Glutamate dehydrogenase mutants and their application in preparation of L-phosphinothricin
10865391 ยท 2020-12-15
Assignee
Inventors
- Lirong Yang (Zhejiang, CN)
- Xinjian Yin (Zhejiang, CN)
- Jianping Wu (Zhejiang, CN)
- Gang Xu (Zhejiang, CN)
Cpc classification
C12Y104/01003
CHEMISTRY; METALLURGY
C12Y104/01004
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to glutamate dehydrogenase mutants and their application in preparation of L-phosphinothricin. The amino acid sequences of the glutamate dehydrogenase mutants are as shown in SEQ ID NO. 1-9, 11, 13, 15, 17-19 and 22. By means of molecular engineering, mutating the specific alanine in glutamate dehydrogenase substrate-binding pocket into glycine and/or mutating the specific valine in glutamate dehydrogenase substrate-binding pocket into alanine, the present invention has obtained NADPH-specific glutamate dehydrogenase mutants with high enzyme activity in catalyzing the substrate 2-oxo-4-[(hydroxy)(methyl)phosphinoyl]butyric acid or its salt for L-phosphinothricin preparation or NADH-specific glutamate dehydrogenase mutants with catalytic activity toward PPO; this has significantly improved substrate conversion, and increased the product concentration of the L-phosphinothricin preparation process.
Claims
1. A method of catalyzing 2-oxo-4-[(hydroxy)(methyl)phosphinoyl]butyric acid or its salt for L-phosphinothricin preparation, comprising: (1) Prepare genetically engineered strain expressing glutamate dehydrogenase mutant; amino acid sequence of the glutamate dehydrogenase mutant is SEQ ID NO. 1, 2, 5, 7 and 8; (2) Culture the genetically engineered strain, and prepare enzyme solution; (3) Add the enzyme solution into a reaction system containing the substrate 2-oxo-4-[(hydroxy)(methyl)phosphinoyl]butyric acid, amino donor and reduced coenzyme to start a reductive amination reaction to prepare L-phosphinothricin.
2. The method according to claim 1, wherein in Step (3) temperature of the reductive amination reaction is 15-60 C., and pH value of the reaction mixture is 5-10.
3. The method according to claim 1, wherein in Step (3) the reduced coenzyme is NADPH or NADH.
4. The method according to claim 1, wherein the reaction system in Step (3) further comprises: coenzyme regeneration enzyme, comprising glucose dehydrogenase, alcohol dehydrogenase or formate dehydrogenase; and coenzyme regeneration substrate, comprising glucose, isopropanol or formate, wherein the reduced coenzyme includes NAD(P)H and NAD(P).sup.+.
5. The method according to claim 4, wherein the coenzyme regeneration system in the reaction system is a glucose dehydrogenase coenzyme regeneration system; amino sequence of the glucose dehydrogenase is SEQ ID NO. 21.
6. The method according to claim 1, wherein the amino donor in Step (3) is ammonia sulfate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3) Wherein,
(4)
(5) Wherein,
(6)
(7)
(8) Wherein, retention time is stated as follows: 6.3 min for L-phosphinothricin and 7.2 min for D-phosphinothricin.
(9)
(10) M: protein marker; 1: PpGluDH wild type; 2: A167G; 3: V378A
(11)
(12) Wherein, A167 and V378 (PpGluDH numbering) are marked with black arrow.
(13)
DESCRIPTION OF THE EMBODIMENTS
(14) The present invention is further described as follows in combination with preferred embodiments. It is to be understood that the following embodiments only aim to explain the present invention, which will not restrict the scope of the present invention.
(15) Unless specified otherwise, experiment methods as stated in the present invention are conventional methods; for gene cloning, please refer to Molecular Cloning: A Laboratory Manual by J. Sambrook et al.
(16) Reagents for genetic engineering operations: DNA polymerase (PrimeSTAR Max DNA Polymerase) and Dpn I used in embodiments of the present invention were purchased from TaKaRa, Bio (Dalian, China) Co., Ltd; Plasmid Miniprep Kit was purchased from Axygen Co., Ltd (Hangzhou, China); E. coli BL21(DE3), plasmid and so on are purchased from Novagen; primer synthesis and gene sequencing were carried out by TsingKe Bio-Tech Co., Ltd (Hangzhou, China). For use method of aforesaid reagents, please refer to product specifications.
