BIOSENSORS FOR MEASURING CELL SIGNALING IN STRESSED AND HEALTHY CELLS
20200393447 ยท 2020-12-17
Inventors
Cpc classification
C12Q1/6897
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed herein are nucleic acids comprising reporter constructs for detecting cellular signaling changes in a stressed cell. Also provided are methods for detecting cellular signaling changes in cells undergoing stress, as well as vectors and cells comprising nucleic acids comprising reporter constructs for detecting cellular signaling changes in a stressed cell.
Claims
1. A nucleic acid comprising from 5 to 3; a) a first open reading frame encoding a first reporter protein; b) a linker sequence comprising an intron that is spliced by inositol-requiring enzyme 1 (IRE1) when transcribed to mRNA; and c) a second open reading frame encoding a second reporter protein, wherein the first and second open reading frames are out of frame from each other.
2. The nucleic acid of claim 1, wherein the intron comprises SEQ ID NO: 1.
3. The nucleic acid of claim 1, wherein the intron comprises SEQ ID NO: 2.
4. The nucleic acid of claim 1, wherein the intron comprises SEQ ID NO: 3.
5. The nucleic acid of any one of claims 1-4, wherein the first reporter protein is a fluorescent or bioluminescent biosensor, the second reporter protein is a fluorescent or bioluminescent biosensor, or both the first and second reporter proteins are fluorescent or bioluminescent biosensors.
6. The nucleic acid of claim 5, wherein the first reporter protein is a fluorescent or bioluminescent biosensor and the second reporter protein is a fluorescent protein.
7. The nucleic acid of claim 5, wherein the first reporter protein is a fluorescent protein and the second reporter protein is a fluorescent or bioluminescent biosensor.
8. The nucleic acid of any one of claims 1-7, wherein the linker sequence comprises one or more sequence elements selected from the group consisting of an IRES, a 2A peptide, and an alternative translation initiation signal.
9. The nucleic acid of any one of claims 1-7, wherein the linker sequence encodes a peptide that links the translated first and second reporter proteins when the intron is spliced from the linker sequence mRNA.
10. The nucleic acid of claim 9, wherein the first reporter protein and the second reporter protein can act as a donor and acceptor pair for resonance energy transfer, wherein the first reporter protein is the donor and the second reporter protein is the acceptor, or the first reporter protein is the acceptor and the second reporter protein is the donor.
11. The nucleic acid of claim 10, wherein the linker sequence further comprises a sequence encoding a caspase cleavage site.
12. The nucleic acid of any one of claims 5-7, wherein the first or second fluorescent or bioluminescent biosensor detects changes in the cellular level of a molecule selected from the group consisting of calcium, cyclic adenosine monophosphate (cAMP), cyclic guanylate monophosphate (cGMP), diacylglycerol, adenosine triphosphate (ATP), adenosine disphosphate (ADP), glucose, ribose, sucrose, glutamate, hydrogen peroxide, lactate, magnesium, oxidized nicotinamide adenine dinucleotide (NAD.sup.+), non-oxidized nicotinamide adenine dinucleotide (NADH), phosphate, reactive oxygen species, and zinc.
13. The nucleic acid of any one of claims 5-7, wherein the first or second fluorescent biosensor detects changes in the transmembrane voltage of a cell.
14. The nucleic acid of any one of claims 1-4, wherein the first reporter protein is a fluorescent protein, the second reporter protein is a fluorescent protein, or both the first and second reporter proteins are fluorescent proteins.
15. The nucleic acid of any one of claims 1-14, wherein the first open reading frame and the second open reading frame are operatively linked to the same promoter.
16. A nucleic acid comprising from 5 to 3; a) a first exon of a reporter protein; b) a linker sequence comprising an intron that is spliced by inositol-requiring enzyme 1 (IRE1); and c) a second exon of the reporter protein, wherein the second exon is in a different reading frame from the first exon, wherein splicing of the intron in mRNA by IRE1 places the second exon in the same reading frame as the first exon.
17. The nucleic acid of claim 16, wherein the intron comprises SEQ ID NO: 1.
18. The nucleic acid of claim 16, wherein the intron comprises SEQ ID NO: 2.
19. The nucleic acid of claim 16, wherein the intron comprises SEQ ID NO: 3.
20. The nucleic acid of claim 17, wherein the reporter protein is selected from the group consisting of a fluorescent biosensor, a bioluminescent biosensor, and a fluorescent protein.
21. The nucleic acid of any one of claims 16-20, wherein the reporter protein is a fluorescent or bioluminescent biosensor that detects changes in the cellular level of a molecule selected from the group consisting of calcium, cyclic adenosine monophosphate (cAMP), cyclic guanylate monophosphate (cGMP), diacylglycerol, adenosine triphosphate (ATP), adenosine disphosphate (ADP), glucose, ribose, sucrose, glutamate, hydrogen peroxide, lactate, magnesium, oxidized nicotinamide adenine dinucleotide (NAD.sup.+), non-oxidized nicotinamide adenine dinucleotide (NADH), phosphate, reactive oxygen species, and zinc.
22. The nucleic acid of any one of claims 16-20, wherein the fluorescent or bioluminescent biosensor detects changes in the transmembrane voltage of a cell.
23. A vector comprising the nucleic acid molecule of any one of claims 1-22.
24. A cell comprising the nucleic acid of any one of claims 1-22 or the vector of claim 23.
25. The cell of claim 24, wherein the nucleic acid is inserted into the genome of the cell.
26. A kit comprising the nucleic acid of any one of claims 1-22, the vector of claim 23, or the cell of claim 24 or claim 25.
27. A protein encoded by the nucleic acid of any one of claims 1-22.
28. A method for measuring signaling in a cell, the method comprising: exposing a cell comprising the nucleic acid of any one of claims 1-15 to light having an excitation wavelength of the first reporter protein, and light having an excitation wavelength of the second reporter protein, and measuring the fluorescence from the cell at the emission wavelength of the first reporter protein and at the emission wavelength of the second reporter protein.
29. The method of claim 28, further comprising contacting the cell with a molecule or organism selected from the group consisting of: a small molecule; a protein; a bacterium; a virus; a protozoan; a worm; or a fungus.
30. The method of claim 28, further comprising exposing the cell to an environmental stressor selected from the group consisting of: a temperature change; a pH change, an osmolarity change; a pressure change; a gravitational force change, and mechanical damage to the cell.
31. A method for measuring signaling in a cell, the method comprising: exposing a cell comprising the nucleic acid of any one of claims 16-22 to light having an excitation wavelength of the reporter protein, and measuring the fluorescence from the cell at the emission wavelength of the reporter protein.
32. The method of claim 31, further comprising contacting the cell with a molecule or organism selected from the group consisting of: a small molecule; a protein; a bacterium; a virus; a protozoan; a worm; or a fungus.
33. The method of claim 31, further comprising exposing the cell to an environmental stressor selected from the group consisting of: a temperature change; a pH change, an osmolarity change; a pressure change; a gravitational force change, and mechanical damage to the cell.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
DETAILED DESCRIPTION
[0040] The technology described herein provides nucleic acid constructs that link the stress status of a cell with the cell's signaling properties. In particular, the disclosure describes fluorescent sensor systems that can be used to both identify a cell experiencing stress and measure the signaling properties of the stressed cell. Once obtained, the signaling properties of the stressed cell can be compared with the signaling properties with healthy, unstressed cells, allowing a user to determine the effect of stress on cellular signaling properties. As described further below, nucleic acids encoding the fluorescent sensor systems described herein can be introduced into a cell to allow detection of the cell's stress status and its intracellular signaling as detected by the sensor. Such sensor systems comprise first and second reporter proteins encoded by an engineered nucleic acid. The first and second reporter proteins may be a fluorescent protein, a bioluminescent protein, or a fluorescent biosensor, wherein expression of the first or second protein is dependent on the stress status of the cell.
[0041] Accordingly, a general embodiment of the instant technology is a nucleic acid molecule having first and second open reading frames encoding first and second reporter proteins, one of the reporter proteins being a fluorescent biosensor, and the second reporter protein being a fluorescent protein or another fluorescent biosensor, wherein a linker sequence between the two open reading frames comprises an intron that interrupts the protein coding sequence. Removal of the intron by splicing is dependent on the stress status of the cell.
