Oligomeric compounds comprising α-β-constrained nucleic acid

10865413 · 2020-12-15

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure provides oligomeric compounds comprising at least one --constrained nucleic acid as provided herein. More particularly, the --constrained nucleic acid provided herein comprise an optionally modified nucleoside with a phosphorus containing constrained internucleoside linkage such as for example a cyclic phosphate internucleoside linkage. The --constrained nucleic acid provided herein are expected to be useful for enhancing one or more properties of oligomeric compounds they are incorporated into such as for example nuclease resistance. In certain embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.

Claims

1. An antisense gapped oligomeric compound comprising: a first region of from 1 to about 5 contiguous monomer subunits; a second region of from 1 to about 5 contiguous monomer subunits; and a third region located between the first and second region comprising from 6 to about 14 monomer subunits; wherein each monomer subunit in the first and second region is, independently, a modified nucleoside and each monomer subunit in the third region is, independently, a nucleoside or a modified nucleoside other than the modified nucleosides in the first and second region and wherein the third region comprises at least one modified nucleotide having Formula III: ##STR00077## wherein independently for each modified nucleotide having Formula III: T.sub.5 is one of the monomer subunits; T.sub.6 is an internucleoside linking group attached to one of the monomer subunits; each Bx is a heterocyclic base moiety; each G.sub.1 and G.sub.2 is, independently, H, OH or a 2-sugar substituent group; each X or each Z is CJ.sub.1J.sub.2, NJ.sub.1, S or O and the other of each X or each Z is O; each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl or C.sub.2-C.sub.6 alkynyl; and n is from 1 to about 3.

2. The gapped oligomeric compound of claim 1 wherein each X is O.

3. The gapped oligomeric compound of claim 1 wherein each X is CJ.sub.1J.sub.2.

4. The gapped oligomeric compound of claim 1 wherein each X is CH.sub.2.

5. The gapped oligomeric compound of claim 1 wherein each X is S.

6. The gapped oligomeric compound of claim 1 wherein each X is NJ.sub.1.

7. The gapped oligomeric compound of claim 6 wherein each J.sub.1 is H or CH.sub.3.

8. The gapped oligomeric compound of claim 1 wherein each Z is O.

9. The gapped oligomeric compound of claim 1 wherein each Z is CJ.sub.1J.sub.2.

10. The gapped oligomeric compound of claim 1 wherein each Z is CH.sub.2.

11. The gapped oligomeric compound of claim 1 wherein each Z is S.

12. The gapped oligomeric compound of claim 1 wherein each Z is NJ.sub.1.

13. The gapped oligomeric compound of claim 12 wherein each J.sub.1 is H or CH.sub.3.

14. The gapped oligomeric compound of claim 1 wherein for each modified nucleotide of Formula III, one of G.sub.1 and G.sub.2 is H and the other of G.sub.1 and G.sub.2 is, independently, selected from halogen and O[C(R.sub.1)(R.sub.2)].sub.i[(CO).sub.m-A].sub.j-T; each R.sub.1 and R.sub.2 is, independently, H, C.sub.1-C.sub.6 alkyl or halogen; A is O, S or N(E.sub.1); T is C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or N(E.sub.2)(E.sub.3); E.sub.1, E.sub.2 and E.sub.3 are each, independently, H, C.sub.1-C.sub.6 alkyl or substituted C.sub.1-C.sub.6 alkyl; i is from 1 to about 6; m is 0 or 1; j is 0 or 1; wherein each substituted group comprises one or more optionally protected substituent groups independently selected from halogen, OJ.sub.3, N(J.sub.3)(J.sub.4), =NJ.sub.3, SJ.sub.3, N.sub.3, CN, OC(=L.sub.2)J.sub.3, OC(=L.sub.2)N(J.sub.3)(J.sub.4) and C(=L.sub.2)N(J.sub.3)(J.sub.4); L.sub.2 is O, S or NJ.sub.5; each J.sub.3, J.sub.4 and J.sub.5 is, independently, H or C.sub.1-C.sub.6 alkyl; and when j is 1 then T is other than halogen.

15. The gapped oligomeric compound of claim 1 wherein for each modified nucleotide of Formula III, one of G.sub.1 and G.sub.2 is H and the other of G.sub.1 and G.sub.2 is, independently, selected from F, OCH.sub.3, O(CH.sub.2).sub.2OCH.sub.3 or OCH.sub.2C(O)N(H)CH.sub.3.

16. The gapped oligomeric compound of any of claim 1 wherein each G.sub.2 is H.

17. The gapped oligomeric compound of claim 1 wherein for each modified nucleotide of Formula III, G.sub.1 is O(CH.sub.2).sub.2OCH.sub.3 and G.sub.2 is H.

18. The gapped oligomeric compound of claim 1 wherein each G.sub.1 and G.sub.2 is H.

19. The gapped oligomeric compound of claim 1 wherein for each modified nucleotide of Formula III, X and Z are each O and G.sub.1 and G.sub.2 are each H.

20. The gapped oligomeric compound of claim 1 wherein each Bx is, independently, an optionally protected pyrimidine, substituted pyrimidine, purine or substituted purine.

Description

DETAILED DESCRIPTION OF THE INVENTION

(1) Provided herein are novel --constrained nucleic acid and oligomeric compounds prepared therefrom. The novel --constrained nucleic acid are expected to be useful for enhancing one or more properties of the oligomeric compounds they are incorporated into such as for example nuclease resistance. In certain embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.

(2) In certain embodiments, the --constrained nucleic acid provided herein are incorporated into antisense oligomeric compounds which are used to reduce target RNA, such as messenger RNA, in vitro and in vivo. The reduction of target RNA can be effected via numerous pathways with a resultant modulation of gene expression. Such modulation can provide direct or indirect increase or decrease in a particular target (nucleic acid or protein). Such pathways include for example the steric blocking of transcription or translation and cleavage of mRNA using either single or double stranded oligomeric compounds. The oligomeric compounds provided herein are also expected to be useful as primers and probes in diagnostic applications. In certain embodiments, oligomeric compounds comprising at least one region of --constrained nucleic acid as provided herein are expected to be useful as aptamers which are oligomeric compounds capable of binding to aberrant proteins in an in vivo setting.

(3) In certain embodiments, oligomeric compounds are provided comprising at least one modified nucleotide having Formula I:

(4) ##STR00009##
wherein independently for each modified nucleotide having Formula I:

(5) each Bx is a heterocyclic base moiety;

(6) each G.sub.1 and G.sub.2 is, independently, H, OH or a 2-sugar substituent group;

(7) one of each X and each Z is CJ.sub.1J.sub.2, NJ.sub.2, S or O and the other of each X and each Z is O;

(8) each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl or C.sub.2-C.sub.6 alkynyl;

(9) each n is, independently, from 1 to about 30; and

(10) when Z is O and X is O then at least one G.sub.1 and G.sub.2 is other than H, OH or OCH.sub.3 and when Z is O and X is CH.sub.2 or S then at least one G.sub.1 and G.sub.2 is other than H.

(11) In certain embodiments, antisense gapped oligomeric compounds are provided comprising:

(12) a first region of from 1 to about 5 contiguous monomer subunits;

(13) a second region of from 1 to about 5 contiguous monomer subunits; and

(14) a third region located between the first and second region comprising from 6 to about 14 monomer subunits;

(15) wherein each monomer subunit in the first and second region is, independently, a modified nucleoside and each monomer subunit in the third region is, independently, a nucleoside or a modified nucleoside other than the modified nucleosides in the first and second region and wherein the third region comprises at least one modified nucleotide having Formula I:

(16) ##STR00010##
wherein independently for each modified nucleotide having Formula I:

(17) each Bx is a heterocyclic base moiety;

(18) each G.sub.1 and G.sub.2 is, independently, H, OH or a 2-sugar substituent group;

(19) each X or each Z is CJ.sub.1J.sub.2, NJ.sub.1, S or O and the other of each X or each Z is O;

(20) each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl or C.sub.2-C.sub.6 alkynyl; and

(21) n is from 1 to about 3.

(22) In certain embodiments, a modified nucleotide having Formula I is prepared by reaction of a phosphoramidite with an intermediate that will provide the cyclic internucleoside linkage and a 5 monomer subunit which is the residue of the phosphoramidite. The use of any phosphoramidite provides for inclusion of numerous different monomer subunits into a modified nucleotide having Formula I. In certain embodiments, other reactive phosphorus groups as known in the art can be used in place of a phosphoramidite group to affect the coupling. Numerous examples of such couplings are provided herein.

(23) The modified nucleotides having Formula I can encompass the entirety of the oligomeric compound such that each internucleoside linkage is a cyclic constrained phosphate or analog thereof as provided herein or can be incorporated as dimers (single cyclic linkage), trimers (two cyclic linkages) or larger blocks at predetermined positions within an oligomeric compound. The variability of incorporation of the blocks having the cyclic internucleoside linkages coupled with the various chemical modifications that can be applied to each of these blocks provide a broad platform for the preparation of oligomeric compounds designed for specific applications. As illustrated in the example section, the stereochemistry of various sites can also be optimized for a specific target or application.

(24) Incorporation of one or more region of --constrained nucleic acid, as provided herein, into an oligomeric compound is expected to enhance one or more desired properties of the resulting oligomeric compound. Such properties include without limitation stability, nuclease resistance, binding affinity, specificity, absorption, cellular distribution, cellular uptake, charge, pharmacodynamics and pharmacokinetics.

(25) As used herein the term motif refers to the pattern created by the relative positioning of monomer subunits within an oligomeric compound wherein the pattern is determined by comparing the sugar moieties of the linked monomer subunits. The only determinant for the motif of an oligomeric compound is the differences or lack of differences between the sugar moieties. The internucleoside linkages, heterocyclic bases and further groups such as terminal groups are not considered when determining the motif of an oligomeric compound. One or more region(s) of --constrained nucleic acid as provided herein can be used in any portion of a motif. Only the 2-sugar substituent groups present on the sugar groups of the --constrained nucleic acid define the motif not the internucleoside linkages.

(26) The preparation of motifs has been disclosed in various publications including without limitation, representative U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922; and published international applications WO 2005/121371 and WO 2005/121372 (both published on Dec. 22, 2005), certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

(27) In certain embodiments, the --constrained nucleic acid provided herein are incorporated into oligomeric compounds such that a motif results. The placement of --constrained nucleic acid into oligomeric compounds to provide particular motifs can enhance the desired properties of the resulting oligomeric compounds for activity using various mechanisms such as for example RNaseH or RNAi. Such motifs include without limitation, gapmer motifs, hemimer motifs, blockmer motifs, uniformly fully modified motifs, positionally modified motifs and alternating motifs. In conjunction with these motifs a wide variety of internucleoside linkages can also be used including but not limited to phosphodiester and phosphorothioate internucleoside linkages which can be incorporated uniformly or in various combinations. The oligomeric compounds can further include terminal groups at one or both of the 5 and or 3 terminals such as a conjugate or reporter group. The positioning of the --constrained nucleic acid provided herein, the use of linkage strategies and terminal groups can be easily optimized to enhance a desired activity for a selected target.

(28) As used herein the term alternating motif refers to an oligomeric compound comprising a contiguous sequence of linked monomer subunits wherein the monomer subunits have two different types of sugar moieties that alternate for essentially the entire sequence of the oligomeric compound. Oligomeric compounds having an alternating motif can be described by the formula: 5-A(-L-B-L-A).sub.n(-L-B).sub.nn-3 where A and B are monomer subunits that have different sugar moieties, each L is, independently, an internucleoside linking group, n is from about 4 to about 12 and nn is 0 or 1. The heterocyclic base and internucleoside linkage is independently variable at each position. The motif further optionally includes the use of one or more other groups including but not limited to capping groups, conjugate groups and other 5 and or 3-terminal groups. This permits alternating oligomeric compounds from about 9 to about 26 monomer subunits in length. This length range is not meant to be limiting as longer and shorter oligomeric compounds are also amenable to oligomeric compounds provided herein. In certain embodiments, each A or each B comprise --constrained nucleic acid as provided herein.

(29) As used herein the term uniformly fully modified motif refers to an oligomeric compound comprising a contiguous sequence of linked monomer subunits that each have the same type of sugar moiety. The heterocyclic base and internucleoside linkage is independently variable at each position. The motif further optionally includes the use of one or more other groups including but not limited to capping groups, conjugate groups and other 5 and or 3-terminal groups. In certain embodiments, the uniformly fully modified motif includes a contiguous sequence of --constrained nucleic acid as provided herein. In certain embodiments, one or both of the 5 and 3-ends of the contiguous sequence of --constrained nucleic acid, comprise 5 and or 3-terminal groups such as one or more unmodified nucleosides.

(30) As used herein the term hemimer motif refers to an oligomeric compound comprising a contiguous sequence of monomer subunits that each have the same type of sugar moiety with a further short contiguous sequence of monomer subunits located at the 5 or the 3 end that have a different type of sugar moiety. The heterocyclic base and internucleoside linkage is independently variable at each position. The motif further optionally includes the use of one or more other groups including but not limited to capping groups, conjugate groups and other 5 and or 3-terminal groups. In general, a hemimer is an oligomeric compound of uniform sugar moieties further comprising a short region (1, 2, 3, 4 or about 5 monomer subunits) having uniform but different sugar moieties located on either the 3 or the 5 end of the oligomeric compound.

(31) In certain embodiments, the hemimer motif comprises a contiguous sequence of from about 10 to about 28 monomer subunits having one type of sugar moiety with from 1 to 5 or from 2 to about 5 monomer subunits having a second type of sugar moiety located at one of the termini. In certain embodiments, the hemimer is a contiguous sequence of from about 8 to about 20 -D-2-deoxyribonucleosides having a region of --constrained nucleic acid comprising from 1-12 linked nucleosides located at one of the termini. In certain embodiments, the hemimer is a contiguous sequence of from about 8 to about 20 -D-2-deoxyribonucleosides having a region of --constrained nucleic acid located at one of the termini. In certain embodiments, the hemimer is a contiguous sequence of from about 12 to about 18 -D-2-deoxyribonucleosides having a region of --constrained nucleic acid located at one of the termini. In certain embodiments, the hemimer is a contiguous sequence of from about 10 to about 14 (-D-2-deoxyribonucleosides having a region of --constrained nucleic acid located at one of the termini.

(32) As used herein the terms blockmer motif and blockmer refer to an oligomeric compound comprising an otherwise contiguous sequence of monomer subunits wherein the sugar moieties of each monomer subunit is the same except for an interrupting internal block of contiguous monomer subunits having a different type of sugar moiety. The heterocyclic base and internucleoside linkage is independently variable at each position of a blockmer. The motif further optionally includes the use of one or more other groups including but not limited to capping groups, conjugate groups and other 5 or 3-terminal groups. A blockmer overlaps somewhat with a gapmer in the definition but typically only the monomer subunits in the block have non-naturally occurring sugar moieties in a blockmer and only the monomer subunits in the external regions have non-naturally occurring sugar moieties in a gapmer with the remainder of monomer subunits in the blockmer or gapmer being -D-2-deoxyribonucleosides or 3-D-ribonucleosides. In certain embodiments, blockmers are provided herein wherein all of the monomer subunits comprise non-naturally occurring sugar moieties.

(33) As used herein the term positionally modified motif is meant to include an otherwise contiguous sequence of monomer subunits having one type of sugar moiety that is interrupted with two or more regions of from 1 to about 5 contiguous monomer subunits having another type of sugar moiety. Each of the two or more regions of from 1 to about 5 contiguous monomer subunits are independently uniformly modified with respect to the type of sugar moiety. In certain embodiments, each of the two or more regions have the same type of sugar moiety. In certain embodiments, each of the two or more regions have a different type of sugar moiety. In certain embodiments, each of the two or more regions, independently, have the same or a different type of sugar moiety. The heterocyclic base and internucleoside linkage is independently variable at each position of a positionally modified oligomeric compound. The motif further optionally includes the use of one or more other groups including but not limited to capping groups, conjugate groups and other 5 or 3-terminal groups. In certain embodiments, positionally modified oligomeric compounds are provided comprising a sequence of from 8 to 20 -D-2-deoxyribonucleosides that further includes two or three regions of --constrained nucleic acid. Positionally modified oligomeric compounds are distinguished from gapped motifs, hemimer motifs, blockmer motifs and alternating motifs because the pattern of regional substitution defined by any positional motif does not fit into the definition provided herein for one of these other motifs. The term positionally modified oligomeric compound includes many different specific substitution patterns.

