METHOD FOR INCREASING FETAL HEMOGLOBIN EXPRESSION LEVEL
20200384032 ยท 2020-12-10
Inventors
- Pengfei YUAN (Beijing, CN)
- Riguo FANG (Beijing, CN)
- Lingling YU (Beijing, CN)
- Penghui XIA (Beijing, CN)
- Jia WANG (Beijing, CN)
- Fucai LIANG (Beijing, CN)
Cpc classification
C12N2501/125
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K2035/124
HUMAN NECESSITIES
C12N15/87
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
C12N5/0647
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
C12N2501/999
CHEMISTRY; METALLURGY
A61K35/28
HUMAN NECESSITIES
C12N2310/346
CHEMISTRY; METALLURGY
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
Abstract
Provided is a method for gene editing of an enhancer site of the BCL11A in hematopoietic stem cells. The genetically modified hematopoietic stem cells have the functions of normal cells, and can significantly increase the expression of fetal hemoglobin so as to be used in the treatment of thalassemia and sickle cell anemia.
Claims
1: A method for increasing fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495219-60495336 in the chromosome 2 of the hematopoietic stem cells by gene editing technology.
2: The method of claim 1, wherein the gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology, or a CRISPR/Cas gene editing technology.
3: The method of claim 2, wherein the gene editing technology is CRISPR/Cas9 gene editing technology.
4: The method of claim 3, wherein the target nucleotide sequence of BCL11A genome is complementary to a sequence selected from any one of SEQ ID NOs: 3-25.
5: The method of claim 4, an sgRNA comprising a sequence selected from any one of SEQ ID NOs: 3-25 is introduced into the hematopoietic stem cell for the gene editing of the BCL11A genome.
6: The method of claim 5, wherein the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified.
7: The method of claim 6, wherein the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA.
8: The method of claim 4, wherein the sgRNA and the Cas9-encoding nucleotides are co-introduced into the hematopoietic stem cells.
9: The method of claim 8, wherein the sgRNA and the Cas9-encoding nucleotides are co-introduced into the hematopoietic stem cells by electroporation.
10: The method of claim 9, wherein the electroporation conditions are 200-600 V, 0.5-2 ms.
11-18. (canceled)
19: A method for preparing mature erythrocytes or precursor cells thereof being genetically modified to increase the fetal hemoglobin (HbF) expression, comprising: (a) obtaining genetically modified hematopoietic stem cells by the method of claim 4; (b) performing hematopoietic stem cell erythroid expansion and differentiation of the genetically modified hematopoietic stem cells by using a HSPCs erythroid expansion and differentiation medium; wherein the HSPCs erythroid expansion and differentiation medium comprises a basal medium and a composition of growth factors, and wherein the composition of growth factors comprises a stem cell growth factor (SCF); interleukin 3, (IL-3) and erythropoietin (EPO).
20: The method of claim 19, further comprising: performing erythroid differentiation and enucleation on hematopoietic stem cells by using an erythroid differentiation and enucleation medium; wherein the erythroid differentiation and enucleation medium comprises a basal medium, growth factors, and antagonists and/or inhibitors of a progesterone receptor and a glucocorticoid receptor.
21: The method of claim 20, wherein the growth factors in the erythroid differentiation and enucleation medium comprise erythropoietin (EPO), wherein the antagonists and/or inhibitors of a progesterone receptor and a glucocorticoid receptor are any one, or two or more selected from the following compounds (I)-(IV): ##STR00006##
22-31. (canceled)
32: A sgRNA construct comprising a nucleotide sequence selected from any one of SEQ ID NOs: 3-25
33: The construct of claim 32, comprising a 2-O-methyl nucleotide modification and/or an internucleotide 3-thio modification.
34: The construct of claim 33, wherein the chemical modification is a 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of a nucleotide sequence selected from any one of SEQ ID NOs: 3-25.
35-39. (canceled)
40: A hematopoietic stem cell obtained by the method of claim 4.
41: The hematopoietic stem cell of claim 40, which has increased fetal hemoglobin (HbF) expression by genetic modification, wherein a BCL11A genomic region from positions 60495219-60495336 in the chromosome 2 of the hematopoietic stem cell is disrupted by gene editing technology.
42: A method for treating or preventing an anemia disease, a hemorrhagic disease, a tumor, or other diseases requiring massive blood transfusion in a subject, comprising administering the hematopoietic stem cells of claim 41 to the subject.
43: The method of claim 42, wherein the disease is thalassemia or sickle cell anemia.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS
[0090] The application relates to gene editing of a BCL11A enhancer locus of CD34-positive hematopoietic stem cells, and obtaining hematopoietic stem cells with efficiently edited BCL11A enhancer by optimizing various conditions of a CRISPR/Cas system, such as sgRNA, transfection conditions and the like. Experimental results prove that the resulting hematopoietic stem cells have normal functions for erythroid differentiation in vitro and the reconstituted hematopoietic system in animal models, and the off-target analysis proves that the cells are safe and reach the standards for clinical treatment.
[0091] The present invention provides genetically modified hematopoietic stem cells, erythrocyte precursors, or mature erythrocytes of clinical therapeutic levels for the treatment or prevention of anemias, hemorrhagic diseases, tumors or other diseases requiring massive blood transfusion, such as thalassemia and sickle cell anemia.
[0092] The present invention provides an sgRNA (e.g., a chemically modified sgRNA) comprising a nucleotide sequence selected from any one of SEQ ID NOs: 3-25, for gene editing of the hematopoietic stem cells.
[0093] The present invention also provides a method for gene editing of hematopoietic stem cells of patients with thalassemia and sickle cell anemia.
[0094] One purpose of the present invention is to efficiently modify the gene of CD34.sup.+ hematopoietic stem cells by CRISPR/Cas gene editing technology. For example, CD34.sup.+ hematopoietic stem cells may be obtained from umbilical cord blood or bone marrow, then gene editing is performed by introducing Cas9 and a given sgRNA into the hematopoietic stem cells under the optimized electroporation conditions, and the genetically modified hematopoietic stem cells are transplanted into experimental animals for the evaluation of the ability of the hematopoietic stem cells to repopulate the hematopoietic system. The sgRNA may be designed for targeting BCL11A enhancer such as targeting BCL11A (+58) locus, by a variety of design software such as CRISPR RGEN TOOLS software.
[0095] In some embodiments, the designed sgRNA ischemically modified, such as a 2-O-methyl modification and an internucleotide 3-thio modification at the three bases of its 5-end and 3-end. Efficient sgRNAs are obtained through the test of combinations of Cas9 mRNA and different sgRNAs. In certain embodiments, the hematopoietic stem cells are obtained by clinical grade magnetic column sorting, and Cas9 protein encoding nucleotides and chemically modified sgRNAs for gene editing are obtained by in vitro transcription assays. The genetically modified hematopoietic stem cells are differentiated into erythroid lineage, and the erythropoiesis rate is detected. For example, the genetically modified hematopoietic stem cells are transplanted into NPG mice irradiated by irradiator for the evaluation of their ability to repopulate the hematopoietic system; or the CD34-positive hematopoietic stem cells of patients may be isolated for the evaluation of gene editing efficiency, erythroid differentiation ability, globin and fetal hemoglobin expression.
[0096] Firstly, the invention provides a method for improving the expression of fetal hemoglobin (HbF), which comprises performing gene editing of an enhancer locus of BCL11A in the hematopoietic stem cells by CRISPR/Cas9 editing technology.
[0097] An sgRNA targeting sequence of BCL11A enhancer locus in hematopoietic stem cell is designed in the editing process. The enhancer loci of BCL11A are named as loci +62, +58 and +55, according to their distances (numbers of kilobase) from the transcription initiation site. It is reported that the erythroid enhancer of BCL11A gene negatively regulates fetal hemoglobin (HbF) expression, wherein the region containing the positions with a distance of 55 kb (kb represents 1000 bases), 58 kb and 62 kb from the transcription initiation site is a key regulatory region. Although researchers have studied the loci +55, +58, and +62, the length of gene sequences before and after the above three loci are all above 1000 bp, with a total of about 6000 bp, and thus those skilled in the art do not know which specific region may be edited to achieve the desired editing effect, and even for locus +58, the gene editing efficiency differs greatly (see: Bauer, D. E. et al. An erythroid enhancer of BCL11A subject to genetic variation determines fetal hemoglobin level. Science. 342 253-257 (2013), and Canver M C, et al. Enhancer section by Cas9-mediated in situ saturating mutagenesis. Nature. 2015 Nov. 12 of BCL11A; 527(7577): 192-7.). Therefore, the first problem for those skilled in the art is to find a specific region which is crucial for gene editing efficiency.