(17) The recombinant E. coli carrying glutamate dehydrogenase gene used in the present invention is constructed and kept by our laboratory. The vector used is pET-28a(+), and the host used is E. coli BL21(DE3). NI-NTA resin (HisPur Ni-NTA Resin) used for protein purification is purchased from Thermo Scientific; protein purification is carried out in reference to specifications.
(18) Reagents used for catalytic process: 2-oxo-4-[hydroxy)(methyl)phosphinoyl]butyric acid (PPO) is artificially synthesized, of which MS spectra and NMR spectra are as shown in
(19) The reaction process is monitored by measuring the concentration of substrate in the reaction solution applying high-performance liquid chromatography (HPLC). HPLC analysis method is stated as follows: column model: Pntulips QS-C18, 5 m, 4.6 mm250 mm. Mobile phase: 50 mM (NH.sub.4).sub.2HPO.sub.4, added 1% of 10% tetrabutyl ammonium hydroxide, adjusted to pH 3.6 with 50% phosphoric acid(mass fraction), added 8% acetonitrile. Detective wave length is 205 nm; flow rate is 1.0 mL/min. Column temperature is 40 C. The retention time of substrate is as shown in
(20) The enantiomeric excess and concentration of product are determined through pre-column derivatization high-performance liquid chromatography; the specific analysis method is stated as follows:
(21) (1) HPLC condition: column model: Pntulips QS-C18, 5 m, 4.6 mm250 mm. Mobile phase: 50 mM Sodium acetate: Acetonitrile=8: 0.5 (v/v). Detective wave length: 338 nm. Flow rate: 0.85 mL/min. Column temperature: 30 C.
(22) (2) Derivatization reagent: Weigh 0.03 g phthalaldehyde and 0.1 g N-acetyl-L-cysteine, and use 400 uL ethanol for solubilization; after that, add 4 mL 0.2 mol/L borate buffer (pH 9.8) and shake for dissolution prior to storage in the fridge under the temperature of 4 C. (no more than 4 days).
(23) (3) Derivatization reaction and analysis: Add 150 L derivatization reagent into 100 L sample, mix and incubate at 25 C. for 5 min, and then inject 20 L for analysis.
(24) The retention time of D-phosphinothricin and L-phosphinothricin is as shown in
Embodiment 1
Engineering of Glutamate Dehydrogenase from Pseudomonas putida and Catalytic Activity Determination
Step 1: Activation of Recombinant Strain and Plasmid Extraction
(25) Use LB medium for activation and culture of recombinant Escherichia coli carrying the gene of glutamate dehydrogenase from Pseudomonas putida (PpGluDII) (NCBI Accession No.: NP_742836.1).
(26) Specific formula for LB culture medium is stated as follows: peptone 10 g/L, yeast powder 5 g/L, NaCl 10 g/L, dissolved in deionized water, and then sterilized at 121 C. for 20 min. Solid culture medium is formed by adding 2% agar into LB liquid medium.
(27) The preserved PpGluDH recombinant strain is streaked onto the plate containing LB solid medium, and culture at 37 C. for 12 h. Single colony is picked and inoculated into 5 mL LB liquid medium containing 50 g/mL kanamycin, and then cultured at 200 rpm under the temperature of 37 C. for 12 h. Once the culture is obtained, the plasmid is extracted according to specifications of plasmid extraction kit. The plasmid obtained can be directly used for follow-up operations or store at 20 C. for a long time.
Step 2: Site-Directed Mutagenesis
(28) Design specific primers (Table 1), mutate the alanine at 167-site and the valine at 378-site in the amino acid sequence of PpGluDH to glycine (A167G) and alanine (V378A), respectively.