Definitions
[0042] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0043] As used herein, the term nucleic acid refers to a polymer of two or more nucleotides or nucleotide analogues (such as ribonucleic acid having methylene bridge between the 2-O and 4-C atoms of the ribose ring) capable of hybridizing to a complementary nucleic acid. As used herein, this term includes, without limitation, DNA, RNA, LNA, and PNA. A nucleic acid may be single-stranded or double-stranded. Where the nucleic acid is single-stranded, a skilled person in the art will appreciate that, the nucleic acid can be in the sense or antisense orientation relative to the direction of transcription of the reporter genes.
[0044] As used herein, the term gene refers to a nucleic acid sequence that encodes an amino acid sequence. A gene of the invention can include a nucleic acid sequence that is a contiguous coding sequence (e.g., an open reading frame; ORF), as well as nucleic acid sequences that contain exons and introns. In the context of the instant technology, the term gene can, but need not, include regulatory sequences such as, for example, promoter sequences, enhancer sequence, polyadenylation signals, and the like.
[0045] Genes of the instant technology can be joined to regulatory sequences, such as promoters, thereby allowing expression of the genes. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5 and 3 untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, and introns. Preferred promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis B virus, and most preferably cytomegalovirus (CMV), or from heterologous mammalian promoters, e.g. beta-actin promoter or EF1 promoter, or from hybrid or chimeric promoters (e.g., CMV promoter fused to the beta-actin promoter). Promoters from the host cell or related species are also useful herein.
[0046] As used herein, the term enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5 or 3 to the transcription unit. Furthermore, enhancers can be within an intron as well as within the coding sequence itself. Enhancers are usually between 10 and 300 base pairs in length, and function in cis. Enhancers usually function to increase transcription from nearby promoters; in some species (e.g. D. melanogaster), enhancers can function in trans on a corresponding allele on another chromosome. Enhancers can also contain response elements that mediate the regulation of transcription. While many enhancer sequences are known from mammalian genes (globin, elastase, albumin, fetoprotein, and insulin), typically enhancers from a eukaryotic cell virus are used for general expression. Preferred examples are the SV40 enhancer on the late side of the replication origin, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
[0047] Genes in constructs of the invention can be operatively linked to the same promoter, or each gene can be independently, operatively linked to a different promoter. As used herein, the term operatively linked means that the promoter can direct the expression of a linked sequence, which encodes protein. In one embodiment, a first gene and a second gene are operatively linked to the same promoter. The promoter and/or an enhancer can be inducible (e.g. chemically or physically regulated). A chemically regulated promoter and/or enhancer can, for example, be regulated by the presence of alcohol, tetracycline, a steroid, or a metal. A physically regulated promoter and/or enhancer can, for example, be regulated by environmental factors, such as temperature and light. Optionally, the promoter and/or enhancer region can act as a constitutive promoter and/or enhancer to maximize the expression of the region of the transcription unit to be transcribed. In certain vectors, the promoter and/or enhancer region can be active in a cell type specific manner. Optionally, in certain vectors, the promoter and/or enhancer region can be active in all eukaryotic cells, independent of cell type. Preferred promoters of this type are the CMV promoter, the SV40 promoter, the -actin promoter, the EF1 promoter, and the retroviral long terminal repeat (LTR).
[0048] In one embodiment, transcription from the promoter results in production of a polycistronic mRNA molecule comprising the first gene sequence and the first and second exon sequences. As used herein, the term polycistronic mRNA is a mRNA molecule that carries multiple, independent coding regions that can produce multiple, independent proteins. There are many ways of creating such mRNAs, which include, without limitation, internal ribosomal entry sites (IRES), 2A peptide sequences (Szymczak et al. 2004), or strategically positioned alternative translation start signals. In one embodiment, the nucleic acid molecule comprises an internal ribosomal entry site (IRES) sequence upstream of the first exon. In one embodiment, the nucleic acid molecule comprises a sequence encoding a 2A peptide sequence upstream of the first exon.
[0049] As used herein, the term reporter protein refers to a protein that is detectable by a user when expressed by a cell in a non-truncated form, and the term reporter gene refers to a gene encoding a reporter protein. For example, a reporter protein may be a fluorescent protein that fluoresces when exposed to a certain wavelength of light (e.g. GFP, enhanced GFP). A reporter protein may be fluorescent biosensor that changes its fluorescence properties in response to a particular type of cell signaling. A reporter protein may be an enzyme that catalyzes a reaction with a substrate to produce an observable change in that substrate, such as the luminescence enzyme luciferase which acts on luciferin or other substrates to emit photons, or -galactosidase which can hydrolyze X-gal (5-bromo-4-chloro-3-indolyl--D-galactopyranoside) to form a blue precipitate that can visualized.
[0050] As used herein, the term bioluminescent protein refers to a protein that catalyzes a reaction with a substrate to emit photons, without needing a light source to excite the protein. Exemplary bioluminescent proteins include, but are not limited to: luciferase (e.g. from fireflies, jellyfish, or dinoflagellates), aequorin (which emits photons when oxidized in the presence of calcium).
[0051] As used herein, the term fluorescent protein refers to a protein that emits light at some wavelength after excitation by light at another wavelength. Exemplary fluorescent proteins that emit in the green spectrum range include, but are not limited to: green fluorescent protein (GFP); enhanced GFP (EGFP); superfolder GFP; AcGFP1; and ZsGreen1; and mNeonGreen. Exemplary fluorescent proteins that emit light in the blue spectrum range include, but are not limited to: enhanced blue fluorescent protein (EBFP), EBFP2, Azurite, and mKalama1. Exemplary fluorescent proteins that emit light in the cyan spectrum range include, but are not limited to: cyan fluorescent protein (CFP); enhanced CFP (ECFP); Cerulean; mHoneydew; and CyPet. Exemplary fluorescent proteins that emit light in the yellow spectrum range include, but are not limited to: yellow fluorescent protein (YFP); Citrine; Venus; mBanana; ZsYellow1; and Ypet. Exemplary fluorescent proteins that emit in the orange spectrum range include, but are not limited to: mOrange; tdTomato; Exemplary fluorescent proteins that emit light in the red and far-red spectrum range include, but are not limited to: DsRed; DsRed-monomer; DsRed-Express2; mRFP1; mCherry; mStrawberry; mRaspberry; mPlum; E2-Crimson; iRFP670; iRFP682; iRFP702; iRFP720. Far red fluorescent proteins (e.g. iRFP670; iRFP682; iRFP702; iRFP720) can be useful for animal or thick tissue preparations, as the wavelength is able to penetrate these thicker structures. Such far red proteins can be engineered into biosensors (see, e.g. Shcherbakova et al. 2016, fusing miRFP703 to IB to detect NF-B activation). Exemplary listings of fluorescent proteins and their characteristics may be found in Day and Davidson. 2009, and in Rodriguez et al. 2017, each of which is incorporated herein by reference.
[0052] Fluorescent proteins may include chimeric combinations of fluorescent proteins that transfer and receive energy through fluorescent resonance energy transfer (FRET) when exposed to a particular wavelength of light. In some embodiments, an acceptor in a FRET pair may emit light at a certain wavelength after accepting energy from a donor molecule exposed to another wavelength of light. Exemplary chimeric FRET pairs, include, but are not limited to ECFP-EYFP; mTurquoise2-SeYFP; EGFP-mCherry; and Clover-mRuby. In some embodiments, the acceptor molecule of chimeric fluorescent molecule may quench the light emission of a donor molecule exposed to its preferred wavelength of light. Quenching between different portions of chimeric fluorescent proteins may occur using a photoactivatable acceptor. For example, a chimeric fluorescent protein may include a photoactivatable GFP that can then quench photoemission by CFP. Examples of FRET proteins are discussed in Hildebrandt et al., Sensors (Base1). 2016 September; 16(9): 1488, incorporated herein by reference.
