NOVEL ADENYLOSUCCINATE SYNTHETASE AND METHOD FOR PRODUCING PURINE NUCLEOTIDES USING THE SAME

20200392478 ยท 2020-12-17

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to an adenylosuccinate synthetase variant, a microorganism containing the same, and a method for preparing purine nucleotides using the microorganism.

    Claims

    1. An adenylosuccinate synthetase variant, wherein the 85.sup.th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 2 is substituted with a different amino acid.

    2. The adenylosuccinate synthetase variant according to claim 1, wherein the different amino acid is selected from the group consisting of serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine, cysteine, tyrosine, lysine, aspartic acid, and glutamic acid.

    3. A polynucleotide encoding the adenylosuccinate synthetase variant of claim 1.

    4. A vector comprising the polynucleotide of claim 3.

    5. A microorganism of the genus Corynebacterium producing purine nucleotides by comprising the adenylosuccinate synthetase variant of claim 1.

    6. The microorganism according to claim 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

    7. A method for preparing IMP, XMP or GMP, comprising: culturing the microorganism of the genus Corynebacterium of claim 5 in a medium; and recovering the purine IMP, XMP or GMP from the microorganism or the medium.

    8. The method according to claim 7, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

    9. A microorganism of the genus Corynebacterium producing purine nucleotides by comprising the vector of claim 4.

    10. The microorganism according to claim 9, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

    11. A method for preparing IMP, XMP or GMP, comprising: culturing the microorganism of the genus Corynebacterium of claim 9 in a medium; and recovering the IMP, XMP or GMP from the microorganism or the medium.

    12. The method according to claim 11, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

    Description

    DETAILED DESCRIPTION OF THE INVENTION

    [0059] Hereinafter, the present disclosure will be described in detail through exemplary embodiments. However, it will be apparent to those skilled in the art to which the present disclosure belongs that these exemplary embodiments are provided for the purpose of illustration only and are not intended to limit the scope of the present disclosure.

    EXAMPLE 1

    Preparation of Wild-Type Based IMP-Producing Strain

    [0060] The wild-type strain of the genus Corynebacterium cannot produce IMP at all or can produce only a very small amount even if it is possible. Accordingly, an IMP-producing strain was prepared based on Corynebacterium stationis ATCC6872. More specifically, the IMP-producing strain was prepared by enhancing the activity of purF gene encoding phosphoribosylpyrophosphate amidotransferase, which is the first enzyme of purine biosynthesis, and weakening the activity of guaB gene encoding 5-inosinic acid dehydrogenase that corresponds to the IMP degradation pathway.

    EXAMPLE 1-1

    Preparation of purF-Enhanced Strain

    [0061] To prepare a strain in which the start codon of purF gene is modified, an insertion vector containing the purF gene of SEQ ID NO: 3 was prepared. To clone the purF gene into an insertion vector, specifically, PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a template and primers of SEQ ID NOS: 4 and 5 and SEQ ID NOS: 6 and 7 for 30 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 2 min. PCR was performed again using two DNA fragments obtained by the above PCR as a template and primers of SEQ ID NOS: 4 and 72 for 30 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 2 min to obtain DNA fragments. The obtained DNA fragments were digested with a restriction enzyme XbaI, and cloned into the pDZ vector (Korean Patent No. 10-0924065 and International Publication No. 2008-033001) digested with the same enzyme. The thus-prepared vector was named as pDZ-purF-g1a.

    TABLE-US-00001 TABLE1 SEQ IDNO Primer Sequence(5-3) 4 purF GCTCTAGACCACTCTAAGACGCGGCCACC g1a-1 5 purF AAGTAGTGTTCACCATGACGCTGATTCTACTAAGTTT g1a-2 6 purF AGTAGAATCAGCGTCATGGTGAACACTACTTTCCCCAG g1a-3 7 purF GCTCTAGACTGTGCGCCCACGATATCCAG g1a-4

    [0062] The recombinant vector pDZ-purF-g1a was transformed into Corynebacterium stationis ATCC6872 by electroporation, and strains in which the vector was inserted into the genomic DNA by homologous recombination were selected on a medium containing 25 mg/L kanamycin. The selected primary strains were subjected to secondary crossover, and these selected strains were subjected to sequencing, and thereby the desired strain into which the mutation was introduced was selected. The strain was named as ATCC6872::purF(g1a) strain.