(29) TABLE-US-00001 TABLE1 PrimersforSite-directedMutationofPpGluDH Primer Sequence(5to3).sup.a A167G-F ACGTACCGGGTGGTGACATCGGTGTGGGGG SEQIDNO.23 A167G-R ATGTCACCACCCGGTACGTCGCAGTCAGCA SEQIDNO.24 V378A-F CGGGCGGCGCAGCCGTGTCGGGCCTGGAAA SEQIDNO.25 V378A-R GACACGGCTGCGCCGCCCGCATTGGAGGCC SEQIDNO.26 Note: underlined codon encodes desired amino acid substitution
(30) Take plasmid extracted in previous step as the template, and use Quickchange site-directed mutagenesis protocol (An efficient one-step site-directed and site-saturation mutagenesis protocol[J]. Nucleic Acids Research, 2004, 32(14):e115) to introduce mutation; the PCR system and conditions are stated as follows:
(31) PCR System:
(32) TABLE-US-00002 DNA polymerase 25 L; Upstream primer (10 pmol/L) 1.5 L; Downstream primer (10 pmol/L) 1.5 L; Plasmid template 1.0 L; ddH.sub.2O 21 L.
(33) PCR Conditions:
(34) 1) Pre-denaturation: 98 C. 2 min;
(35) 2) Denaturation: 98 C. 15 s; annealing: 58 C. 10 s; elongation: 72 C. 2 min; total 30 cycles;
(36) 3) Extension: 72 C. 10 min;
(37) 4) Storage under the temperature of 4 C.
(38) After PCR amplification, the amplified product is digested with Dpn I for 3 h to remove the template plasmids; the digestion product is transformed into E. coli BL21(DE3) competent cell, and then plated on LB agar plates. Pick single colonies to LB medium for culture, and then sequence to verify the correctness of the mutation. The positive mutants are stored at 80 C. until for further use.
Step 3: Cell Culture and Crude Enzyme Preparation
(39) The preserved recombinant E. coli is streaked onto the plate for activation. Single colonies are picked and inoculated into 5 mL LB liquid medium containing 50 g/mL kanamycin and cultured at 37 C. for 12 h. The culture is transferred to 50 mL fresh LB liquid medium containing 50 g/mL kanamycin at a 2% inoculum, and then incubated at 37 C. until the OD.sub.600 reaches 0.6; after that, add IPTG to a final concentration of 0.5 mM, and then proceed with induction culture under the temperature of 18 C. for 16 h.
(40) After the cultivation, the culture is centrifuged at 10000 rpm for 10 min; discard supernatant, and collect cells. The harvested cells are washed for 2 times using pH 7.5 50 mM phosphate buffer. After that, the cells are re-suspend into the pH 7.5 phosphate buffer and disrupted ultrasonically (400W for 30 times, Ultrasonic time is 3 s, and the interval is 7 s). The cell disrupted solution is centrifuged at 12000 g for 5 min at 4 C. to remove the precipitate, and the supernatant obtained is the crude enzyme containing recombinant glutamate dehydrogenase
Step 4: Measurement of Enzyme Activity
(41) The standard enzyme activity measurement system: Appropriate amount of enzyme, 100 mM substrate, 10 mM coenzyme (NADH or NADPH), 500 mM NH.sub.4.sup.+ ((NH.sub.4).sub.2SO.sub.4); total system volume is up to 400 L; reaction medium is pH 7.5 phosphate buffer. 35 C. reaction for 10 min; after that, add 40 uL 5 M NaOH to terminate reaction.
(42) Definition of enzyme activity unit: The quantity of enzyme as required by generation of 1 mol L-phosphinothricin per minute under standard reaction conditions.
(43) Enzyme activity (per volume fermentation broth) of wild type PpGluDH and mutants (PpGluDH-A167G and PpGluDH-V378A) obtained by the aforesaid engineering method has been measured with aforesaid enzyme activity measurement method. Enzyme activity of wild type PpGluDH is 0.11 U/mL; Enzyme activity of PpGluDH-A167G is 14.85 U/mL, which is 135 times higher than that of wild type; activity of PpGluDH-V378A is 13.3 U/mL, which is 121 times higher than that of wild type.
(44) Meanwhile, specific activity of pure enzyme obtained through purification has also been measured. As measured, specific activity of pure protein of wild type PpGluDH is 0.31 U/mg; specific activity of PpGluDH-A167G is 38.13 U/mg, which is 123 times higher than that of wild type; specific activity of PpGluDH-V378A is 35.96 U/mg, which is 116 times higher than that of wild type.