[0098] The inventors of the present application have found through intensive studies that a base sequence of 150 bp at locus +58 (e.g., as shown in SEQ ID NO: 2) has a great influence on the efficiency of gene editing. The region targeted by the sgRNAs of the present invention is an editable region and may be used efficiently for clinical application. The 150 bp genomic sequence is located in the region from base 60495197 to base 60495346 (abbreviated herein as chr2: 60495197-60495346) on human chromosome 2.
[0099] All the sgRNAs provided in the invention may be used to efficiently realize gene editing of the hematopoietic stem cells from both healthy donors and anemia patients, wherein the candidate sgRNAs with relatively higher efficiency may obviously improve the expression of fetal hemoglobin. It was reported in the literatures that, by designing sgRNAs libraries for loci +55, +58, and +62, and screening with cell models by using CRISPR/Cas9, a sequence targeting GATAA at locus +58 is found to be a key regulatory sequence, i.e., an sgRNA containing the GATAA sequence is most effective in increasing fetal hemoglobin. However, it is noteworthy that the the region around +58 k anchored by the sgRNA being discovered in the present invention is distinct from the critical base site of GATAA disclosed in the prior art. The gene editing of introducing the sgRNAs provided in this invention significantly increases fetal hemoglobin expression, and it is adequate for the clinical treatment.
[0100] Those skilled in the art can understand that after acquiring a high efficient gene editing region, one skilled in the art can edit the known high efficient gene editing region and optimize the gene editing conditions to achieve high editing efficiency by using any gene editing methods, such as zinc finger nuclease-based gene editing technology, TALEN gene editing technology, CRISPR/Cas (e.g., CRISPR/Cas9) gene editing technology, as well as other gene editing methods found in the future. Accordingly, the present invention comprises any of the technical schemes for performing gene editing with a BCL11A gene targeting sequence selected from SEQ ID NOs: 3-25 and identified by the present invention through any available gene editing method. In some preferred embodiments, the present invention relates to a solution for achieving efficient gene editing by CRISPR/Cas9 gene editing technology.
[0101] As used herein, CRISPR/Cas is a gene editing technology including, but not limited to, various naturally occurring or artificially designed CRISPR/Cas systems, such as the CRISPR/Cas9 system. Naturally occurring CRISPR/Cas system is an adaptive immune defense formed in bacteria and archaea during long-term evolution, and is used to combat invading viruses and foreign DNAs. For example, CRISPR/Cas9 works on the principle that crRNA (CRISPR-derived RNA) binds to tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA/crRNA complex, which directs the nuclease Cas9 protein to cleave the double-stranded DNA at a target site in a sequence matching with the crRNA. However, a single guide RNA (sgRNA) with the guiding ability may be formed by transformation with artificially designed tracrRNA and the crRNA, the sgRNA is able to guide a Cas9 to perform site-specific cleavage of DNA. As an RNA-guided dsDNA-binding protein, the Cas9 effector nuclease is able to co-localize RNA, DNA and proteins, thereby providing tremendous potential to be engineered. Cas proteins of type I, II or III may be used in CRISPR/Cas system. In some embodiments of the invention, Cas9 is taken in the method. Other suitable CRISPR/Cas systems include, but are not limited to, the systems and methods described in WO2013176772, WO2014065596, WO2014018423, and U.S. Pat. No. 8,697,359.
[0102] In another aspect, the invention relates to a series of sgRNA molecules of the invention that enable efficient gene editing.
[0103] In the present invention, an sgRNA, a gRNA, a single guide RNA, a synthetic guide RNA, or a guide RNA are used interchangeably. The sgRNA of present invention comprises a guide sequence targeting a target sequence. In a preferred embodiment, the sgRNA of the present invention further comprises a tracr sequence and a tracr chaperone sequence.
[0104] A guide sequence in the present invention may be a sequence of about 17-20 bp with specified targeting site, and may be used interchangeablely with a leader sequence or a spacer. In the context of formation of a CRISPR complex, a target sequence is, for example, a sequence which a guide sequence is designed to be complementary to it, wherein hybridization between a target sequence and the guide sequence promotes the formation of a CRISPR complex, and the hybridization requires that the complementarity between the target sequence and the guide sequence or the leader sequence is sufficient for inducing hybridization and promoting the formation of the CRISPR complex, while a complete complementarity is not a must.
[0105] Complementary means that a guide sequence or leader sequence may hybridize to a target nucleotide sequence (in the context of the present invention, a target nucleotide sequence of BCL11A gene in the hematopoietic stem cells) by the nucleotide pairing principle found by Watson and Crick. It will be appreciated by those skilled in the art that a guide sequence may hybridize to a target nucleotide sequence so long as it is sufficiently complementary to the target nucleotide sequence, while 100% and complete complementarity between them is not a must. In some embodiments, the degree of complementarity between the guide sequence and its corresponding target sequence may be about or higher than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, when they are optimally aligned by using a suitable alignment algorithm.
[0106] The optimal alignment may be determined by using any suitable algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, the Burrows-Wheeler Transform based algorithm, etc.
[0107] In general, in the context of an endogenous CRISPR system, the formation of a CRISPR complex (including the hybridization of a guide sequence to a target sequence, and then complexing with one or more Cas proteins) results in the cleavage of one or both strands in or near the target sequence (e.g., within the range of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs from the target sequence). Without wishing to be bound by theory, the tracr sequence may comprise all or a part of the wild-type tracr sequence, (e.g., about or more than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85 or more nucleotides of the wild-type tracr sequence), or a tracr sequence comprising the foregoing may also form a part of a CRISPR complex, for example by hybridizing along at least a part of the tracr sequence to all or a part of the tracr chaperone sequence which is operably linked to the guide sequence.
[0108] In some embodiments, the tracr sequence is sufficiently complementary to the tracr chaperone sequence to hybridize and participate in the formation of a CRISPR complex. Like the case of hybridizing atarget sequence to a guide sequence or a leader sequence, complete complementarity is not necessary so long as it is enough to perform its function. In some embodiments, in the case of optimal alignment, the tracr sequence exhibits at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% complementarity along the length of the tracr chaperone sequence.
[0109] The BCL11A genomic region from positions 60495219-60495336 in the chromosome 2 in the hematopoietic stem cells mentioned in the present application is defined according to the positions in the standard human gene sequence of GRCh38. Those skilled in the art will appreciate that the positions may vary with reference to different standard human genomic sequences, but those skilled in the art can understand the corresponding positions of the mentioned region while referring to different standard human gene sequences. In some embodiments, the disruption of the BCL11A genomic region from positions 60495219-60495336 in the chromosome 2 in hematopoietic stem cells comprises the introduction of insertions and/or deletions (Indel) of nucleotide sequences into this region, e.g., indels of any type (e.g., selected from A, T, C, G) and/or any number (e.g., 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2) of nucleotides. In some embodiments, the disruption comprises replacing the original nucleotide sequence with a new nucleotide sequence. In some embodiments, the disruption comprises the knock-in or knock-out of a nucleotide sequence in the region.
[0110] In the present application, the targeting sequence of BCL11A locus in the hematopoietic stem cells is shown as SEQ ID NO: 2. The sgRNAs of the present application are designed for the 150 bp base region shown in SEQ ID NO: 2, and the sgRNA sequences are required to be complementary to a sequence of at least 17, preferably 18, preferably 19, or preferably 20 contiguous nucleotides in the sequence of SEQ ID NO: 2.