(34) As used herein the term gapmer or gapped oligomeric compound refers to an oligomeric compound having two external regions or wings and an internal region or gap. The three regions form a contiguous sequence of monomer subunits with the sugar moieties of the external regions being different than the sugar moieties of the internal region and wherein the sugar moiety of each monomer subunit within a particular region is essentially the same. In certain embodiments, each monomer subunit within a particular region has the same sugar moiety. When the sugar moieties of the external regions are the same the gapmer is a symmetric gapmer and when the sugar moiety used in the 5-external region is different from the sugar moiety used in the 3-external region, the gapmer is an asymmetric gapmer. In certain embodiments, the external regions are small (each independently 1, 2, 3, 4 or about 5 monomer subunits) and the monomer subunits comprise non-naturally occurring sugar moieties with the internal region comprising -D-2-deoxyribonucleosides. In certain embodiments, the external regions each, independently, comprise from 1 to about 5 monomer subunits having non-naturally occurring sugar moieties and the internal region comprises from 6 to 18 unmodified nucleosides. The internal region or the gap generally comprises -D-2-deoxyribonucleosides but can comprise non-naturally occurring sugar moieties. The heterocyclic base and internucleoside linkage is independently variable at each position of a gapped oligomeric compound. The motif further optionally includes the use of one or more other groups including but not limited to capping groups, conjugate groups and other 5 or 3-terminal groups.

(35) In certain embodiments, gapped oligomeric compounds are provided having modified nucleosides in the wings and an internal region of -D-2-deoxyribonucleosides. Such a gapmer can include --constrained nucleic acid in one or both wings and or in a portion of the gap or for the entirety of the gap. In certain embodiments, the gapped oligomeric compounds comprise an internal region of -D-2-deoxyribonucleosides with one of the external regions comprising --constrained nucleic acid as disclosed herein and the other external region comprising modified nucleosides having different sugar groups than the --constrained nucleic acid as disclosed herein. In certain embodiments, the gapped oligomeric compounds comprise an internal region of -D-2-deoxyribonucleosides with both of the external regions comprising --constrained nucleic acid as provided herein. In certain embodiments, gapped oligomeric compounds are provided herein wherein all of the monomer subunits comprise non-naturally occurring sugar moieties.

(36) In certain embodiments, gapped oligomeric compounds are provided comprising at least one region of the --constrained nucleic acid as disclosed herein and one or two modified nucleosides at the 5-end, two or three modified nucleosides at the 3-end and an internal region of from 10 to 16 -D-2-deoxyribonucleosides. In certain embodiments, gapped oligomeric compounds are provided comprising at least one region of the --constrained nucleic acid as disclosed herein and one modified nucleoside at the 5-end, two modified nucleosides at the 3-end and an internal region of from 10 to 16 -D-2-deoxyribonucleosides. In certain embodiments, gapped oligomeric compounds are provided comprising at least one region of the --constrained nucleic acid as disclosed herein and one modified nucleoside at the 5-end, two modified nucleosides at the 3-end and an internal region of from 10 to 14 -D-2-deoxyribonucleosides.

(37) In certain embodiments, gapped oligomeric compounds are provided that are from about 18 to about 21 monomer subunits in length. In certain embodiments, gapped oligomeric compounds are provided that are from about 16 to about 21 monomer subunits in length. In certain embodiments, gapped oligomeric compounds are provided that are from about 10 to about 21 monomer subunits in length. In certain embodiments, gapped oligomeric compounds are provided that are from about 12 to about 16 monomer subunits in length. In certain embodiments, gapped oligomeric compounds are provided that are from about 12 to about 14 monomer subunits in length. In certain embodiments, gapped oligomeric compounds are provided that are from about 14 to about 16 monomer subunits in length.

(38) As used herein the term alkyl, refers to a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to about 6 carbon atoms being more preferred. The term lower alkyl as used herein includes from 1 to about 6 carbon atoms. Alkyl groups as used herein may optionally include one or more further substituent groups.

(39) As used herein the term alkenyl, refers to a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.

(40) As used herein the term alkynyl, refers to a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.

(41) As used herein the term aliphatic, refers to a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.

(42) As used herein the term alicyclic refers to a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.

(43) As used herein the term alkoxy, refers to a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.

(44) As used herein the term aminoalkyl refers to an amino substituted C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.

(45) As used herein the terms aryl and aromatic, refer to a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.

(46) As used herein the terms aralkyl and arylalkyl, refer to an aromatic group that is covalently linked to a C.sub.1-C.sub.12 alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.

(47) As used herein the term heterocyclic radical refers to a radical mono-, or poly-cyclic ring system that includes at least one heteroatom and is unsaturated, partially saturated or fully saturated, thereby including heteroaryl groups. Heterocyclic is also meant to include fused ring systems wherein one or more of the fused rings contain at least one heteroatom and the other rings can contain one or more heteroatoms or optionally contain no heteroatoms. A heterocyclic radical typically includes at least one atom selected from sulfur, nitrogen or oxygen. Examples of heterocyclic radicals include, [1,3]dioxolanyl, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as used herein may optionally include further substituent groups.

(48) As used herein the terms heteroaryl, and heteroaromatic, refer to a radical comprising a mono- or poly-cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.

(49) As used herein the term heteroarylalkyl, refers to a heteroaryl group as previously defined that further includes a covalently attached C.sub.1-C.sub.12 alkyl radical. The alkyl radical portion of the resulting heteroarylalkyl group is capable of forming a covalent bond with a parent molecule. Examples include without limitation, pyridinylmethylene, pyrimidinylethylene, napthyridinylpropylene and the like. Heteroarylalkyl groups as used herein may optionally include further substituent groups on one or both of the heteroaryl or alkyl portions.

(50) As used herein the term acyl, refers to a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula C(O)X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.

(51) As used herein the term hydrocarbyl includes radical groups that comprise C, O and H. Included are straight, branched and cyclic groups having any degree of saturation. Such hydrocarbyl groups can include one or more additional heteroatoms selected from N and S and can be further mono or poly substituted with one or more substituent groups.

(52) As used herein the term mono or poly cyclic structure is meant to include all ring systems selected from single or polycyclic radical ring systems wherein the rings are fused or linked and is meant to be inclusive of single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic and heteroarylalkyl. Such mono and poly cyclic structures can contain rings that each have the same level of saturation or each, independently, have varying degrees of saturation including fully saturated, partially saturated or fully unsaturated. Each ring can comprise ring atoms selected from C, N, O and S to give rise to heterocyclic rings as well as rings comprising only C ring atoms which can be present in a mixed motif such as for example benzimidazole wherein one ring has only carbon ring atoms and the fused ring has two nitrogen atoms. The mono or poly cyclic structures can be further substituted with substituent groups such as for example phthalimide which has two O groups attached to one of the rings. Mono or poly cyclic structures can be attached to parent molecules using various strategies such as directly through a ring atom, fused through multiple ring atoms, through a substituent group or through a bifunctional linking moiety.

(53) As used herein the terms halo and halogen, refer to an atom selected from fluorine, chlorine, bromine and iodine.

(54) As used herein the term oxo refers to the group (O).

(55) As used herein the term protecting group, refers to a labile chemical moiety which is known in the art to protect reactive groups including without limitation, hydroxyl, amino and thiol groups, against undesired reactions during synthetic procedures. Protecting groups are typically used selectively and/or orthogonally to protect sites during reactions at other reactive sites and can then be removed to leave the unprotected group as is or available for further reactions. Protecting groups as known in the art are described generally in Greene's Protective Groups in Organic Synthesis, 4th edition, John Wiley & Sons, New York, 2007.

(56) Groups can be selectively incorporated into oligomeric compounds as provided herein as precursors. For example an amino group can be placed into a compound as provided herein as an azido group that can be chemically converted to the amino group at a desired point in the synthesis. Generally, groups are protected or present as precursors that will be inert to reactions that modify other areas of the parent molecule for conversion into their final groups at an appropriate time. Further representative protecting or precursor groups are discussed in Agrawal et al., Protocols for Oligonucleotide Conjugates, Humana Press; New Jersey, 1994, 26, 1-72.

(57) The term orthogonally protected refers to functional groups which are protected with different classes of protecting groups, wherein each class of protecting group can be removed in any order and in the presence of all other classes (see, Barany et al., J Am. Chem. Soc., 1977, 99, 7363-7365; Barany et al., J. Am. Chem. Soc., 1980, 102, 3084-3095). Orthogonal protection is widely used in for example automated oligonucleotide synthesis. A functional group is deblocked in the presence of one or more other protected functional groups which is not affected by the deblocking procedure. This deblocked functional group is reacted in some manner and at some point a further orthogonal protecting group is removed under a different set of reaction conditions. This allows for selective chemistry to arrive at a desired compound or oligomeric compound.

(58) Examples of hydroxyl protecting groups include without limitation, acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, bis(2-acetoxyethoxy)methyl (ACE), 2-trimethylsilylethyl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, [(triisopropylsilyl)oxy]methyl (TOM), benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, benzoyl, p-phenylbenzoyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triphenylmethyl (trityl), monomethoxytrityl, dimethoxytrityl (DMT), trimethoxytrityl, 1(2-fluorophenyl)-4-methoxypiperidin-4-yl (FPMP), 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (MOX). Wherein more commonly used hydroxyl protecting groups include without limitation, benzyl, 2,6-dichlorobenzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, benzoyl, mesylate, tosylate, dimethoxytrityl (DMT), 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (MOX).

(59) Examples of amino protecting groups include without limitation, carbamate-protecting groups, such as 2-trimethylsilylethoxycarbonyl (Teoc), 1-methyl-1-(4-biphenylyl)ethoxycarbonyl (Bpoc), t-butoxycarbonyl (BOC), allyloxycarbonyl (Alloc), 9-fluorenylmethyloxycarbonyl (Fmoc), and benzyl-oxycarbonyl (Cbz); amide-protecting groups, such as formyl, acetyl, trihaloacetyl, benzoyl, and nitrophenylacetyl; sulfonamide-protecting groups, such as 2-nitrobenzenesulfonyl; and imine- and cyclic imide-protecting groups, such as phthalimido and dithiasuccinoyl.

(60) Examples of thiol protecting groups include without limitation, triphenylmethyl (trityl), benzyl (Bn), and the like.

(61) The compounds described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)-, or , or as (D)- or (L)- such as for amino acids. Included herein are all such possible isomers, as well as their racemic and optically pure forms. Optical isomers may be prepared from their respective optically active precursors by the procedures described above, or by resolving the racemic mixtures. The resolution can be carried out in the presence of a resolving agent, by chromatography or by repeated crystallization or by some combination of these techniques which are known to those skilled in the art. Further details regarding resolutions can be found in Jacques, et al., Enantiomers, Racemates, and Resolutions, John Wiley & Sons, 1981. When the compounds described herein contain olefinic double bonds, other unsaturation, or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers or cis- and trans-isomers. Likewise, all tautomeric forms are also intended to be included. The configuration of any carbon-carbon double bond appearing herein is selected for convenience only and is not intended to limit a particular configuration unless the text so states.

(62) The terms substituent and substituent group, as used herein, are meant to include groups that are typically added to other groups or parent compounds to enhance desired properties or provide other desired effects. Substituent groups can be protected or unprotected and can be added to one available site or to many available sites in a parent compound. Substituent groups may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.

(63) Substituent groups amenable herein include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (C(O)R.sub.aa), carboxyl (C(O)OR.sub.aa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (OR.sub.aa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (N(R.sub.bb)(R.sub.cc)), imino(=NR.sub.bb), amido (C(O)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(O)R.sub.aa), azido (N.sub.3), nitro (NO.sub.2), cyano (CN), carbamido (OC(O)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(O)OR.sub.aa), ureido (N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido (N(R.sub.bb)C(S)N(R.sub.bb)(R.sub.cc)), guanidinyl (N(R.sub.bb)C(NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl (C(NR.sub.bb)N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)C(NR.sub.bb)(R.sub.aa)), thiol (SR.sub.bb), sulfinyl (S(O)R.sub.bb), sulfonyl (S(O).sub.2R.sub.bb) and sulfonamidyl (S(O).sub.2N(R.sub.bb)(R.sub.cc) or N(R.sub.bb)S(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb and R.sub.cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.

(64) In this context, recursive substituent means that a substituent may recite another instance of itself. Because of the recursive nature of such substituents, theoretically, a large number may be present in any given claim. One of ordinary skill in the art of medicinal chemistry and organic chemistry understands that the total number of such substituents is reasonably limited by the desired properties of the compound intended. Such properties include, by way of example and not limitation, physical properties such as molecular weight, solubility or log P, application properties such as activity against the intended target and practical properties such as ease of synthesis.

(65) Recursive substituents are an intended aspect of the invention. One of ordinary skill in the art of medicinal and organic chemistry understands the versatility of such substituents. To the degree that recursive substituents are present in a claim of the invention, the total number will be determined as set forth above.

(66) The terms stable compound and stable structure as used herein are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contemplated herein.

(67) As used herein, the term nucleobase refers to unmodified or naturally occurring nucleobases which include, but are not limited to, the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

(68) As used herein the term heterocyclic base moiety refers to unmodified or naturally occurring nucleobases as well as modified or non-naturally occurring nucleobases and synthetic mimetics thereof (such as for example phenoxazines). In one embodiment, a heterocyclic base moiety is any heterocyclic system that contains one or more atoms or groups of atoms capable of hydrogen bonding to a heterocyclic base of a nucleic acid.

(69) In certain embodiments, heterocyclic base moieties include without limitation modified nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (CCCH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein.

(70) In certain embodiments, heterocyclic base moieties include without limitation tricyclic pyrimidines such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Heterocyclic base moieties also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further heterocyclic base moieties include without limitation those known to the art skilled (see for example: U.S. Pat. No. 3,687,808; Swayze et al., The Medicinal Chemistry of Oligonucleotides in Antisense a Drug Technology, Chapter 6, pages 143-182, Crooke, S. T., ed., 2008); The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-302). Modified polycyclic heterocyclic compounds useful as heterocyclic base moieties are disclosed in the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269; 5,681,941; 5,750,692; 5,763,588; 5,830,653; 6,005,096; and U.S. Patent Application Publication 20030158403, each of which is incorporated herein by reference in its entirety.

(71) As used herein the term sugar moiety refers to naturally occurring sugars having a furanose ring, synthetic or non-naturally occurring sugars having a modified furanose ring and sugar surrogates wherein the furanose ring has been replaced with a cyclic ring system such as for example a morpholino or hexitol ring system or a non-cyclic sugar surrogate such as that used in peptide nucleic acids. Illustrative examples of sugar moieties useful in the preparation of oligomeric compounds include without limitation, -D-ribose, -D-2-deoxyribose, substituted sugars (such as 2, 5 and bis substituted sugars), 4-S-sugars (such as 4-S-ribose, 4-S-2-deoxyribose and 4-S-2-substituted ribose wherein the ring oxygen atom has been replaced with a sulfur atom), bicyclic modified sugars (such as the 2-OCH.sub.2-4 or 2-O(CH.sub.2).sub.2-4 bridged ribose derived bicyclic sugars) and sugar surrogates (such as for example when the ribose ring has been replaced with a morpholino, a hexitol ring system or an open non-cyclic system).