Step 5: Construction of Combinatorial Mutant and Measurement of Enzyme Activity
(45) Proceed with activation and plasmid extraction for PpGluDH-A167G mutant; after that, mutation is introduced by Quickchange site-directed mutagenesis protocol using primer V378A-F/V378A-R; specific methods are as shown in Step 2; combinatorial mutant of PpGluDH-A167G/V378A (SEQ ID NO. 22) has been constructed. Induction culture of the combinatorial mutant strain has been carried out as per Step 3 and Step 4, and enzyme activity has been measured. As measured, enzyme activity (per volume fermentation broth) of PpGluDH-A167G/VA78A is 13.85 U/mL, which is 126 times higher than that of wild type. Comparative Embodiment 1
(46) The catalytic activity of wild type PpGluDH and mutants toward other keto acid substrates has been measured by spectrophotometry. Compared with the wild type, mutants have exhibited reduced catalytic activity to most of substrates (2-8a, 10-11a and 13a) For 2-ketoglutarate (1 a) and 2-ketohexanoic acid (9a), PpGluDH-A167G and PpGluDH-V378A have exhibited improved catalytic activity; for 2-oxo-4-phenylbutyric acid (12a), catalytic activity of PpGluDH-A167G has been improved to some extent; whereas catalytic activity of PpGluDH-V378A decreased.
(47) TABLE-US-00003 TABLE 2 Catalytic activity of wild type PpGluDH and mutants toward other keto acid substrates
Embodiment 2
Step 1: Selection of Glutamate Dehydrogenases
(48) Select 9 glutamate dehydrogenases of different sources, different coenzyme specificity and different homology with PpGluDH to perform the same protein engineering (for details, please refer to Table 2). Wherein, CgGluDH, PeGluDH and LsGluDH belong to NADPH-specific glutamate dehydrogenases; GsGluDH, BsGluDH, BmGluDH, LsGluDH, CsGluDH and BtGluDH belong to NADH-specific glutamate dehydrogenases.
(49) TABLE-US-00004 TABLE 2 The GluDHs selected for applicability evaluation Homology Coenzyme Designation Source (%) NCBI Accession No. Specificity PpGluDH pseudomonas putida 100 NP_742836.1 NADPH CgGluDH corynebacterium glutamicum 59.0 NP_601279.1 PeGluDH Pseudomonas entomophila 93.8 WP_044487662.1 LsGluDHp Lysinibacillus sphaericus 54.8 WP_012293812.1 GsGluDH Geobacillus stearothermophilus 29.8 WP_033013982.1 NADH BsGluDH Bacillus subtilis 28.8 NP_391659.2 BmGluDH Bacillus megaterium 28.2 WP_013084905.1 LsGluDH Lysinibacillus sphaericus 29.8 WP_012292398.1 CsGluDH Clostridium symbiosum 53.4 WP_003497202.1 BtGluDH Brevibacillus thermoruber 29.7 WP_029099571.1 Note: The sequence homology was measured with the amino acid sequence of PpGluDH as reference.
Step 2: Identification of Corresponding Mutation Sites and Construction of Mutants
(50) Use online software T-Coffee for multiple sequence alignment to target amino acid residues (
(51) From the alignment result, it can be found that the two amino acid residues (
(52) TABLE-US-00005 TABLE3 Glutamatedehydrogenasemutantstobeconstructed Codonvariation (Before mutation.fwdarw.after Aminoacid Designation Mutant mutation) sequence CgGluDH A166G GCA.fwdarw.GGT SEQIDNO.3 V376A GTT.fwdarw.GCA SEQIDNO.4 PeGluDH A164G GCC.fwdarw.GGT SEQIDNO.5 V375A GTG.fwdarw.GCA SEQIDNO.6 LsGluDHp A175G GCT.fwdarw.GGT SEQIDNO.7 V386A GTT.fwdarw.GCA SEQIDNO.8 GsGluDH A153G GCG.fwdarw.GGT SEQIDNO.9 V354A GTG.fwdarw.GCA SEQIDNO.10 BsGluDH A154G GCT.fwdarw.GGT SEQIDNO.11 V355A GTC.fwdarw.GCA SEQIDNO.12 BmGluDH A156G GCG.fwdarw.GGT SEQIDNO.13 V357A GTA.fwdarw.GCA SEQIDNO.14 LsGluDH A144G GCA.fwdarw.GGT SEQIDNO.15 V345A GTT.fwdarw.GCA SEQIDNO.16 CsGluDH A164G GCA.fwdarw.GGT SEQIDNO.17 V378A GTT.fwdarw.GCA SEQIDNO.18 BtGluDH A155G GCA.fwdarw.GGT SEQIDNO.19 V356A GTA.fwdarw.GCA SEQIDNO.20
Step 3: Construction of Mutants and Measurement of Enzyme Activity
(53) Proceed with induction culture of constructed mutants, and prepare crude enzyme solution. Catalytic activity of such mutants toward PPO has been measured based on standard enzyme activity measurement system; results are as shown in Table 4.