[0053] Fluorescent proteins may also include chimeric combinations of bioluminescent proteins and fluorescent proteins that transfer and receive energy through bioluminescent resonance energy transfer (BRET). In some embodiments, an acceptor in a BRET pair (e.g. GFP) may emit light at a certain wavelength after accepting energy from photons emitted by a bioluminescent protein (e.g. luciferase). In such an embodiment, the bioluminescent protein alone, before ER-stress induced splicing, would produce light of one particular wavelength. After the mRNA is spliced to remove the intron, a new, closely linked fluorescent protein would be translated that would accept the energy emitted by the bioluminescent protein and in turn emit light of different wavelength. For example, luciferase fused to a fluorescent protein and catalyzing luciferin or an analogue would produce a red-shifted light. In this case the luciferase emission alone would be one marker, and the red-shifted emission from the acceptor protein, if it is there, would be the second signal (see, e.g., Xu et al. 1999).
[0054] As used herein, the term fluorescent biosensor (also referred to as a cell signaling sensor protein) refers to a recombinant, fluorescent fusion protein that changes its fluorescence properties in response to a particular type of cell signaling. For example, in the case of excitable cells, a fluorescent biosensor may change fluorescence in response to changes in transmembrane voltage, such as FlaSh (a voltage-gated potassium channel fused to a fluorescent protein), ArcLight (a voltage-sensitive phosphatase fused to a mutated pHluorin), and microbial rhodopsin-based proteins that are either inherently fluorescent or can be paired with a fused fluorescent protein to utilize FRET fluorescence or quenching (e.g. Mermaid, using fluorescent proteins from Coral) (see, e.g. Storace et al. 2016, incorporated herein by reference). Alternatively, the biosensor may change fluorescence in response to changes in the level of a cell signaling molecule such as, for example, calcium (e.g. Cameleon, a fusion of calmodulin, calmodulin-binding peptide, and GFP), chloride (e.g. Clomeleon, a fusion of a chloride-sensing yellow fluorescent protein and cyan fluorescent protein), pH (e.g. pHluorin), cAMP (see, e.g. U.S. Patent Application No. 20160274109A1 incorporated herein by reference), cGMP (see, e.g., Nikolaev et al. 2006, incorporated herein by reference), or diacylglycerol (DAG) (see, e.g., U.S. Pat. No. 9,547,017 incorporated herein by reference). FLIP biosensors utilize binding proteins from bacteria (e.g. glutamate/aspartate binding protein, glucose binding protein, sucrose binding protein) fused to two GFPs (see, e.g. Okumuto et al. 2005; Bermejo et al. 2010; Lager et al. 2006). HyPer (a circular permutant of YFP) and roGFP (with substituted cysteines) can be used for detection of reactive oxygen species (see e.g. Bilan et al. 2013). REX-YFP or Peredox (a fusion of fluorescent protein and the T-Rex sensor from Thermus aquaticus) may be used to detect the redox state of nicotinamide adenine dinucleotide (NAD+/NADH) (see, e.g. Bilan et al. 2014; Hung et al. 2011). Zinc can be detected using a fusion of a fluorescent protein and a His4 protein sensor (see, e.g. Dittmer et al. 2009). Phosphate detection may be accomplished using bacterial phosphate-binding protein (PiBP) to eCFP and eYFP (see, Gu et al. 2006.). Perceval is a fusion of bacterial regulatory protein GlnK1 and cpmVenus (eYFP) for detecting the ATP/ADP ratio in live cells (see, e.g., Berg et al., 2009). FLIPW is a fusion of tryptophan-activated repressor protein (TrpR) and eCFP and cpmVenus (eYFP) (see e.g. Kaper et al. 2007). Intracellular lactate may be detected with a fusion of bacterial L1d receptor and Venus (eYFP) (see, e.g., San Martin et al. 2013.). MagFRET is a fusion of human centrin 3 (HsCen3) to Cerulean and Citrine that detects magnesium (Lindenburg et al. 2013). Exemplary signaling molecules that may be detected by a fluorescent biosensor include, but are not limited to, calcium chloride, cAMP, cGMP, diacylglycerol, ATP, ADP, glucose, ribose, sucrose, glutamate, hydrogen peroxide, lactate, magnesium, NAD+, NADH, phosphate, reactive oxygen species, and zinc.
[0055] As used herein, the term cellular stress refers to a wide variety of molecular changes that occur in cells in response to environmental stressors such as, for example, temperature changes, changes in pH, changes in osmolarity, changes in pressure, changes in gravitational force, mechanical damage to the cell, infection, and the like. Environmental stressors may also include cell contact with molecules and organisms, including, but not limited to small molecules (a molecule of molecular weight less than 900 daltons, e.g. chemotherapeutic compounds), proteins (e.g. diphtheria toxin), bacteria, viruses, protozoa, worms, and fungi. Cells respond to stressors, at least in part, by modulation of cellular molecules, one class of which are stress response proteins. Many of these stress response proteins affect the transcription of certain genes through either direct interaction with genetic elements (e.g., promoters), or through modulation of other molecules (e.g., proteins) that eventually interact with genetic elements. Thus, the stress status of a cell can refer to the relative level and/or activity of one or more stress response proteins. Accordingly, the stress status of a cell can be determined by measuring the level or activity of one or more stress response proteins. Such measurement can be direct (e.g., determination of protein level) or indirect (e.g., assays using reporter constructs affected by one or more stress response proteins).
[0056] Examples of stress response proteins include, but are not limited to, x-box binding protein 1 (XBP1), and inositol requiring protein 1 (IRE1), both of which are activated when hydrophobic patches are exposed in unfolded proteins in the lumen of the endoplasmic reticulum (described in further detail below). The presence of unfolded proteins activates the RNase activity of IRE1, which splices immature, cytosolic mRNA for XBP1, generating an active transcription factor that alters gene expression (Yoshida et al. 2001). Thus, in one embodiment, a stressed cell is a cell in which the RNAse activity of the IRE1 protein has been activated. In one embodiment, a stressed cell is a cell in which the XBP1 intron is being spliced. This is classically referred to as the unfolded protein response (UPR); however, a wide variety of stimuli can cause this splicing, so the broader term of stressed cells is used here. For example, reactive oxygen species are known to produce the UPR (Santos et al. 2009), as well as metabolic stressors (Pilkis et al. 1992; Belmadani et al. 2017). Mis-folded proteins often found in neurodegenerative diseases trigger the UPR (Halliday et al. 2014). Substances and drugs that are toxic to cells often trigger the UPR (Foufelle et al. 2016).
[0057] As used herein, the term linker sequence or linker nucleic acid refers to a nucleotide sequence that is located between two other nucleotide sequences. In some embodiments, a linker nucleotide sequence may encode an intron, an IRES, a cleavage site of a protease, and/or a ribosomal skipping peptide. For example, if two proteins are translated with a linker nucleotide sequence encoding an amino acid sequence of a protease cleavage site (e.g. 3C or PreScission; enterokinase (EKT); Factor Xa (Fxa); Tobacco etch virus (TEV); or thrombin) from a multicistronic mRNA, specific proteases that are concomitantly expressed by the cell will cleave the peptide at the cleavage site. In another example, the nucleotide sequence encoding peptide 2A (such as T2A, P2A, E2A, or F2A) may be used, which causes ribosomal skipping at the end of the 2A sequence. This leaves no peptide bond between the 2A peptide and any peptide translated after the 2A peptide, and allows multiple separate proteins to be translated from a single transcript.
[0058] As used herein, the term exon refers to a nucleic acid sequence that encodes a peptide or protein sequence. In some embodiments, an exon encodes part of a protein sequence. In some embodiments, an exon encodes an entire protein sequence.
[0059] As used herein, the term intron refers to a nucleic acid sequence that interrupts other coding sequences, such as exons. Any intron can be used in constructs of the technology described herein, as long as activation of the cell stress response causes the intron to be spliced out of pre-mRNA.
[0060] As used herein, the term splicing refers to the removal of introns from a pre-mRNA sequence.
