Alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohols

Abstract

The present disclosure discloses an alcohol dehydrogenase mutant and application thereof in synthesis of diaryl chiral alcohols, and belongs to the technical field of bioengineering. The alcohol dehydrogenase mutant of the present disclosure has excellent catalytic activity and stereoselectivity, and may efficiently catalyze the preparation of a series of chiral diaryl alcohols in R- and S-configurations. By coupling alcohol dehydrogenase of the present disclosure to glucose dehydrogenase or formate dehydrogenase, the synthesis of chiral diaryl alcohol intermediates of various antihistamines may be achieved. Compared with the prior art, a method for preparing diaryl chiral alcohols through asymmetric catalytic reduction using the alcohol dehydrogenase of the present disclosure has the advantages of simple and convenient operation, high substrate concentration, complete reaction and high product purity, and has great industrial application prospects.

Claims

1. An alcohol dehydrogenase mutant, wherein the alcohol dehydrogenase mutant comprises an amino acid sequence having all of SEQ ID NO:2 except for: (a) a substitution of glycine for glutamic acid at position 214 of SEQ ID NO:2; (b) a substitution of glycine for glutamic acid at position 214 and a substitution of cysteine for serine at position 237 of SEQ ID NO:2; (c) a substitution of glycine for glutamic acid at position 214, a substitution of cysteine for serine at position 237, and a substitution of asparagine for glutamine at position 136 of SEQ ID NO:2; (d) a substitution of glycine for glutamic acid at position 214, a substitution of cysteine for serine at position 237, a substitution of asparagine for glutamine at position 136, and a substitution of glycine for serine at position 196 of SEQ ID NO:2; (e) a substitution of glycine for glutamic acid at position 214, a substitution of cysteine for serine at position 237, a substitution of asparaginate asparagine for glutamine at position 136, a substitution of glycine for serine at position 196, and a substitution of valine for phenylalanine at position 161 of SEQ ID NO:2; or (f) a substitution of valine for glutamic acid at position 214, and a substitution of serine for threonine at position 215 of SEQ ID NO:2, and wherein the alcohol dehydrogenase mutant has alcohol dehydrogenase activity.

2. An alcohol dehydrogenase mutant, wherein an amino acid sequence of the alcohol dehydrogenase mutant comprises all of SEQ ID NO:2, except for: (a) mutation of amino acid glutamine to asparagine at position 136, (b) mutation of amino acid phenylalanine to valine at position 161, (c) substitution of amino acid serine at position 196 with glycine, (d) substitution of amino acid glutamic acid at position 214 with glycine, (e) mutation of amino acid threonine to serine at position 215, or (f) substitution of amino acid serine at position 237 with cysteine, and wherein the alcohol dehydrogenase mutant has alcohol dehydrogenase activity.

3. A method for producing chiral (4-chlorophenyl)-(pyridin-2-yl)-methanol (CPMA) which comprises: combining the alcohol dehydrogenase mutant of claim 1 at a concentration of 1 to 10 kU/L with prochiral (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK) at a concentration of 10 to 500 mM, and NADP.sup.+ at a concentration of 0.1 to 1.0 mM; adding a coenzyme circulation system comprising glucose dehydrogenase at a concentration of 1 to 10 kU/L, D-glucose at a concentration of 20 to 1000 mM, and a phosphate buffer; incubating the coenzyme circulation system with the alcohol dehydrogenase mutant, CPMK, and NADP.sup.+ at 30 to 35 C. and a pH of 6 to 8 for 1 to 24 hours to produce CPMA; and extracting the CPMA by adding an organic solvent after an asymmetric reduction reaction; wherein the coenzyme circulation system further comprises: (i) phosphite and phosphite dehydrogenase (FTDH), (ii) formic acid and formate dehydrogenase (FDH), (iii) lactic acid and lactate dehydrogenase (LDH), or (iv) glycerol and glycerol dehydrogenase.