[0111] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495203-60495222, particularly position 60495219, in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to the guide sequence of the sgRNA comprising SEQ ID NO: 9. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 9 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495203-60495222, particularly position 60495219 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0112] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495208-60495227, particularly position 60495224, in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence comprising the sgRNA of SEQ ID NO: 10. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 10 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495208-60495227, particularly position 60495224 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0113] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495217-60495236, particularly position 60495233 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 11. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 11 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites on the target sequence of the BCL11A genome from positions 60495217-60495236, particularly position 60495233 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0114] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495218-60495237, particularly position 60495234 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 12. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 12 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495218-60495237, particularly position 60495234 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0115] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495219-60495238, particularly position 60495235 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 13. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 13 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495219-60495238, particularly position 60495235 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0116] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495221-60495240, particularly position 60495223 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 16. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 16 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495221-60495240, particularly position 60495223 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0117] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495222-60495241, particularly position 60495238 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 14. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 14 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V for 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites the target sequence of the BCL11A genome from positions 60495222-60495241, particularly position 60495238 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0118] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495223-60495242, particularly position 60495239 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 15. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 15 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495223-60495242, particularly position 60495239 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0119] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495228-60495247, particularly position 60495244 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 17. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 17 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495228-60495247, particularly position 60495244 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0120] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495229-60495248, particularly position 60495245 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 18. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 18 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495229-60495248, particularly position 60495245 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0121] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495230-60495249, particularly position 60495246 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 19. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 19 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites on the BCL11A genomic target sequence from positions 60495230-60495249, particularly position 60495246 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0122] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495231-60495250, particularly position 60495247 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 20. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 20 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites on the BCL11A genomic target sequence from positions 60495231-60495250, particularly position 60495247 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0123] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495234-60495253, particularly position 60495250 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 21. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 21 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495234-60495253, particularly position 60495250 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0124] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495235-60495254, particularly position 60495251 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 22. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 22 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495235-60495254, particularly position 60495251 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0125] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495236-60495255, particularly position 60495238 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 4. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 4 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495236-60495255, particularly position 60495238 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0126] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495247-60495266, particularly position 60495263 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 3. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 3 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495247-60495266, particularly position 60495263 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0127] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495252-60495271, particularly position 60495268 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 8. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 8 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495252-60495271, particularly position 60495268 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0128] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495253-60495272, particularly position 60495269 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 7. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 7 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495253-60495272, particularly position 60495269 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0129] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495257-60495276, particularly position 60495273 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 6. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 6 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495257-60495276, particularly position 60495273 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0130] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495264-60495283, particularly position 60495280 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, and preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 5. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 5 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495264-60495283, particularly position 60495280 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0131] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495299-60495318, particularly position 60495301 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 24. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 24 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495299-60495318, particularly position 60495301 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0132] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495319-60495338, particularly position 60495335 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 25. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 25 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495319-60495338, particularly position 60495335 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0133] In some embodiments, the present invention provides a method for increasing the fetal hemoglobin (HbF) expression in human hematopoietic stem cells, comprising: disrupting a BCL11A genomic region from positions 60495320-60495339, particularly position 60495336 in the chromosome 2 in the hematopoietic stem cells by gene editing technology. The gene editing technology is a zinc finger nuclease-based gene editing technology, a TALEN gene editing technology or a CRISPR/Cas gene editing technology, preferably a CRISPR/Cas9 gene editing technology, preferably the target nucleotide sequence in the BCL11A genome is complementary to a guide sequence of the sgRNA comprising SEQ ID NO: 23. The method of the present invention involves introducing an sgRNA comprising the sequence of SEQ ID NO: 23 into hematopoietic stem cells to effectively edit said BCL11A genome, preferably co-introducing the sgRNA with Cas9-encoding nucleotides (e.g., mRNA) into the hematopoietic stem cells, preferably co-introducing the sgRNA with Cas9-encoding nucleotides into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 V, 0.5-2 ms. In some embodiments, the sgRNA is 2-O-methyl modified and/or internucleotide 3-thio modified, e.g., the chemical modification is 2-O-methyl modification of the first one, two and/or three bases at the 5 end and/or the last base at the 3 end of the sgRNA. In some embodiments, the invention also relates to a hematopoietic stem cell, wherein one or more sites in the target sequence of the BCL11A genome from positions 60495320-60495339, particularly position 60495336 in the chromosome 2 in the hematopoietic stem cell are disrupted by gene editing technology. Further, the invention relates to erythrocytes obtained from in vitro differentiation culture of the hematopoietic stem cells, and medical preparations containing the erythrocytes.
[0134] Further, in the present invention, Indels are efficiently produced, i.e., gene editing is efficiently performed, by using any of the 23 sgRNAs designed by the inventors. The preferable sgRNA of the present invention comprises a sequence selected from any one of SEQ ID NOs: 3-25, and the sequence of the cleavage site in the target sequence which corresponds to the sgRNA is located in the region of chr2: 60495219-chr2: 60495336 (i.e., positions 60495219-60495336 in the chromosome 2).
[0135] In particular, the following table lists the positions of the genomic sequences on human chromosome 2 which are targeted by the 23 sgRNAs of the present invention, as well as the Cas9 cleavage sites triggered by each sgRNA.
TABLE-US-00001 Positions on the human Names genomic sequence Cleavage sites BCL11A enhancer-7 chr2: 60495203-60495222 chr2: 60495219 BCL11A enhancer-8 chr2: 60495208-60495227 chr2: 60495224 BCL11A enhancer-9 chr2: 60495217-60495236 chr2: 60495233 BCL11A enhancer-10 chr2: 60495218-60495237 chr2: 60495234 BCL11A enhancer-11 chr2: 60495219-60495238 chr2: 60495235 BCL11A enhancer-14 chr2: 60495221-60495240 chr2: 60495223 BCL11A enhancer-12 chr2: 60495222-60495241 chr2: 60495238 BCL11A enhancer-13 chr2: 60495223-60495242 chr2: 60495239 BCL11A enhancer-15 chr2: 60495228-60495247 chr2: 60495244 BCL11A enhancer-16 chr2: 60495229-60495248 chr2: 60495245 BCL11A enhancer-17 chr2: 60495230-60495249 chr2: 60495246 BCL11A enhancer-18 chr2: 60495231-60495250 chr2: 60495247 BCL11A enhancer-19 chr2: 60495234-60495253 chr2: 60495250 BCL11A enhancer-20 chr2: 60495235-60495254 chr2: 60495251 BCL11A enhancer-2 chr2: 60495236-60495255 chr2: 60495238 BCL11A enhancer-1 chr2: 60495247-60495266 chr2: 60495263 BCL11A enhancer-6 chr2: 60495252-60495271 chr2: 60495268 BCL11A enhancer-5 chr2: 60495253-60495272 chr2: 60495269 BCL11A enhancer-4 chr2: 60495257-60495276 chr2: 60495273 BCL11A enhancer-3 chr2: 60495264-60495283 chr2: 60495280 BCL11A enhancer-22 chr2: 60495299-60495318 chr2: 60495301 BCL11A enhancer-23 chr2: 60495319-60495338 chr2: 60495335 BCL11A enhancer-21 chr2: 60495320-60495339 chr2: 60495336
[0136] Analysis of cleavage sites of the 23 sgRNAs reveals that, the Cas9 cleavage sites triggered by these sgRNAs are concentrated in the genonic region from positions 60495219 to 60495336 in the BCL11A gene.
[0137] A particular embodiment of the present invention further includes a composition containing said sgRNA, comprising any of the above 23 sgRNAs according to the present invention or a vector thereof.
[0138] In general, the guide sequence in an sgRNA is any polynucleotide sequence sufficiently complementary to a target polynucleotide sequence and capable of hybridizing to the target sequence, thereby directing the sequence-specific binding of CRISPR complex to the target sequence. In some embodiments, when optimal alignment is performed by using a suitable alignment algorithm, the degree of the complementarity between the guide sequence and its corresponding target sequence is about or higher than about 80%, 85%, 90%, 95%, 97.5%, 99% or more. Optimal alignment may be determined by using any suitable algorithm for aligning sequences, non-limiting examples of the algorithms include: the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, the Burrows-Wheeler Transform based algorithms (e.g., Burrows Wheeler Aligner), ClustalW, Clustai X, BLAT, Novoalign (Novocaft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap. genomics. org. cn), and Maq (available at maq. sourceforge. net). In some embodiments, the length of the guide sequence may be about or greater than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or more nucleotides. In some embodiments, the length of the guide sequence is less than about 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 12 or fewer nucleotides. The ability of the guide sequence to direct sequence-specific binding of the CR1SPR complex to the target sequence may be assessed by any suitable assays. For example, a host cell having a corresponding target sequence may be provided with the components of the CRISPR system capable of forming a CRISPR complex (including the guide sequences to be tested), for instance, it may be performed by transfection with a vector encoding the components of the CRISPR sequences, followed by evaluation of preferential cleavages within the target sequence (e.g., determined by Surveyor as described herein). Likewise, the cleavage of a target polynucleotide sequence can also be assessed in a test tube by providing a target sequence and the components of a CRISPR complex (comprising a guide sequence to be tested, and a control guide sequence different from the guide sequence), and then comparing the binding or cleaving rate of the tested guide sequences and the control guide sequence on the target sequence. Other assays known to those skilled in the art can also be used for the above determination and assessment.