    EXAMPLE 1-2

    Preparation of guaB-Weakened Strain

    [0063] To prepare a strain in which the start codon of guaB gene is modified, an insertion vector containing the guaB gene of SEQ ID NO: 8 was prepared. To clone the guaB gene into the insertion vector, specifically, PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a template and primers of SEQ ID NOS: 9 and 10 and SEQ ID NOS: 11 and 12. The PCR products were cloned as in Example 1-1, and the vector prepared was named as pDZ-guaB-a1t. The vector was introduced into the ATCC6872::purF(g1a) and the strain in which the above mutation was introduced was finally selected.

    [0064] The finally selected wild-type Corynebacterium stationis ATCC6872-based strain producing IMP was named as CJI2330.

    TABLE-US-00002 TABLE2 SEQ IDNO Primer Sequence(5-3) 9 guaBa1t-1 GCTCTAGACTACGACAACACGGTGCCTAA 10 guaBa1t-2 CACGATTTTCGGTCAATACGGGTCTTCTC CTTCGCAC 11 guaBa1t-3 AGGAGAAGACCCGTATTGACCGAAAATCG TGTTTCT 12 guaBa1t-4 GCTCTAGAATCGACAAGCAAGCCTGCACG

    EXAMPLE 1-3

    Fermentation Titer Test of CJI2330

    [0065] After dispensing a seed culture medium (2 mL) into test tubes (diameter: 18 mm), the tubes were autoclaved. Each of ATCC6872 and CJI2330 was inoculated and incubated at 30 C. for 24 h with shaking and used as a seed culture. A fermentation medium (29 mL) was dispensed into each 250 mL shaking Erlenmeyer flask, and autoclaved at 121 C. for 15 min. The seed culture (2 mL) was inoculated to the medium and cultured for 3 days. Culture conditions were adjusted to 170 rpm, 30 C., and pH 7.5.

    [0066] After completion of the culture, the amount of IMP production was measured by HPLC (SHIMAZDU LC20A), and the culture results are as in Table 3 below. The following results suggest that the purF-enhanced and purA-weakened strain has IMP productivity.

    TABLE-US-00003 TABLE 3 Strain IMP (g/L) ATCC6872 0 CJI2330 0.50 [0067] Seed culture medium: 1% glucose, 1% peptone, 1% meat extract, 1% yeast extract, 0.25% sodium chloride, 100 mg/L adenine, 100 mg/L guanine, pH 7.5 [0068] Fermentation medium: 0.1% sodium glutamate, 1% ammonium chloride, 1.2% magnesium sulfate, 0.01% calcium chloride, 20 mg/L iron sulfate, 20 mg/L manganese sulfate, 20 mg/L zinc sulfate, 5 mg/L copper sulfate, 23 mg/L L-cysteine, 24 mg/L alanine, 8 mg/L nicotinic acid, 45 g/L biotin, 5 mg/L thiamine hydrochloride, 30 mg/L adenine, 1.9% phosphoric acid (85%), 2.55% glucose, 1.45% fructose

    EXAMPLE 2

    Preparation of Adenylosuccinate Synthetase-Weakened Variant

    [0069] To discover an adenylosuccinate synthetase variant capable improving purine nucleotide productivity, a mutant library of purA gene encoding adenylosuccinate synthetase was prepared.

    EXAMPLE 2-1

    Preparation of Vector Containing purA Gene

    [0070] To prepare a mutant library of purA gene, a recombinant vector containing the purA gene was first prepared. PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a template and primers of SEQ ID NO: 13 and SEQ ID NO: 14, and the PCR product was cloned into E. coli vector pCR2.1 using a TOPO Cloning Kit (Invitrogen) to obtain pCR-guaB.

    TABLE-US-00004 TABLE4 SEQ IDNO Primer Sequence(5-3) 13 purA5primerF(temp) ATGGCTAAATACATTATCACT 14 purA3primerR(temp) TGTGCTGGAGACCCCTCATAG

    EXAMPLE 2-2

    Preparation of Mutant Library of purA Gene

    [0071] A mutant library of purA gene was prepared based on the vector prepared in Example 2-1. The library was prepared using an error-prone PCR kit (Clontech Diversify PCR Random Mutagenesis Kit). Under conditions where mutations may occur, PCR was performed using primers of SEQ ID NO: 15 and SEQ ID NO: 16. Specifically, under conditions where 0 to 3 mutations per 1000 bp may occur, pre-heating was performed at 94 C. for 30 sec, followed by 25 cycles of 94 C. for 30 sec and 68 C. for 1 min 30 sec. A PCR product thus obtained was subjected to PCR using a megaprimer (500 ng to 125 ng) for 25 cycles of 95 C. for 50 sec, 60 C. for 50 sec, and 68 C. for 12 min, treated with DpnI, and transformed into E. coli DH5 and spread on an LB solid medium containing kanamycin (25 mg/L). After selecting 20 different kinds of transformed colonies, plasmids were obtained therefrom and subjected to sequencing analysis. As a result, it was confirmed that mutations were introduced at different sites at a frequency of 2 mutations/kb. About 20,000 transformed E. coli colonies were collected and the plasmids were extracted, and named as a pTOPO-purA-library.