(72) As used herein the term sugar substituent group refers to groups that are covalently attached to sugar moieties. In certain embodiments, examples of sugar substituent groups include without limitation halogen, alkyl, substituted alkyl, alkoxy, substituted alkoxy, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, amino, substituted amino, thio, substituted thio and azido. In certain embodiments the alkyl and alkoxy groups are C.sub.1 to C.sub.6. In certain embodiments, the alkenyl and alkynyl groups are C.sub.2 to C.sub.6. In certain embodiments, examples of sugar substituent groups include without limitation 2-F, 2-allyl, 2-amino, 2-azido, 2-thio, 2-O-allyl, 2-OCF.sub.3, 2-OC.sub.1-C.sub.10 alkyl, 2-OCH.sub.3, 2-O(CH.sub.2).sub.nCH.sub.3, 2-OCH.sub.2CH.sub.3, 2-O(CH.sub.2).sub.2CH.sub.3, 2-O(CH.sub.2).sub.2OCH.sub.3 (MOE), 2-O[(CH.sub.2).sub.nO].sub.mCH.sub.3, 2-O(CH.sub.2).sub.2SCH.sub.3, 2-O(CH.sub.2).sub.3N(R.sub.p)(R.sub.q), 2-O(CH.sub.2).sub.nNH.sub.2, 2-O(CH.sub.2).sub.2ON(R.sub.p)(R.sub.q), O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3].sub.2, 2-O(CH.sub.2).sub.nONH.sub.2, 2-O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(R.sub.p)(R.sub.q), 2-OCH.sub.2C(O)N(R.sub.p)(R.sub.q), 2-OCH.sub.2C(O)N(H)CH.sub.3, 2-OCH.sub.2C(O)N(H)(CH.sub.2).sub.2N(R.sub.p)(R.sub.q) and 2-OCH.sub.2N(H)C(NR)[N(R.sub.p)(R.sub.q)], wherein each R.sub.p, R.sub.q and R.sub.r is, independently, H, substituted or unsubstituted C.sub.1-C.sub.10 alkyl or a protecting group and where n and m are from 1 to about 10.

(73) In certain embodiments, examples of substituent groups useful for modifying furanose sugar moieties (e.g., sugar substituent groups used for modified nucleosides), include without limitation 2-F, 2-allyl, 2-amino, 2-azido, 2-thio, 2-O-allyl, 2-OCF.sub.3, 2-OC.sub.1-C.sub.10 alkyl, 2-OCH.sub.3, OCF.sub.3, 2-OCH.sub.2CH.sub.3, 2-O(CH.sub.2).sub.2CH.sub.3, 2-O(CH.sub.2).sub.2OCH.sub.3 (MOE), 2-O(CH.sub.2).sub.2SCH.sub.3, 2-OCH.sub.2CHCH.sub.2, 2-O(CH.sub.2).sub.3N(R.sub.m)(R.sub.n), 2-O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), 2-O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(R.sub.m)(R.sub.n), 2-OCH.sub.2C(O)N(R.sub.m)(R.sub.n), 2-OCH.sub.2C(O)N(H)(CH.sub.2).sub.2N(R.sub.m)(R.sub.n) and 2-OCH.sub.2N(H)C(NR.sub.m)[N(R.sub.m)(R.sub.n)] wherein each R.sub.m and R.sub.n is, independently, H, substituted or unsubstituted C.sub.1-C.sub.10 alkyl or a protecting group. In certain embodiments, examples of 2-sugar substituent groups include without limitation fluoro, OCH.sub.3, OCH.sub.2CH.sub.3, O(CH.sub.2).sub.2CH.sub.3, O(CH.sub.2).sub.2OCH.sub.3, OCH.sub.2CHCH.sub.2, O(CH.sub.2).sub.3N(R.sub.1)(R.sub.2), O(CH.sub.2).sub.2ON(R.sub.1)(R.sub.2), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(R.sub.1)(R.sub.2), OCH.sub.2C(O)N(R.sub.1)(R.sub.2), OCH.sub.2C(O)N(H)(CH.sub.2).sub.2N(R.sub.1)(R.sub.2) and OCH.sub.2N(H)C(NR) [N(R.sub.1)(R.sub.2)] wherein R.sub.1 and R.sub.2 are each independently, H or C.sub.1-C.sub.2 alkyl. In certain embodiments, examples of sugar substituent groups include without limitation fluoro, OCH.sub.3, O(CH.sub.2).sub.2OCH.sub.3, OCH.sub.2C(O)N(H)(CH.sub.3), OCH.sub.2C(O)N(H)(CH.sub.2).sub.2N(CH.sub.3).sub.2 and OCH.sub.2N(H)C(NCH.sub.3)[N(CH.sub.3).sub.2]. In certain embodiments, examples of sugar substituent groups include without limitation fluoro, OCH.sub.3, O(CH.sub.2).sub.2OCH.sub.3, OCH.sub.2C(O)N(H)(CH.sub.3) and OCH.sub.2C(O)N(H)(CH.sub.2).sub.2N(CH.sub.3).sub.2. Further examples of modified sugar moieties include without limitation bicyclic sugars (e.g. bicyclic nucleic acids or bicyclic nucleosides discussed below).

(74) In certain embodiments, examples of sugar substituent groups include without limitation one or two 5-sugar substituent groups independently selected from C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl and halogen. In certain embodiments, examples of sugar substituent groups include without limitation one or two 5-sugar substituent groups independently selected from vinyl, 5-methyl, 5-(S)-methyl and 5-(R)-methyl. In certain embodiments, examples of sugar substituent groups include without limitation one 5-sugar substituent group selected from vinyl, 5-(S)-methyl and 5-(R)-methyl.

(75) In certain embodiments, examples of sugar substituent groups include without limitation substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an oligomeric compound, and other substituents having similar properties. In certain embodiments, oligomeric compounds include modified nucleosides comprising 2-MOE substituent groups (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2-MOE substitution has been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2-O-methyl, 2-O-propyl, and 2-O-aminopropyl. Oligonucleotides having the 2-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

(76) Sugar moieties can be substituted with combinations of sugar substituent groups including without limitation 2-F-5-methyl substituted nucleosides (see PCT International Application WO 2008/101157, published on Aug. 21, 2008 for other disclosed 5, 2-bis substituted nucleosides). Other combinations are also possible, including without limitation, replacement of the ribosyl ring oxygen atom with S and further substitution at the 2-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) and 5-substitution of a bicyclic nucleoside (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4-CH.sub.2O-2 bicyclic nucleoside is further substituted at the 5 position with a 5-methyl or a 5-vinyl group).

(77) As used herein, the term nucleoside refers to a nucleobase-sugar combination. The two most common classes of such nucleobases are purines and pyrimidines.

(78) As used herein, the term nucleotide refers to a nucleoside further comprising a modified or unmodified phosphate internucleoside linking group or a non-phosphate internucleoside linking group. For nucleotides that include a pentofuranosyl sugar, the internucleoside linking group can be linked to either the 2, 3 or 5 hydroxyl moiety of the sugar. The phosphate and or a non-phosphate internucleoside linking groups are routinely used to covalently link adjacent nucleosides to one another to form a linear polymeric compound.

(79) The term nucleotide mimetic as used herein is meant to include monomers that incorporate into oligomeric compounds with sugar and linkage surrogate groups, such as for example peptide nucleic acids (PNA) or morpholinos (linked by N(H)C(O)O). In general, the heterocyclic base at each position is maintained for hybridization to a nucleic acid target but the sugar and linkage is replaced with surrogate groups that are expected to function similar to native groups but have one or more enhanced properties.

(80) As used herein the term nucleoside mimetic is intended to include those structures used to replace the sugar and the base at one or more positions of an oligomeric compound. Examples of nucleoside mimetics include without limitation nucleosides wherein the heterocyclic base moiety is replaced with a phenoxazine moiety (for example the 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one group, also referred to as a G-clamp which forms four hydrogen bonds when hybridized with a guanosine base) and further replacement of the sugar moiety with a group such as for example a morpholino, a cyclohexenyl or a bicyclo[3.1.0]hexyl.

(81) As used herein the term modified nucleoside is meant to include all manner of modified nucleosides that can be incorporated into an oligomeric compound using oligomer synthesis. The term is intended to include modifications made to a nucleoside such as modified stereochemical configurations, one or more substitutions, and deletion of groups as opposed to the use of surrogate groups which are described elsewhere herein. The term includes nucleosides having a furanose sugar (or 4-S analog) portion and can include a heterocyclic base or can be an abasic nucleoside. One group of representative modified nucleosides includes without limitation, substituted nucleosides (such as 2, 5, and/or 4 substituted nucleosides) 4-S-modified nucleosides, (such as 4-S-ribonucleosides, 4-S-2-deoxyribonucleosides and 4-S-2-substituted ribonucleosides), bicyclic modified nucleosides (such as for example, bicyclic nucleosides wherein the sugar moiety has a 2-OCHR.sub.a-4 bridging group, wherein R.sub.a is H, alkyl or substituted alkyl) and base modified nucleosides. The sugar can be modified with more than one of these modifications listed such as for example a bicyclic modified nucleoside further including a 5-substitution or a 5 or 4 substituted nucleoside further including a 2 substituent. The term modified nucleoside also includes combinations of these modifications such as base and sugar modified nucleosides. These modifications are meant to be illustrative and not exhaustive as other modifications are known in the art and are also envisioned as possible modifications for the modified nucleosides described herein.

(82) As used herein the term monomer subunit is meant to include all manner of monomer units that are amenable to oligomer synthesis with one preferred list including monomer subunits such as -D-ribonucleosides, -D-2-deoxyribnucleosides, modified nucleosides, including substituted nucleosides (such as 2, 5 and bis substituted nucleosides), 4-S-modified nucleosides, (such as 4-S-ribonucleosides, 4-S-2-deoxyribonucleosides and 4-S-2-substituted ribonucleosides), bicyclic modified nucleosides (such as bicyclic nucleosides wherein the sugar moiety has a 2-OCHR.sub.a-4 bridging group, wherein R.sub.a is H, alkyl or substituted alkyl), other modified nucleosides, nucleoside mimetics, nucleosides having sugar surrogates and regions of --constrained nucleic acid as provided herein.

(83) As used herein the term bicyclic nucleoside refers to a nucleoside comprising at least a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides having a furanosyl sugar that comprises a bridge between two of the non-geminal carbons, preferably the 4 and the 2 carbon atoms. In certain embodiments, oligomeric compounds provided herein include one or more 4 to 2 bridged bicyclic nucleosides. Examples of such 4 to 2 bridged bicyclic nucleosides, include but are not limited to one of formulae: 4-(CH.sub.2)O-2 (LNA); 4-(CH.sub.2)S-2; 4-(CH.sub.2).sub.2O-2 (ENA); 4-CH(CH.sub.3)O-2 and 4-CH(CH.sub.2OCH.sub.3)O-2 (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4-C(CH.sub.3)(CH.sub.3)O-2 (and analogs thereof see published International Application WO/2009/006478, published Jan. 8, 2009); 4-CH.sub.2N(OCH.sub.3)-2 (and analogs thereof see published International Application WO/2008/150729, published Dec. 11, 2008); 4-CH.sub.2ON(CH.sub.3)-2 (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4-CH.sub.2N(R)O-2, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4-CH.sub.2C(H)(CH.sub.3)-2 (see Chattopadhyaya, et al., J Org. Chem., 2009, 74, 118-134); and 4-CH.sub.2C(CH.sub.2)-2 (and analogs thereof see published International Application WO 2008/154401, published on Dec. 8, 2008). Further bicyclic nucleosides have been reported in published literature (see for example: Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; U.S. Pat. Nos. 7,399,845; 7,053,207; 7,034,133; 6,794,499; 6,770,748; 6,670,461; 6,525,191; 6,268,490; U.S. Patent Publication Nos.: US2008-0039618; US2007-0287831; US2004-0171570; U.S. patent application Ser. Nos. 12/129,154; 61/099,844; 61/097,787; 61/086,231; 61/056,564; 61/026,998; 61/026,995; 60/989,574; International applications WO 2007/134181; WO 2005/021570; WO 2004/106356; WO 94/14226; and PCT International Applications Nos.: PCT/US2008/068922; PCT/US2008/066154; and PCT/US2008/064591). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example -L-ribofuranose and -D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).

(84) In certain embodiments, bicyclic nucleosides comprise a bridge between the 4 and the 2 carbon atoms of the pentofuranosyl sugar moiety including without limitation, bridges comprising 1 or from 1 to 4 linked groups independently selected from [C(R.sub.a)(R.sub.b)].sub.n, C(R.sub.a)C(R.sub.b), C(R.sub.a)N, C(NR.sub.a), C(O), C(S), O, Si(R.sub.a).sub.2, S(O).sub.x, and N(R.sub.a); wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(O)H), substituted acyl, CN, sulfonyl (S(O).sub.2-J.sub.1), or sulfoxyl (S(O)-J.sub.1); and

(85) each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(O)H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.

(86) In certain embodiments, the bridge of a bicyclic sugar moiety is, [C(R.sub.a)(R.sub.b)].sub.n, [C(R.sub.a)(R.sub.b)].sub.nO, C(R.sub.aR.sub.b)N(R)O or C(R.sub.aR.sub.b)ON(R). In certain embodiments, the bridge is 4-CH.sub.2-2, 4-(CH.sub.2).sub.2-2, 4-(CH.sub.2).sub.3-2, 4-CH.sub.2O-2, 4-(CH.sub.2).sub.2O-2, 4-CH.sub.2ON(R)-2 and 4-CH.sub.2N(R)O-2- wherein each R is, independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.

(87) In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4-(CH.sub.2)O-2 bridge, may be in the -L configuration or in the -D configuration. Previously, -L-methyleneoxy (4-CH.sub.2O-2) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

(88) In certain embodiments, bicyclic nucleosides include those having a 4 to 2 bridge wherein such bridges include without limitation, -L-4-(CH.sub.2)O-2, -D-4-CH.sub.2O-2, 4-(CH.sub.2).sub.2O-2, 4-CH.sub.2ON(R)-2, 4-CH.sub.2N(R)O-2, 4-CH(CH.sub.3)O-2, 4-CH.sub.2S-2, 4-CH.sub.2N(R)-2, 4-CH.sub.2CH(CH.sub.3)-2, and 4-(CH.sub.2).sub.3-2, wherein R is H, a protecting group or C.sub.1-C.sub.12 alkyl.

(89) In certain embodiments, bicyclic nucleosides have the formula:

(90) ##STR00011##
wherein:

(91) Bx is a heterocyclic base moiety;

(92) -Q.sub.a-Q.sub.b-Q.sub.c- is CH.sub.2N(R.sub.c)CH.sub.2, C(O)N(R.sub.c)CH.sub.2, CH.sub.2ON(R.sub.c), CH.sub.2N(R.sub.c)O or N(R.sub.c)OCH.sub.2;

(93) R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting group; and

(94) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

(95) In certain embodiments, bicyclic nucleosides have the formula:

(96) ##STR00012##
wherein:

(97) Bx is a heterocyclic base moiety;

(98) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

(99) Z.sub.a is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.

(100) In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ.sub.c, NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(X)J.sub.c, and NJ.sub.eC(X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d and J.sub.e is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.c.

(101) In certain embodiments, bicyclic nucleosides have the formula:

(102) ##STR00013##
wherein:

(103) Bx is a heterocyclic base moiety;

(104) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

(105) Z.sub.b is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl or substituted acyl (C(O)).

(106) In certain embodiments, bicyclic nucleosides have the formula:

(107) ##STR00014##
wherein:

(108) Bx is a heterocyclic base moiety;

(109) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

(110) R.sub.d is C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;

(111) each q.sub.a, q.sub.b, q.sub.c and q.sub.d is, independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxyl, substituted C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6 aminoalkyl or substituted C.sub.1-C.sub.6 aminoalkyl;

(112) In certain embodiments, bicyclic nucleosides have the formula:

(113) ##STR00015##
wherein:

(114) Bx is a heterocyclic base moiety;

(115) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

(116) q.sub.a, q.sub.b, q.sub.e and q.sub.f are each, independently, hydrogen, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxy, substituted C.sub.1-C.sub.12 alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(O)OJ.sub.j, C(O)NJ.sub.jJ.sub.k, C(O)J.sub.j, OC(O)NJ.sub.jJ.sub.k, N(H)C(NH)NJ.sub.jJ.sub.k, N(H)C(O)NJ.sub.jJ.sub.k or N(H)C(S)NJ.sub.jJ.sub.k;

(117) or q.sub.e and q.sub.f together are C(q.sub.g)(q.sub.h);

(118) q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.

(119) The synthesis and preparation of adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4-CH.sub.2O-2 bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.

(120) Analogs of various bicyclic nucleosides that have 4 to 2 bridging groups such as 4-CH.sub.2O-2 and 4-CH.sub.2S-2, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2-amino- and 2-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

(121) In certain embodiments, bicyclic nucleosides have the formula:

(122) ##STR00016##
wherein:

(123) Bx is a heterocyclic base moiety;

(124) T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

(125) each q.sub.i, q.sub.j, q.sub.k and q.sub.l is, independently, H, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxyl, substituted C.sub.1-C.sub.12 alkoxyl, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(O)OJ.sub.j, C(O)NJ.sub.jJ.sub.k, C(O)J.sub.j, OC(O)NJ.sub.jJ.sub.k, N(H)C(NH)NJ.sub.jJ.sub.k, N(H)C(O)NJ.sub.jJ.sub.k or N(H)C(S)NJ.sub.jJ.sub.k; and

(126) q.sub.i and q.sub.j or q.sub.i and q.sub.k together are C(q.sub.g)(q.sub.h), wherein q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.