4. A method for producing chiral (4-chlorophenyl)-(pyridin-2-yl)-methanol (CPMA), which comprises: combining the alcohol dehydrogenase mutant of claim 2 at a concentration of 1 to 10 kU/L with prochiral (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK) at a concentration of 10 to 500 mM, and NADP.sup.+ at a concentration of 0.1 to 1.0 mM; adding a coenzyme circulation system comprising glucose dehydrogenase is at a concentration of 1 to 10 kU/L, D-glucose at a concentration of 20 to 1000 mM, and a phosphate buffer; incubating the coenzyme circulation system with the alcohol dehydrogenase mutant, CPMK, and NADP.sup.+ at 30 to 35 C. and a pH of 6 to 8 for 1 to 24 hours to produce CPMA; and extracting the CPMA by adding an organic solvent after an asymmetric reduction reaction; wherein the coenzyme circulation system further comprises: (i) phosphite and phosphite dehydrogenase (FTDH), (ii) formic acid and formate dehydrogenase (FDH), (iii) lactic acid and lactate dehydrogenase (LDH), or (iv) glycerol and glycerol dehydrogenase.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 is a whole plasmid PCR nucleic acid electrophoretogram of wild type and alcohol dehydrogenase mutants M1 to M7.

(2) FIG. 2 is SDS-PAGE analysis of alcohol dehydrogenase mutants M1 to M7, respectively.

(3) FIG. 3 is a chiral liquid chromatogram of a product produced from CPMK reduction catalyzed by an alcohol dehydrogenase mutant M6.

(4) FIG. 4 is a chiral liquid chromatogram of a product produced from CPMK reduction catalyzed by an alcohol dehydrogenase mutant M7.

DETAILED DESCRIPTION

(5) The present disclosure will be described in detail below by means of specific Examples, but this does not limit the present disclosure to the scope of the described Examples. The experimental methods without indicated specific experimental conditions in the following Examples may be selected according to conventional methods and conditions, or according to the specification.

Example 1: Method for Measuring Activity of Alcohol Dehydrogenase

(6) Adopting a total reaction system of 200 L including: 1.0 mM NADPH, 1.0 mM substrate CPMK and sodium phosphate buffer (PBS, 100 mM, pH 7.0), fully and evenly mixing, maintaining at 30 C. for 2 min, adding an appropriate amount of enzyme solution, and detecting the change in light absorption at 340 nm.

(7) The enzyme activity was calculated by the following formula:
Enzyme activity (U)=EWV10.sup.3/(62201);

(8) in the formula, EW is the change in absorbance at 340 nm in 1 min; V is the volume of a reaction solution in mL; 6220 is the molar extinction coefficient of NADPH in L/(mol.Math.cm); and 1 is the optical path distance in cm. One activity unit (U) corresponds to the amount of enzyme required to catalyze the oxidation of 1 mol NADPH per minute under the above conditions.

(9) Method for determining optical purity ee:

(10) $\mathrm{ee}=\frac{\mathrm{AS}-\mathrm{AR}}{\mathrm{AS}+\mathrm{AR}}100\%;$

(11) As: molar concentration of (S)-CPMA obtained by liquid chromatography; and A.sub.R: molar concentration of (R)-CPMA obtained by liquid chromatography.

Example 2: Construction of Alcohol Dehydrogenase Mutant Gene and Recombinant Expression Transformant

(12) A whole plasmid PCR method was used for site-directed mutagenesis on amino acid residues at positions 136, 161, 196, 214, 215 and 237 to construct an iterative combination mutant. The primer design was as follows (all described in the 5-3 direction, and the underline represents the mutation site):

(13) M1 (using pET28a-KpADH recombinant plasmid as a template):

(14) TABLE-US-00001 E214G-F: (SEQIDNO.3) AAGAAACTAAATGGTACTTGT; E214G-R: (SEQIDNO.4) AATTTCACAAGTACCATTTAG;

(15) M2 (using pET28a-KpADH recombinant plasmid as a template):

(16) TABLE-US-00002 E214V-F: (SEQIDNO.5) AAGAAACTAAATGTTACTTGT; E214V-R: (SEQIDNO.6) AATTTCACAAGTAACATTTAG;

(17) M3 (using M1 recombinant plasmid as a template):

(18) TABLE-US-00003 S237C-F: (SEQIDNO.7) AAGACTCACTTCTGTCAATTC; S237C-R: (SEQIDNO.8) ATCAATGAATTGACAGAAGTG;

(19) M4 (using M3 recombinant plasmid as a template):

(20) TABLE-US-00004 Q136N-F: (SEQIDNO.9) ACCCCACATAGAAATAATGAT; Q136N-R: (SEQIDNO.10) AGTTGGATCATTATTTCTATG;

(21) M5 (using M4 recombinant plasmid as a template):