    TABLE-US-00005 TABLE5 SEQ IDNO Primer Sequence(5-3) 15 purAerrorPCRprimerF AAGGGCAAAGCTACAGACATC 16 purAerrorPCRprimerR CCGCCGAGCATGAGAACCCGA

    EXAMPLE 3

    Evaluation of Prepared Library and Selection of Strain

    EXAMPLE 3-1

    Evaluation of Library

    [0072] The pTOPO-purA-library prepared in Example 2-2 was transformed into the CJI2330 strain prepared in Example 1 by electroporation, and the strain was spread on a nutrient medium containing 25 mg/L kanamycin to obtain 10,000 colonies into which the mutant gene was inserted. Each of the colonies was named as CJI2330::pTOPO_purA(m01 to CJI2330::pTOPO_purA(mt)10000. [0073] Nutrient medium: 1% peptone, 1% meat extract, 0.25% sodium chloride, 1% yeast extract, 2% agar, pH 7.2

    [0074] Each of the obtained 10,000 colonies was inoculated in 200 L of an autoclaved seed culture medium, and cultured in a 96-deep well plate with shaking at 30 C., 1200 rpm for 24 hours using a microplate shaker (TAITEC), and used as a seed culture. The autoclaved fermentation medium (290 L) was dispensed into a 96-deep well plate, and 20 L of each of the seed cultures was inoculated thereto, followed by culturing with shaking under the same conditions as above for 72 hours.

    [0075] To analyze the 5-inosinic acid produced in the culture medium, after completion of the culture, 3 L of the culture supernatant was transferred to a 96-well UV-plate, where each well contained 197 L of distilled water, and shaken for 30 sec using a microplate reader, and absorbance was measured 270 nm at 25 C. using a spectrophotometer. The absorbance was compared with that of the CJI2330 strain, and 50 colonies of mutant strains showing a 10% or more increase in the absorbance were selected. Other colonies showed similar or decreased absorbance compared to the control.

    [0076] The absorbance of the 50 selected strains was measured in the same manner as above to repeatedly examine the amount of 5-inosinic acid production. One strain, CJI2330::pTOPO_purA(mt)333, which showed a significant improvement in 5-inosinic acid productivity compared to the CJI2330 strain, was selected.

    [0077] To confirm the validity of selected mutants, a fermentation titer test was performed.

    [0078] After dispensing a seed culture medium (2 mL) into test tubes (diameter: 18 mm), the tubes were autoclaved. Each of CJI2330 and CJI2330::pTOPO_purA(mt)333 was inoculated and incubated at 30 C. for 24 h with shaking and used as a seed culture. A fermentation medium (29 mL) was dispensed into each 250 mL shaking Erlenmeyer flask, and autoclaved at 121 C. for 15 min. The seed culture (2 mL) was inoculated to the medium and cultured for 3 days. Culture conditions were adjusted to 170 rpm, 30 C., and pH 7.5.

    [0079] After completion of the culture, the amount of IMP production was measured by HPLC (SHIMAZDU LC20A), and the culture results are as in Table 6 below.

    TABLE-US-00006 TABLE 6 Strain IMP (g/L) CJI2330 0.50 CJI2330::pTOPO_purA(mt)333 0.61

    [0080] As can be seen from the above results, it was confirmed that the amount of IMP was increased by about 122% in the strain where a vector containing a purA gene mutation compared to the CJI2330 strain. Accordingly, it was determined that the selected mutation in the library was valid.

    EXAMPLE 3-2

    Confirmation of purA Variation

    [0081] To confirm the gene variation of the mutant strain, PCR was performed in the CJI2330::pTOPO_purA(mt)333 strain using primers of SEQ ID NOS: 17 and 18, and the PCR product was subjected to sequencing, thereby confirming the presence of variation in the purA gene.