[0061] As used herein, the term pre-mRNA refers to messenger RNA (mRNA) transcribed from a nucleic acid molecule, which has not yet undergone splicing and thus contains at least one intron. As used herein, the term mature mRNA refers to pre-mRNA that has completed the splicing process and is ready to undergo translation to produce an encoded protein. In one embodiment, the intron is recognized by the IRE1 protein. In one embodiment, the intron is a cytoplasmic XBP1 intron present in the XBP1 mRNA. In one embodiment, the intron comprises a sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 1 or SEQ ID NO:2. In one embodiment, the intron comprises SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the intron is SEQ ID NO: 1 or SEQ ID NO: 2.
[0062] As used herein, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. For example, a nucleic acid molecule refers to one or more nucleic acid molecules. As such, the terms a, an, one or more and at least one can be used interchangeably. Similarly the terms comprising, including and having can be used interchangeably. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as solely, only and the like, in connection with the recitation of claim elements, or use of a negative limitation.
[0063] As used herein, the term about in quantitative terms refers to plus or minus 10% of the value it modifies (rounded up to the nearest whole number if the value is not subdividable, such as a number of molecules or nucleotides). For example, about 100 mg would encompass 90 mg to 110 mg, inclusive; about 2500 mg would encompass 2250 mg to 2750 mg. When applied to a percentage, the term about refers to plus or minus 10% relative to that percentage. For example, about 20% would encompass 15-20% and about 80% would encompass 75-85%, inclusive. Moreover, where about is used herein in conjunction with a quantitative term it is understood that in addition to the value plus or minus 10%, the exact value of the quantitative term is also contemplated and described. For example, the term about 23% expressly contemplates, describes, and includes exactly 23%.
Unfolded Protein Response (UPR)
[0064] The unfolded protein response (UPR) is a cellular stress mechanism for managing unfolded protein accumulation in the lumen of the endoplasmic reticulum (ER), which can occur when protein synthesis is unregulated due to protein mutation or other stress conditions. Binding immunoglobulin protein (BiP), also known as glucose regulated protein 78 (GRP78), acts as an initial sensor of unfolded proteins in the ER and initiates the UPR pathway.
[0065] During times of normal ER function, BiP is associated with the luminal domain of three different ER membrane proteins: inositol-requiring enzyme 1 (IRE1), activating transcription factor 6 (ATF6), and PKR-like ER kinase (PERK). If BiP interacts with a hydrophobic, unfolded patch of protein in the lumen of the ER, it dissociates from IRE1, ATF6, and PERK, allowing these luminal ER proteins to act as part of the unfolded protein response. Following dissociation from BiP, IRE1 oligomerizes and autophosphorylates, activating RNase activity that splices many mRNAs, including immature, cytosolic mRNA for the transcription factor X-box binding protein 1 (XBP1). Spliced XBP1 generates an active transcription factor that alters gene expression (Yoshida et al. 2001).
[0066] This cytosolic splicing of XBP1 mRNA has been used to generate reporter systems in which XBP1 splicing produces a functional, fluorescent protein (Iwawaki et al. 2003; U.S. Patent Publication Number US2012/0202751A1, incorporated herein by reference), and there are now a variety of PCR-based splicing assays or reporters of XBP1 transcriptional activity (Rong et al. 2015).
[0067] ER stress and the UPR can be induced by a number of drugs, including anticancer drugs (Foufelle et al. 2016; Pluquet et al. 2015) and mutations associated with different diseases, especially neurodegenerative diseases (Grootjans et al. 2016; Scheper et al. 2015; Halliday et al. 2014; Wang et al. 2012) and cancer (Cubillos-Ruiz et al. 2017).
Unfolded Protein Response (UPR)
[0068] One embodiment of the technology described herein is a nucleic acid comprising a gene comprising a first exon and a second exon separated by an intron, wherein the intron is chosen such that activation of the cellular stress response results in splicing of the intron and joining of the first and second exons to form an open reading frame (ORF) that encodes a fluorescent biosensor. In such an embodiment, the level of fluorescence from the fluorescent biosensor changes in response to the cellular level of a cell signaling molecule such as, for example, a cell signaling molecule selected from the group consisting of Ca.sup.2+, cAMP, cGMP, diacylglycerol, ATP, ADP, glucose, glutamate, hydrogen peroxide, lactate, magnesium, NAD+, NADH, phosphate, reactive oxygen species, ribose, sucrose, and zinc. In certain embodiments, the level of fluorescence from the fluorescent biosensor changes in response to the transmembrane voltage of the cell.
[0069] In certain embodiments, nucleic acid constructs encoding a multiplex fluorescent biosensor would express a genetically encoded, fluorescent sensor for diacylglycerol or Ca.sup.2+ in all of the cells, and a different fluorescent protein in only the cells undergoing a stress response that causes splicing of the XBP1 intron. Such nucleic acid constructs would allow comparison of diacylglycerol or Ca.sup.2+ signaling in healthy and stressed cells (See Example 1). In stressed cells the diacylglycerol or Ca.sup.2+ levels could be different due to effects on either the sources of diacylglycerol or Ca.sup.2+ or the clearance of these second messengers. Such fluorescent biosensors could also be used to identify whether stressed cells have a different pharmacological profile such that drugs that typically cause diacylglycerol or Ca.sup.2+ signaling in healthy cells no longer do in stressed cells. The fluorescent biosensors could also be used to determine if there are drugs that would act preferentially on diacylglycerol or Ca.sup.2+ signaling in stressed cells rather than healthy ones.
[0070] In certain embodiments, the two-colored multiplex sensor would express a genetically encoded, green fluorescent sensor for cAMP in all of the cells, and red fluorescent protein in just the ones undergoing an unfolded protein response that causes splicing the of XBP1 intron (SEQ ID NO:1). This would allow comparison of cAMP signaling in healthy and stressed cells (Example 2). In stressed cells the cAMP levels could be different due to effects on either the sources of cAMP, the adenylyl cyclases, or the clearance of cAMP by phosphodiesterases. The sensor could also be used to identify whether stressed cells have a different pharmacological profile such that drugs that typically cause cAMP signaling in healthy cells no longer do in stressed cells. The sensor could also be used to determine if there are drugs that would act preferentially on cAMP signaling in stressed cells rather than healthy ones.
[0071] In certain embodiments, a single transcript would carry encode of the necessary components, including both a fluorescent biosensor, a different colored fluorescent protein, and the XBP1 intron (SEQ ID NO:1). In a different embodiment separate vectors would comprise two different genes that produce two different transcripts, one of which includes the XBP1 intron and one color of fluorescent protein and a different transcript that carries a different colored fluorescent sensor for cell signaling.
[0072] One embodiment of the invention is a nucleic acid molecule comprising a nucleic acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to a nucleic acid sequence disclosed herein. One embodiment of the invention is a nucleic acid molecule comprising any of the nucleic acid sequences disclosed herein.
[0073] One embodiment of the invention is a nucleic acid comprising a nucleic acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:3 or SEQ ID NO:4. One embodiment of the invention is a nucleic acid molecule comprising SEQ ID NO:3 or SEQ ID NO:4.
[0074] One embodiment of the invention is a protein encoded by a nucleic acid of the invention.
[0075] The present disclosure also discloses nucleic acid vectors useful for practicing methods of the invention. In certain embodiments, a nucleic acid vector of the invention can be a plasmid, a cosmid, a viral vector, and the like, that comprises a nucleic acid molecule of the invention. The nucleic acid constructs described herein may be introduced into a cell using transient transfection techniques (e.g. using a plasmid introduced by lipids or electroporation), or it may be stably integrated into a cellular genome, such as by viral delivery (e.g. using a lentivirus or baculovirus vector). The multifunctional DBS reporter constructs may also be integrated into a specific genomic region of interest, using site-directed recombinase technology (e.g. Cre-Lox or FLP-FRT) or transposon-based technology (e.g. Sleeping Beauty transposon/SB100X).
[0076] Nucleic acid molecules of the invention may be inserted into the genomes of transgenic animals or model organisms, used to create stable cell lines, or transiently expressed via transfection or viral transduction. In such constructs, the nucleic acid molecule may be inserted into the host genome or remain episomal. Methods to generate stable lines or animals or to transiently express the sensors are well known in the art and readily adaptable for use with the compositions and methods described herein. Nucleic acid sequence of the invention may also located in the genome of a cell in a transgenic animal and tissue, including, but not limited to, C. elegans, drosophila, mice, rats, marmosets, organoids, and embryonic stem cells derived from any vertebrate.