(22) TABLE-US-00005 S196G-F: (SEQIDNO.11) ACTATCCACCCAGGTTTCGTT; S196G-R: (SEQIDNO.12) TCCGAAAACGAAACCTGGGTG;

(23) M6 (using M5 recombinant plasmid as a template):

(24) TABLE-US-00006 F161V-F: (SEQIDNO.13) TATGAAAATGTCGTTACTGCT; F161V-R: (SEQIDNO.14) ACAATAAGCAGTAACGACATT;

(25) M7 (using pET28a-KpADH recombinant plasmid as a template):

(26) TABLE-US-00007 E214V/T215S-F: (SEQIDNO.15) AAGAAACTAAATGTTAGCTGTGAA; E214V/T215S-R: (SEQIDNO.1+) GATAATTTCACAGCTAACATTTAG;

(27) M8 (using pET28a-KpADH.sub.Q136N recombinant plasmid as a template):

(28) TABLE-US-00008 F161V-F: (SEQIDNO.17) TATGAAAATGTCGTTACTGCT; F161V-R: (SEQIDNO.18) ACAATAAGCAGTAACGACATT;

(29) M9 (using pET28a-KpADH.sub.S196G recombinant plasmid as a template):

(30) TABLE-US-00009 S237C-F: (SEQIDNO.19) AAGACTCACTTCTGTCAATTC; S237C-R: (SEQIDNO.20) ATCAATGAATTGACAGAAGTG.

(31) A PCR reaction system was: a PCR reaction system (50 L) including KOD enzyme (2.5 U/mL) 1.0 L, template (5-50 ng) 1.0 L, dNTP 4.0 L, 10 reaction buffer 5.0 L, forward primer 1.0 L, reverse primer 1.0 L, and the rest of ddH2O to make the reaction system 50 L in total.

(32) A PCR amplification procedure was: (1) denaturation at 94 C. for 3 min, (2) denaturation at 94 C. for 30 sec, (3) annealing at 54 C. for 30 sec, (4) extension at 72 C. for 150 sec, repeating steps (2) to (4) for 10-15 cycles, finally extension at 72 C. for 10 min, and storing a PCR amplification product at 4 C.

(33) After PCR, DpnI restriction enzyme was added into a reaction mixture and incubated at 37 C. for 1 h, 10 L digested PCR reaction solution was transferred into 50 L E. coli BL21 (DE3) competent cells through CaCl.sub.2 thermal transformation, and the cells were used to uniformly coat an LB agar plate containing 50 g/mL kanamycin sulfate for inversion culture at 37 C. for 12 h.

Example 3: Expression and Purification of Alcohol Dehydrogenase and Mutant Thereof

(34) Recombinant Escherichia coli carrying a stereoselective improvement mutant was inoculated into an LB medium containing kanamycin sulfate (50 g/mL) at a transfer amount of 2% for shake cultivation at 37 C. and 200 rpm, 0.2 mM isopropyl--D-thiogalactofuranoside (IPTG) was added for induction at 25 C. when the absorbance OD.sub.600 of the medium reached 0.8, after 8 hours of induction, a strain for efficient expression of a recombinant alcohol dehydrogenase mutant was obtained through 10 minutes of centrifugation at 8000 rpm, and the collected strain was suspended in a potassium phosphate buffer (100 mM, pH 6.0) for ultrasonication.

(35) A column used for purification was a nickel affinity column HisTrap FF crude, and purification was achieved through affinity chromatography using a histidine tag on recombinant protein. The nickel column was equilibrated with a solution A first, a crude enzyme solution was loaded, a penetrating peak was further eluted off using the solution A, and after equilibrium, a solution B (20 mM sodium phosphate, 500 mM NaCl, and 1000 mM imidazole, pH 7.4) was used for gradient elution to elute off the recombinant protein bound to the nickel column, so as to obtain the recombinant alcohol dehydrogenase mutant. The purified protein was subjected to activity measurement (CPMK as substrate, and NADPH as coenzyme) and SDS-PAGE analysis. After purification of the nickel column, a single band was displayed at around 45 kDa, and the amount of impure protein was small, indicating that the column purification effect was good. The purified alcohol dehydrogenase protein was then replaced into a Tris-HCl (100 mM, pH 7.0) buffer using a Hi Trap Desalting column (GE Healthcare).