[0139] In the present invention, the sgRNAs used in performing gene editing are preferably chemically modified. Chemically modified sgRNA refers to an sgRNA modified with a specific chemical group, for example, 2-O-methyl modification and/or an internucleotide 3-thio modification at the 5 end and 3 end three bases.
[0140] The chemically modified sgRNA employed by the present inventors is believed to have the following two advantages. Firstly, as sgRNA is an single-stranded RNA, its half-life is very short, and it degrades rapidly after entering the cell (not more than 12 hours), while the binding of Cas9 protein to sgRNA to perform gene editing requires at least 48 hrs gene editing. Therefore, a chemically modified sgRNA is used for stable expression after entering a cell, and after binding to the Cas9 protein it can generate Indels by efficiently edit the genome. Secondly, an unmodified sgRNA has poor ability to penetrate cell membranes and cannot effectively enter cells or tissues to perform corresponding functions, while the ability of a chemically modified sgRNA to penetrate cell membranes is generally enhanced. Chemical modification methods commonly used in the art may used in the present invention, so long as the stability of the sgRNA may be enhanced (the half-life is prolonged), and the ability to enter the cell membrane may be improved. In addition to the specific chemical modifications used in the examples, other modification methods are also included, such as those chemical modification methods reported in the following literatures: Deleevey GFl, Damha M J.; Designing chemically modified oligonucleotides for targeted gene silencing. Chem Biol. 2012 Aug. 24; 19(8): 937-54, and Hendel et al.; Chemically modified guide RNAs enhance CRISPR-Cas gene editing in human primary cells. Nat Biotechnol. 2015 September; 33(9): 985-989.
[0141] In some embodiments, the sgRNA and/or Cas9-encoding nucleotides (e.g., mRNA) are introduced into hematopoietic stem cells by electroporation under the electroporation conditions such as 250-360 V, 0.5-1 ms; 250-300V, 0.5-1 ms; 250V 1 ms; 250V, 2 ms; 300V, 0.5 ms; 300V, 1 ms; 360V, 0.5 ms; or 360 V, 1 ms. In some embodiments, the sgRNA and the Cas9-encoding nucleotides are co-introduced into the hematopoietic stem cells by electroporation. In some embodiments, the sgRNA is introduced into hematopoietic stem cells expressing Cas9 by electroporation.
[0142] In some embodiments, the Cas9-encoding nucleotide is an mRNA, such as an mRNA containing an ARCA cap. In some embodiments, the Cas9-encoding nucleotides are included in a viral vector, such as a lentiviral vector. In some embodiments, the Cas9-encoding nucleotides comprise the sequence of SEQ ID NO: 26. In some embodiments, the sgRNA and the Cas9-encoding nucleotides are included in the same vector.
[0143] The invention relates to hematopoietic stem cells obtained by the genetic modification method according to the present invention, the precursor cells at different differentiation stages before mature erythrocytes and being obtained by differentiation culture of the genetically modified hematopoietic stem cells, and the mature erythrocytes obtained by differentiation culture of the genetically modified hematopoietic stem cells.
[0144] The present invention relates to a pharmaceutical composition obtained by the method according to the present invention, the composition comprises the hematopoietic stem cells obtained by the genetic modification method of the present invention, or the precursor cells at different differentiation stages before mature erythrocytes and being obtained by differentiation culture of the genetically modified hematopoietic stem cells, or the mature erythrocytes obtained by differentiation culture of the genetically modified hematopoietic stem cells.
[0145] The pharmaceutical composition according to the present invention may be administered to a subject in need thereof by a route conventionally used for administering a medical preparation containing cellular components, e.g., by an intravenous infusion route. The dosage of administration may be specifically determined depending on the condition of the subject and the general health conditions.
[0146] In some aspects, the invention provides methods of delivering an sgRNA of the invention and/or Cas9-encoding nucleotides to hematopoietic stem cells. In some embodiments, in this the delivery the construct may be introduced into hematopoietic stem cells or other host cells by using conventional virus based and non-virus based gene transferring methods. Non-viral delivery systems include DNA plasmids, RNA (e.g., the transcripts of the vector described herein), naked nucleic acids, and liposomes. Viral vector delivery systems include DNA and RNA viruses having a free or integrated genome for the delivery to a cell. In some embodiments, the inventors introduce genes encoding Cas9 and the sgRNA into the hematopoietic stem cells by electroporation to perform gene editing of a specific sequence of the BCL11A gene in the hematopoietic stem cell. After repeated experiments, the inventors found that the gene editing efficiency for co-introducing Cas9-encoding nucleotides and the sgRNA into the hematopoietic stem cells by electroporation under the electroporation conditions of 200-600 v, 0.5 ms-2 ms is significantly higher than that under other electroporation conditions.
[0147] In some embodiments, the chemically modified sgRNA and the Cas9-encoding gene are co-introduced into the CD34+ hematopoietic stem cells by electroporation, achieving a high efficiency of gene editing (indicated as Indels %). The data in the examples shows that, if the Cas9 mRNA is co-introduced together with a chemically unmodified sgRNA by electroporation, the Indels efficiency is only 2.7%, which is much lower than that obtained by introducing a chemically modified sgRNA by electroporation (the efficiency is at least 10% or more).
[0148] As used herein, the full name of Indel is insertion/deletion, which is referred to an insertion and deletion mutation.
[0149] As used herein, hematopoietic stem cells (hematopoietic stem and progenitor cells, HSPCs) are the most primitive hematopoietic cells for generating various blood cells. Their main characteristics are strong proliferation potential, multi-directional differentiation ability and self-renewal ability. Thus, they not only differentiates and supplements various blood cells, but also maintains the characteristics and quantity of stem cells through self-renewal. Hematopoietic stem cells have different differentiation degrees proliferation abilities, and are heterogeneous. Pluripotent hematopoietic stem cells are the most primitive, they firstly differentiate into committed pluripotent hematopoietic stem cells, such as myeloid hematopoietic stem cells capable of producing granulocytic, erythroid, mononuclear cells and megakaryo-platelet lineages, and lymphoid stem cells capable of producing B and T lymphocytes. These two types of stem cells maintain the basic characteristics of hematopoietic stem cells, but they are slightly differentiated and respectively responsible for the generation of bone marrow components and lymphocytes, hence they are called as committed pluripotent hematopoietic stem cells. They further differentiate into hematopoietic progenitor cells, which are also primitive blood cells, but have lost many of the basic characteristics of hematopoietic stem cells, for example, losing the ability of multi-directional differentiation, and they can only differentiate into one cell line or two closely related cell lines; the repeated self-renewal capacity is lost, and their quantity is supplemented by the proliferation and differentiation of hematopoietic stem cells; and the proliferation potential is limited and they only divide several times. Depending on the number of blood cell lines that may be differentiated from the hematopoietic progenitor cells, they may be divided into unipotent hematopoietic progenitor cells (differentiating into only one blood cell line) and oligopotent hematopoietic progenitor cells (differentiating into 2-3 blood cell lines). The term hematopoietic stem cell in the present invention encompasses pluripotent hematopoietic stem cells, committed pluripotent hematopoietic stem cells, and hematopoietic progenitor cells, and it is a generic term for all hematopoietic stem cells with different heterogeneities.
[0150] In a particular embodiment of the present invention, the hematopoietic stem cells (HSPCs) uses in the present invention for gene editing may be derived from bone marrow, umbilical cord blood, or peripheral blood mononuclear cells (PBMCs).
[0151] As used herein, CRISPR RGEN is the name of a website developed by the research team of Korean scientist Jin-Soo Kim specifically for designing sgRNA at www.rgenome.net/about/.
[0152] As used herein, TIDE refers to the name of a tool website for analyzing Indels efficiency at tide-calculator.nki.nl.
[0153] As used herein, CD34, CD45RA, CD3, CD4, CD8, CD33, CD19, CD56, CD71, and CD235a are membrane protein markers of hematologic cells.
