPs *mRNA R10160 (group K) and R10161 (groupL) were produced with 3′OME Clean Cap.

(677) Determination of IgG1 and IgG2 antibody titers using ELISA and virus neutralizing titers via CPE (cytopathic effect) were performed as described in Example 6. T-cell analysis by Intracellular cytokine staining (ICS) are performed as described in Example 6.

(678) Results: As shown in FIG. 23 A mRNA encoding full length S stabilized protein (S_stab) induced different levels of IFNa in human PBMCs. For most of the constructs moderate levels of IFNa were induced, whereas LNP-formulated mRNA comprising chemically modified nucleotides did not induce IFNa.

(679) The vaccination with mRNA encoding full length S stabilized protein (S_stab) comprising improved non-coding regions induced strong levels of virus neutralizing antibody titers (VNTs) already on day 21 after first vaccination (shown in FIG. 23 B). All of the mRNA vaccine compositions with mRNAs comprising a 3′ end “hSL-A100” or “A-100” (groups C-G, I-M) showed this improved, early and strong induction of VNTs. In these constructs, the poly(A) sequence is located directly at the 3′ terminus of the RNA.

(680) The introduction of chemically modified nucleotides (groups H, 1, J, M) led to comparable VNTs.

(681) After the second vaccination on day 42 (shown in FIG. 23 C), most of the mRNA vaccines show a robust induction of high titers of VNTs. Also CVnCoV, vaccine composition comprising mRNA with the 3′ end A64-N5-C30-hSL-N5 (group B) induced very high amount of VNT. The introduction of chemically modified nucleotides (m1ψ, group H) resulted in decreased levels. All of the mRNA vaccine compositions with mRNAs comprising a 3′ end “hSL-A100” or “A-100” (groups C-G, I-M) showed this improved, early and strong induction of VNTs, irrespectively of using m1ψ or not. In these constructs, the poly(A) sequence is located directly at the 3′ terminus of the RNA.

Example 17: Vaccination of Mice with mRNA Encoding SARS-CoV-2 Antigen S_Stab Formulated in LNPs

(682) The present example shows that SARS-CoV-2 S mRNA vaccines with mRNA comprising improved non coding regions induce strong immune responses. This study compares an “only prime” with a “prime-boost” vaccination regimen. Some groups of mice received mRNA vaccine composition comprising chemically modified nucleotides (N(1)-methylpseudouridine, m1ψ). More details are indicated in Table 23.

(683) Preparation of LNP Formulated mRNA Vaccine:

(684) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4.

(685) Immunization:

(686) Female BALB/c mice (6-8 weeks old, n=8) were injected intramuscularly (i.m.) with mRNA vaccine compositions indicated in Table 23. As a negative control, one group of mice was vaccinated with buffer (group K). The animals were vaccinated only one time on day 0 (group A-E), or twice on day 0 and 21 (group F-J). Blood samples were collected on day 21 and 42 for the determination of antibody titers, splenocytes were isolated on day 42 for T-cell analysis.

(687) TABLE-US-00029 TABLE 23 Vaccination regimen (Example 17): 5′-UTR/ 3′-UTR; SEQ ID SEQ ID Vaccine mRNA CDS UTR NO: NO: Mod. Group composition ID opt. Design 3′-end Protein RNA Dose nucleotides A mRNA encoding R9515 opt1 -/muag A64-N5- 10 163 1 μg — S_stab formulated C30-hSL- day0 in LNPs N5 B mRNA encoding R9709 opt1 HSD17B4/ hSL- 10 149 1 μg — S_stab formulated PSMB3 A100 day0 in LNPs C m RNA encoding R10157 opt1 -/muag A64-N5- 10 163 1 μg m1ψ S_stab formulated C30-hSL- day0 in LNPs N5 D mRNA encoding R10159 opt1 H5D17B4/ hSL- 10 149 1 μg m1ψ S_stab formulated PSMB3 A100 day0 in LNPs E mRNA encoding R10162 opt10 H5D17B4/ hSL- 10 151 1 μg m1ψ S_stab formulated PSMB3 A100 day0 in LNPs F mRNA encoding R9515 opt1 -/muag A64-N5- 10 163 1 μg — S_stab formulated C30-hSL- day0 in LNPs N5 day21 G mRNA encoding R9709 opt1 HSD17B4/ hSL- 10 149 1 μg — S_stab formulated PSMB3 A100 day0 in LNPs day21 H mRNA encoding R10157 opt1 -/muag A64-N5- 10 163 1 μg m1ψ S_stab formulated C30-hSL- day0 in LNPs N5 day21 I mRNA encoding R10159 opt1 HSD17B4/ hSL- 10 149 1 μg m1ψ S_stab formulated PSMB3 A100 day0 in LNPs day21 J mRNA encoding R10162 opt10 H5D17B4/ hSL- 10 151 1 μg m1ψ S_stab formulated PSMB3 A100 day0 in LNPs day21 K buffer — — — — day0 — day21

(688) Determination of virus neutralizing titers via CPE (cytopathic effect) were performed as described in Example 6. T-cell analysis by Intracellular cytokine staining (ICS) are performed as described in Example 6.