[0077] Methods of making cells of the invention are known and the method of transformation and choice of expression vector will depend on the host system selected. Transformation and transfection methods are described, e.g., in F. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., (1998), and, as described above, expression vectors may be chosen from examples known in the art. There are a number of compositions and methods which can be used to deliver the nucleic acid molecules and/or polypeptides to cells, either in vitro or in vivo via, for example, expression vectors. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems. Such methods are well known in the art and readily adaptable for use with the compositions and methods described herein. Examples of viral vectors useful for practicing the present invention include, but are not limited to, Adenovirus, Adeno-associated virus, Lentivirus, Baculovirus modified for mammalian expression (BacMam), herpes virus, Vaccinia virus, Polio virus, Sindbis, and other RNA viruses, including these viruses with the HIV backbone. Non-viral based vectors, can include expression vectors comprising nucleic acid molecules and nucleic acid sequences encoding polypeptides, wherein the nucleic acids are operably linked to an expression control sequence. Suitable vector backbones include, for example, those routinely used in the art such as plasmids, artificial chromosomes, BACs, YACs, or PACs.
[0078] As described above, sensor systems of the invention are useful for measuring cell signaling (e.g., Ca.sup.2+, cAMP, cGMP, diacylglycerol, ATP, ADP, glucose, glutamate, hydrogen peroxide, lactate, magnesium, NAD+, NADH, phosphate, reactive oxygen species, ribose, sucrose, zinc, etc.) in cells that are undergoing stress. Thus, one embodiment of the invention is a method of measuring cell signaling in a cell undergoing a stress response, comprising exposing a cell comprising a nucleic acid molecule of the invention to light having the excitation wavelength of the first fluorescent protein and the second fluorescent protein, and measuring the fluorescence from the cell at the emission wavelength of the first fluorescent protein and the second fluorescent protein.
[0079] One embodiment of the present invention is a kit for practicing methods of the present invention. Kits can include a nucleic acid molecule, a nucleic acid vector, or a cell of the present invention as well components for making such nucleic acid molecules, nucleic acid vectors, or cells. As such, kits can include, for example, primers, nucleic acid molecules, expression vectors, DNA constructs of the present invention, cells, buffers, reagents, and directions for using any of said components. It should be appreciated that a kit may comprise more than one container comprising any of the aforementioned, or related, components. For example, certain parts of the kit may require refrigeration, whereas other parts can be stored at room temperature. Thus, as used herein, a kit comprises components sold in separate containers by one or more entity, with the intention that the components contained therein be used together.
Two-Color Multiplex Reporter Construct
[0080] An exemplary two-color multiplex reporter nucleic acid construct is shown in the schematic diagram of
[0081] While a cell is unstressed, i.e. is not mobilizing or expressing proteins in the UPR (e.g. XBP1 or IRE1), the red biosensor is expressed constitutively, and the mNeonGreen protein is not translated because its coding sequence is out of frame. In the cells undergoing ER stress, IRE1 is released from the BiP, dimerizing and acquiring RNase activity. IRE1 recognizes the intron in transcribed RNA and splices it out (see bottom portion of diagram in
[0082] In some embodiments, the intron is the XBP1 intron CAGCACTCAGACTACGTGCACCTCTG (SEQ ID NO: 1). The XBP1 intron is the sequence spliced out of the mRNA by IRE1 during the unfolded protein response. In some embodiments, the intron includes the XBP1 intron structure sequence SEQ ID NO: 2 CCGGGTCTGCTGAGTCCGCAGCACTCAGACTACGTGCACCTCTGCAGCAGGTGCA GGCCCAG (SEQ ID NO: 2). The XBP intron structure sequence includes the XBP1 intron that is spliced out of the pre-mRNA, and includes sequence that is recognized by IRE1 during the splicing event. In some embodiments, the intron includes a portion of the XBP1 protein coding sequence and the XBP1 intron structure sequence (SEQ ID NO: 3).
[0083] A nucleic acid construct of
[0084]
EXAMPLES
[0085] The following examples are meant to be illustrative and should not be construed as further limiting. The contents of the figures and all references, patents, and published patent applications cited throughout this application are expressly incorporated herein by reference.
Example 1
Multiplex Ca.SUP.2+ Biosensor Construct to Measure Ca.SUP.2+ Response in Cells Exposed to Stressor Molecule
[0086] In order to analyze the calcium response of cells exposed to an ER-stress inducing molecule, HEK293T cells transfected with the nucleic acid construct described in
[0087] HEK293T cells were transfected with SEQ ID NO: 4 as follows. 27,000 cells per well in 100 L of EMEM media were plated onto Greiner 96-well plates coated with poly-D lysine. The cells were incubated for 24 hours at 37 C. and 5% CO.sub.2. 100 ng of plasmid DNA expressing SEQ ID NO: 4 and 10 ng of plasmid expressing human muscarinic receptor 1 were then transfected using FUGENE as follows. 100 ng of DNA expressing SEQ ID NO: 4 and 10 ng of DNA expressing human muscarinic receptor 1 were combined with 0.4 L of FUGENE and brought to a final volume of 50 L using OPTIMEM serum free media and incubated for 20 mins at 25 C. then added to the cells. After 16 hours the cells were treated with a final concentration of 1 M thapsigargin for 5 hours to induce ER stress. The cells were then washed 5 with 100 L DPBS and 150 L of DPBS was added to the wells. The cells were imaged using a Zeiss Axiovert fluorescence microscope using standard Green Fluorescent Protein (GFP) and Red Fluorescent Protein (RFP) excitation and emission filters. Images were obtained in both the red and green channels every 2 seconds for 100 seconds. A final concentration of 50 M carbachol was added to the wells to stimulate Gq signaling after 20 seconds, releasing intracellular Ca.sup.2+ stores for detection by the biosensor. The images were analyzed as follows. Cells were identified as either stressed or unstressed based on their green fluorescence intensity. The Ca.sup.2+ signaling response upon Gq stimulation was monitored in the red fluorescence channel.
[0088] In the ER stressed cells, splicing of the XBP1 intron introduces a frameshift in the coding region such that the mNeonGreen protein is expressed, marking the cells that experience ER stress.
[0089]
Example 2
Multiplex Ca.SUP.2+ Biosensor Construct to Measure Ca.SUP.2+ Response in Cells Stressed with Mutant Protein
[0090] In order to analyze the calcium response of cells expressing a mutant protein, HEK293T cells were transfected with both the nucleic acid construct described in
[0091] The experiment in
[0092]
Example 3
Multiplex cAMP Biosensor Construct in HEK293 Cultures
[0093] In order to analyze the cAMP response of cells exposed to a ER-stress inducing molecule, HEK293T cells were transfected with 100 ng of a red fluorescent cAMP biosensor (cADDis; Montana Molecular, Bozeman, Mont., USA) and 100 ng of the rhodopsin P23H mutant plasmid described in Example 2 above. After 24 hours of incubation, the green and red fluorescence were monitored on a BioTek synergy MX plate reader with the fluorescence intensity read every 30 seconds. Isoproterenol was added after 5 minutes to stimulate Gs signaling and increase intracellular levels of cAMP, and the cells were monitored for 15 minutes after isoproterenol addition.
[0094]
[0095] Expression of the rhodopsin mutant P23H not only produces changes in Ca.sup.2+ response to carbachol as discussed in Example 2, but also produces changes in cAMP signaling. In this case, the ER stressed cells expressing P23H rhodopsin have lower levels of cytosolic cAMP, and the response of the cells to a drug that produces large increases in cAMP in healthy cells (turquoise) is much smaller in the stressed ones (red). This is consistent with the observation that cAMP dependent processes are reduced in cells stressed in neurodegenerative diseases (Carlyle et al. 2014; Bibb et al. 2000).