[0154] As used herein, BCL11A is a transcription factors first found in mice as a retroviral binding site, it was named Evi9 and was later found in a human genome locating at locus 2p13 of the short arm chromosome 2, and it is expressed primarily in the germinal center of B lymphocytes.
[0155] As used herein, HBB/HBG are different subtypes of hemoglobin. Hemoglobin is a protein responsible for oxygen transport in higher organisms. Hemoglobin consists of four chains, two a chains and two chains, each having a cyclic heme which contains an iron atom. Oxygen is bound to the iron atom and transported by erythrocytes for using by the organism.
[0156] Further, the present invention relates to hematopoietic stem cells obtained by genetically editing a specific sequence of BCL11A in the hematopoietic stem cells by CRISPR/Cas9 gene editing technology through the method of the present invention as described above. In addition, preparations comprising the hematopoietic stem cells are also comprised in the scope of the present invention.
[0157] The hematopoietic stem cells or the preparations thereof according to the present invention may be used to treat a disease selected from an anemia disease, a hemorrhagic disease, a tumor, or other disease requiring massive blood transfusion for treatment. In particular it may be used for the treatment of thalassemia or sickle cell anemia.
[0158] Further, the present invention relates to an erythrocyte obtained by in vitro differentiation culture (as described below) of the genetically modified hematopoietic stem cells according to the present invention.
[0159] Further, the present invention relates to precursor cells at different stages of differentiation from hematopoietic stem cells to mature erythrocytes, which are obtained through treating the genetically modified hematopoietic stem cells according to the present invention by the following erythroid expansion and differentiation steps for the hematopoietic stem cells:
[0160] wherein the above in vitro differentiation culture comprises: a hematopoietic stem cell erythroid expansion and differentiation step; and a hematopoietic stem cell erythroid differentiation and enucleation step; and
[0161] in the erythroid expansion and differentiation step, the hematopoietic stem cells are cultured by using a HSPCs erythroid expansion and differentiation medium; and
[0162] in the erythroid differentiation and enucleation step, an erythroid differentiation and enucleation medium is used.
[0163] In some embodiments, the HSPCs erythroid expansion and differentiation medium comprises: a basal culture medium, and a composition of growth factors, wherein the composition of growth factors comprises a stem cell growth factor (SCF); interleukin 3 (IL-3); and erythropoietin (EPO).
[0164] In some embodiments, the erythroid differentiation and enucleation medium comprises basal culture medium, growth factors, and antagonists and/or inhibitors of a progesterone receptor and a glucocorticoid receptor.
[0165] When the genetically modified hematopoietic stem cells are cultured by the above method, the hematopoietic stem cells may be differentiated into mature erythrocytes through two steps, compared with the prior art, only 14 days are needed for the in vitro differentiation culture according to the present invention, and the time period is shorter and greatly shortened as compared with a time period of more than 21 days needed in the prior art.
[0166] In some embodiments, the growth factors comprise erythropoietin (EPO), and the antagonists and/or inhibitors of a progesterone receptor and a glucocorticoid receptor are selected from any one or two or more of the following compounds (I)-(IV):
##STR00002##
[0167] In some embodiments, the HSPCs erythroid expansion and differentiation medium comprises a basal culture medium such as STEMSSPAN SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), X-VIVO 15, alpha-MEM, RPMI 1640, DF12, and the like. As for the growth factors, for example if STEMSPAN SFEM II is used as basal culture medium, additional growth factors including 50-200 ng/ml SCF, 10-100 ng/ml IL-3, 1-10 U/ml EPO are needed to add into the medium, wherein U is defined as: the amount of protein which convert 1 mol of substrate in 1 min under specific conditions, i.e. 1 IU=1 mol/min, and now, the letter I of IU (international unit) is often omitted in most clinical laboratories at home and abroad, and it is abbreviated as U. Erythropoietin (EPO) is a glycoprotein secreted primarily by kidney in response to hypoxia or anemia, in this embodiment, it promotes the differentiation of hematopoietic stem cells, and typically the duration of its effect is around 7 days.
[0168] When a basal culture medium other than STEMSPAN SFEM II is adopted as the basal medium, the following ingredients are needed:100ITS (in-transferrin-selenium) (wherein the final concentrations of each substance in the ITS of the medium are as follows: the concentration of insulin is 0.1 mg/ml; human transferrin, 0.0055 mg/ml; selenium, 6.710.sup.6 mg/ml) (i.e., consisting essentially of insulin, human transferrin, and selenium); 10-50 g/ml vitamin C; 0.5-5% BSA (Bovine serum albumin); growth factors, such as 50-200 ng/ml SCF, 10-100 ng/ml IL-3, and 1-10 U/ml EPO.
[0169] In addition, those skilled in the art will appreciate that any one of commonly used basal culture medium may be used. For example, the basal media commonly used in the art listed as follows: STEMSPAN SFEM II (available from STEM CELL TECHNOLOGIES); and IMDM; DF12; Knockout DMEM; RPMI 1640, Alpha MEM, DMEM, etc. available from Thermo Fisher.
[0170] In addition, some other ingredients also may be added to the above medium as desired, such as ITS (i.e., consisting essentially of insulin, human transferrin, and elemental selenium), L-glutamine, vitamin C, and bovine serum albumin. For example, the IMDM medium may be supplemented with ITS, 2 mM L-glutamine, 10-50 g/ml vitamin C, and 0.5-5 wt % BSA (bovine serum albumin). In addition, the DF12 described above may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C, and bovine serum albumin; Knockout DMEM may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C and bovine serum albumin; RPMI 1640 may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C and bovine serum albumin; Alpha MEM may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C and bovine serum albumin; DMEM may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C and bovine serum albumin. Herein, the concentrations of each substance in the added ITS in the various basal media are: insulin concentration is 0.1 mg/ml; human transferrin, 0.0055 mg/ml; and selenium, 6.710.sup.6 mg/ml. In addition, the concentrations of each component in the added ITS may also be adjusted according to practical requirements. ITS may be purchased from Thermofisher, and adjusted to the appropriate final concentration for use as needed.
[0171] In an embodiment, the erythroid differentiation and enucleation medium comprises a basal culture medium, growth factors and antagonists of a progesterone receptor and a glucocorticoid receptor.
[0172] In an embodiment, the hematopoietic stem cell erythroid differentiation and enucleation medium comprises a basal culture medium such as STEMSSPAN SFEM II (STEM CELLS TECHNOLOGY Inc.), IMDM (Iscove's Modified Dulbecco's Medium), X-VIVO 15, alpha-MEM, RPMI 1640, DF12, and the like. Growth factors are also comprised, e.g. if STEMSPAN SFEM II is used as the basal culture medium, additional growth factors needed comprise: 1-10 U/ml EPO, 100-1000 g/ml human transferrin, and chemical small molecules of 0.5-10 mol/ml mifepristone.
[0173] If a basal culture medium other than STEMSPAN SFEM II basal culture medium is used, it is necessary to add, for example, ITS (insulin-transferrin-selenium) (wherein the final concentrations of each substance in the ITS in the medium are: insulin concentration is 0.1 mg/ml; human transferrin, 0.0055 mg/ml; selenium, 6.7106 mg/ml (i.e., consisting essentially of insulin, human transferrin, and selenium); vitamin C, 10-50 ug/ml; BSA (Bovine serum albumin), 0.5-5%; growth factors such as EPO, 1-10 U/ml; human transferrin, 100-1000 ug/ml; small chemical molecules such as mifepristone, 0.5-10 mol/ml.
[0174] In addition, those skilled in the art will appreciate that any one of commonly used basal media may be used. For example, the basal media commonly used in the art listed as follows: STEMSPAN SFEM II (available from STEM CELL TECHNOLOGIES); IMDM; DF12; Knockout DMEM; RPMI 1640, Alpha MEM, DMEM, etc. available from Thermo Fisher.