(689) Results: FIG. 24 A shows the induction of VNTs after only one vaccination. As shown before in Example 17. mRNA vaccine compositions with mRNAs comprising a 3′ end “hSL-A100” or “A-100” (groups A, D, E, G, I, and J)) showed improved, early and strong induction of VNTs. In these constructs, the poly(A) sequence is located directly at the 3′ terminus of the RNA.

(690) FIG. 24 B demonstrate the induction of VNTs after only one vaccination (group A-E) or after two vaccination (group F-J) on day 42. mRNA vaccine composition comprising R9709 (group B) induced most prominent titers of VNTs between the groups receiving only one vaccination. The strength of vaccine composition comprising R9709 may support an immunization protocol for the treatment or prophylaxis of a subject against coronavirus, preferably SARS-CoV-2 coronavirus comprising only one single dose of the composition or the vaccine.

(691) mRNA vaccine compositions with mRNAs comprising a 3′ end “hSL-A100” or “A-100” (groups A, D, E, G, I, and J)) showed improved, early and strong induction of VNTs. In these constructs, the poly(A) sequence is located directly at the 3′ terminus of the RNA.

Example 18: Efficacy of mRNA Vaccines in K18-hACE2 Mouse Model for SARS-CoV-2 Infection

(692) Mice are not susceptible to infection with SARS-CoV-2, but a genetically engineered mouse model has been developed that expresses the human receptor ACE2 (hACE2), required for entry of the virus into the host cell under the K18 promoter. The model was originally developed to investigate the causative agent of SARS (SARS-CoV) (MCCRAY, Paul B., et al. Lethal infection of K18-hACE2 mice infected with severe acute respiratory syndrome coronavirus. Journal of virology, 2007, 81. Jg., Nr. 2, S. 813-821) but is now also used as a suitable small animal model for COVID-19. Previously, hACE2 mice have been shown to be susceptible to SARS-CoV-2 and to exhibit a disease course with weight loss, pulmonary pathology, and symptoms similar to those in humans (e.g. BAO, Linlin, et al. The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice. Nature, 2020, 583. Jg., Nr. 7818, S. 830-833, or YINDA, Claude Kwe, et al. K18-hACE2 mice develop respiratory disease resembling severe COVID-19. PLoS pathogens, 2021, 17. Jg., Nr. 1, S. e1009195; DE ALWIS, Ruklanthi M., et al. A Single Dose of Self-Transcribing and Replicating RNA Based SARS-CoV-2 Vaccine Produces Protective Adaptive Immunity In Mice. BioRxiv, 2020.). In principle, the K18-hACE2 mouse is suitable for vaccine studies to investigate the prevention of infection with SARS-CoV-2 or the reduction of viral load, and at the same time to investigate the correlates and causes of a protective effect of an mRNA vaccine against COVID-19 with well-established immunological methods, which are generally available for mouse models.

(693) The present example shows that SARS-CoV-2 S mRNA vaccines induce strong humoral as well as cellular immune response in K18-hACE2 mice. SARS-CoV-2 S mRNA vaccines protect K18-hACE2 mice from SARS-CoV-2 viral challenge, which can be shown e.g. by measuring the viral loads of infected animals, by monitoring the disease progression with weight loss, pulmonary pathology and other symptoms, or by histopathology and survival.

(694) Preparation of LNP formulated mRNA vaccine:

(695) SARS-CoV-2 S mRNA constructs are prepared as described in Example 1 (RNA in vitro transcription). HPLC purified mRNA was formulated with LNPs according to Example 1.4 prior to use in in vivo vaccination experiments.

(696) Immunization and Challenge:

(697) K18-hACE2 mice are injected intramuscularly (i.m.) with mRNA vaccine compositions and doses as indicated in Table 24. As a negative control, one group is vaccinated with buffer. As a control, one group is injected intramuscularly with, 20 μl Formalin-inactivated SARS-CoV-2 virus (10.sup.6 PFU) adjuvanted with Alum. All animals were vaccinated on day 0 and day 28. Blood samples were collected on day 0, day 28 (post prime) and 56 (post boost, before challenge) for the determination of antibody titers. The animals are challenged intranasally with e.g. 10.sup.5 PFU SARS-CoV-2 (Bavaria 1) at day 56. Animals were followed for four to ten days post challenge.

(698) TABLE-US-00030 TABLE 24 Vaccination regimen (Example 18): 5′-UTR/ 3′-UTR; SEQ ID SEQ ID mRNA CDS UTR NO: NO: Group Vaccine composition ID opt. Design 3′-end Protein RNA Dose A buffer — — — — 20 μl B mRNA encoding S_stab R9515 opt1 -/muag; A64-N5- 10 163 8 μg formulated in LNPs C30-hSL- N5 C mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL-A100 10 149 8 μg formulated in LNPs PSMB3 D mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL-A100 10 149 2 μg formulated in LNPs PSMB3 E mRNA encoding S_stab R9709 opt1 HSD17B4/ hSL-A100 10 149 0.5 μg formulated in LNPs PSMB3 F Formalin-inactivated virus + — — — — — — 10.sup.6 Alum PFU, 20 μl

(699) Determination of IgG1 and IgG2 antibody titers using ELISA, determination of virus neutralizing titers via CPE (cytopathic effect)-based micron neutralization assay and T-cell analysis by Intracellular cytokine staining (ICS) are performed as described in Example 6.