Example 4
Single Color Cell Stress Biosensor Construct in HEK293 Cultures
[0096] In order to determine if a fluorescent protein can be used with the intron splicing behavior of IRE1, a nucleic acid construct was created in which the XBP1 intron is inserted within a circularly permuted mNeonGreen protein coding sequence. Circularly permuted fluorescent proteins have been incorporated into biosensor proteins to fluoresce in response to the presence of an intracellular molecule, such as DAG (see, e.g. U.S. Pat. No. 9,547,017B2, incorporated herein by reference) and cAMP (see, e.g. US Patent Publication number 20160274109A1, incorporated herein by reference).
[0097] The XBP1 region inserted into the circularly permuted mNeonGreen coding sequence includes both the spliced intron and a coding sequence for several amino acids from XBP1. Following mRNA splicing of the XBP1 intron, a coding portion of the XBP1 sequence remains. The spliced mRNA encodes several amino acids, and there are several regions in the fluorescent protein that can tolerate the insertion of additional amino acids while maintaining the ability of the protein to fluoresce.
[0098] HEK293T cells were transfected with SEQ ID NO: 5 as follows. 27,000 cells per well in 100 L of EMEM media were plated onto Greiner 96-well plates coated with poly-D lysine. The cells were incubated for 24 hours at 37 C. and 5% CO.sub.2. The cells were transfected with 100 ng of plasmid DNA expressing SEQ ID NO: 5 using FUGENE as follows. 100 ng of DNA was combined with 0.4 L of FUGENE and 47.6 L of OPTIMEM serum-free media and incubated for 20 mins at 25 C. then added to the cells. After 16 hours the cells were treated with a final concentration of 1 M thapsigargin (to induce ER stress) or a DMSO control (vehicle control) for 5 hours. The green fluorescence was then imaged using a Zeiss Axiovert fluorescence microscope and standard GFP excitation and emission filters.
[0099]
Example 5
Multiplex FRET Biosensor Construct to Detect Cell Stress, Intracellular Signaling, and Apoptosis
[0100]
[0101] As shown in
[0102] If a cell is committed to die via apoptosis, caspases expressed as part of the apoptotic signaling pathway would then recognize and cleave the caspase cleavage site in the translated FRET fusion protein, eliminating the FRET response of the fusion protein (see
Example 6
Signal Reversibility of Multiplex Fluorescent Stress Sensor Construct
[0103] A second nucleic acid construct (SEQ ID NO: 6) was constructed and tested. This nucleic acid construct is a red fluorescent protein (RFP) with a nuclear localization sequence, placed upstream of the XBP1 intron sequence. A T2A peptide encoding sequence is placed after the RFP sequence. This is followed by a partial sequence from the endogenous XBP1 gene that encodes a region of the protein important for regulating its stability. This partial XBP1 sequence is fused to the mNeonGreen coding sequence. Upon stress activation the XBP1 intron sequence is removed, this removes a stop codon, shifts the reading frame, and allows for translation of the XBP1-mNeonGreen fusion construct. This construct was transfected into HEK293T cells, which were then treated with 1 M thapsigargin or DMSO vehicle control to induce ER stress. Isolated mRNA from the treated cells was then analyzed for intron splicing using RT-PCR (see van Schadewijk et al., 2012).
[0104] HEK293T cells were transduced with 25 L of the nucleic acid construct of SEQ ID NO: 6. The construct was transduced into 48,000 HEK293T cell in FluoroBrite media and the cells were incubated at 37 C. and 5% CO.sub.2 for 16 hours. A final concentration of 1 M thapsigargin was added to the cells. For RT-PCR analysis a total of 2 g of total RNA was isolated form 6 wells of cells grown on 96-well Greiner plates coated in poly-D-lysine. RNA was isolated using the Zymo Quick RNA microprep kit according to the manufacturer's instructions. mRNA was converted to cDNA by reverse transcription using M-MLV reverse transcriptase from Promega and an oligo dT primer according to the manufacturer's instructions. RNA was isolated at 30 minutes, 2.5 hours, 6 hours, and 24 hours after treatment with thapsigargin. After cDNA conversion primers spanning the XBP1 intron sequence specific to the biosensor were used to determine the level of XBP1 splicing at each time point. PCR products were then analyzed on a 2% agarose gel. Cells were also imaged at the same time points used to collect RNA for RT-PCR analysis. All images were obtained using a Zeiss Axiovert fluorescence microscope with standard RFP and GFP excitation and emission filter sets. The red and green images were overlaid in Fiji image analysis software. To continuously monitor cells treated with thapsigargin over 24 hours HEK293T cells were transduced and treated with either DMSO or thapsigargin as described above. The media was supplemented with 25 mM HEPES and the cells were incubated in the BioTek Synergy MX plate reader at 37 C. for 24 hours. Green fluorescence was monitored using excitation and emission wavelengths of 485 nm and 528 nm respectively, while red fluorescence was monitored using 558 nm/603 nm excitation and emission wavelengths. All wavelengths had a bandpass of 20 nm. The percentage of change in green, red, and green/red ratio fluorescence was then calculated.
[0105]
[0106]
[0107] The experiments above show that the addition of this sequence instills the reversible nature of the sensor. The reversibility of the signal by the biosensor is important for two at least two reasons. First, the biosensor can detect both the onset and recovery from ER stress, allowing the sensor to be used for both the detection of stress-inducing compounds or mutations, as well as compounds that reverse ER-mediated cell stress. Second, the biosensor allows kinetic monitoring of stress onset and recovery. When screening drug compounds or testing new compounds for ER-stress activation the kinetics of ER stress activation and cellular recovery are important. Accordingly, fluorescent biosensors disclosed herein can be used to determine both in a single assay.
[0108] Without being bound by theory, the reversibility of the XBP1-mNeonGreen signal likely comes from the fact that the XBP1 spliced protein (XBP1s) is an unstable version of XBP1. Stability for the endogenous version of XBP1 is regulated first by binding of the unspliced version of XBP1 to the spliced version, which causes the spliced version to relocate to the cytoplasm from the nucleus and be degraded (see, e.g., Yoshida et al. 2006). The second mechanism that stabilizes the spliced version of XBP1 is the binding of the UBC9 protein to the leucine zipper domain (residues 93-133) of XBP1. In this instance UBC9 binds to the leucine zipper domain and stabilizes the XBP1s protein form by preventing its degradation (see, e.g., Uemura et al. 2013).
[0109] In the case of the sensor described in Example 6 (RFP-XBP1-mNeonGreen), residues 123-189 of the unspliced form of XBP1 protein are used in the construct. This version of XBP1 in the construct is unstable and rapidly degraded (see Yoshida et al. 2006). Under the endogenous mechanism the XBP1 leucine zipper domain stabilizes XBP1s after its splicing and protects it from being bound by the unspliced form, exclusion from the nucleus, and degradation. As the XBP1 sequence in the construct of SEQ ID NO: 6 does not contain this leucine zipper domain, it is not stabilized by UBC9 and thus still subject to binding by the unspliced XBP1 isoform, removal from the nucleus, and degradation by the proteasome. Importantly, as SEQ ID NO: 6 does not encode the full length XBP1 protein, it is only the endogenous XBP1 protein of the transfected cell that is regulating degradation of the XBP1-mNeonGreen protein. This means that the XBP1-mNeonGreen protein is responding to the endogenous state of ER stress. Endogenous XBP1 from the cell's ER stress response continually clears the XBP1-mNeonGreen fusion protein from the nucleus for degradation in the cytosol. As ER stress decreases and endogenous XBP1 is no longer mobilized, the XBP1-mNeonGreen protein is also not created by mRNA splicing. This results in a decrease in the cellular XBP1-mNeonGreen protein to undetectable levels when measuring fluorescence intensity, as any remaining XBP1-mNeonGreen is degraded.