[0175] In addition, some other ingredients also may be added to the above medium as desired, such as ITS (i.e., consisting essentially of insulin, human transferrin, and elemental selenium), L-glutamine, vitamin C, and bovine serum albumin. For example, the IMDM medium may be supplemented with ITS, 2 mM L-glutamine, 10-50 g/ml vitamin C, and 0.5-5 wt % BSA (bovine serum albumin). In addition, the DF12 described above may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C, and bovine serum albumin; Knockout DMEM may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C and bovine serum albumin; RPMI 1640 may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C and bovine serum albumin; Alpha MEM may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C and bovine serum albumin; DMEM may be supplemented with the same concentrations of ITS, L-glutamine, vitamin C and bovine serum albumin. Herein, the concentrations of each substance in the the added ITS in the various basal mediaare: insulin concentration is 0.1 mg/ml; human transferrin, 0.0055 mg/ml, and selenium, 6.710.sup.6 mg/ml. In addition, the concentrations of each component in the added ITS may also be adjusted according to practical requirements. ITS may be purchased from Thermofisher and adjusted to the appropriate final concentration for use as needed.
[0176] Mifepristone used herein is a chemically synthesized small molecule as an antagonist of the progesterone receptor and the glucocorticoid receptor. The structural formula of the molecule is as follows:
##STR00003##
[0177] Other antagonists and inhibitors of a progesterone receptor and a glucocorticoid receptor may also be used in the present invention, including cyproterone acetate, geldanamycin, CORT 108297, and the like. The chemical structures are as follows:
##STR00004##
[0178] In some embodiments, the mature erythrocytes of the present invention may be produced by a method comprising the steps from a) to c): a) isolating CD34-positive HSPCs from human umbilical cord blood to perform gene modification by any one of the methods disclosed by the invention; b) amplifying and differentiating the genetically modified HSPCs for 5-10 days, e.g., 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, to obtain erythrocyte precursor cells, e.g., erythroblasts, nucleated erythrocytes, young erythroblasts, and reticulocytes; c) further differentiating the erythrocyte precursor cells for 7 days to obtain mature erythrocytes.
[0179] In some embodiments, mature erythrocytes of the present invention may be produced by a method comprising the steps from a) to d):
[0180] a) isolating CD34-positive HSPCs from human umbilical cord blood by magnetic bead sorting;
[0181] b) genetically modifying the CD34-positive HSPCs by any one of the methods of the invention;
[0182] c) adding additional growth factors into the serum-free medium (SFME), and after 5-10 days, e.g., 5 days, 6 days, 7 days, 8 days, 9 days, 10 days of expansion and differentiation, the HSPCs are differentiated into erythrocyte precursor cells, and the medium at this stage is named as HSPCs erythroid expansion and differentiation medium (abbreviated as HEEDM);
[0183] d) adding additional growth factors into a serum-free medium (SFME), and after 7 days of differentiation, the mature erythrocytes may be obtained, the medium at this stage is named as HSPCs erythroid differentiation and enucleation medium (abbreviated as HEDEM).
[0184] That is, for genetically edited CD34-positive hematopoietic stem cells, the mature erythrocytes may be obtained in two steps by the method of the present invention described above, and the time period of the whole process may be 10-18 days, 11-17 days, 12-16 days, 13-15 days, 10-17 days, 10-16 days, 10-15 days, or 10-14 days, such a time period is greatly shorter than the period of at least 21 days in prior art by using three or four steps.
[0185] As described above, the present invention relates to a method for preparing mature erythrocytes or precursor cells thereof being genetically modified to increase the expression of fetal hemoglobin (HbF), the method comprises: (a) obtaining the hematopoietic stem cells by the genetic modification method disclosed by the invention; (b) performing hematopoietic stem cell erythroid expansion and differentiation of the genetically modified hematopoietic stem cells by using the above HSPCs erythroid expansion and differentiation medium.
[0186] Further, the present invention relates to a method for preparing mature erythrocytes or precursor cells thereof being genetically modified to increase the fetal hemoglobin (HbF) expression, the method comprises: (a) obtaining the hematopoietic stem cells by the genetic modification method disclosed by the invention; (b) performing hematopoietic stem cell erythroid expansion and differentiation of the genetically modified hematopoietic stem cells by using the above HSPCs erythroid expansion and differentiation medium; and (c) performing HSPCs erythroid differentiation and enucleation by using the erythroid differentiation and enucleation medium. The invention also relates to use of the HSPCs erythroid expansion and differentiation medium and/or the erythroid differentiation and enucleation medium used in the above method for expanding and/or differentiating hematopoietic stem cells or precursor cells of mature erythrocytes.
[0187] As used herein, differentiation refers to a phenomenon in which the structure or function of a cell is specialized during the process of division, proliferation, and growth thereof, i.e., the characteristics and function of cells or tissues of an organism are altered to perform a function imparted to the cells or tissues. In general, it refers to the phenomenon in which a relatively simple system is divided into two or more partial systems having different properties.
[0188] As used herein, Ficoll liquid density gradient centrifugation is based on the principle that the specific gravity of different components in the blood are different, and different cells may be separated in layers through low speed density gradient centrifugation. The density of erythrocytes and granulocytes is greater than the stratified liquid, and when erythrocytes encounter ficoll liquid they will rapidly aggregate into a string arrangement and accumulate at the bottom of the tube. Only the mononuclear cells with a density equivalent to that of the stratified liquid are enriched between the plasma layer and the stratified liquid, i.e., the white membrane layer; and the hematopoietic stem cells exist in this layer and they may be obtained through subsequent magnetic bead sorting. In the present invention, mononuclear cells are obtained by using commercially available lymphocyte separation tubes.
[0189] As used herein, mature erythrocytes refers to the most abundant type of cells in the blood, and they have the function of carrying nutrients such as oxygen, amino acids, carbon dioxide, and the like. Mature erythrocytes have no mitochondria and nuclei.
[0190] As used herein, interleukin 3 (IL-3) refers to a cytokine produced by activated CD4- and CD8-positive T lymphocytes, and its major biological function of which is involved in regulating the proliferation and differentiation of the hematopoietic stem cells in bone marrow.
[0191] As used herein, erythropoietin (EPO) refers to a growth factor secreted by erythroblasts, i.e., erythrocyte precursors. In adults, there are glycoproteins secreted by the interstitial cells surrounding the renal tubules in renal cortex and the liver. EPO stimulates the hematopoietic stem cells to differentiate into erythrocytes.
[0192] In some embodiments, the stem cell factors (SCFs) include mast cell growth factor (MGF), kit ligand (KL), and steel factor (SLF).
[0193] As used herein, HSPCs erythroid expansion and differentiation medium refers to a culturing system for facilitating the massive expansion of HSPCs and their differentiation into erythroid progenitor cells. In the present invention, the medium comprises two main components, namely a basal culture medium and a growth factor additive. The basal culture medium is a serum-free system, either STEMSPAN SFEM II (STEM CELLS TECHNOLOGY Inc.), or IMDM (Iscove's Modified Dulbecco's Medium), plus ITS (Thermofisher), L-glutamine (Thermofisher), vitamin C, and bovine serum albumin. The growth factor additive is a combination of different concentrations of IL-3, SCF and EPO.
[0194] As used herein, a HSPCs erythroid differentiation and enucleation medium refers to a medium that aids in further expansion and differentiation of erythroid progenitor cells into enucleated erythrocytes. In the present invention, the culture medium comprises two main components, namely a basal medium, and additives of growth factors and chemical small molecules. The basal culture medium is a serum-free system, either STEMSPAN SFEM II (STEM CELLS TECHNOLOGY Inc.), or IMDM (Iscove's Modified Dulbecco's Medium), plus ITS (Thermofisher), L-glutamine (Thermofisher) vitamin C, and bovine serum albumin. Additives of growth factors and chemical small molecules include EPO, human transferrin, and the chemical small molecule of mifepristone.
[0195] In some embodiments, hematopoietic stem cells are sorted by magnetic beads. For example, the cells are specifically labeled with superparamagnetic MACS microbeads, and after magnetic labeling, making the cells to pass through a sorting column placed in a strong and stable magnetic field. The matrix in the sorting column creates a high gradient magnetic field.
[0196] The magnetically labeled cells are retained in the column while the unlabeled cells are discharged. After the sorting column is removed from the magnetic field, magnetically labeled cells retained in the column may be eluted. Thus, both labeled and unlabeled cell components may be completely obtained.
[0197] In some specific embodiments of the present invention, through utilizing the sgRNA of the present invention, the hematopoietic stem cells derived from three different umbilical cord blood are genetically modified by the genetic modification methods described herein, and the efficient gene editing may be achieved with an efficiency of at least 40% or more, e.g., 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. For example, as for the preferred sgRNA, the average gene editing efficiency even reaches 80%.