(54) TABLE-US-00006 TABLE 4 Enzyme activity measurement result of the mutants Enzyme activity Enzyme activity of wild type of mutants Fold Designation (U/mL) Mutant (U/mL) change CgGluDH 0.011 A166G 0.34 31 V376A 2.48 225 PeGluDH 0.103 A164G 11.29 110 V375A 11.06 107 LsGluDHp 0.021 A175G 34.47 1641 V386A 12.34 588 GsGluDH N.D. A153G 0.04 V354A N.D. BsGluDH N.D. A154G 0.50 V355A N.D. BmGluDH N.D. A156G 0.34 V357A N.D. LsGluDH N.D. A144G 1.69 V345A N.D. CsGluDH N.D. A164G 2.61 V378A 1.76 BtGluDH N.D. A155G 0.50 V356A N.D. Note: N.D. = no detectable activity
(55) From the results of the enzyme activity measurement, it can be found that for NADPH-specific glutamate dehydrogenases, both A167G and V378A mutations (PpGluDH numbering) could significantly improve the catalytic activity toward PPO, and the highest activity increase is up to 1641-fold.
(56) For NADH-specific glutamate dehydrogenases, mutation of A167G ((PpGluDH numbering) could increase their PPO activity from zero of wild type to considerable values.
Embodiment 3
Preparation of L-phosphinothricin by Coupling Wild Type Glutamate Dehydrogenase (PpGluDH) with Glucose Dehydrogenase
(57) Culture recombinant E. coli expressing glutamate dehydrogenase (PpGluDH) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(58) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NADP.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 1.0 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(59) Data upon completion of reaction is stated as follows: residual PPO is 447 mM; substrate conversion is 10.6%. The concentration of formed L-phosphinothricin is 8.7 g/L; ee value >99%.
Embodiment 4
Preparation of L-phosphinothricin by Coupling Glutamate Dehydrogenase Mutant (PpGluDH-A167G) with Glucose Dehydrogenase
(60) Culture recombinant E. coli expressing glutamate dehydrogenase (PpGluDH-A167G, SEQ ID NO. 1) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(61) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NADP.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 1.0 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(62) Data upon completion of reaction is stated as follows: residual PPO is 0.9 mM; substrate conversion is 99.8%. The concentration of formed L-phosphinothricin is 83.7 g/L; ee value >99%.
Embodiment 5
Preparation of L-phosphinothricin by Coupling Glutamate Dehydrogenase Mutant (PpGluDH-V378A) with Glucose Dehydrogenase
(63) Culture recombinant E. coli expressing glutamate dehydrogenase (PpGluDH-V378AG, SEQ ID NO. 2) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(64) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NADP.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 1.0 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(65) Data upon completion of reaction is stated as follows: residual PPO is 1.2 mM; substrate conversion is 99.8%. The concentration of formed L-phosphinothricin is 81.9 g/L; ee value >99%.
Embodiment 6
Preparation of L-phosphinothricin by Coupling Wild Type Glutamate Dehydrogenase (LsGluDHp) with Glucose Dehydrogenase
(66) Culture recombinant E. coli expressing glutamate dehydrogenase (LsGluDHp) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(67) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NADP.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 0.5 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(68) Data upon completion of reaction is stated as follows: residual PPO is 481 mM; substrate conversion is 3.8%. The concentration of formed L-phosphinothricin is 0.87 g/L; ee value >99%.
Embodiment 7
Preparation of L-phosphinothricin by Coupling Glutamate Dehydrogenase Mutant (LsGluDHp-A175G) with Glucose Dehydrogenase
(69) Culture recombinant E. coli expressing glutamate dehydrogenase (LsGluDHp-A175G, SEQ ID NO. 7) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(70) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NADP.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 0.5 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(71) Data upon completion of reaction is stated as follows: residual PPO is 0 mM; substrate conversion is 100%. The concentration of formed L-phosphinothricin is 82.4 g/L; ee value >99%.