    TABLE-US-00007 TABLE7 SEQ IDNO Primer Sequence(5-3) 17 purAseqF GACGCGTCGGAATCGCCGATA 18 purAseqR CCGCCGAGCATGAGAACCCGA

    [0082] Specifically, it was confirmed that the purA gene of the CJI2330::pTOPO_purA(mt)333 strain includes a variation where the 85.sup.th amino acid (i.e., glycine) of the purA amino acid sequence represented by SEQ ID NO: 2 is substituted with serine (i.e., the 253.sup.rd nucleotide, g, is substituted with a nucleotide a). Accordingly, in Examples hereinbelow, attempts were made to confirm whether the above variation can affect the amount of purine nucleotide production in each microorganism of the genus Corynebacterium.

    EXAMPLE 4

    Confirmation of IMP Production in IMP-Producing Strain Derived from ATCC6872

    [0083] An IMP-producing strain derived from ATCC6872 was prepared, and the variation confirmed in Example 3 was introduced into the strain and the IMP productivity of the strain was confirmed.

    EXAMPLE 4-1

    Selection of IMP-Producing Strain Derived From ATCC6872

    [0084] To prepare an IMP-producing strain derived from the ATCC6872 strain, the culture of ATCC6872 was suspended in a phosphate buffer (pH 7.0) or citrate buffer (pH 5.5) at a density of 10.sup.7 cells/mL to 10.sup.8 cells/mL and treated with UV at room temperature or 32 C. for 20 min to 40 min to induce a mutation. The strain was washed with a 0.85% saline solution twice and spread, after dilution, on a minimal medium containing 1.7% agar which was supplemented with a resistance-providing material at an appropriate concentration, and thereby colonies were obtained. Each colony was cultured in a nutrient medium and then cultured in a seed culture medium for 24 hours. After culturing each colony in a fermentation medium for 3 to 4 days, colonies which showed excellent production of IMP accumulated in the culture medium were selected. To prepare a strain producing IMP at high concentration, adenine-auxotroph, guanine-leaky type, lysozyme sensitivity, 3,4-dehydroproline resistance, streptomycin resistance, sulfaguanidine resistance, norvaline resistance, and trimethoprim resistance were provided by performing the corresponding procedures in a sequential manner. As a result, the CJI2335 strain provided with resistance to the above materials and having excellent IMP productivity was finally selected. The resistances of the CJI2332 strain relative to those of ATCC6872 were compared and the results are shown in the following Table 8.

    TABLE-US-00008 TABLE 8 Characteristic ATCC6872 CJI2332 Adenine-auxotroph Non-auxotroph Auxotroph Guanine-leaky type Non-auxotroph Leaky type Lysozyme sensitivity 80 g/mL 8 g/mL 3,4-Dehydroproline resistance 1000 g/mL 3,500 g/mL Streptomycin resistance 500 g/mL 2,000 g/mL Sulfaguanidine resistance 50 g/mL 200 g/mL Norvaline resistance 0.2 mg/mL 2 mg/mL Trimethoprim resistance 20 g/mL 100 g/mL [0085] Minimal medium: 2% glucose, 0.3% sodium sulfate, 0.1% monopotassium phosphate, 0.3% dipotassium phosphate, 0.3% magnesium sulfate, 10 mg/L calcium chloride, 10 mg/L iron sulfate, 1 mg/L zinc sulfate, 3.6 mg/L manganese chloride, 20 mg/L L-cysteine, 10 mg/L calcium pantothenate, 5 mg/L thiamine hydrochloride, 30 g/L biotin, 20 mg/L adenine, 20 mg/L guanine, adjusted to pH 7.3.

    EXAMPLE 4-2

    Fermentation Titer Test of CJI2332

    [0086] After dispensing a seed culture medium (2 mL) into test tubes (diameter: 18 mm), the tubes were autoclaved. Each of ATCC6872 and CJI2332 was inoculated and incubated at 30 C. for 24 hours with shaking and used as a seed culture. A fermentation medium (29 mL) was dispensed into each 250 mL shaking Erlenmeyer flask, and autoclaved at 121 C. for 15 min. The seed culture (2 mL) was inoculated to the medium and cultured for 3 days. Culture conditions were adjusted to 170 rpm, 30 C., and pH 7.5.

    [0087] After completion of the culture, the amount of IMP production was measured by HPLC (SHIMAZDU LC20A), and the culture results are as in Table 9 below.