[0198] In some embodiments of the present invention, the hematopoietic stem cells obtained by the gene editing method of the present invention are transplanted into a mouse. The proportion of human hCD45 expression in the mouse continuously increases after the transplantation of the genetically modified hematopoietic stem cells, as compared with that of the transplantation of the hematopoietic stem cells not being genetically modified. In peripheral blood samples, the proportion of hCD45 expression increases from 20% at week 6 to 60% at week 16; the proportion even reaches 90% in bone marrow and 70% in spleen at week 16; indicating that the genetically modified hematopoietic stem cells may be rapidly and efficiently implanted into the hematopoietic system of the mouse model, and the in vivo differentiation function of the cells is normal.
[0199] In some embodiments of the present invention, the umbilical cord blood-derived hematopoietic stem cells are modified by the gene editing method of the present invention, and then they are differentiated by using the two-step differentiation method of the present invention, i.e., the HSPCs erythroid expansion and differentiation medium is used for expansion and differentiation, and then HSPCs erythroid differentiation and enucleation medium is used for further differentiation. The detection results show that, the hemoglobin (HBG) expression in differentiated erythrocytes is increased by 20%-90%, even by 100% as compared with that of the original erythrocytes, i.e., increased by about 1 fold (2 folds of the expression of the original erythrocytes); the fetal hemoglobin expression is also increased by 20%-90%, even up to 100% as compared with that of the original erythrocytes, i.e. about 1 fold higher (2 times of the expression of the original erythrocytes); even up to 200%, i.e., about 2 folds higher (3 times of the original); even up to 300%, i.e., about 3 folds higher (4 times of the original); even up to 400%, i.e., about 4 folds higher (5 times of the original); even up to 500% or more, i.e., about 5 folds higher or more (6 or more times of the original), etc.
EXAMPLES
[0200] Hereinafter, the present invention will be further described with reference to the following examples. It will be apparent to those skilled in the art that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention. Accordingly, the essential scope of the invention is to be defined by the appended claims and their equivalents.
Example 1: Efficient Gene Editing of Umbilical Cord Blood-Derived CD34-Positive Hematopoietic Stem Cells
[0201] 1-1: Testing Electroporation Conditions by Using K562 Cells
[0202] Due to the limited source of hematopoietic stem cells and the high cost of each single isolation, the cancer cell line K562 (purchased from ATCC organization, website: https://www.atcc.org) is selected as a model cell line for testing electroporation conditions in this example.
[0203] Particularly, the specific steps for implementation are described below.
[0204] The first experiments: transfecting 510.sup.5 K562 cells with 5 g of GFP mRNA (the sequence of SEQ ID NO: 1) by BTX830 electroporator under the conditions of 250 V, 1 ms; 360 V, 1 ms; 400 V, 1 ms; and 500 V, 1 ms respectively. 4 days after the electroporation, GFP expression and 7-AAD expression are determined by flow cytometry, wherein GFP represents electroporation efficiency, and 7-AAD represents the growth state, i.e. viability of the cells after electroporation. SEQ ID NO:1: sequence information of GFP mRNA:
TABLE-US-00002 atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttga attagatggtgatgttaatgggcacaaattttctgtcagtggagagggtg aaggtgatgcaacatacggaaaacttacccttaaatttatttgcactact ggaaaactacctgttccatggccaacacttgtcactactttctcttatgg tgttcaatgcttttcaagatacccagatcatatgaaacggcatgactttt tcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtga tacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatg gaaacattcttggacacaaattggaatacaactataactcacacaatgta tacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaat tagacacaacattgaagatggaagcgttcaactagcagaccattatcaac aaaatactccaattggcgatggccctgtccttttaccagacaaccattac ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagacca catggtccttcttgagtttgtaacagctgctgggattacacatggcatgg atgaactatacaaatag
[0205] The second experiments: transfecting 510.sup.5 K562 cells with 5 g of the above GFP mRNA by BTX830 electroporator under the conditions of 250 V, 1 ms; 250 V, 2 ms; 300 V, 0.5 ms; 300 V, 1 ms; 360 V, 0.5 ms; and 360 V; 1 ms respectively. 4 days after the electroporation, GFP expression and 7-AAD expression are determined by flow cytometry, wherein GFP represents electroporation efficiency, and 7-AAD represents the growth state, i.e. viability of the cells after electroporation.
[0206] The third experiments: transfecting 510.sup.5 K562 cells with 5 g of the above GFP mRNA by BTX830 electroporator under the conditions of 250 V, 1 ms; 250 V, 1 ms; 300 V, 1 ms; and 300 V, 1 ms respectively. 4 days after the electroporation, GFP expression and 7-AAD expression are determined by flow cytometry, wherein GFP represents electroporation efficiency, and 7-AAD represents the growth state, i.e. viability of the cells after electroporation. The results are shown in
[0207] Among them,
[0208]
[0209] The data of these experiments shows that, under the electroporation conditions of 300V, 1 ms, the comprehensive index of electroporation efficiency and cell viability is the highest for cancer cell line K562, and they will be used as the electroporation conditions for subsequent experiments.
[0210] 1-2. Transfecting the Hematopoietic Stem Cells with GFP mRNA Under the Electroporation Conditions of 300 v, 1 ms
[0211] 510.sup.5 hematopoietic stem cells (purchased from ALLCELLs Biotechnology (Shanghai) Co., Ltd., www.allcells.com) are transfected with the above GFP mRNA by electroporation under the electroporation conditions of 300V, 1 ms which produce the highest efficiency and viability in the previous step. GFP expression and 7-AAD expression are detected 4 days later. The results are shown in
[0212]
[0213]
[0214] It can be seen from the results of
[0215] 1-3: Gene Editing of BCL11A Locus in the Cord Blood-Derived Hematopoietic Stem Cells by Electroporation with CRISPR/Cas9
[0216] A. Multiple sgRNAs for locus BCL11A (+58) are designed by using the CRISPR RGEN TOOLS software, and the chemically modified sgRNAs (the information shown in
TABLE-US-00003 the150bpsequenceatthelocus58KofBCL11A enhancer: SEQIDNO:2: ctgccagtcctcttctaccccacccacgcccccaccctaatcagaggcca aacccttcctggagcctgtgataaaagcaactgttagcttgcactagact agcttcaaagttgtattgaccctggtgtgttatgtctaagagtagatgcc referredtoasBCL11AEnhancer-1sgRNA (sometimesabbreviatedasEnhancer-1): SEQIDNO:3: cacaggctccaggaagggtt referredtoasBCL11AEnhancer-2sgRNA (sometimesabbreviatedasEnhancer-2): SEQIDNO:4: atcagaggccaaacccttcc referredtoasBCL11AEnhancer-3sgRNA (sometimesabbreviatedasEnhancer-3): SEQIDNO:5: ctaacagttgcttttatcac referredtoasBCL11AEnhancer-4sgRNA (sometimesabbreviatedasEnhancer-4): SEQIDNO:6: ttgcttttatcacaggctcc referredtoasBCL11AEnhancer-5sgRNA (sometimesabbreviatedasEnhancer-5): SEQIDNO:7: ttttatcacaggctccagga referredtoasBCL11AEnhancer-6sgRNA (sometimesabbreviatedasEnhancer-6): SEQIDNO:8: tttatcacaggctccaggaa referredtoasBCL11AEnhancer-7sgRNA (sometimesabbreviatedasEnhancer-7): SEQIDNO:9: tgggtggggtagaagaggac referredtoasBCL11AEnhancer-8sgRNA (sometimesabbreviatedasEnhancer-8): SEQIDNO:10: gggcgtgggtggggtagaag referredtoasBCL11AEnhancer-9sgRNA (sometimesabbreviatedasEnhancer-9): SEQIDNO:11: ttagggtgggggcgtgggtg referredtoasBCL11AEnhancer-10sgRNA (sometimesabbreviatedasEnhancer-10): SEQIDNO:12: attagggtgggggcgtgggt referredtoasBCL11AEnhancer-11sgRNA (sometimesabbreviatedasEnhancer-11): SEQIDNO:13: gattagggtgggggcgtggg referredtoasBCL11AEnhancer-12sgRNA (sometimesabbreviatedasEnhancer-12): SEQIDNO:14: tctgattagggtgggggcgt referredtoasBCL11AEnhancer-13sgRNA (sometimesabbreviatedasEnhancer-13): SEQIDNO:15: ctctgattagggtgggggcg referredtoasBCL11AEnhancer-14sgRNA (sometimesabbreviatedasEnhancer-14): SEQIDNO:16: cacgcccccaccctaatcag referredtoasBCL11AEnhancer-15sgRNA (sometimesabbreviatedasEnhancer-15): SEQIDNO:17: ttggcctctgattagggtgg referredtoasBCL11AEnhancer-16sgRNA (sometimesabbreviatedasEnhancer-16): SEQIDNO:18: tttggcctctgattagggtg referredtoasBCL11AEnhancer-17sgRNA (sometimesabbreviatedasEnhancer-17): SEQIDNO:19: gtttggcctctgattagggt referredtoasBCL11AEnhancer-18sgRNA (sometimesabbreviatedasEnhancer-18): SEQIDNO:20: ggtttggcctctgattaggg referredtoasBCL11AEnhancer-19sgRNA (sometimesabbreviatedasEnhancer-19): SEQIDNO:21: aagggtttggcctctgatta referredtoasBCL11AEnhancer-20sgRNA (sometimesabbreviatedasEnhancer-20): SEQIDNO:22: gaagggtttggcctctgatt referredtoasBCL11AEnhancer-21sgRNA (sometimesabbreviatedasEnhancer-21): SEQIDNO:23: actcttagacataacacacc referredtoasBCL11AEnhancer-22sgRNA (sometimesabbreviatedasEnhancer-22): SEQIDNO:24: cttcaaagttgtattgaccc referredtoasBCL11AEnhancer-23sgRNA (sometimesabbreviatedasEnhancer-23): SEQIDNO:25: ctcttagacataacacacca
[0217] As described above, the above 23 sgRNAs are designed for the 150 bp sequence at the locus 58K of BCL11A enhancer.