(700) The immunization and challenge of K18-hACE2 mice as described in the present Example can be used to determine the protective efficacy of further inventive mRNA constructs and compositions. Furthermore, by using mutated virus variants or isolates of SARS-CoV-2 (e.g. B.1.351 see also Table 25), it can be shown, that the inventive mRNA vaccine compositions are effective in addition against these mutated virus variants or isolates.

Example 19: Neutralizing Activity of mRNA Vaccines Against Emerging SARS-CoV-2 Variants

(701) The neutralizing activity of sera from 20 phase 1 clinical trial participants (aged 18-60 years, male and female) who received two doses of 2 μg, 4 μg, 8 μg, or 12 μg CVnCoV (see Example 10 regarding the clinical study outline) is tested against emerging SARS-CoV-2 variants or isolates. The serum samples were obtained on days 36, 43 or 57 of the clinical study and exhibit Virus neutralizing antibody titers (VNTs) at a range of 10-1280 (MN 25TCD50), representing samples with low (10-20) and with high (452-1280) VNTs.

(702) VNTs are analysed as described e.g. for the analysis of hamster sera in Example 9, whereby the serum samples are incubated with emerging virus variants. Strain SARS-CoV-2/human/ITA/INMI/2020 or UVE/SARS-CoV-2/2020/FR/702 can be used as reference (“wildtype strain”). Emerging SARS-CoV-2 variants or isolates for analysis are listed in Table 25. Further variants may arise and can be tested as well.

(703) TABLE-US-00031 TABLE 25 List of emerging SARS-CoV-2 variants (Example 19): Variant Amino acid changes in spike protein Mink Cluster 5 variant GISAID: EPI_ISL_616802 (hCoV- delH69, delV70, Y453F, D614G, I692V, M1229I 19/Denmark/DCGC-3024/2020) B.1.1.7 (a.k.a., 20B/501Y.V1, 501Y.V1, Variant of Concern- delH69, delV70, delY144, N501Y, A570D, D614G, 202012/01, VOC-202012/01, VUI-202012/01, B117, ″UK P681H, T716I, S982A, D1118H variant″) B.1.351 (a.k.a., 20C/501Y.V2, 501Y.V2, N501Y.V2, ″SA L18F, D80A, D215G, delL242, delA243, delL244, variant″, ″South Africa variant″) R246I, K417N, E484K, N501Y, D614G, A701V P.1 (a.k.a., ″Brazil variant″ = ″Japan variant″) L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I CAL.20C (a.k.a., ″California variant″) S13I, W152C, L452R, D614G NCBI: QQN00429.1 (CAL.20.C example: SARS-CoV- 2/human/USA/CA-LACPHL-AF00114/2021)

(704) Neutralization can also be measured by a recombinant VSV- or lentiviral-based pseudovirus neutralization (PsVN) assay that incorporates the spike mutations present in the SARS-CoV-2 variant strain.

(705) The capacity of binding antibodies can be tested in ELISA assays as described above in e.g. Example 10 with recombinant spike proteins for coating featuring the mutations of emerging virus variant.

(706) The efficacy of mRNA vaccine can also be tested in challenge models as described e.g. in Example 17 for hACE-mice, in Example 15 for NHPs, and in Example 9 for hamsters using an emerging SARS-Cov-2 variant for the challenge infection.

Coronavirus vaccine

Assignee

Inventors

Cpc classification

Classification Explorer

A61K39/215

HUMAN NECESSITIES

Classification Explorer

A61K2039/6093

HUMAN NECESSITIES

Classification Explorer

A61K39/12

HUMAN NECESSITIES

Classification Explorer

A61K2039/55555

HUMAN NECESSITIES

Classification Explorer

A61K47/26

HUMAN NECESSITIES

Classification Explorer

A61K9/0019

HUMAN NECESSITIES

Classification Explorer

A61K2039/53

HUMAN NECESSITIES

Classification Explorer

A61K2039/575

HUMAN NECESSITIES

Classification Explorer

A61K2039/6018

HUMAN NECESSITIES

Classification Explorer

C12N2770/20034

CHEMISTRY; METALLURGY

Classification Explorer

A61K47/543

HUMAN NECESSITIES

Classification Explorer

A61P31/14

HUMAN NECESSITIES

Classification Explorer

A61K9/5123

HUMAN NECESSITIES

Classification Explorer

A61K2039/51

HUMAN NECESSITIES

Classification Explorer

A61K2039/54

HUMAN NECESSITIES

Classification Explorer

A61K47/6929

HUMAN NECESSITIES

International classification

Classification Explorer

A61K39/215

HUMAN NECESSITIES

Classification Explorer

A61P31/14

HUMAN NECESSITIES

Classification Explorer

A61K9/00

HUMAN NECESSITIES

Classification Explorer

A61K47/26

HUMAN NECESSITIES

Abstract

Claims

Description