(127) One carbocyclic bicyclic nucleoside having a 4-(CH.sub.2).sub.3-2 bridge and the alkenyl analog bridge 4-CHCHCH.sub.2-2 have been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

(128) In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) -L-methyleneoxy (4-CH.sub.2O-2) BNA, (B) -D-methyleneoxy (4-CH.sub.2O-2) BNA, (C) ethyleneoxy (4-(CH.sub.2).sub.2O-2) BNA, (D) aminooxy (4-CH.sub.2ON(R)-2) BNA, (E) oxyamino (4-CH.sub.2N(R)O-2) BNA, (F) methyl(methyleneoxy) (4-CH(CH.sub.3)O-2) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4-CH.sub.2S-2) BNA, (H) methylene-amino (4-CH.sub.2N(R)-2) BNA, (I) methyl carbocyclic (4-CH.sub.2CH(CH.sub.3)-2) BNA, (J) propylene carbocyclic (4-(CH.sub.2).sub.3-2) BNA, and (K) vinyl BNA as depicted below.

(129) ##STR00017## ##STR00018##

(130) wherein Bx is the base moiety and R is, independently, H, a protecting group, C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy.

(131) As used herein the term sugar surrogate refers to replacement of the nucleoside furanose ring with a non-furanose (or 4-substituted furanose) group with another structure such as another ring system or open system. Such structures can be as simple as a six membered ring as opposed to the five membered furanose ring or can be more complicated such as a bicyclic or tricyclic ring system or a non-ring system used in peptide nucleic acid. In certain embodiments, sugar surrogates include without limitation sugar surrogate groups such as morpholinos, cyclohexenyls and cyclohexitols. In general the heterocyclic base is maintained even when the sugar moiety is a sugar surrogate so that the resulting monomer subunit will be able to hybridize.

(132) In certain embodiments, nucleosides having sugar surrogate groups include without limitation, replacement of the ribosyl ring with a sugar surrogate such as a tetrahydropyranyl ring system (also referred to as hexitol) as illustrated below:

(133) ##STR00019##

(134) In certain embodiments, sugar surrogates are selected having the formula:

(135) ##STR00020##
wherein:

(136) Bx is a heterocyclic base moiety;

(137) T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the oligomeric compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group or a 5 or 3-terminal group; q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl; and

(138) one of R.sub.1 and R.sub.2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(X)J.sub.1, OC(X)NJ.sub.1J.sub.2, NJ.sub.3C(X)NJ.sub.1J.sub.2 and CN, wherein X is O, S or NJ.sub.1 and each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

(139) In certain embodiments, q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H; R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.

(140) Such sugar surrogates can be referred to as a modified tetrahydropyran nucleoside or modified THP nucleoside. Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), altritol nucleic acid (ANA), and mannitol nucleic acid (MNA) (see Leumann, C. J., Bioorg. & Med. Chem., 2002, 10, 841-854).

(141) In certain embodiments, oligomeric compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvth et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides &Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have Formula X.

(142) ##STR00021##

(143) wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X:

(144) Bx is a heterocyclic base moiety;

(145) T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5- or 3-terminal group; and

(146) q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6, q.sub.7, q.sub.8 and q.sub.9 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or other sugar substituent group.

(147) Many other monocyclic, bicyclic and tricyclic ring systems are known in the art and are suitable as sugar surrogates that can be used to modify nucleosides for incorporation into oligomeric compounds as provided herein (see for example review article: Leumann, Christian J. Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to further enhance their activity.

(148) Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed Jun. 2, 2005 and published as WO 2005/121371 on Dec. 22, 2005 certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

(149) The --constrained nucleic acid as provided herein can be prepared by any of the applicable techniques of organic synthesis, as, for example, illustrated in the examples below. Many such techniques are well known in the art. However, many of the known techniques are elaborated in Compendium of Organic Synthetic Methods, John Wiley & Sons, New York: Vol. 1, Ian T. Harrison and Shuyen Harrison, 1971; Vol. 2, Ian T. Harrison and Shuyen Harrison, 1974; Vol. 3, Louis S. Hegedus and Leroy Wade, 1977; Vol. 4, Leroy G. Wade Jr., 1980; Vol. 5, Leroy G. Wade Jr., 1984; and Vol. 6, Michael B. Smith; as well as March, J., Advanced Organic Chemistry, 3rd Edition, John Wiley & Sons, New York, 1985; Comprehensive Organic Synthesis. Selectivity, Strategy & Efficiency in Modern Organic Chemistry, in 9 Volumes, Barry M. Trost, Editor-in-Chief, Pergamon Press, New York, 1993; Advanced Organic Chemistry, Part B: Reactions and Synthesis, 4th Edition; Carey and Sundberg, Kluwer Academic/Plenum Publishers, New York, 2001; Advanced Organic Chemistry, Reactions, Mechanisms, and Structure, 2nd Edition, March, McGraw Hill, 1977; Greene, T. W., and Wutz, P. G. M., Protecting Groups in Organic Synthesis, 4th Edition, John Wiley & Sons, New York, 1991; and Larock, R. C., Comprehensive Organic Transformations, 2nd Edition, John Wiley & Sons, New York, 1999.

(150) As used herein the term reactive phosphorus is meant to include groups that are covalently linked to a monomer subunit that can be further attached to an oligomeric compound that are useful for forming internucleoside linkages including for example phosphodiester and phosphorothioate internucleoside linkages. Such reactive phosphorus groups are known in the art and contain phosphorus atoms in P.sup.III or P.sup.V valence state including, but not limited to, phosphoramidite, H-phosphonate, phosphate triesters and phosphorus containing chiral auxiliaries. In certain embodiments, reactive phosphorus groups are selected from diisopropylcyanoethoxy phosphoramidite (O*P[N[(CH(CH.sub.3).sub.2].sub.2]O(CH.sub.2).sub.2CN) and H-phosphonate (O*P(O)(H)OH), wherein the O* is provided from the Markush group for the monomer. A preferred synthetic solid phase synthesis utilizes phosphoramidites (P.sup.III chemistry) as reactive phosphites. The intermediate phosphite compounds are subsequently oxidized to the phosphate or thiophosphate (P.sup.V chemistry) using known methods to yield, phosphodiester or phosphorothioate internucleoside linkages. Chiral auxiliaries are known in the art (see for example: Wang et al., Tetrahedron Letters, 1997, 38(5), 705-708; Jin et al., J Org. Chem, 1997, 63, 3647-3654; Wang et al., Tetrahedron Letters, 1997, 38(22), 3797-3800; and U.S. Pat. No. 6,867,294, issued Mar. 15, 2005). Additional reactive phosphates and phosphites are disclosed in Tetrahedron Report Number 309 (Beaucage and Iyer, Tetrahedron, 1992, 48, 2223-2311).

(151) As used herein, oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).

(152) The term oligonucleoside refers to a sequence of nucleosides that are joined by internucleoside linkages that do not have phosphorus atoms. Internucleoside linkages of this type include short chain alkyl, cycloalkyl, mixed heteroatom alkyl, mixed heteroatom cycloalkyl, one or more short chain heteroatomic and one or more short chain heterocyclic. These internucleoside linkages include without limitation, siloxane, sulfide, sulfoxide, sulfone, acetyl, formacetyl, thioformacetyl, methylene formacetyl, thioformacetyl, alkeneyl, sulfamate, methyleneimino, methylenehydrazino, sulfonate, sulfonamide, amide and others having mixed N, O, S and CH.sub.2 component parts.

(153) As used herein, the term oligomeric compound refers to a contiguous sequence of linked monomer subunits. Each linked monomer subunit normally includes a heterocyclic base moiety but monomer subunits also includes those without a heterocyclic base moiety such as abasic monomer subunits. At least some and generally most if not essentially all of the heterocyclic bases in an oligomeric compound are capable of hybridizing to a nucleic acid molecule, normally a preselected RNA target. The term oligomeric compound therefore includes oligonucleotides, oligonucleotide analogs and oligonucleosides. It also includes polymers having one or a plurality of nucleoside mimetics and or nucleosides having sugar surrogate groups.

(154) In certain embodiments, oligomeric compounds comprise a plurality of monomer subunits independently selected from naturally occurring nucleosides, non-naturally occurring nucleosides, modified nucleosides, nucleoside mimetics, and nucleosides having sugar surrogate groups. In certain embodiments, oligomeric compounds are single stranded. In certain embodiments, oligomeric compounds are double stranded comprising a double-stranded duplex. In certain embodiments, oligomeric compounds comprise one or more conjugate groups and/or terminal groups.

(155) When preparing oligomeric compounds having specific motifs as disclosed herein it can be advantageous to mix non-naturally occurring monomer subunits with the --constrained nucleic acid as provided herein with other non-naturally occurring monomer subunits, naturally occurring monomer subunits (nucleosides) or mixtures thereof. In certain embodiments, oligomeric compounds are provided herein comprising a contiguous sequence of linked monomer subunits including at least one region of --constrained nucleic acid as provided. In certain embodiments, oligomeric compounds are provided comprising at least two regions of --constrained nucleic acid as provided herein.

(156) Oligomeric compounds are routinely prepared linearly but can also be joined or otherwise prepared to be circular and/or can be prepared to include branching. Oligomeric compounds can form double stranded constructs such as for example two strands hybridized to form a double stranded composition. Double stranded compositions can be linked or separate and can include various other groups such as conjugates and/or overhangs on the ends.

(157) As used herein, antisense compound refers to an oligomeric compound, at least a portion of which is at least partially complementary to a target nucleic acid to which it hybridizes. In certain embodiments, an antisense compound modulates (increases or decreases) expression or amount of a target nucleic acid. In certain embodiments, an antisense compound alters splicing of a target pre-mRNA resulting in a different splice variant. In certain embodiments, an antisense compound modulates expression of one or more different target proteins. Antisense mechanisms contemplated herein include, but are not limited to an RNase H mechanism, RNAi mechanisms, splicing modulation, translational arrest, altering RNA processing, inhibiting microRNA function, or mimicking microRNA function.

(158) As used herein, antisense activity refers to any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, such activity may be an increase or decrease in an amount of a nucleic acid or protein. In certain embodiments, such activity may be a change in the ratio of splice variants of a nucleic acid or protein. Detection and/or measuring of antisense activity may be direct or indirect. For example, in certain embodiments, antisense activity is assessed by detecting and/or measuring the amount of target protein or the relative amounts of splice variants of a target protein. In certain embodiments, antisense activity is assessed by detecting and/or measuring the amount of target nucleic acids and/or cleaved target nucleic acids and/or alternatively spliced target nucleic acids. In certain embodiments, antisense activity is assessed by observing a phenotypic change in a cell or animal.

(159) As used herein the term internucleoside linkage or internucleoside linking group is meant to include all manner of internucleoside linking groups known in the art including but not limited to, phosphorus containing internucleoside linking groups such as phosphodiester and phosphorothioate, and non-phosphorus containing internucleoside linking groups such as formacetyl and methyleneimino. Internucleoside linkages also includes neutral non-ionic internucleoside linkages such as amide-3 (3-CH.sub.2C(O)N(H)-5), amide-4 (3-CH.sub.2N(H)C(O)-5) and methylphosphonate wherein a phosphorus atom is not always present.

(160) In certain embodiments, oligomeric compounds as provided herein can be prepared having one or more internucleoside linkages containing modified e.g. non-naturally occurring internucleoside linkages. The two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom. Modified internucleoside linkages having a phosphorus atom include without limitation, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3-alkylene phosphonates, 5-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3-5 linkages, 2-5 linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3 to 3, 5 to 5 or 2 to 2 linkage. Oligonucleotides having inverted polarity can comprise a single 3 to 3 linkage at the 3-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

(161) Representative U.S. patents that teach the preparation of the above phosphorus containing linkages include without limitation, U.S.: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,194,599; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,527,899; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,565,555; 5,571,799; 5,587,361; 5,625,050; 5,672,697 and 5,721,218, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

(162) In certain embodiments, oligomeric compounds as provided herein can be prepared having one or more non-phosphorus containing internucleoside linkages. Such oligomeric compounds include without limitation, those that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

(163) Representative U.S. patents that teach the preparation of the above oligonucleosides include without limitation, U.S.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,677,439; 5,646,269 and 5,792,608, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

(164) As used herein neutral internucleoside linkage is intended to include internucleoside linkages that are non-ionic. Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3-CH.sub.2N(CH.sub.3)O-5), amide-3 (3-CH.sub.2C(O)N(H)-5), amide-4 (3-CH.sub.2N(H)C(O)-5), formacetal (3-OCH.sub.2O-5), and thioformacetal (3-SCH.sub.2O-5). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.

(165) In certain embodiments, oligomeric compounds as provided herein can be prepared having one or more optionally protected phosphorus containing internucleoside linkages. Representative protecting groups for phosphorus containing internucleoside linkages such as phosphodiester and phosphorothioate linkages include -cyanoethyl, diphenylsilylethyl, -cyanobutenyl, cyano p-xylyl (CPX), N-methyl-N-trifluoroacetyl ethyl (META), acetoxy phenoxy ethyl (APE) and butene-4-yl groups. See for example U.S. Pat. Nos. 4,725,677 and Re. 34,069 (J.sub.3-cyanoethyl); Beaucage et al., Tetrahedron, 1993, 49(10), 1925-1963; Beaucage et al., Tetrahedron, 1993, 49(46), 10441-10488; Beaucage et al., Tetrahedron, 1992, 48(12), 2223-2311.

(166) As used herein the terms linking groups and bifunctional linking moieties are meant to include groups known in the art that are useful for attachment of chemical functional groups, conjugate groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general, a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind to essentially any selected group such as a chemical functional group or a conjugate group. In some embodiments, the linker comprises a chain structure or a polymer of repeating units such as ethylene glycols or amino acid units. Examples of functional groups that are routinely used in bifunctional linking moieties include without limitation, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like. Some nonlimiting examples of bifunctional linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include without limitation, substituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

(167) In certain embodiments, the oligomeric compounds as provided herein can be modified by covalent attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the oligomeric compounds they are attached to. Such oligonucleotide properties include without limitation, pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional linking moiety or linking group to a parent compound such as an oligomeric compound. A preferred list of conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.

(168) In certain embodiments, the oligomeric compounds as provided herein can be modified by covalent attachment of one or more terminal groups to the 5 or 3-terminal groups. A terminal group can also be attached at any other position at one of the terminal ends of the oligomeric compound. As used herein the terms 5-terminal group, 3-terminal group, terminal group and combinations thereof are meant to include useful groups known to the art skilled that can be placed on one or both of the terminal ends, including but not limited to the 5 and 3-ends of an oligomeric compound respectively, for various purposes such as enabling the tracking of the oligomeric compound (a fluorescent label or other reporter group), improving the pharmacokinetics or pharmacodynamics of the oligomeric compound (such as for example: uptake and/or delivery) or enhancing one or more other desirable properties of the oligomeric compound (a group for improving nuclease stability or binding affinity). In certain embodiments, 5 and 3-terminal groups include without limitation, modified or unmodified nucleosides; two or more linked nucleosides that are independently, modified or unmodified; conjugate groups; capping groups; phosphate moieties; and protecting groups.

(169) As used herein the term phosphate moiety refers to a terminal phosphate group that includes phosphates as well as modified phosphates. The phosphate moiety can be located at either terminus but is preferred at the 5-terminal nucleoside. In one aspect, the terminal phosphate is unmodified having the formula OP(O)(OH)OH. In another aspect, the terminal phosphate is modified such that one or more of the O and OH groups are replaced with H, O, S, N(R) or alkyl where R is H, an amino protecting group or unsubstituted or substituted alkyl. In certain embodiments, the 5 and or 3 terminal group can comprise from 1 to 3 phosphate moieties that are each, independently, unmodified (di or tri-phosphates) or modified.