    TABLE-US-00009 TABLE 9 Strain IMP (g/L) ATCC6872 0 CJI2332 1.74

    EXAMPLE 4-3

    Preparation of Insertion Vector Containing purA Variation

    [0088] To introduce the variations selected in Example 3 into the strains, an insertion vector was prepared. The process for preparing the vector for introduction of purA(G85S) variation is as follows. PCR was performed using the CJI2330::Topo_purA(G85S) as a template and primers of SEQ ID NO: 19 and SEQ ID NO: 20. PCR was performed as follows: denaturation at 94 C. for 5 min; 20 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and polymerization at 72 C. for 1 min; and polymerization at 72 C. for 5 min. The thus obtained gene fragments were each digested with XbaI. Each gene fragment was cloned into a linear pDZ vector digested with XbaI using T4 ligase, and thereby the pDZ-purA(G85S) vector was prepared.

    TABLE-US-00010 TABLE10 SEQ IDNO Primer Sequence(5-3) 19 purA(G85S)F GCTCTAGATGCCGGCATTTTTCGAAGC 20 purA(G85S)R GCTCTAGAAAGTAGTCGGTAAAGCCGTTG

    EXAMPLE 4-4

    Introduction of Variants into CJI2330 and CJI2332 Strains Derived from ATCC6872 and Their Evaluation

    [0089] The purA variation was introduced to each of the wild-type-derived IMP-producing CJI2330 strain prepared in Example 1 and the CJI2332 strain selected in Example 4-1, and the amount of IMP produced by each strain was evaluated. To confirm the presence of a variation in the purA gene, the chromosomal DNA of the CJI2332 strain was amplified by PCR. Specifically, first, purA gene fragments were amplified by PCR using the chromosomal DNA of the CJI2332 strain as a template and primers of SEQ ID NOS: 17 and 18, in which the PCR was performed by 28 cycles of denaturation at 94 C. for 1 min; annealing at 58 C. for 30 sec, and polymerization at 72 C. for 2 min using Taq DNA polymerase. The nucleotide sequences of the amplified purA fragments were analyzed using the same primers, and as a result, it was confirmed that there was no variation in the purA gene of the CJI2332 strain.

    [0090] Then, the pDZ-purA(G85S) vector was transformed into the CJI2330 strain and the CJI2332 strain, and the strains in which the vector was inserted on the genomic DNA by recombination of homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to secondary crossover, and thereby the strains in which a variation of the target gene was introduced were selected. For confirmation of the introduction of the gene variation in the desired transformed strains, PCR was performed using primers of SEQ ID NO: 17 and SEQ ID NO: 18 and the PCR products were confirmed by sequence analysis. As a result, it was confirmed that the gene variation was introduced into the strains. The thus-prepared strains were named as CJI2330::purA(G85S) and CJI2332::purA(G85S), respectively.

    [0091] The IMP productivity for each of CJI2330, CJI2332, CJI2330::purA(G85S), and CJI2332::purA(G85S) strains was evaluated. After the completion of culture, the amount of IMP production by each strain was measured by a method using HPLC, and the culture results are shown in Table 11 below.

    TABLE-US-00011 TABLE 11 Strain IMP (g/L) CJI2330 0.50 CJI2330::purA(G85S) 0.61 CJI2332 1.74 CJI2332::purA(G85S) 2.03

    [0092] In the above results, it was confirmed that the strain in which the purA gene variation was introduced showed an increase in the amount of IMP production by about 122% and about 116% compared to the wild-type-derived IMP-producing CJI2330 and CJI2332 strains, respectively.

    [0093] The CJI2332 strain was deposited at the Korean Culture Center of Microorganisms (KCCM) on June 22, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12277P. Additionally, the prepared CJI2332::purA(G85S) strain, also called CJI2348, was deposited at the KCCM on Jun. 22, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12280P.