Example 4: Kinetic and Stereoselective Analysis of Alcohol Dehydrogenase Mutant

(36) The activity of KpADH at different substrate concentrations and coenzyme concentrations was determined, and a double reciprocal curve was made based on the reciprocal of activity and substrate concentration to calculate kinetic parameters.

(37) It can be seen from Table 1 that the k.sub.cat/K.sub.m of KpADH to CPMK was 28.9 s.sup.1.Math.mM.sup.1, the reduction product configuration was R configuration, and the ee value was 82.5%. The stereoselectivity of (R)-CPMA synthesized by mutants M2 and M7 was increased, and the ee values of the products were 92.3% and 99.1% respectively. Mutant M1 showed a reduced stereoselectivity, the reduction product configuration was also R configuration, and the ee value of the product was 3.29%. Mutants M3, M4, M5 and M6 showed an inverted stereoselectivity, the reduction products were in the S configuration, and the ee values of the products were 51.8%, 88.0%, 93.5% and 97.8% respectively. The reduction products of the control examples M8 and M9 were in the R configuration, the ee values of the products were little different from that of the wild type KpADH, and the mutation had no effect on the stereoselectivity of the enzyme.

(38) TABLE-US-00010 TABLE 1 Kinetic parameters and stereoselectivity of alcohol dehydrogenase mutant Vmax Kcat/Km Km (mol .Math. min.sup.1 .Math. Kcat (s.sup.1 .Math. ee Config. Enzyme (mM) mg.sup.1) (s.sup.1) mM.sup.1) (%) (R/S) KpADH 0.410 17.9 11.8 28.9 82.5 R M1 0.52 11.1 7.32 14.1 3.29 R M2 0.574 17.5 11.7 14.2 92.3 R M3 0.632 9.32 6.16 9.74 51.8 S M4 0.861 10.2 6.76 7.85 88.0 S M5 0.72 21.3 17.0 23.6 93.5 S M6 1.12 25.2 20.1 17.9 99.8 S M7 0.702 21.3 14.2 20.3 99.9 R M8 (control 0.604 22.3 14.8 24.6 83.5 R example) M9 (control 0.730 26.5 17.6 24.1 81.7 R example)

Example 5: Substrate Specificity Analysis of Alcohol Dehydrogenase Mutant

(39) The reduction on prochiral carbonyl compounds by the alcohol dehydrogenase mutants obtained in Example 2 was studied, and the studied prochiral carbonyl compounds include (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK), phenyl-(pyridin-2-yl)-methanone, (4-chlorophenyl)-(phenyl)-methanone, (4-bromophenyl)-(phenyl)-methanone, (4-fluorophenyl)-(pyridin-2-yl)-methanone, (4-methoxyphenyl)-(phenyl)-methanone, acetophenone, 4-chloroacetophenone and 2-(4-chlorophenyl)acetyl chloride.

(40) TABLE-US-00011 TABLE 2 Substrate specificity of alcohol dehydrogenase mutant M8 M9 Substrate WT M1 M2 M3 M4 M5 M6 M7 (control) (control) 81.9 (R) 24.2 (R) 92.3 (R) 65.4 (S) 80.6 (S) 87.7 (S) 99.8 (S) 99.9 (R) 83.5 (R) 81.7 (R) 26.3 (R) 41.0 (R) 30.6 (R) 36.5 (R) 20.7 (R) 15.5 (R) 6.81 (S) 11.9 (R) 22.3 (R) 42.3 (R) 71.4 (S) 63.2 (S) 87.9 (S) 33.2 (R) 38.6 (R) 62.0 (R) 91.7 (R) 99.4 (S) 52.4 (S) 78.4 (S) 69.2 (S) 49.3 (S) 95.5 (S) 63.3 (R) 66.5 (R) 70.9 (R) 95.1 (R) 99.6 (S) 70.2 (S) 59.2 (S) 25.3 (R) 7.51 (R) 0.56 (S) 45.6 (R) 49.1 (R) 59.5 (R) 64.2 (R) 9.22 (S) 55.3 (R) 67.3 (R) 14.9 (R) 42.7 (R) 23.2 (R) 80.6 (R) 82.6 (R) 81.7 (R) 95.1 (R) 45.7 (S) 24.5 (R) 49.1 (R) 59.2 (R) 68.5 (R) 45.3 (R) 95.3 (R) 91.5 (R) 95.6 (R) 95.3 (R) 51.3 (R) 66.2 (R) 49.7 (R) 67.1 (R) 86.3 (R) 94.9 (R) 88.9 (R) 57.7 (R) 49.1 (R) 82.1 (R) 95.1 (R) 77.1 (R) 47.3 (R) 77.8 (R) 94.5 (R) 91.2 (S) 99.8 (R) 99.3 (R) 99.9 (R) 99.9 (R) 77.5 (R) 57.2 (R) 42.8 (R)