Example 7
Determining Percentage of ER-Stressed Cells in a Population
[0110] The two-color biosensor described in Example 5 above (RFP-GFP stress sensor; SEQ ID NO: 6) may be used to calculate the percent of cells undergoing ER stress, and may be used as measurement technique to detect side effects induced by chemotherapeutics. In order to determine the percentage of cells in population experiencing ER-stress following exposure to a ER-stress-inducing compound, iPSC-derived peripheral neurons were transduced with the two-color stress sensor described in Example 5 above. The cells were treated with the chemotherapeutic vincristine at concentrations of 0.0001 M, 0.01 M, and 0.1 M. Measurement of the red fluorescence was used to identify transduced cells and measurement of green fluorescence identifies stressed cells. Stressed and unstressed cells were counted to quantify the percentage of stressed cells in the population.
[0111] Peri.4U peripheral neurons from Ncardia were plated onto 96-well plates according to the manufacturer's instructions. Cells were incubated for 2 days at 37 C. and 5% CO.sub.2 and the media was changed every 24 hours, using Ncardia neuro supplement media. Cells were then transduced with 25 L of the two-color cell stress sensor (SEQ ID NO:6) and incubated for 16 hours. Varying concentrations of the chemotherapeutic vincristine or DMSO were added to the cells in 8 replicates for each condition. After 24 hours of incubation with the drug, a final concentration of 1 mM crystal Ponceau 6R was added to the cells and they were imaged as described above in Example 5. Image analysis in Cellprofiler was used to determine the percentage of stressed cells in each condition. Those cells that expressed both the constitutively expressed red nuclear marker and the green, stress induced, nuclear fluorescence were considered stressed, while those only expressing the red marker were considered unstressed. The percentage of stressed in each condition was also used to determine EC50 values for vincristine.
[0112]
[0113]
[0114] The data from
[0115] This method of calculating an EC50 for stress-induction was compared with another technique that measures inhibition of neurite growth by cells in response to compound exposures. Peripheral neurons derived from iPSCs were treated with the chemotherapeutic compounds vincristine (a microtubule-interfering agent), docetaxel (a microtubule stabilizing agent), oxaloplatin, and carboplatin (platinum DNA adducts), and neurite growth inhibition was measured using the methods described in Rana et al., 2017, to calculate an IC50. Images were captured and analysis was performed after 24 h of drug treatment and drug treated cultures were compared to time-matched, untreated controls. Image analysis was performed using the Neuronal Profiling version 4 bioapplication, and all fields were evaluated for each well. DAPI was used to identify and count individual nuclei in channel 1. IIItubulin was used in channel 2 to identify cell bodies and neurites by intensity. Cell bodies were not used for neurite detection if they contained>1 nucleus. The critical well level output parameters reported were Neuron Count per Valid Field (provides relative cell counts for cytotoxicity measurement), and Mean Neurite Total Length Ch2. Concentration-response plots were expressed as percent of time-matched controls (equivalent endpoints in untreated cultures) plotted as log of concentration vs. normalized response. IC50 values for each compound were generated using a non-linear regression model of the form Y=100/(1+10{circumflex over ()}((Log IC50.X)* Hillslope))), constrained between 0 and 100% of the time matched controls.
[0116]
[0117] The EC50 values determined using the cell stress sensor are very similar to the inhibitory concentrations (IC50) values determined using the neurite outgrowth assay (data not shown). For the chemotherapeutic compound oxaloplatin, the stress sensor is two orders of magnitude more sensitive that neurite outgrowth.
Example 8
Detecting Genetically Induced ER-Stress
[0118] The biosensors described herein can be used to simultaneously monitor changes in both ER-mediated stress and overall protein expression. As stress-inducing mutations or stress caused by chemical compounds can often change protein expression within the cell having indicators of both stress and protein expression is important for determining actual causes of cellular stress.
[0119] To analyze ER-mediated stress and protein expression, HEK293T cells were transfected with the RFP-GFP stress sensor described above in Example 6, along with plasmids encoding either the wild type or a mutant version of a gene selected from rhodopsin, alpha-synuclein, and superoxide dismutase 1 (SOD1). The green and red fluorescence of the transfected cells was measured, and the ratio of green to red fluorescence was calculated.
[0120] HEK293T cells were transfected with SEQ ID NO: 6 and either wild type or mutant versions of rhodopsin, SOD or alpha-synuclein genes as follows. 27,000 cells per well in 100 L of FluoroBrite media were plated onto Greiner 96-well plates coated with poly-D lysine. The cells were incubated for 24 hours at 37 C. and 5% CO.sub.2. The cells were then transfected with 100 ng of each plasmid using LIPOFECTAMINE 2000 according to the manufacturer's instructions. The cells were incubated for 24 hours as described above. The green and red fluorescence for triplicate wells of cells expression the two-color stress sensor and either wild type or mutant versions of the rhodopsin, SOD1, or alpha-synuclein genes was then acquired using a BioTek Synergy MX plate reader. Green fluorescence was monitored using excitation and emission wavelengths of 485 nm and 528 nm respectively, while red fluorescence was monitored using 558/603 excitation and emission wavelengths. All wavelengths had a bandpass of 20 nm. The mean green, red and green/rad ratio fluorescence and standard deviation were then plotted for each condition.
[0121]
[0122] The red fluorescence is used to monitor overall changes in protein expression caused by expression of the mutant genes (middle bar graph of
[0123] The green/red fluorescence ratio measures the cumulative effects of changes in ER-stress and protein expression in the transfected cells. The mutant rhodopsin protein showed the greatest difference in cumulative effects.
[0124] The foregoing description is intended to illustrate but not to limit the scope of the disclosure, which is defined by the scope of the appended claims. Other embodiments are within the scope of the following claims.
REFERENCES
[0125] Ahrens et al. 2013. Whole-Brain Functional Imaging at Cellular Resolution Using Light-Sheet Microscopy. Nat. Methods 10(5):413-20. [0126] Akerboom et al. 2013. Genetically Encoded Calcium Indicators for Multi-Color Neural Activity Imaging and Combination with Optogenetics. Front Mol Neurosci. 6 (January): 1-29. [0127] Belmadani et al. 2017. The Unraveling Truth About IRE1 and MicroRNAs in Diabetes. Diabetes 66(1): 23-24. [0128] Berg et al., 2009. A genetically encoded fluorescent reporter of ATP:ADP ratio. Nat Methods. 