    EXAMPLE 5

    Confirmation of 5-xanthylic Acid Productivity by purA Gene Variation

    EXAMPLE 5-1

    Selection of XMP-Producing Strains Derived from ATCC6872

    [0094] To prepare a 5-xanthosine monophosphate (XMP)-producing strain derived from ATCC6872, the Corynebacterium stationis ATCC6872 strain was suspended in the phosphate buffer (pH 7.0) or citrate buffer (pH 5.5) at a density of 10.sup.7 cells/mL to 10.sup.8 cells/mL and treated with UV at room temperature or 32 C. for 20 min to 40 min to induce a mutation. The strain was washed with a 0.85% saline solution twice and spread, after dilution, on a minimal medium containing 1.7% agar which was supplemented with a resistance-providing material at an appropriate concentration, and thereby colonies were obtained. Each colony was cultured in a nutrient medium and then cultured in a seed culture medium for 24 h. After culturing each colony in a fermentation medium for 3 to 4 days, colonies which showed excellent production of XMP accumulated in the culture medium were selected. Specifically, strains were selected from those which can grow in a medium where fluorotryptophan is added according to concentrations (addition medium), and more specifically, from those which can grow in a medium with a fluorotryptophan concentration of 100 mg/L and has an improved concentration of 5-xanthylic acid. The selected strain was named as CJX1664. [0095] Minimal medium: glucose 20 g/L, monopotassium phosphate 1 g/L, dipotassium phosphate 1 g/L, urea 2 g/L, ammonium sulfate 3 g/L, magnesium sulfate 1 g/L, calcium chloride 100 mg/L, iron sulfate 20 mg/L, manganese sulfate 10 mg/L, zinc sulfate 10 mg/L, biotin 30 g/L, thiamine hydrochloride 0.1 mg/L, copper sulfate 0.8 mg/L, adenine 20 mg/L, guanine 20 mg/L, pH 7.2 [0096] Addition medium: a medium where fluorotryptophan at a concentration of 10 mg/L, 20 mg/L, 50 mg/L, 70 mg/L, 100 mg/L, and 200 mg/L is added to a minimal medium

    [0097] The biochemical characteristics of the CJX1664 strain are shown in Table 12 below. Referring to Table 12, the CJX1664 strain can be grown in an addition medium where a fluorotryptophan is added at a concentration of 100 mg/L.

    TABLE-US-00012 TABLE 12 Characteristics ATCC6872 CJX1664 Fluorotryptophan Resistance 10 mg/L 100 mg/L

    EXAMPLE 5-2

    CJX1664 Fermentation Titer Test

    [0098] After dispensing a seed culture medium (2 mL) into test tubes (diameter: 18 mm), the tubes were autoclaved. Each of ATCC6872 and CJX1664 was inoculated and incubated at 30 C. for 24 h with shaking and used as a seed culture. A fermentation medium (29 mL) was dispensed into each 250 mL shaking Erlenmeyer flask, and autoclaved at 121 C. for 15 min. The seed culture (2 mL) was inoculated to the medium and cultured for 3 days. Culture conditions were adjusted to 170 rpm, 30 C., and pH 7.5.

    [0099] After completion of the culture, the amount of XMP production was measured by HPLC (SHIMAZDU LC20A), and the culture results are as in Table 13 below.

    TABLE-US-00013 TABLE 13 Strain XMP (g/L) ATCC6872 0 CJX1664 4.72

    EXAMPLE 5-3

    Introduction of Variant into CJX1664 Strain and Their Evaluation

    [0100] To confirm the presence of a variation of the purA gene of the CJX1664 strain selected in Example 5-1, the chromosomal DNA PCR of the CJX1664 strain was amplified by PCR. Specifically, first, purA fragments were amplified by PCR using the chromosomal DNA of the CJX1664 strain as a template and primers of SEQ ID NOS: 17 and 18, in which the PCR was performed by 28 cycles of denaturation at 94 C. for 1 min; annealing at 58 C. for 30 sec, and polymerization at 72 C. for 2 min using Taq DNA polymerase. The nucleotide sequences of the amplified purA gene fragments were analyzed using the same primers, and as a result, it was confirmed that there was no variation in the purA gene of the CJX1664 strain.

    [0101] The vector prepared in Example 4-3 was transformed into the CJX1664 strain, and the strains in which the vector was inserted on the genomic DNA by recombination of homologous sequences were selected on a medium containing 25 mg/L kanamycin. The selected primary strains were subjected to secondary crossover, and thereby those strains in which a variation of the target gene was introduced were selected. The introduction of the gene variation in the desired transformed strains was confirmed by sequence analysis.

    [0102] The XMP productivity for each of CJX1664 and CJX1664::purA(G85S) strains was evaluated. After the completion of culture, the amount of XMP production by each strain was measured by a method using HPLC, and the culture results are shown in Table 14 below.

    TABLE-US-00014 TABLE 14 Strain XMP (g/L) CJX1664 4.72 CJX1664::purA(G85S) 5.19

    [0103] As can be seen in Table 14 above, the CJX1664::purA(G85S) strain showed an increase in the amount of XMP production by about 109% compared to the CJX1664 strain (i.e., an ATCC6872-based XMP-producing strain).

    [0104] The CJX1664 strain was deposited at the Korean Culture Center of Microorganisms (KCCM) on Jul. 6, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12285P. Additionally, the prepared CJX1664::purA(G85S) strain, also called CJX1665, was deposited at the KCCM on Jul. 6, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12286P.