Embodiment 8
Preparation of L-phosphinothricin by Coupling Glutamate Dehydrogenase Mutant (LsGluDHp-A175G) with Alcohol Dehydrogenase
(72) Culture recombinant E. coli expressing glutamate dehydrogenase (LsGluDHp-A175G, SEQ ID NO. 7) and alcohol dehydrogenase (TBADH, WP_041589967.1) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(73) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 750 mM isopropanol, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NADP.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 0.5 g/L; concentration of alcohol dehydrogenase cells (dry weight) is 2.5 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 12 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(74) Data upon completion of reaction is stated as follows: residual PPO is 1.3 mM; substrate conversion is 99.7%. The concentration of formed L-phosphinothricin is 81.3 g/L; ee value >99%.
Embodiment 9
Preparation of L-phosphinothricin by Coupling Wild Type Glutamate Dehydrogenase (CsGluDH) with Glucose Dehydrogenase
(75) Culture recombinant E. coli expressing glutamate dehydrogenase (CsGluDH) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(76) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NAD.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 1.25 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(77) Data upon completion of reaction is stated as follows: residual PPO is 491.3 mM; substrate conversion is 1.7%. The concentration of formed L-phosphinothricin is 1.63 g/L; ee value >99%.
Embodiment 10
Preparation of L-phosphinothricin by Coupling Glutamate Dehydrogenase Mutant (CsGluDH-A164G) with Glucose Dehydrogenase
(78) Culture recombinant E. coli expressing glutamate dehydrogenase (CsGluDH-A164G, SEQ ID NO. 17) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(79) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NAD.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 1.25 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(80) Data upon completion of reaction is stated as follows: residual PPO is 0 mM; substrate conversion is 100%. The concentration of formed L-phosphinothricin is 79.6 g/L; ee value >99%.
Embodiment 11
Preparation of L-phosphinothricin by Coupling Glutamate Dehydrogenase Mutant (CsGluDH-V378A) with Glucose Dehydrogenase
(81) Culture recombinant E. coli expressing glutamate dehydrogenase (CsGluDH-V378A, SEQ ID NO. 18) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(82) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NAD.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 1.25 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 35 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 12 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(83) Data upon completion of reaction is stated as follows: residual PPO is 1.8 mM; substrate conversion is 99.6%. The concentration of formed L-phosphinothricin is 78.5 g/L; ee value >99%.
Embodiment 12
Preparation of L-phosphinothricin by Coupling Wild Type Glutamate Dehydrogenase (BtGluDH) with Glucose Dehydrogenase
(84) Culture recombinant E. coli expressing glutamate dehydrogenase (BtGluDH) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(85) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NAD.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 1.25 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 50 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(86) Data upon completion of reaction is stated as follows: residual PPO is 493.1 mM; substrate conversion is 1.4%. The concentration of formed L-phosphinothricin is 0 g/L; ee value >99%.
Embodiment 13
Preparation of L-phosphinothricin by Coupling Glutamate Dehydrogenase Mutant (BtGluDH-A155G) with Glucose Dehydrogenase
(87) Culture recombinant E. coli expressing glutamate dehydrogenase (BtGluDH-A155G, SEQ ID NO. 19) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 21) with method in Step 3 of Embodiment 1; proceed with centrifugal collection of cells and ultrasonic cell disruption to prepare crude enzyme solution.
(88) The final volume of the reaction is 30 mL; each sample contains 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4 and 0.5 mM NAD.sup.+. Concentration of glutamate dehydrogenase cells (dry weight) is 1.25 g/L; concentration of glucose dehydrogenase cells (dry weight) is 1.25 g/L. Use water bath to control the reaction temperature at 50 C.; titrate ammonia to control pH at 7.5 during the reaction process. Use non-chiral HPLC to determine residual concentration of PPO after reaction for 6 h; meanwhile, use pre-column derivatization HPLC to determine the concentration and ee value of formed L-phosphinothricin.
(89) Data upon completion of reaction is stated as follows: residual PPO is 1.4 mM; substrate conversion is 99.7%. The concentration of formed L-phosphinothricin is 80.3 g/L; ee value >99%.