6(2): 161-166. [0129] Bermejo et al. 2010. Dynamic analysis of cytosolic glucose and ATP levels in yeast using optical sensors. Biochem J. 432(2):399-406; [0130] Bibb et al. 2000. Severe Deficiencies in Dopamine Signaling in Presymptomatic Huntington's Disease Mice. Proc Natl Acad Sci USA. 97(12):6809-14. [0131] Bilan et al. 2013. HyPer-3: a genetically encoded H(2)O(2) probe with improved performance for ratiometric and fluorescence lifetime imaging. ACS Chem Biol. 8(3):535-42. [0132] Bilan et al. 2014. Genetically encoded fluorescent indicator for imaging NAD(+)/NADH ratio changes in different cellular compartments. Biochim Biophys Acta. 1840(3):951-7 [0133] Brette et al. 2017. A Novel Cardiotoxic Mechanism for a Pervasive Global Pollutant. Sci Rep 7 (January): 41476. [0134] Carlyle et al. 2014. cAMP-PKA Phosphorylation of Tau Confers Risk for Degeneration in Aging Association Cortex. Proc Natl Acad Sci USA 111(13): 5036-41. [0135] Chiu et al. 2015. Elucidating the Role of the A2A Adenosine Receptor in Neurodegeneration Using Neurons Derived from Huntington's Disease iPSCs. Hum Mol Genet 24(21): 6066-79. [0136] Cubillos-Ruiz et al. 2017. Tumorigenic and Immunosuppressive Effects of Endoplasmic Reticulum Stress in Cancer. Cell 168(4): 692-706. [0137] Dana et al. 2014. Thy1-GCaMP6 Transgenic Mice for Neuronal Population Imaging in Vivo. PloS One 9(9): e108697. [0138] Day and Davidson. 2009. The fluorescent protein palette: tools for cellular imaging. Chem Soc Rev. 2009 October; 38(10): 2887-2921. [0139] Dittmer et al. 2009. Genetically encoded sensors to elucidate spatial distribution of cellular zinc. J Biol Chem. 284(24): 16289-16297. [0140] Foufelle et al. 2016. Role of Endoplasmic Reticulum Stress in Drug-Induced Toxicity. Pharmacol Res Perspect 4(1): e00211. [0141] Gress et al. 2015. Cardiotoxic Electrophysiological Effects of the Herbicide ROUNDUP in Rat and Rabbit Ventricular Myocardium In Vitro. Cardiovasc Toxicol 15(4):324-35. [0142] Grootjans et al. 2016. The Unfolded Protein Response in Immunity and Inflammation. Nat Rev Immunol 16(8): 469-84. [0143] Gu et al. 2006. A novel analytical method for in vivo phosphate tracking. FEBS Lett. 580(25):5885-93 [0144] Halliday et al. 2014. Targeting the Unfolded Protein Response in Neurodegeneration: A New Approach to Therapy. Neuropharmacol 76 Pt A (January):169-74. [0145] Hebb et al. 2004. Striatal Phosphodiesterase mRNA and Protein Levels Are Reduced in Huntington's Disease Transgenic Mice prior to the Onset of Motor Symptoms. Neuroscience 123 (4): 967-81. [0146] Hung et al. 2011. Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor. Cell Metab. 14(4):545-54. [0147] Iwawaki et al. 2003. A Transgenic Mouse Model for Monitoring Endoplasmic Reticulum Stress. Nat Med 10(1): 98-102. [0148] Kaper et al. 2007. Nanosensor detection of an immunoregulatory tryptophan influx/kynurenine efflux cycle. PLoS Biol. 5(10):e257 [0149] Lager et al. 2006. Conversion of a putative Agrobacterium sugar-binding protein into a FRET sensor with high selectivity for sucrose. J Biol Chem 281(41):30875-83). [0150] Lindenburg et al. 2013. MagFRET: the first genetically encoded fluorescent Mg2+ sensor. PLoS One. 8(12):e82009. [0151] Marambaud et al. 2009. Calcium Signaling in Neurodegeneration. Mol Neurodegener 4 (May): 20. [0152] Moore et al. 2016. Cilia Have High cAMP Levels That Are Inhibited by Sonic Hedgehog-Regulated Calcium Dynamics. Proc Nat Acad Sci USA 113(46): 13069-74. [0153] Nikolaev et al. 2006. Fluorescent Sensors for Rapid Monitoring of Intracellular cGMP. Nat Methods 3(1): 23-25. [0154] Okumuto et al. 2005. Detection of glutamate release from neurons by genetically encoded surface-displayed FRET nanosensors. Proc Natl Acad Sci USA. 2005. 102(24):8740-5. [0155] Peschek et al. 2015. A Conformational RNA Zipper Promotes Intron Ejection during Non-conventional XBP1 mRNA Splicing. EMBO Reports 16(12): 1688-98. [0156] Pilkis et al. 1992. Molecular Physiology of the Regulation of Hepatic Gluconeogenesis and Glycolysis. Annu Rev Physiol 54: 885-909. [0157] Pluquet et al. 2015. The Unfolded Protein Response and Cellular Senescence. A Review in the Theme: Cellular Mechanisms of Endoplasmic Reticulum Stress Signaling in Health and Disease, Am J Physiol Cell Physiol 308(6): C415-25. [0158] Rana et al. 2017. Utilization of iPSC-derived human neurons for high-throughput drug-induced peripheral neuropathy screening. Toxicol In Vitro. 45(Pt 1):111-118 [0159] Rivolta et al. 2002. Retinitis Pigmentosa and Allied Diseases: Numerous Diseases, Genes, and Inheritance Patterns. Hum Mol Gen 11(10): 1219-27. [0160] Rodriguez et al. 2017. The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins. Trends Biochem Sci 42(2):111-29. [0161] Rong et al. 2015. Cell-Based High-Throughput Luciferase Reporter Gene Assays for Identifying and Profiling Chemical Modulators of Endoplasmic Reticulum Signaling Protein, IRE1. J Biomol Screen 20(10): 1232-45. [0162] San Martin et al. 2013. A genetically encoded FRET lactate sensor and its use to detect the Warburg effect in single cancer cells. PLoS One. 8(2):e57712 [0163] Santos et al. 2009. Mechanisms and Implications of Reactive Oxygen Species Generation during the Unfolded Protein Response: Roles of Endoplasmic Reticulum Oxidoreductases, Mitochondrial Electron Transport, and NADPH Oxidase. Antioxid Redox Signal 11(10): 2409-27. [0164] Scheper et al. 2015. The Unfolded Protein Response in Neurodegenerative Diseases: A Neuropathological Perspective. Acta Neuropathol 130(3):315-31. [0165] Shcherbakova et al. 2016. Bright monomeric near-infrared fluorescent proteins as tags and biosensors for multiscale imaging. Nat Commun 7:12405 [0166] Shaner et al. 2013. A Bright Monomeric Green Fluorescent Protein Derived from Branchiostoma Lanceolatum. Nat Methods 10 (5): 407-9. [0167] Shaner et al. 2005. A Guide to Choosing Fluorescent Proteins. Nat Methods 2(12):905-9. [0168] Storace et al. 2016. Toward Better Genetically Encoded Sensors of Membrane Potential. Trends Neurosci. 39(5):277-89. [0169] Sugars et al. 2004. Decreased cAMP response element-mediated transcription: an early event in exon 1 and full-length cell models of Huntington's disease that contributes to polyglutamine pathogenesis. J Biol Chem 279(6):4988-99. [0170] Sung et al. 1991. Functional Heterogeneity of Mutant Rhodopsins Responsible for Autosomal Dominant Retinitis Pigmentosa. Proc Natl Acad Sci USA 88(19):8840-44. [0171] Szymczak et al. 2004. Correction of Multi-Gene Deficiency in Vivo Using a Single Self-Cleaving 2A Peptide-based Retroviral Vector. Nat Biotechnol 22(5):589-94. [0172] Talbert et al. 2015. A Multi-Parameter in Vitro Screen in Human Stem Cell-Derived Cardiomyocytes Identifies Ponatinib-Induced Structural and Functional Cardiac Toxicity. Toxicol Sci 143(1):147-55. [0173] Tallini et al. 2006. Imaging Cellular Signals in the Heart in Vivo: Cardiac Expression of the High-Signal Ca.sup.2+ Indicator GCaMP2. Proc Natl Acad Sci USA 103(12):4753-58. [0174] Tewson et al. 2016. New DAG and cAMP Sensors Optimized for Live-Cell Assays in Automated Laboratories. J Biomol Screen 21(3): 298-305. [0175] Uemura et al. 2013. UBC9 Regulates the Stability of XBP1, a Key Transcription Factor Controlling the ER Stress Response. Cell Struct Funct 38 (1): 67-79. [0176] van Schadewijk et al. 2012. A quantitative method for detection of spliced X-box binding protein-1 (XBP1) mRNA as a measure of endoplasmic reticulum (ER) stress. Cell Stress Chaperones 17(2):275-279. [0177] Wang et al. 2012. The Impact of the Unfolded Protein Response on Human Disease. J Cell Biol 197(7):857-67. [0178] Xu et al. 1999. A bioluminescence resonance energy transfer (BRET) system: application to interacting circadian clock proteins. Proc Natl Acad Sci USA 96:151-6. [0179] Yoshida et al. 2001. XBP1 mRNA Is Induced by ATF6 and Spliced by IRE1 in Response to ER Stress to Produce a Highly Active Transcription Factor. Cell 107(7): 881-91. [0180] Yoshida et al. 2006. pXBP1(U) Encoded in XBP1 Pre-mRNA Negatively Regulates Unfolded Protein Response Activator pXBP1(S) in Mammalian ER Stress Response. J Cell Biol 172 (4): 565-75. [0181] Zhao et al. 2011. An Expanded Palette of Genetically Encoded Ca.sup.2+ Indicators. Science 333 (6051): 1888-91. [0182] JP2004081143A [0183] US20040170622A1 [0184] US20050250182A1 [0185] US20100221743A1 [0186] US20110142799 [0187] US20110142799A1 [0188] U.S. Pat. No. 9,085,791B2 [0189] U.S. Pat. No. 9,547,017B2