    EXAMPLE 6

    Substitution of Amino Acid in purA Variation with Different Amino Acid

    EXAMPLE 6-1

    Preparation of Vector for Insertion of Amino Acid in purA Variation

    [0105] Through the above Examples, it was confirmed that the purA(G85S) variation can improved the productivity of purine nucleotides. In this regard, to confirm the positional importance of the purA variation, the effect of the substitution of the 85.sup.th amino acid with a different amino acid on the productivity of purine nucleotides was examined. The process of preparing the vector for the insertion of purA(G85S) variation is as follows. Site-directed mutagenesis was performed using the pDZ-purA(G85S) vector prepared in Example 4 as a backbone. Specifically, PCR was performed using the sequences shown in Table 15 as primers under the following conditions: 18 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and extension at 68 C. for 12 min. The resulting PCR products were digested with DpnI, transformed into a DH5 strain, and colonies were obtained therefrom. The plasmids of thus obtained colonies were obtained by a known plasmid extraction method, and the information of the obtained plasmids are shown below in Table 15.

    TABLE-US-00015 TABLE15 SEQ IDNO Primer Sequence(5-3) 21 purA CTTTGAGGAAATTGAAGCTCTCGAAGCCCGCGGCGC (G85A)F 22 purA GCGCCGCGGGCTTCGAGAGCTTCAATTTCCTCAAAG (G85A)R 23 purA CTTTGAGGAAATTGAAGTCCTCGAAGCCCGCGGCGC (G85V)F 24 purA GCGCCGCGGGCTTCGAGGACTTCAATTTCCTCAAAG (G85V)R 25 purA CTTTGAGGAAATTGAACTGCTCGAAGCCCGCGGCGC (G85L)F 26 purA GCGCCGCGGGCTTCGAGCAGTTCAATTTCCTCAAAG (G85L)R 27 purA CTTTGAGGAAATTGAAATGCTCGAAGCCCGCGGCGC (G85M)F 28 purA GCGCCGCGGGCTTCGAGCATTTCAATTTCCTCAAAG (G85M)R 29 purA CTTTGAGGAAATTGAAATCCTCGAAGCCCGCGGCGC (G85I)F 30 purA GCGCCGCGGGCTTCGAGGATTTCAATTTCCTCAAAG (G85I)R 31 purA CTTTGAGGAAATTGAAACTCTCGAAGCCCGCGGCGC (G85T)F 32 purA GCGCCGCGGGCTTCGAGAGTTTCAATTTCCTCAAAG (G85T)R 33 purA CTTTGAGGAAATTGAAAACCTCGAAGCCCGCGGCGC (G85N)F 34 purA GCGCCGCGGGCTTCGAGGTTTTCAATTTCCTCAAAG (G85N)R 35 purA CTTTGAGGAAATTGAACAGCTCGAAGCCCGCGGCGC (G85Q)F 36 purA GCGCCGCGGGCTTCGAGCTGTTCAATTTCCTCAAAG (G85Q)R 37 purA CTTTGAGGAAATTGAATGCCTCGAAGCCCGCGGCGC (G85C)F 38 purA GCGCCGCGGGCTTCGAGGCATTCAATTTCCTCAAAG (G85C)R 39 purA CTTTGAGGAAATTGAACCACTCGAAGCCCGCGGCGC (G85P)F 40 purA GCGCCGCGGGCTTCGAGTGGTTCAATTTCCTCAAAG (G85P)R 41 purA CTTTGAGGAAATTGAATACCTCGAAGCCCGCGGCGC (G85Y)F 42 purA GCGCCGCGGGCTTCGAGGTATTCAATTTCCTCAAAG (G85Y)R 43 purA CTTTGAGGAAATTGAATGGCTCGAAGCCCGCGGCGC (G85W)F 44 purA GCGCCGCGGGCTTCGAGCCATTCAATTTCCTCAAAG (G85W)R 45 purA CTTTGAGGAAATTGAAAAGCTCGAAGCCCGCGGCGC (G85K)F 46 purA GCGCCGCGGGCTTCGAGCTTTTCAATTTCCTCAAAG (G85K)R 47 purA CTTTGAGGAAATTGAACGCCTCGAAGCCCGCGGCGC (G85R)F 48 purA GCGCCGCGGGCTTCGAGGCGTTCAATTTCCTCAAAG (G85R)R 49 purA CTTTGAGGAAATTGAACACCTCGAAGCCCGCGGCGC (G85H)F 50 purA GCGCCGCGGGCTTCGAGGTGTTCAATTTCCTCAAAG (G85H)R 51 purA CTTTGAGGAAATTGAAGATCTCGAAGCCCGCGGCGC (G85D)F 52 purA GCGCCGCGGGCTTCGAGATCTTCAATTTCCTCAAAG (G85D)R 53 purA CTTTGAGGAAATTGAAGAACTCGAAGCCCGCGGCGC (G85E)F 54 purA GCGCCGCGGGCTTCGAGTTCTTCAATTTCCTCAAAG (G85E)R