(170) As used herein, the term phosphorus moiety refers to a group having the formula:

(171) ##STR00022##
wherein:

(172) R.sub.x and R.sub.y are each, independently, hydroxyl, protected hydroxyl group, thiol, protected thiol group, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy, a protected amino or substituted amino; and

(173) R.sub.z is O or S.

(174) As a monomer such as a phosphoramidite or H-phosphonate the protected phosphorus moiety is preferred to maintain stability during oligomer synthesis. After incorporation into an oligomeric compound the phosphorus moiety can include deprotected groups.

(175) Phosphorus moieties included herein can be attached to a monomer, which can be used in the preparation of oligomeric compounds, wherein the monomer may be attached using O, S, NR.sub.d or CR.sub.eR.sub.f, wherein R.sub.d includes without limitation H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, substituted C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or substituted acyl, and Re and R.sub.f each, independently, include without limitation H, halogen, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy or substituted C.sub.1-C.sub.6 alkoxy. Such linked phosphorus moieties include without limitation, phosphates, modified phosphates, thiophosphates, modified thiophosphates, phosphonates, modified phosphonates, phosphoramidates and modified phosphoramidates.

(176) RNA duplexes exist in what has been termed A Form geometry while DNA duplexes exist in B Form geometry. In general, RNA:RNA duplexes are more stable, or have higher melting temperatures (T.sub.m) than DNA:DNA duplexes (Sanger et al., Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New York, N.Y.; Lesnik et al., Biochemistry, 1995, 34, 10807-10815; Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634). The increased stability of RNA has been attributed to several structural features, most notably the improved base stacking interactions that result from an A-form geometry (Searle et al., Nucleic Acids Res., 1993, 21, 2051-2056). The presence of the 2 hydroxyl in RNA biases the sugar toward a C3 endo pucker, i.e., also designated as Northern pucker, which causes the duplex to favor the A-form geometry. In addition, the 2 hydroxyl groups of RNA can form a network of water mediated hydrogen bonds that help stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35, 8489-8494). On the other hand, deoxy nucleic acids prefer a C2 endo sugar pucker, i.e., also known as Southern pucker, which is thought to impart a less stable B-form geometry (Sanger, W. (1984) Principles of Nucleic Acid Structure, Springer-Verlag, New York, N.Y.).

(177) The relative ability of a chemically-modified oligomeric compound to bind to complementary nucleic acid strands, as compared to natural oligonucleotides, is measured by obtaining the melting temperature of a hybridization complex of said chemically-modified oligomeric compound with its complementary unmodified target nucleic acid. The melting temperature (T.sub.m), a characteristic physical property of double helixes, denotes the temperature in degrees centigrade at which 50% helical versus coiled (unhybridized) forms are present. T.sub.m (also commonly referred to as binding affinity) is measured by using the UV spectrum to determine the formation and breakdown (melting) of hybridization. Base stacking, which occurs during hybridization, is accompanied by a reduction in UV absorption (hypochromicity). Consequently a reduction in UV absorption indicates a higher T.sub.m.

(178) It is known in the art that the relative duplex stability of an antisense compound:RNA target duplex can be modulated through incorporation of chemically-modified nucleosides into the antisense compound. Sugar-modified nucleosides have provided the most efficient means of modulating the T.sub.m of an antisense compound with its target RNA. Sugar-modified nucleosides that increase the population of or lock the sugar in the C3-endo (Northern, RNA-like sugar pucker) configuration have predominantly provided a per modification T.sub.m increase for antisense compounds toward a complementary RNA target. Sugar-modified nucleosides that increase the population of or lock the sugar in the C2-endo (Southern, DNA-like sugar pucker) configuration predominantly provide a per modification Tm decrease for antisense compounds toward a complementary RNA target. The sugar pucker of a given sugar-modified nucleoside is not the only factor that dictates the ability of the nucleoside to increase or decrease an antisense compound's T.sub.m toward complementary RNA. For example, the sugar-modified nucleoside tricycloDNA is predominantly in the C2-endo conformation, however it imparts a 1.9 to 3 C. per modification increase in T.sub.m toward a complementary RNA. Another example of a sugar-modified high-affinity nucleoside that does not adopt the C3-endo conformation is -L-LNA (described in more detail herein).

(179) As used herein, T.sub.m means melting temperature which is the temperature at which the two strands of a duplex nucleic acid separate. T.sub.m is often used as a measure of duplex stability or the binding affinity of an antisense compound toward a complementary strand such as an RNA molecule.

(180) As used herein, complementarity in reference to nucleobases refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases or more broadly, heterocyclic base moieties, comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of complementarity.

(181) As used herein, non-complementary in reference to nucleobases refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

(182) As used herein, complementary in reference to linked nucleosides, oligonucleotides, oligomeric compounds, or nucleic acids, refers to the capacity of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid through nucleobase or more broadly, heterocyclic base, complementarity. In certain embodiments, an antisense compound and its target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can bond with each other to allow stable association between the antisense compound and the target. One skilled in the art recognizes that the inclusion of mismatches is possible without eliminating the ability of the oligomeric compounds to remain in association. Therefore, described herein are antisense compounds that may comprise up to about 20% nucleotides that are mismatched (i.e., are not nucleobase complementary to the corresponding nucleotides of the target). Preferably the antisense compounds contain no more than about 15%, more preferably not more than about 10%, most preferably not more than 5% or no mismatches. The remaining nucleotides are nucleobase complementary or otherwise do not disrupt hybridization (e.g., universal bases). One of ordinary skill in the art would recognize the compounds provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a target nucleic acid.

(183) It is understood in the art that the sequence of an oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligomeric compound may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). In certain embodiments, oligomeric compounds can comprise at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted. For example, an oligomeric compound in which 18 of 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an oligomeric compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within this scope. Percent complementarity of an oligomeric compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

(184) As used herein, hybridization refers to the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases). For example, the natural base adenine is nucleobase complementary to the natural nucleobases thymidine and uracil which pair through the formation of hydrogen bonds. The natural base guanine is nucleobase complementary to the natural bases cytosine and 5-methyl cytosine. Hybridization can occur under varying circumstances.

(185) As used herein, target nucleic acid refers to any nucleic acid molecule the expression, amount, or activity of which is capable of being modulated by an antisense compound. In certain embodiments, the target nucleic acid is DNA or RNA. In certain embodiments, the target RNA is mRNA, pre-mRNA, non-coding RNA, pri-microRNA, pre-microRNA, mature microRNA, promoter-directed RNA, or natural antisense transcripts. For example, the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In certain embodiments, target nucleic acid is a viral or bacterial nucleic acid.

(186) Further included herein are oligomeric compounds such as antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these oligomeric compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the oligomeric compounds provided herein may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid. Alternatively, the oligomeric compound may inhibit the activity the target nucleic acid through an occupancy-based method, thus interfering with the activity of the target nucleic acid.

(187) One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded oligomeric compounds which are DNA-like elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.

(188) While one form of oligomeric compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.

(189) As used herein, modulation refers to a perturbation of amount or quality of a function or activity when compared to the function or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include perturbing splice site selection of pre-mRNA processing, resulting in a change in the amount of a particular splice-variant present compared to conditions that were not perturbed. As a further example, modulation includes perturbing translation of a protein.

(190) As used herein, the term pharmaceutically acceptable salts refers to salts that retain the desired activity of the compound and do not impart undesired toxicological effects thereto. The term pharmaceutically acceptable salt includes a salt prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic or organic acids and bases.

(191) Pharmaceutically acceptable salts of the oligomeric compounds described herein may be prepared by methods well-known in the art. For a review of pharmaceutically acceptable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, Weinheim, Germany, 2002). Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic administration to humans. Accordingly, in one embodiment the oligomeric compounds described herein are in the form of a sodium salt.

(192) In certain embodiments, oligomeric compounds provided herein comprise from about 8 to about 80 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 monomer subunits in length, or any range therewithin.

(193) In certain embodiments, oligomeric compounds provided herein comprise from about 8 to 40 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 monomer subunits in length, or any range therewithin.

(194) In certain embodiments, oligomeric compounds provided herein comprise from about 8 to 20 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 monomer subunits in length, or any range therewithin.

(195) In certain embodiments, oligomeric compounds provided herein comprise from about 8 to 16 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15 or 16 monomer subunits in length, or any range therewithin.

(196) In certain embodiments, oligomeric compounds provided herein comprise from about 10 to 14 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 10, 11, 12, 13 or 14 monomer subunits in length, or any range therewithin.

(197) In certain embodiments, oligomeric compounds provided herein comprise from about 10 to 18 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 10, 11, 12, 13, 14, 15, 16, 17 or 18 monomer subunits in length, or any range therewithin.

(198) In certain embodiments, oligomeric compounds provided herein comprise from about 10 to 21 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 monomer subunits in length, or any range therewithin.

(199) In certain embodiments, oligomeric compounds provided herein comprise from about 12 to 14 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 12, 13 or 14 monomer subunits in length, or any range therewithin.

(200) In certain embodiments, oligomeric compounds provided herein comprise from about 12 to 18 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 12, 13, 14, 15, 16, 17 or 18 monomer subunits in length, or any range therewithin.

(201) In certain embodiments, oligomeric compounds provided herein comprise from about 12 to 21 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 monomer subunits in length, or any range therewithin.

(202) In certain embodiments, oligomeric compounds provided herein comprise from about 14 to 18 monomer subunits in length. One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 14, 15, 16, 17 or 18 monomer subunits in length, or any range therewithin.

(203) In certain embodiments, oligomeric compounds of any of a variety of ranges of lengths of linked monomer subunits are provided. In certain embodiments, oligomeric compounds are provided consisting of X-Y linked monomer subunits, where X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, this provides oligomeric compounds comprising: 8-9, 8-10, 8-11, 8-12, 8-13, 8-14, 8-15, 8-16, 8-17, 8-18, 8-19, 8-20, 8-21, 8-22, 8-23, 8-24, 8-25, 8-26, 8-27, 8-28, 8-29, 8-30, 9-10, 9-11, 9-12, 9-13, 9-14, 9-15, 9-16, 9-17, 9-18, 9-19, 9-20, 9-21, 9-22, 9-23, 9-24, 9-25, 9-26, 9-27, 9-28, 9-29, 9-30, 10-11, 10-12, 10-13, 10-14, 10-15, 10-16, 10-17, 10-18, 10-19, 10-20, 10-21, 10-22, 10-23, 10-24, 10-25, 10-26, 10-27, 10-28, 10-29, 10-30, 11-12, 11-13, 11-14, 11-15, 11-16, 11-17, 11-18, 11-19, 11-20, 11-21, 11-22, 11-23, 11-24, 11-25, 11-26, 11-27, 11-28, 11-29, 11-30, 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked monomer subunits.

(204) In certain embodiments, the ranges for the oligomeric compounds listed herein are meant to limit the number of monomer subunits in the oligomeric compounds, however such oligomeric compounds may further include 5 and/or 3-terminal groups including but not limited to protecting groups such as hydroxyl protecting groups, optionally linked conjugate groups and/or other substituent groups.

(205) In certain embodiments, the preparation of oligomeric compounds as disclosed herein is performed according to literature procedures for DNA: Protocols for Oligonucleotides and Analogs, Agrawal, Ed., Humana Press, 1993, and/or RNA: Scaringe, Methods, 2001, 23, 206-217; Gait et al., Applications of Chemically synthesized RNA in RNA:Protein Interactions, Smith, Ed., 1998, 1-36; Gallo et al., Tetrahedron, 2001, 57, 5707-5713. Additional methods for solid-phase synthesis may be found in Caruthers U.S. Pat. Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,973,679; and 5,132,418; and Koster U.S. Pat. Nos. 4,725,677 and Re. 34,069.

(206) Oligomeric compounds are routinely prepared using solid support methods as opposed to solution phase methods. Commercially available equipment commonly used for the preparation of oligomeric compounds that utilize the solid support method is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. Suitable solid phase techniques, including automated synthesis techniques, are described in Oligonucleotides and Analogues, a Practical Approach, F. Eckstein, Ed., Oxford University Press, New York, 1991.

(207) The synthesis of RNA and related analogs relative to the synthesis of DNA and related analogs has been increasing as efforts in RNA interference and micro RNA increase. The primary RNA synthesis strategies that are presently being used commercially include 5-O-DMT-2-O-t-butyldimethylsilyl (TBDMS), 5-O-DMT-2-O-[1(2-fluorophenyl)-4-methoxypiperidin-4-yl] (FPMP), 2-O-[(triisopropylsilyl)oxy]methyl (2-OCH.sub.2OSi(iPr).sub.3 (TOM) and the 5-O-silyl ether-2-ACE (5-O-bis(trimethylsiloxy)cyclododecyloxysilyl ether (DOD)-2-O-bis(2-acetoxyethoxy)methyl (ACE). A current list of some of the major companies currently offering RNA products include Pierce Nucleic Acid Technologies, Dharmacon Research Inc., Ameri Biotechnologies Inc., and Integrated DNA Technologies, Inc. One company, Princeton Separations, is marketing an RNA synthesis activator advertised to reduce coupling times especially with TOM and TBDMS chemistries. The primary groups being used for commercial RNA synthesis are: TBDMS: 5-O-DMT-2-O-t-butyldimethylsilyl; TOM: 2-O-[(triisopropylsilyl)oxy]methyl; DOD/ACE: (5-O-bis(trimethylsiloxy)cyclododecyloxysilyl ether-2-O-bis(2-acetoxyethoxy)methyl; and FPMP: 5-O-DMT-2-O-[1(2-fluorophenyl)-4-ethoxypiperidin-4-yl]. In certain embodiments, each of the aforementioned RNA synthesis strategies can be used herein. In certain embodiments, the aforementioned RNA synthesis strategies can be performed together in a hybrid fashion e.g. using a 5-protecting group from one strategy with a 2-O-protecting from another strategy.

(208) In some embodiments, suitable target segments may be employed in a screen for additional oligomeric compounds that modulate the expression of a selected protein. Modulators are those oligomeric compounds that decrease or increase the expression of a nucleic acid molecule encoding a protein and which comprise at least an 8-nucleobase portion which is complementary to a suitable target segment. The screening method comprises the steps of contacting a suitable target segment of a nucleic acid molecule encoding a protein with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding a protein. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a nucleic acid molecule encoding a peptide, the modulator may then be employed herein in further investigative studies of the function of the peptide, or for use as a research, diagnostic, or therapeutic agent. In the case of oligomeric compounds targeted to microRNA, candidate modulators may be evaluated by the extent to which they increase the expression of a microRNA target RNA or protein (as interference with the activity of a microRNA will result in the increased expression of one or more targets of the microRNA).

(209) As used herein, expression refers to the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, splicing, post-transcriptional modification, and translation.

(210) Suitable target segments may also be combined with their respective complementary oligomeric compounds provided herein to form stabilized double-stranded (duplexed) oligonucleotides. Such double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature, 1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498; Elbashir et al., Genes Dev., 2001, 15, 188-200). For example, such double-stranded moieties have been shown to inhibit the target by the classical hybridization of antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., Science, 2002, 295, 694-697).

(211) The oligomeric compounds provided herein can also be applied in the areas of drug discovery and target validation. In certain embodiments, provided herein is the use of the oligomeric compounds and targets identified herein in drug discovery efforts to elucidate relationships that exist between proteins and a disease state, phenotype, or condition. These methods include detecting or modulating a target peptide comprising contacting a sample, tissue, cell, or organism with one or more oligomeric compounds provided herein, measuring the nucleic acid or protein level of the target and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further oligomeric compound as provided herein. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a particular disease, condition, or phenotype. In certain embodiments, oligomeric compounds are provided for use in therapy. In certain embodiments, the therapy is reducing target messenger RNA.

(212) As used herein, the term dose refers to a specified quantity of a pharmaceutical agent provided in a single administration. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual.

(213) In certain embodiments, chemically-modified oligomeric compounds are provided herein that may have a higher affinity for target RNAs than does non-modified DNA. In certain such embodiments, higher affinity in turn provides increased potency allowing for the administration of lower doses of such compounds, reduced potential for toxicity, improvement in therapeutic index and decreased overall cost of therapy.

(214) Effect of nucleoside modifications on RNAi activity is evaluated according to existing literature (Elbashir et al., Nature, 2001, 411, 494-498; Nishikura et al., Cell, 2001, 107, 415-416; and Bass et al., Cell, 2000, 101, 235-238.)