(41) As can be seen from Table 2, compared with WT, the combined mutant M6 obtained by iterative combination mutation had an inverse stereoselectivity for (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK), 4-bromophenyl-(pyridin-2-yl)-methanone and 4-methoxy-(phenyl)-methanone, and the ee values of products were all 95% or above; the mutant M6 had the same stereoselectivity as the wild type for 2-(4-chlorophenyl)acetyl chloride, and the ee values of products were all 99% or above; and the mutant M7 had the same stereoselectivity as WT for (4-chlorophenyl)-(pyridin-2-yl)-methanone (CPMK), and (4-bromophenyl)-(phenyl)-methanone, and the ee values of products were over 99%. Experiments have shown that the combination mutant strains obtained through iterative combination mutation had high R- and S-stereoselectivity for aryl ketone, especially large sterically hindered diaryl ketone substrates, and may be used as biocatalysts for preparation of R- and S-configuration chiral aryl alcohol intermediates.

Example 6: Preparation of (S)-CPMA and (R)-CPMA Through Asymmetric Reduction of CPMK by Alcohol Dehydrogenase Mutant

(42) A 20 mL biocatalytic system was established: 100 mM potassium phosphate buffer (pH 7.0), and the alcohol dehydrogenase mutants M6 and M7 obtained in Example 2 as well as wild KpADH 10 g/L, CPMK 100 mM, 200 mM and 500 mM were added (substrate added in batches). The reaction was performed at 30 C. and 200 rpm for 12 h with a constant pH of 7.5.

(43) The conversion rate analysis results during the reaction are shown in Table 3, Table 4 and Table 5. It can be seen that both the wild type dehydrogenase and the mutants M6 and M7 may asymmetrically reduce 100 mM and 200 mM CPMK. When the CPMK concentration was 200 mM, the wild type KpADH and the two mutants (M6 and M7) required 12 h and 24 h respectively to achieve a conversion rate close to 99.9%. The final reduction product of the wild type KpADH was (R)-CPMA, and the ee value was 82%; the final reduction product of the mutant M6 was (S)-CPMA, and the ee value was 99.5%; and the final reduction product of the mutant M7 was (R)-CPMA, and the ee value was 99.7%. The obtained crude products of (R)-CPMA and (S)-CPMA were redissolved in ethanol, and corresponding pure products of (R)-CPMA and (S)-CPMA were added as seed crystals to recrystallize at 4 C. to finally obtain products with optical purity greater than 99.9% ee.

(44) TABLE-US-00012 TABLE 3 Asymmetric reduction of CPMK catalyzed by wild type alcohol dehydrogenase KpADH Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 47.76 25.6 11.7 2 77.9 36.9 20.1 3 87.1 50.5 44.8 4 96.5 62.8 59.6 6 98.7 85.3 80.2 8 99.6 97.4 93.2 12 >99.9 99.4 95.6 24 >99.9 99.7 99.2

(45) TABLE-US-00013 TABLE 4 Asymmetric reduction of CPMK catalyzed by alcohol dehydrogenase mutant M6 Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 24.6 19.1 12.8 2 54.6 36.4 22.1 3 69.4 52.8 30.6 4 80.2 70.6 65.3 6 95.2 89.7 77.9 8 97.2 92.2 87.6 12 98.2 95.4 90.2 24 99.6 99.2 99.5

(46) TABLE-US-00014 TABLE 5 Asymmetric reduction of CPMK catalyzed by alcohol dehydrogenase mutant M7 Conversion rate (%) Reaction time (h) 100 mM 200 mM 500 mM 1 34.0 20.9 10.8 2 40.8 33.1 21.1 3 41.5 48.1 38.7 4 46.5 55.2 43.2 6 58.7 77.4 62.1 8 69.0 86.3 70.7 12 99.7 92.2 89.9 24 99.7 99.7 99.4

(47) From this, it is understood that the alcohol dehydrogenase mutant enzymes M6 and M7 of the present disclosure have very good performance in terms of efficient, highly stereoselective asymmetric reduction of CPMK.