    TABLE-US-00016 TABLE 16 No. Plasmid 1 pDZ-purA G85A 2 pDZ-purA G85V 3 pDZ-purA G85L 4 pDZ-purA G85M 5 pDZ-purA G85I 6 pDZ-purA G85T 7 pDZ-purA G85N 8 pDZ-purA G85Q 9 pDZ-purA G85C 10 pDZ-purA G85P 11 pDZ-purA G85Y 12 pDZ-purA G85W 13 pDZ-purA G85K 14 pDZ-purA G85R 15 pDZ-purA G85H 16 pDZ-purA G85D 17 pDZ-purA G85E

    EXAMPLE 6-2

    Preparation of Strain where an Amino Acid is Substituted with a Different Amino Acid According to Position of Variation of a purA Variant, and Comparison of 5-Inosinic Acid Productivities

    [0106] Each of the 18 kinds of vectors, for the introduction of variants, prepared in Example 6-1 was transformed into the CJI2332 strain, and those strains where these vectors were inserted into the genomic DNA by homologous recombination were selected on a medium containing 25 mg/L kanamycin. The selected primary strains were subjected to secondary crossover, and thereby those strains into which a variation of the target gene was introduced were selected. For confirmation of the introduction of the gene variation in the desired transformed strains, PCR was performed using primers of SEQ ID NO: 17 and SEQ ID NO: 18 and the PCR products were confirmed by sequence analysis. The strains were named according to the inserted varions as shown in Table 17.

    TABLE-US-00017 TABLE 17 No. Strain 1 CJI2332::purA(G85A) 2 CJI2332::purA(G85V) 3 CJI2332::purA(G85L) 4 CJI2332::purA(G85M) 5 CJI2332::purA(G85I) 6 CJI2332::purA(G85T) 7 CJI2332::purA(G85N) 8 CJI2332::purA(G85Q) 9 CJI2332::purA(G85C) 10 CJI2332::purA(G85P) 11 CJI2332::purA(G85Y) 12 CJI2332::purA(G85W) 13 CJI2332::purA(G85K) 14 CJI2332::purA(G85R) 15 CJI2332::purA(G85H) 16 CJI2332::purA(G85D) 17 CJI2332::purA(G85E)

    [0107] The concentration of 5-inosinic acid was analyzed by culturing the strains in the same manner as in Example 1.

    TABLE-US-00018 TABLE 18 Concentration of 5-inosinic acid with variation in purA (g/L) Average No. Strain 5-Inosinic acid CJI2332 1.74 Control CJI2332::purA(G85S) 2.03 Group 1 CJI2332::purA(G85A) 1.93 2 CJI2332::purA(G85V) 1.84 3 CJI2332::purA(G85L) 2.01 4 CJI2332::purA(G85M) 2.01 5 CJI2332::purA(G85I) 2.02 6 CJI2332::purA(G85T) 2.02 7 CJI2332::purA(G85N) 1.83 8 CJI2332::purA(G85Q) 2.03 9 CJI2332::purA(G85C) 1.82 10 CJI2332::purA(G85P) 1.10 11 CJI2332::purA(G85Y) 1.92 12 CJI2332::purA(G85W) 0.39 13 CJI2332::purA(G85K) 1.86 14 CJI2332::purA(G85R) 1.30 15 CJI2332::purA(G85H) 1.67 16 CJI2332::purA(G85D) 2.02 17 CJI2332::purA(G85E) 1.94

    [0108] Referring to Table 18 above, it was confirmed that the strains containing the purA, in which the 85.sup.th amino acid of the amino acid sequence encoding the purA gene is substituted with a different amino acid, showed a significant change in the amount of IMP production, compared to other strains which did not contain the above variation. That is, it was confirmed that the 85.sup.th amino acid of the amino acid sequence encoding the purA gene is an important position for variation associated with the production of purine nucleotides, and when the 85.sup.th amino acid of the amino acid sequence encoding the purA gene is substituted with an amino acid selected from the group consisting of serine, alanine, valine, leucine, methionine, isoleucine, threonine, asparagine, glutamine, cysteine, tyrosine, lysine, aspartic acid, and glutamic acid, the microorganism having the variation can significantly increase the production of purine nucleotides.

    [0109] From the foregoing, a skilled person in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.