(215) In certain embodiments, oligomeric compounds provided herein can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Furthermore, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway. In certain embodiments, oligomeric compounds provided herein can be utilized either alone or in combination with other oligomeric compounds or other therapeutics as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues. Oligomeric compounds can also be effectively used as primers and probes under conditions favoring gene amplification or detection, respectively. These primers and probes are useful in methods requiring the specific detection of nucleic acid molecules encoding proteins and in the amplification of the nucleic acid molecules for detection or for use in further studies. Hybridization of oligomeric compounds as provided herein, particularly the primers and probes, with a nucleic acid can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of selected proteins in a sample may also be prepared.

(216) As one nonlimiting example, expression patterns within cells or tissues treated with one or more of the oligomeric compounds provided herein are compared to control cells or tissues not treated with oligomeric compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds and or oligomeric compounds which affect expression patterns.

(217) Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 1976-81), protein arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal. Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) and mass spectrometry methods (To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).

(218) Those skilled in the art, having possession of the present disclosure will be able to prepare oligomeric compounds, comprising a contiguous sequence of linked monomer subunits, of essentially any viable length to practice the methods disclosed herein. Such oligomeric compounds will include at least one region of --constrained nucleic acid as provided herein and may also include other monomer subunits including but not limited to nucleosides, modified nucleosides, nucleosides comprising sugar surrogate groups and nucleoside mimetics.

(219) While in certain embodiments, oligomeric compounds provided herein can be utilized as described, the following examples serve only to illustrate and are not intended to be limiting.

EXAMPLES (GENERAL)

(220) .sup.1H and .sup.13C NMR spectra were recorded on a 300 MHz and 75 MHz Bruker spectrometer, respectively.

Example 1

(221) Synthesis of Nucleoside Phosphoramidites

(222) The preparation of nucleoside phosphoramidites is performed following procedures that are illustrated herein and in the art such as but not limited to U.S. Pat. No. 6,426,220 and published PCT WO 02/36743.

Example 2

(223) Synthesis of Oligomeric Compounds

(224) The oligomeric compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as alkylated derivatives and those having phosphorothioate linkages.

(225) Oligomeric compounds: Unsubstituted and substituted phosphodiester (PO) oligomeric compounds, including without limitation, oligonucleotides can be synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.

(226) In certain embodiments, phosphorothioate internucleoside linkages (PS) are synthesized similar to phosphodiester internucleoside linkages with the following exceptions: thiation is effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time is increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55 C. (12-16 hr), the oligomeric compounds are recovered by precipitating with greater than 3 volumes of ethanol from a 1 M NH.sub.4OAc solution. Phosphinate internucleoside linkages can be prepared as described in U.S. Pat. No. 5,508,270.

(227) Alkyl phosphonate internucleoside linkages can be prepared as described in U.S. Pat. No. 4,469,863.

(228) 3-Deoxy-3-methylene phosphonate internucleoside linkages can be prepared as described in U.S. Pat. No. 5,610,289 or 5,625,050.

(229) Phosphoramidite internucleoside linkages can be prepared as described in U.S. Pat. No. 5,256,775 or 5,366,878.

(230) Alkylphosphonothioate internucleoside linkages can be prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively).

(231) 3-Deoxy-3-amino phosphoramidate internucleoside linkages can be prepared as described in U.S. Pat. No. 5,476,925.

(232) Phosphotriester internucleoside linkages can be prepared as described in U.S. Pat. No. 5,023,243.

(233) Borano phosphate internucleoside linkages can be prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198.

(234) Oligomeric compounds having one or more non-phosphorus containing internucleoside linkages including without limitation methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone oligomeric compounds having, for instance, alternating MMI and PO or PS linkages can be prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289.

(235) Formacetal and thioformacetal internucleoside linkages can be prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564.

(236) Ethylene oxide internucleoside linkages can be prepared as described in U.S. Pat. No. 5,223,618.

Example 3

(237) Isolation and Purification of Oligomeric Compounds

(238) After cleavage from the controlled pore glass solid support or other support medium and deblocking in concentrated ammonium hydroxide at 55 C. for 12-16 hours, the oligomeric compounds, including without limitation oligonucleotides and oligonucleosides, are recovered by precipitation out of 1 M NH.sub.4OAc with >3 volumes of ethanol. Synthesized oligomeric compounds are analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis is determined by the ratio of correct molecular weight relative to the 16 amu product (+/32+/48). For some studies oligomeric compounds are purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material are generally similar to those obtained with non-HPLC purified material.

Example 4

(239) Synthesis of Oligomeric Compounds Using the 96 Well Plate Format

(240) Oligomeric compounds, including without limitation oligonucleotides, can be synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleoside linkages are afforded by oxidation with aqueous iodine. Phosphorothioate internucleoside linkages are generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites can be purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per standard or patented methods and can be functionalized as base protected beta-cyanoethyldiisopropyl phosphoramidites.

(241) Oligomeric compounds can be cleaved from support and deprotected with concentrated NH.sub.4OH at elevated temperature (55-60 C.) for 12-16 hours and the released product then dried in vacuo. The dried product is then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.

Example 5

(242) Analysis of Oligomeric Compounds Using the 96-Well Plate Format

(243) The concentration of oligomeric compounds in each well can be assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products can be evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE 5000, ABI 270). Base and backbone composition is confirmed by mass analysis of the oligomeric compounds utilizing electrospray-mass spectroscopy. All assay test plates are diluted from the master plate using single and multi-channel robotic pipettors. Plates are judged to be acceptable if at least 85% of the oligomeric compounds on the plate are at least 85% full length.

Example 6

(244) In Vitro Treatment of Cells with Oligomeric Compounds

(245) The effect of oligomeric compounds on target nucleic acid expression is tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. Cell lines derived from multiple tissues and species can be obtained from American Type Culture Collection (ATCC, Manassas, Va.).

(246) The following cell type is provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays or RT-PCR.

(247) b.END cells: The mouse brain endothelial cell line b.END was obtained from Dr. Werner Risau at the Max Plank Institute (Bad Nauheim, Germany). b.END cells are routinely cultured in DMEM, high glucose (Invitrogen Life Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad, Calif.). Cells are routinely passaged by trypsinization and dilution when they reached approximately 90% confluence. Cells are seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.) at a density of approximately 3000 cells/well for uses including but not limited to oligomeric compound transfection experiments.

(248) Experiments involving treatment of cells with oligomeric compounds:

(249) When cells reach appropriate confluency, they are treated with oligomeric compounds using a transfection method as described.

(250) LIPOFECTIN

(251) When cells reached 65-75% confluency, they are treated with one or more oligomeric compounds.

(252) The oligomeric compound is mixed with LIPOFECTIN Invitrogen Life Technologies, Carlsbad, Calif.) in Opti-MEM-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) to achieve the desired concentration of the oligomeric compound(s) and a LIPOFECTIN concentration of 2.5 or 3 g/mL per 100 nM oligomeric compound(s). This transfection mixture is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, wells are washed once with 100 L OPTI-MEM-1 and then treated with 130 L of the transfection mixture. Cells grown in 24-well plates or other standard tissue culture plates are treated similarly, using appropriate volumes of medium and oligomeric compound(s). Cells are treated and data are obtained in duplicate or triplicate. After approximately 4-7 hours of treatment at 37 C., the medium containing the transfection mixture is replaced with fresh culture medium. Cells are harvested 16-24 hours after treatment with oligomeric compound(s).

(253) Other suitable transfection reagents known in the art include, but are not limited to, CYTOFECTIN, LIPOFECTAMINE, OLIGOFECTAMINE, and FUGENE. Other suitable transfection methods known in the art include, but are not limited to, electroporation.

Example 7

(254) Real-Time Quantitative PCR Analysis of Target mRNA Levels

(255) Quantitation of target mRNA levels is accomplished by real-time quantitative PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5 end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3 end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3 quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.

(256) Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be multiplexed with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only (single-plexing), or both (multiplexing).

(257) Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.

(258) RT and PCR reagents are obtained from Invitrogen Life Technologies (Carlsbad, Calif.). RT, real-time PCR is carried out by adding 20 L PCR cocktail (2.5PCR buffer minus MgCl.sub.2, 6.6 mM MgCl.sub.2, 375 M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM Taq, 5 Units MuLV reverse transcriptase, and 2.5ROX dye) to 96-well plates containing 30 L total RNA solution (20-200 ng). The RT reaction is carried out by incubation for 30 minutes at 48 C. Following a 10 minute incubation at 95 C. to activate the PLATINUM Taq, 40 cycles of a two-step PCR protocol are carried out: 95 C. for 15 seconds (denaturation) followed by 60 C. for 1.5 minutes (annealing/extension).

(259) Gene target quantities obtained by RT, real-time PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RIBOGREEN (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).

(260) In this assay, 170 L of RIBOGREEN working reagent (RIBOGREEN reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 L purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.

Example 8

(261) Analysis of Inhibition of Target Expression

(262) Antisense modulation of a target expression can be assayed in a variety of ways known in the art.

(263) For example, a target mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR. Real-time quantitative PCR is presently desired. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. One method of RNA analysis of the present disclosure is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

(264) Protein levels of a target can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.

(265) Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.

Example 9

(266) Design of Phenotypic Assays and In Vivo Studies for the Use of Target Inhibitors

(267) Phenotypic Assays Once target inhibitors have been identified by the methods disclosed herein, the oligomeric compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition.

(268) Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of a target in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).

(269) In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with a target inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.

(270) Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.

(271) Measurement of the expression of one or more of the genes of the cell after treatment is also used as an indicator of the efficacy or potency of the target inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.

(272) In Vivo Studies

(273) The individual subjects of the in vivo studies described herein are warm-blooded vertebrate animals, which includes humans.

Example 10

(274) RNA Isolation

(275) Poly(A)+ mRNA Isolation

(276) Poly(A)+ mRNA is isolated according to Miura et al., (Clin. Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 L cold PBS. 60 L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well, the plate is gently agitated and then incubated at room temperature for five minutes. 55 L of lysate is transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates are incubated for 60 minutes at room temperature, washed 3 times with 200 L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate is blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70 C., is added to each well, the plate is incubated on a 90 C. hot plate for 5 minutes, and the eluate is then transferred to a fresh 96-well plate.

(277) Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.

(278) Total RNA Isolation

(279) Total RNA is isolated using an RNEASY 96 kit and buffers purchased from Qiagen Inc. (Valencia, Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium is removed from the cells and each well is washed with 200 L cold PBS. 150 L Buffer RLT is added to each well and the plate vigorously agitated for 20 seconds. 150 L of 70% ethanol is then added to each well and the contents mixed by pipetting three times up and down. The samples are then transferred to the RNEASY 96 well plate attached to a QIAVAC manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum is applied for 1 minute. 500 L of Buffer RW1 is added to each well of the RNEASY 96 plate and incubated for 15 minutes and the vacuum is again applied for 1 minute. An additional 500 L of Buffer RW1 is added to each well of the RNEASY 96 plate and the vacuum is applied for 2 minutes. 1 mL of Buffer RPE is then added to each well of the RNEASY 96 plate and the vacuum applied for a period of 90 seconds. The Buffer RPE wash is then repeated and the vacuum is applied for an additional 3 minutes. The plate is then removed from the QIAVAC manifold and blotted dry on paper towels. The plate is then re-attached to the QIAVAC manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA is then eluted by pipetting 140 L of RNAse free water into each well, incubating 1 minute, and then applying the vacuum for 3 minutes.

(280) The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.

Example 11

(281) Target-Specific Primers and Probes

(282) Probes and primers may be designed to hybridize to a target sequence, using published sequence information.

(283) For example, for human PTEN, the following primer-probe set was designed using published sequence information (GENBANK accession number U92436.1, SEQ ID NO: 1).

(284) TABLE-US-00001 Forwardprimer: (SEQIDNO:2) AATGGCTAAGTGAAGATGACAATCAT Reverseprimer: (SEQIDNO:3) TGCACATATCATTACACCAGTTCGT
And the PCR probe:

(285) FAM-TTGCAGCAATTCACTGTAAAGCTGGAAAGG-TAMRA (SEQ ID NO: 4), where FAM is the fluorescent dye and TAMRA is the quencher dye.

Example 12

(286) Western Blot Analysis of Target Protein Levels

(287) Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 l/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to a target is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER (Molecular Dynamics, Sunnyvale Calif.).

Example 13

(288) Preparation of Phosphoramidites 1-15

(289) ##STR00023##

(290) Phosphoramidites 1-15 are prepared using procedures similar to published procedures (see Wilds et al., Nucleic Acids Research, 2000, 28(18), 3625-3635; Prakash et al., Org. Lett., 2003, 5(4), 403-406; Ravikumar et al., Process Research and Development, 2002, 6(6), 798-806; Martin, P., Helvetica Chimica Acta, 1995, 78(2), 486-504; WO 2011/123621; WO 2010/101951; WO 2010/048549; WO 2010/048585; WO 2008/101157; WO 1994/22890 and US patent U.S. Pat. No. 6,147,200).

Example 14

(291) General Method for the Preparation of Phosphoramidites 16-31b

(292) ##STR00024## ##STR00025##

(293) Phosphoramidites 16-31 are prepared as per the procedures well known in the art as described in the specification herein and also as per the procedures illustrated in Example 13. Compounds 31a and 31b are prepared using similar procedures as described in published literature (see Seth et al., Bioorg. Med. Chem., 2011, 21(4), 1122-1125, J Org. Chem., 2010, 75(5), 1569-1581, Nucleic Acids Symposium Series, 2008, 52(1), 553-554; and Martin et al., J. Am. Chem. Soc, 2011, 133(41), 16642-16649; also see published PCT International Applications (WO 2011/115818, WO 2010/091308, WO 2010/077578, WO2010/036698, WO2009/143369, WO 2009/006478, WO 2009/023855, and WO 2007/090071), and U.S. Pat. No. 7,569,686).

Example 15

(294) Preparation of Compounds 40 (RC5, S.sub.P) and 41 (RC5, R.sub.P)

(295) ##STR00026##

(296) Compound 32 is available from commercial sources. Compounds 38 and 39 were separated by column chromatography. Either isomer can be used for the subsequent phosphitylation reaction.

(297) The major isomer, Compound 38 was treated with TBAF to remove the TBS protecting group followed by a phosphitylation reaction to provide the desired phosphoramidite, Compound 40 which was used as building blocks for oligonucleotide synthesis. The structural analysis of Compound 40 was confirmed by .sup.1H and .sup.31P NMR spectroscopy.

Example 16

(298) Preparation of Compounds 45-45e (RC5, S.sub.P) and 46-46e (RC5, R.sub.P)

(299) ##STR00027##

(300) Phosphoramidites 2-15 and Compound 36 are prepared as per the procedures illustrated in Examples 13 and 15. The diastereomeric mixture obtained after cyclization is separated by column chromatography to provide the desired product as a single diastereomer (e.g. Compounds 43-43e or 44-44e).

Example 17

(301) General Method for the Preparation of Compounds 50-50e (RC5, S.sub.P and 51-51e (RC5, R.sub.P)

(302) ##STR00028##

(303) Phosphoramidites 16-30 and Compound 36 are prepared as per the procedures illustrated in Examples 14 and 15. The diastereomeric mixture obtained after cyclization is separated by column chromatography to provide the desired product as a single diastereomer (e.g. Compounds 48-48e or 49-49e).

Example 18

(304) General Method for the Preparation of Compounds 55 (RC5, S.sub.P) and 56 (RC5, R.sub.P)

(305) ##STR00029##

(306) Phosphoramidite 31 and Compound 36 are prepared as per the procedures illustrated in Examples 14 and 15. Compounds 53 and 54 are separated by column chromatography.

Example 19

(307) Preparation of Compounds 63 (RC5, S.sub.P) and 64 (RC5, R.sub.P)

(308) ##STR00030##

(309) Phosphoramidite 1 and Compound 33 are prepared as per the procedures illustrated in Examples 13 and 15.

(310) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the tosylate precursor (e.g. Compound 58) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 59).

(311) Oxidation followed by cyclization in the presence of Et.sub.3N provides the cyclic phosphoramidate as a diastereomeric mixture, which is separated by column chromatography to provide Compounds 61 and 62.

(312) TBS deprotection followed by phosphitylation provides the desired dimer phosphoramidites Compounds 63 and 64, which are used as building blocks in oligonucleotide synthesis.

Example 20

(313) Preparation of Compounds 71 (RC5, S.sub.P) and 72 (RC5, R.sub.P)

(314) ##STR00031##

(315) Phosphoramidite 1 and Compound 33 are prepared as per the procedures illustrated in Examples 13 and 15.

(316) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the thio tosylate precursor (e.g. Compound 66) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 67).

(317) Oxidation followed by cyclization in the presence of Et.sub.3N provides the cyclic phosphorothioate as a diastereomeric mixture, which is separated by column chromatography to provide Compounds 69 and 70. TBS deprotection followed by phosphitylation provides the desired dimer phosphoramidites Compounds 71 and 72, which are used as building blocks in oligonucleotide synthesis.

Example 21

(318) Preparation of Compounds 79 and 80

(319) ##STR00032##

(320) Compound 73 is available from commercial sources. Phosphoramidite 1 is prepared as per the procedures illustrated in Example 13. Compounds 77 and 78 are separated by column chromatography.

(321) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the iodo precursor (e.g. Compound 77 or 78) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 79 or 80).

Example 22

(322) Preparation of Compounds 83 (RC5, S.sub.P), 83a (RC5, R.sub.P), 84 (SC5, S.sub.P) and 84a (SC5, R.sub.P)

(323) ##STR00033##

(324) Compounds 79 and 80 are prepared as per the procedures illustrated in Example 21. Compounds 81 and 81a, or 82 and 82a are separated by column chromatography to provide the cyclic dimer as a single diastereomer. Either isomer, Compound 81, 81a, 82 or 82a can be used for a phosphitylation reaction to provide the desired phosphoramidites, Compounds 83-84a.

Example 23

(325) Preparation of Compounds 89 (RC5, S.sub.P) and 90 (RC5, R.sub.P)

(326) ##STR00034##

(327) Phosphoramidite 1 and Compound 75 are prepared as per the procedures illustrated in Examples 13 and 21.

(328) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the bromide precursor (e.g. Compound 86) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 87). Compounds 88 and 88a are separated by column chromatography.

Example 24

(329) Preparation of Compounds 97 (RC5, S.sub.P) and 98 (RC5, R.sub.P)

(330) ##STR00035##

(331) Phosphoramidite 1 and Compound 74 are prepared as per the procedures illustrated in Examples 13 and 21.

(332) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the bromo amine precursor (e.g. Compound 94) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 95). Compounds 96 and 96a are separated by column chromatography.

Example 25

(333) Preparation of Compounds 103 (RC5, S.sub.P) and 104 (RC5, R.sub.P)

(334) ##STR00036##

(335) Phosphoramidite 1 and Compound 92 are prepared as per the procedures illustrated in Examples 13 and 24. Compounds 102 and 102a are separated by column chromatography.

Example 26

(336) Preparation of Compounds 113 (RC5, S.sub.P) and 114 (RC5, R.sub.P)

(337) ##STR00037## ##STR00038##

(338) Compound 105 is available from commercial sources. Phosphoramidite 1 is prepared as per the procedures illustrated in Example 13.

(339) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the tosylate precursor (e.g. Compound 110) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 111). Compounds 112 and 112a are separated by column chromatography.

Example 27

(340) General Method for the Preparation of Compounds 123 (SC5, S.sub.P) and 124 (SC5, R.sub.P)

(341) ##STR00039## ##STR00040##

(342) Compound 105 is available from commercial sources. Phosphoramidite 1 is prepared as per the procedures illustrated in Example 13.

(343) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the tosylate precursor (e.g. Compound 119) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 120). Compounds 121 and 122 are separated by column chromatography.

Example 28

(344) General Method for the Preparation of Compounds 131 (RC5, S.sub.P) and 132 (SRC5, R.sub.P)

(345) ##STR00041##

(346) Phosphoramidite 1 and Compound 107 are prepared as per the procedures illustrated in Examples 13 and 26.

(347) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the bromo precursor (e.g. Compound 127) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 128). Compounds 129 and 130 are separated by column chromatography.

Example 29

(348) General Method for the Preparation of Compounds 139 (SC5, S.sub.P) and 140 (SC5, R.sub.P)

(349) ##STR00042##

(350) Phosphoramidite 1 and Compound 116 are prepared as per the procedures illustrated in Examples 13 and 27.

(351) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the bromo precursor (e.g. Compound 135) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 136). Compounds 137 and 138 are separated by column chromatography.

Example 30

(352) Preparation of Compounds 157-158 (RC5, S.sub.P) and 159-160 (RC5, R.sub.P)

(353) ##STR00043##

(354) Compounds 141 and 142 are prepared using procedures similar to published procedures (see Wilds et al., Nucleic Acids Research, 2000, 28(18), 3625-3635; Prakash et al., Org. Lett., 2003, 5(4), 403-406; Ravikumar et al., Process Research and Development, 2002, 6(6), 798-806; Martin, P., Helvetica Chimica Acta, 1995, 78(2), 486-504; WO 2011/123621; WO 2010/101951; WO 2010/048549; WO 2010/048585; WO 2008/101157; WO 1994/22890 and US patent U.S. Pat. No. 6,147,200). Phosphoramidite 1 is prepared as per the procedures illustrated in Example 13.

(355) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the tosylate precursor (e.g. Compound 149 or 150) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 151 or 152). Compounds 157-160 are separated by column chromatography.

Example 31

(356) Preparation of Compounds 169-170 (RC5, S.sub.P) and 171-172 (RC5, R.sub.P)

(357) ##STR00044##

(358) Phosphoramidite 1, Compounds 147 and 148 are prepared as per the procedures illustrated in Examples 13 and 30.

(359) Phosphoramidite 1 used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to couple with the bromo precursor (e.g. Compound 161 or 162) in the same manner as exemplified in Examples 15-18 to provide the desired dimer (e.g. Compound 163 or 164). Compounds 165 and 166, or 167 and 168 are separated by column chromatography.

Example 32

(360) Preparation of Compounds 174 and 175

(361) ##STR00045##

(362) Phosphoramidite 1 and Compound 85 are prepared as per the procedures illustrated in Examples 13 and 23. Trimethylsilyl acetylene, Compound 173 is available from commercial sources.

(363) Phosphoramidite 1 used in this example serve only to illustrate the compounds described herein and is not intended to be limiting. Various phosphoramidites as illustrated in Examples 13 and 14 (e.g. Compounds 2-31) can also be used to synthesize additional analogs of Compound 174.

Example 33

(364) Preparation of Compounds 182 (RC5, S.sub.P), 183 (RC5, R.sub.P), 184 (SC5, S.sub.P) and 185 (SC5, R.sub.P)

(365) ##STR00046##

(366) Compounds 174 and 175 are prepared as per the procedures illustrated in Example 32. Ring closing metathesis followed by palladium-catalyzed hydrogenation provides a diastereomeric mixture of Compounds 176 and 177, which is separated by column chromatography to provide the desired product as a single diastereomer. Either isomer can be used for the subsequent reactions. Similarly, the diastereomeric mixtures of Compounds 178 and 179, or 180 and 181 obtained after cyclization are also chromatographically separated. Either isomer can be used for a phosphitylation reaction to provide the desired phosphoramidites, Compounds 182-185.

Example 34

(367) Preparation of Compounds 194-195 (SC5, S.sub.P) and 196-197 (SC5, R.sub.P)

(368) ##STR00047##

(369) Compounds 145 and 146 are prepared as per the procedures illustrated in Example 30. Compounds 190 and 192, or 191 and 193 are separated by column chromatography.

Example 35

(370) Preparation of Compounds 206-207 (SC5, S.sub.P) and 208-209 (SC5, R.sub.P)

(371) ##STR00048##

(372) Compounds 145 and 146 are prepared as per the procedures illustrated in Example 30. Compounds 202 and 204, or 203 and 205 are separated by column chromatography.

Example 36

(373) General Method for the Preparation of Compounds 214 (RC5, S.sub.P) and 215 (RC5, R.sub.P)

(374) ##STR00049##

(375) Phosphoramidite 31 and Compound 210 are prepared using similar procedures as described in Examples 13-15, 26, and 30. Compounds 212 and 213 are separated by column chromatography.

Example 37

(376) General Method for the Preparation of Compounds 220 (SC5, S.sub.P) and 221 (SC5, R.sub.P)

(377) ##STR00050##

(378) Phosphoramidite 31 and Compound 216 are prepared using similar procedures as described in Examples 13-15, 27, and 34. Compounds 218 and 219 are separated by column chromatography.

Example 38

(379) General Method for the Preparation of Compounds 226 (RC5, S.sub.P) and 227 (RC5, R.sub.P)

(380) ##STR00051##

(381) Phosphoramidite 31 and Compound 222 are prepared using similar procedures as described in Examples 13-15, 28 and 31. Compounds 224 and 225 are separated by column chromatography.

Example 39

(382) General Method for the Preparation of Compounds 232 (SC5, S.sub.P) and 233 (SC5, R.sub.P)

(383) ##STR00052##

(384) Phosphoramidite 31 and Compound 228 are prepared using similar procedures as described in Examples 13-15, 29 and 35. Compounds 230 and 231 are separated by column chromatography.

Example 40

(385) General Method for the Preparation of Compounds 237 (RC5, S.sub.P) and 238 (RC5, R.sub.P)

(386) ##STR00053##

(387) Phosphoramidite 31a and Compound 210 are prepared using similar procedures as described in Examples 14, 26 and 30. Compounds 235 and 236 are separated by column chromatography.

(388) Phosphoramidite 31a used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Additional bicyclic phosphoramidites known in the art as described in the specification herein can also be employed to generate various dimeric phosphoramidite analogs of Compounds 237 and 238. These dimers are used as phosphoramidite building blocks for oligonucleotide synthesis.

Example 41

(389) General Method for the Preparation of Compounds 242 (RC5, S.sub.P) and 243 (RC5, R.sub.P)

(390) ##STR00054##

(391) Phosphoramidite 31a and Compound 222 are prepared using similar procedures as described in Examples 14, 28 and 38. Compounds 240 and 241 are separated by column chromatography.

(392) Phosphoramidite 31a used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Additional bicyclic phosphoramidites known in the art as described in the specification herein can also be employed to generate various dimeric phosphoramidite analogs of Compounds 242 and 243. These dimers are used as phosphoramidite building blocks for oligonucleotide synthesis.

Example 42

(393) General Method for the Preparation of Compounds 247 (RC5, S.sub.P) and 248 (RC5, R.sub.P)

(394) ##STR00055##

(395) Phosphoramidite 31b and Compound 210 are prepared using similar procedures as described in Examples 14, 26 and 30. Compounds 245 and 246 are separated by column chromatography.

(396) Phosphoramidite 31b used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Additional sugar surrogate groups known in the art as described in the specification herein can also be employed to generate various dimeric phosphoramidite analogs of Compounds 247 and 248. These dimers are used as phosphoramidite building blocks for oligonucleotide synthesis.

Example 43

(397) General Method for the Preparation of Compounds 252 (RC5, S.sub.P) and 253 (RC5, R.sub.P)

(398) ##STR00056##

(399) Phosphoramidite 31b and Compound 222 are prepared using similar procedures as described in Examples 14, 28 and 38. Compounds 250 and 251 are separated by column chromatography.

(400) Phosphoramidite 31b used in the coupling step serves only to illustrate the compounds described herein and is not intended to be limiting. Additional sugar surrogate groups known in the art as described in the specification herein can also be employed to generate various dimeric phosphoramidite analogs of Compounds 252 and 253. These dimers are used as phosphoramidite building blocks for oligonucleotide synthesis.

Example 44

(401) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 258 (RC5, S.sub.P).sub.2 and 259 (RC5, S.sub.P)-(RC5, R.sub.P)

(402) ##STR00057## ##STR00058##

(403) Dimeric phosphoramidite 214 and the tosylate precursor, Compound 254 are prepared using similar procedures as described in Example 26, 30 and 36, respectively. Compounds 256 and 257 are separated by column chromatography.

(404) Dimeric phosphoramidite 214 and the tosylate precursor, Compound 254 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and dimeric phosphoramidite subunits as illustrated in Examples 15-43 can also be employed to construct trimers, tetramers or multiple monomer subunits that are used as building blocks in oligonucleotide synthesis.

Example 45

(405) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 264 (RC5, S.sub.P).sub.2 and 265 (RC5, S.sub.P)-(RC5, R.sub.P)

(406) ##STR00059## ##STR00060##

(407) Dimeric phosphoramidite 226 and the bromo precursor, Compound 260 are prepared using similar procedures as described in Example 38. Compounds 262 and 263 are separated by column chromatography.

(408) Dimeric phosphoramidite 226 and the bromo precursor, Compound 260 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and dimeric phosphoramidite subunits as illustrated in Examples 15-43 can also be employed to construct trimers, tetramers or multiple monomer subunits that are used as building blocks in oligonucleotide synthesis.

Example 46

(409) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 269 (RC5, S.sub.P).sub.2 and 270 (RC5, S.sub.P)-(RC5, R.sub.P)

(410) ##STR00061## ##STR00062##

(411) Dimeric phosphoramidite 237 and the tosylate precursor, Compound 254 are prepared using similar procedures as described in Example 40 and 44, respectively. Compounds 267 and 268 are separated by column chromatography.

(412) Dimeric phosphoramidite 237 and the tosylate precursor, Compound 254 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and dimeric phosphoramidite subunits as illustrated in Examples 15-43 can also be employed to construct trimers, tetramers or multiple monomer subunits that are used as building blocks in oligonucleotide synthesis.

Example 47

(413) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 274 (RC5, S.sub.P).sub.2 and 275 (RC5, S.sub.P)-(RC5, R.sub.P)

(414) ##STR00063## ##STR00064##

(415) Dimeric phosphoramidite 242 and the bromo precursor, Compound 260 are prepared using similar procedures as described in Example 41 and 45, respectively. Compounds 272 and 273 are separated by column chromatography.

(416) Dimeric phosphoramidite 242 and the bromo precursor, Compound 260 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and dimeric phosphoramidite subunits as illustrated in Examples 15-43 can also be employed to construct trimers, tetramers or multiple monomer subunits that are used as building blocks in oligonucleotide synthesis.

Example 48

(417) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 279 (RC5, S.sub.P).sub.2 and 280 (RC5, S.sub.P)-(RC5, R.sub.P)

(418) ##STR00065##

(419) Dimeric phosphoramidite 247 and the tosylate precursor, Compound 254 are prepared using similar procedures as described in Example 42 and 44, respectively. Compounds 277 and 278 are separated by column chromatography.

(420) Dimeric phosphoramidite 247 and the tosylate precursor, Compound 254 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and dimeric phosphoramidite subunits as illustrated in Examples 15-43 can also be employed to construct trimers, tetramers or multiple monomer subunits that are used as building blocks in oligonucleotide synthesis.

Example 49

(421) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 284 (RC5, S.sub.P).sub.2 and 285 (RC5, S.sub.P)-(RC5, R.sub.P)

(422) ##STR00066##

(423) Dimeric phosphoramidite 252 and the bromo precursor, Compound 260 are prepared using similar procedures as described in Example 43 and 47, respectively. Compounds 282 and 283 are separated by column chromatography.

(424) Dimeric phosphoramidite 252 and the bromo precursor, Compound 260 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and dimeric phosphoramidite subunits as illustrated in Examples 15-43 can also be employed to construct trimers, tetramers or multiple monomer subunits that are used as building blocks in oligonucleotide synthesis.

Example 50

(425) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 289 (RC5, S.sub.P).sub.2 and 290 (RC5, S.sub.P)-(RC5, R.sub.P)

(426) ##STR00067## ##STR00068##

(427) Compounds 94, 100 and 131 are prepared as per the procedures illustrated in Examples 24, 26 and 28. The amino and thio precursors along with Phosphoramidite 131 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and phosphoramidites as illustrated in Examples 13-43 can also be employed to construct trimers, tetramers or multiple monomer subunits that are used as building blocks in oligonucleotide synthesis. Compounds 287 and 288 are separated by column chromatography.

Example 51

(428) General Method of for the Preparation of Trimeric Phosphoramidites, Compounds 294 (SRC5, S.sub.P).sub.2 and 295 (RC5, S.sub.P)-(RC5, R.sub.P)

(429) ##STR00069## ##STR00070##

(430) Compounds 127 and 131 are prepared as per the procedures illustrated in Example 28. The bromo precursor and Phosphoramidite 131 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and phosphoramidites as illustrated in Examples 13-43 can also be employed to construct trimers, tetramers or multiple building block subunits that are used in oligonucleotide synthesis. Compounds 292 and 293 are separated by column chromatography.

Example 52

(431) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 303 (RC5, S.sub.P)-(SC5, S.sub.P) and 304 (RC5, S.sub.P)-(SC5, R.sub.P)

(432) ##STR00071## ##STR00072##

(433) Compounds 119 and 131 are prepared as per the procedures illustrated in Examples 27 and 28. The tosylate precursor and Phosphoramidite 131 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and phosphoramidites as illustrated in Examples 13-43 can also be employed to construct trimers, tetramers or multiple building block subunits that are used in oligonucleotide synthesis. Compounds 301 and 302 are separated by column chromatography.

Example 53

(434) General Method for the Preparation of Trimeric Phosphoramidites, Compounds 308 (RC5, S.sub.P).sub.2 and 309 (RC5, S.sub.P)-(RC5, R.sub.P)

(435) ##STR00073## ##STR00074##

(436) Compounds 58, 66 and 131 are prepared as per the procedures illustrated in Examples 19, 20 and 28. The amino and thio tosylate precursors along with Phosphoramidite 131 used in the coupling step serve only to illustrate the compounds described herein and are not intended to be limiting. Additional precursors and phosphoramidites as illustrated in Examples 13-43 can also be employed to construct trimers, tetramers or multiple building block subunits that are used in oligonucleotide synthesis. Compounds 306 and 307 are separated by column chromatography.

Example 54

(437) General Preparation of Oligomeric Compound 312 (RC5, S.sub.P)

(438) ##STR00075##

(439) The Unylinker 310 is commercially available. Oligomeric Compound 312 comprising a cyclic phosphonate internucleoside linkage is prepared using standard procedures in automated DNA/RNA synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). Phosphoramidite building block Compound 226 is prepared as per the procedures illustrated in Example 38. The synthetic steps illustrated are meant to be representative and not limiting as other dimers and trimers or longer building blocks which are disclosed in examples 13 to 43 can be used in place of Compound 226 to prepare an oligomeric compound having a predetermined sequence and composition such as a specific motif. The order of addition to the solid support can also be altered to provide for a region of --constrained nucleic acid or multiple regions located at predetermined positions within an oligomeric compound.

(440) The synthetic methods described herein (e.g. Examples 13-53) are versatile and allow for the incorporation of cyclic phosphorus containing internucleoside linkage(s) to be introduced at any position of the oligonucleotide.

Example 55

(441) General Method for the Preparation of Oligomeric Compounds Comprising a Cyclic Phosphate Internucleoside Linkage Via Solid Phase Techniques (Preparation of 460209, 575149 and 626304)

(442) Unless otherwise stated, all reagents and solutions used for the synthesis of oligomeric compounds are purchased from commercial sources. Standard phosphoramidite building blocks and solid support are used for incorporation nucleoside residues which include for example T, A, U, G, C and .sup.mC residues. A 0.2 M solution of phosphoramidite in anhydrous acetonitrile was used for 2-O-MOE, P-D-2-deoxyribonucleoside monomers and cyclic phosphate containing -D-2-deoxyribonucleoside dimers. For constrained ethyl (cEt) BNA phosphoramidite, a 0.2 M solution in a 1:1 (v/v) mixture of acetonitrile and toluene was used.

(443) The oligomeric compound was synthesized on VIMAD UnyLinker solid support and the appropriate amounts of solid support were packed in the column for synthesis. Dichloroacetic acid (3%) in DCM was used as detritylating reagent. 4,5-Dicyanoimidazole in the presence of N-methylimidazole or 1H-tetrazole in CH.sub.3CN was used as activator during the coupling step. The synthesis of oligomeric compounds was performed on an ABI394 synthesizer (Applied Biosystems) on a 2 mol scale using the procedures set forth below.

(444) A solid support preloaded with the Unylinker was loaded into a synthesis column after closing the column bottom outlet and CH.sub.3CN was added to form a slurry. The swelled support-bound Unylinker was treated with a detritylating reagent containing 3% dichloroacetic acid in DCM to provide the free hydroxyl groups. During the coupling step, four to fourteen equivalents of phosphoramidite solutions were delivered with coupling for 10 minutes. All of the other steps followed standard protocols. Phosphorothioate linkages were introduced by sulfurization with PADS (0.2 M) in 1:1 pyridine/CH.sub.3CN for a contact time of 5 minutes.

(445) After the desired sequence was assembled, the cyanoethyl phosphate protecting groups were deprotected using a 1:1 (v/v) mixture of triethylamine and acetonitrile. The solid support bound oligomeric compound was washed with acetonitrile and dried under high vacuum. The solid-support bound oligomeric compound was then suspended in ammonia (28-30 wt %) at room temperature for 48 h to remove nucleobase protecting groups and to cleave from the solid support.

(446) The unbound oligomeric compound was then filtered and the support was rinsed and filtered with water:ethanol (1:1) followed by water. The filtrate was combined and concentrated to dryness. The residue obtained was purified by cationic ion exchange HPLC (Source 30Q resin, A50 mM sodium bicarbonate in CH.sub.3CN:H.sub.2O 3:7 (v/v), B50 mM sodium bicarbonate, 1.5 M sodium bromide in CH.sub.3CN:H.sub.2O 3:7 (v/v), 0-30% in 110 min, flow 6 mL/min, =260 nm). Fractions containing full-length oligomeric compound were pooled together (assessed by LC/MS analysis>95%). The residue was desalted by HPLC on a reverse phase cartridge to yield the desired oligomeric compound. ISIS 460209 was also synthesized and analyzed in the same manner as described herein.

(447) The modified oligomeric compounds were evaluated in a thermal stability (T.sub.m) assay. A Cary 100 Bio spectrophotometer with the Cary Win UV Thermal program was used to measure absorbance vs. temperature. For the T.sub.m experiments, oligomeric compounds were prepared at a concentration of 8 M in a buffer of 100 mM Na+, 10 mM phosphate, 0.1 mM EDTA, pH 7. The concentration of the oligonucleotides was determined at 85 C. The concentration of each oligomeric compound was 4 M after mixing of equal volumes of test oligomeric compound and complimentary RNA strand (or the RNA strand having a single base mismatch). Oligomeric compounds were hybridized with the complimentary RNA strand by heating the duplex to 90 C. for 5 minutes followed by cooling to room temperature. Using the spectrophotometer, T.sub.m measurements were taken by heating the duplex solution at a rate of 0.5 C/min in cuvette starting @ 15 C. and heating to 85 C. T.sub.m values were determined using Vant Hoff calculations (A.sub.260 vs temperature curve) using non self-complementary sequences where the minimum absorbance which relates to the duplex and the maximum absorbance which relates to the non-duplex single strand are manually integrated into the program. The oligomeric compounds are hybridized to a complementary region of 30mer RNA SEQ ID NO.: 07 (Tm.sup.1), and also to a single base mismatch 30mer RNA SEQ ID NO.: 08 (Tm.sup.2). The results are presented below.

(448) TABLE-US-00002 SEQIDNO./ Tm.sup.1 Tm.sup.2 ISISNO. Composition(5 to3) (RNA.sup.mu) (RNA.sup.wt) 06/460209 T.sub.eA.sub.kA.sub.kA.sub.dT.sub.dT.sub.dG.sub.dT.sub.d.sup.mC.sub.dA.sub.dT.sub.d.sup.mC.sub.dA.sub.k.sup.mC.sub.k.sup.mC.sub.e (53.7) (52.2) 06/575149 T.sub.eA.sub.kA.sub.kA.sub.dT.sub.xTG.sub.dT.sub.d.sup.mC.sub.dA.sub.dT.sub.d.sup.mC.sub.dA.sub.k.sup.mC.sub.k.sup.mC.sub.e 2.7 1.3 06/626304 T.sub.eA.sub.kA.sub.kA.sub.dT.sub.yTG.sub.dT.sub.d.sup.mC.sub.dA.sub.dT.sub.d.sup.mC.sub.dA.sub.k.sup.mC.sub.k.sup.mC.sub.e -2.3 -2.3 SEQIDNO. RNAComplementaryStrands(5 to3) 07/539568 AGACUUUUUCUGGUGAUGACAAUUUAUUAA complementarymutant(mu) 08/539569 AGACUUUUUCUGGUGAUGGCAAUUUAUUAA singlebasemismatchwild type(wt)

(449) Each internucleoside linkage for the modified oligonucleotides is a phosphorothioate internucleoside linkage except for the dimers T.sub.xT and T.sub.yT, the internucleoside linkages of which are shown below. Each internucleoside linkage for the RNA complementary strands is a phosphodiester internucleoside linkage. Each nucleoside followed by a subscript e indicates a 2-O-methoxyethyl (MOE) modified nucleoside. Each nucleoside followed by a subscript k indicates an (S)-cEt modified nucleoside (constrained ethyl bicyclic nucleoside having a 4-CH[(S)CH.sub.3)]O-2 bridging group) as shown below. Each nucleoside followed by a subscript d is a -D-2-deoxyribonucleoside. Each .sup.mC is a 5-methyl cytosine modified nucleoside.

(450) ##STR00076##

Example 56

(451) Single Nucleotide Polymorphisms (SNPs) in the Huntingtin (HTT) Gene Sequence

(452) SNP positions (identified by Hayden et al, WO/2009/135322) associated with the HTT gene were mapped to the HTT genomic sequence, designated herein as SEQ ID NO: 5 (NT_006081.18 truncated from nucleotides 1566000 to 1768000). The chart below provides SNP positions associated with the HTT gene and a reference SNP ID number from the Entrez SNP database at the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp), incorporated herein by reference. The chart below furnishes further details on each SNP. The Reference SNP ID number or RS number is the number designated to each SNP from the Entrez SNP database at NCBI, incorporated herein by reference. SNP position refers to the nucleotide position of the SNP on SEQ ID NO: 5. Polymorphism indicates the nucleotide variants at that SNP position. Major allele indicates the nucleotide associated with the major allele, or the nucleotide present in a statistically significant proportion of individuals in the human population. Minor allele indicates the nucleotide associated with the minor allele, or the nucleotide present in a relatively small proportion of individuals in the human population.

Single Nuclear Polymorphisms (SNPs) and their Positions on SEQ ID NO: 5

(453) TABLE-US-00003 SNP Major Minor RS No. position Polymorphism allele allele rs2857936 1963 C/T C T rs12506200 3707 A/G G A rs762855 14449 A/G G A rs3856973 19826 G/A G A rs2285086 28912 G/A A G rs7659144 37974 C/G C G rs16843804 44043 C/T C T rs2024115 44221 G/A A G rs10015979 49095 A/G A G rs7691627 51063 A/G G A rs2798235 54485 G/A G A rs4690072 62160 G/T T G rs6446723 66466 C/T T C rs363081 73280 G/A G A rs363080 73564 T/C C T rs363075 77327 G/A G A rs363064 81063 T/C C T rs3025849 83420 A/G A G rs6855981 87929 A/G G A rs363102 88669 G/A A G rs11731237 91466 C/T C T rs4690073 99803 A/G G A rs363144 100948 T/G T G rs3025838 101099 C/T C T rs34315806 101687 A/G G A rs363099 101709 T/C C T rs363096 119674 T/C T C rs2298967 125400 C/T T C rs2298969 125897 A/G G A rs6844859 130139 C/T T C rs363092 135682 C/A C A rs7685686 146795 A/G A G rs363088 149983 A/T A T rs362331 155488 C/T T C rs916171 156468 G/C C G rs362322 161018 A/G A G rs362275 164255 T/C C T rs362273 167080 A/G A G rs2276881 171314 G/A G A rs3121419 171910 T/C C T rs362272 174633 G/A G A rs362271 175171 G/A G A rs3775061 178407 C/T C T rs362310 179429 A/G G A rs362307 181498 T/C C T rs362306 181753 G/A G A rs362303 181960 T/C C T rs362296 186660 C/A C A rs1006798 198026 A/G A G

Example 57

(454) Modified Oligonucleotides Targeting Huntingtin (HTT) Single Nucleotide Polymorphism (SNP)

(455) A modified oligonucleotide was designed based on a parent gapmer, ISIS 460209 wherein the central gap region contains nine (-D-2-deoxyribonucleosides. The modified oligonucleotide was designed by introducing a cyclic phosphate internucleoside linkage within the central gap region of the gapmer. The cyclic phosphate containing oligonucleotide (ISIS 575149) was tested for its ability to selectively inhibit mutant (mut) HTT mRNA expression levels targeting rs7685686 while leaving the expression of the wild-type (wt) intact. The potency and selectivity of the modified oligonucleotide (ISIS 575149) was evaluated and compared to the parent gapmer (ISIS 460209).

(456) The composition and motif for the modified oligonucleotide is described previously in Example 55. The position on the oligonucleotides opposite to the SNP position, as counted from the 5-terminus is position 8.

(457) Cell Culture and Transfection

(458) The modified oligonucleotide was tested in vitro. Heterozygous fibroblast GM04022 cell line was used (from Coriell Institute). Cultured GM04022 cells at a density of 25,000 cells per well were transfected using electroporation with 0.12, 0.37, 1.1, 3.3 and 10 M concentrations of modified oligonucleotides. After a treatment period of approximately 24 hours, cells were washed with DPBS buffer and lysed. RNA was extracted using Qiagen RNeasy purification and mRNA levels were measured by quantitative real-time PCR using ABI assay C_2229297_10 which measures at dbSNP rs362303. RT-PCR method in short; A mixture was made using 2020 uL 2PCR buffer, 101 uL primers (300 uM from ABI), 1000 uL water and 40.4 uL RT MIX. To each well was added 15 uL of this mixture and 5 uL of purified RNA. The mutant and wild-type HTT mRNA levels were measured simultaneously by using two different fluorophores, FAM for mutant allele and VIC for wild-type allele. The HTT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN and the results are presented below.

(459) Analysis of IC.sub.50's

(460) The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is presented below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of HTT mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of HTT mRNA expression was achieved compared to the control. The IC.sub.50 at which each oligonucleotide inhibits the mutant HTT mRNA expression is denoted as mut IC.sub.50. The IC.sub.50 at which each oligonucleotide inhibits the wild-type HTT mRNA expression is denoted as wt IC.sub.50. Selectivity was calculated by dividing the IC.sub.50 for inhibition of the wild-type HTT versus the IC.sub.50 for inhibiting expression of the mutant HTT mRNA. The results are presented below.

(461) The parent gapmer, ISIS 460209 is included in the study as a benchmark oligonucleotide against which the potency and selectivity of the modified oligonucleotide is compared. As illustrated below, the oligonucleotide containing a cyclic phosphate internucleoside linkage in the central gap region exhibited enhanced potency and selectivity as compared to the parent gapmer having a full deoxy gap.

(462) TABLE-US-00004 SEQIDNO./ ISISNO. Composition(5 to3) 06/460209 T.sub.eA.sub.kA.sub.kA.sub.dT.sub.dT.sub.dG.sub.dT.sub.d.sup.mC.sub.dA.sub.dT.sub.d.sup.mC.sub.dA.sub.k.sup.mC.sub.k.sup.mC.sub.e 06/575149 T.sub.eA.sub.kA.sub.kA.sub.dT.sub.xTG.sub.dT.sub.d.sup.mC.sub.dA.sub.dT.sub.d.sup.mC.sub.dA.sub.k.sup.mC.sub.k.sup.mC.sub.e 06/626304 T.sub.eA.sub.kA.sub.kA.sub.dT.sub.yTG.sub.dT.sub.d.sup.mC.sub.dA.sub.dT.sub.d.sup.mC.sub.dA.sub.k.sup.mC.sub.k.sup.mC.sub.e

(463) (see Example 55 for description of oligonucleotide modifications)

(464) TABLE-US-00005 SEQ ID NO./ Mut Selectivity ISIS NO. IC.sub.50 (M) (mut vs. wt) Gap Chemistry 06/460209 0.33 4.2 2-deoxy gap 06/575149 0.14 7.2-paper single cyclic PO, T.sub.xT 06/626304 0.25 27 single cyclic PO, T.sub.yT

(465) All publications, patents, and patent applications referenced herein are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.