[0218] B. The electroporation conditions of 300 V, 1 ms are used, and the inventors synthesized Cas9 mRNA (the sequence of SEQ ID NO: 26) and the 23 chemically modified sgRNAs which are designed as described above, wherein the chemical modification of the 23 sgRNAs is 2-O-methyl modified and internucleotide 3-thio modification of the first three bases at the 5 end and the last three bases at the 3 end of the sgRNA. As shown in the formulas below, the chemically modified sgRNA is shown on the left, and unmodified sgRNA is shown on the right.
##STR00005##
[0219] The cord blood-derived CD34-positive hematopoietic stem cells (purchased from ALLCELLS Biotechnology (Shanghai) Co., Ltd., www.allcells.com) are transfected with the above 23 chemically modified sgRNAs by electroporation under the above-identified electroporation conditions, analyzing the Indels efficiency by TIDE software 4 says later. The results are shown in
[0220]
TABLE-US-00004 Forwardprimer: (SEQIDNO:29) cacctcagcagaaacaaagttatc Reverseprimer: (SEQIDNO:30) gggaagctccaaactctcaa
[0221] Cleavage site selection: in the case of Enhancer-3, 5-ctaaacagttg cttttatcac-3 (SEQ ID NO: 5), the cleavage site is at the right site of the 3 end (Cong L, et al. Science. 2013).
[0222] Sanger sequencing is performed to amplify the above fragment by using the upstream and downstream primer sequences as shown in SEQ ID NO: 29 and SEQ ID NO: 30. Based on the sequencing results, statistic analysis of the resulting Indels efficiency is performed by using TIDE software, wherein the TIDE software is an on-line software for Indels efficiency analysis. The efficiency of Indels for producing double-peak mutation may be analyzed according to the first-generation sequencing results by referring to Tide.deskgen.com.
[0223] The results show that all the 23 sgRNAs synthesized in this example may be used to successfully perform gene editing of the hematopoietic stem cells, and Indels may be effectively produced with an efficiency of at least 10%. The most efficient one of them is Enhancer-2.
TABLE-US-00005 thesequenceofCas9mRNA SEQIDNO:26: gacaagaagtacagcatcggcctggacatcggcaccaactctgtgggctg ggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaaggtgc tgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctg ctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgc cagaagaagatacaccagacggaagaaccggatctgctatctgcaagaga tcttcagcaacgagatggccaaggtggacgacagcttcttccacagactg gaagagtccttcctggtggaagaggataagaagcacgagcggcaccccat cttcggcaacatcgtggacgaggtggcctaccacgagaagtaccccacca tctaccacctgagaaagaaactggtggacagcaccgacaaggccgacctg cggctgatctatctggccctggcccacatgatcaagttccggggccactt cctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgt tcatccagctggtgcagacctacaaccagctgttcgaggaaaaccccatc aacgccagcggcgtggacgccaaggccatcctgtctgccagactgagcaa gagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaaga atggcctgttcggcaacctgattgccctgagcctgggcctgacccccaac ttcaagagcaacttcgacctggccgaggatgccaaactgcagctgagcaa ggacacctacgacgacgacctggacaacctgctggcccagatcggcgacc agtacgccgacctgtttctggccgccaagaacctgtccgacgccatcctg ctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgag cgcctctatgatcaagagatacgacgagcaccaccaggacctgaccctgc tgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttc ttcgaccagagcaagaacggctacgccggctacattgacggcggagccag ccaggaagagttctacaagttcatcaagcccatcctggaaaagatggacg gcaccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaag cagcggaccttcgacaacggcagcatcccccaccagatccacctgggaga gctgcacgccattctgcggcggcaggaagatttttacccattcctgaagg acaaccgggaaaagatcgagaagatcctgaccttccgcatcccctactac gtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaa gagcgaggaaaccatcaccccctggaacttcgaggaagtggtggacaagg gcgcttccgcccagagcttcatcgagcggatgaccaacttcgataagaac ctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtactt caccgtgtataacgagctgaccaaagtgaaatacgtgaccgagggaatga gaaagcccgccttcctgagcggcgagcagaaaaaggccatcgtggacctg ctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggacta cttcaagaaaatcgagtgcttcgactccgtggaaatctccggcgtggaag atcggttcaacgcctccctgggcacataccacgatctgctgaaaattatc aaggacaaggacttcctggacaatgaggaaaacgaggacattctggaaga tatcgtgctgaccctgacactgtttgaggacagagagatgatcgaggaac ggctgaaaacctatgcccacctgttcgacgacaaagtgatgaagcagctg aagcggcggagatacaccggctggggcaggctgagccggaagctgatcaa cggcatccgggacaagcagtccggcaagacaatcctggatttcctgaagt ccgacggcttcgccaacagaaacttcatgcagctgatccacgacgacagc ctgacctttaaagaggacatccagaaagcccaggtgtccggccagggcga tagcctgcacgagcacattgccaatctggccggcagccccgccattaaga agggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatg ggccggcacaagcccgagaacatcgtgatcgaaatggccagagagaacca gaccacccagaagggacagaagaacagccgcgagagaatgaagcggatcg aagagggcatcaaagagctgggcagccagatcctgaaagaacaccccgtg gaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaa tgggcgggatatgtacgtggaccaggaactggacatcaaccggctgtccg actacgatgtggaccatatcgtgcctcagagctttctgaaggacgactcc atcgacaacaaggtgctgaccagaagcgacaagaaccggggcaagagcga caacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggc agctgctgaacgccaagctgattacccagagaaagttcgacaatctgacc aaggccgagagaggcggcctgagcgaactggataaggccggcttcatcaa gagacagctggtggaaacccggcagatcacaaagcacgtggcacagatcc tggactcccggatgaacactaagtacgacgagaatgacaagctgatccgg gaagtgaaagtgatcaccctgaagtccaagctggtgtccgatttccggaa ggatttccagttttacaaagtgcgcgagatcaacaactaccaccacgccc acgacgcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtac cctaagctggaaagcgagttcgtgtacggcgactacaaggtgtacgacgt gcggaagatgatcgccaagagcgagcaggaaatcggcaaggctaccgcca agtacttcttctacagcaacatcatgaactttttcaagaccgagattacc ctggccaacggcgagatccggaagcggcctctgatcgagacaaacggcga aaccggggagatcgtgtgggataagggccgggattttgccaccgtgcgga aagtgctgagcatgccccaagtgaatatcgtgaaaaagaccgaggtgcag acaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgataa gctgatcgccagaaagaaggactgggaccctaagaagtacggcggcttcg acagccccaccgtggcctattctgtgctggtggtggccaaagtggaaaag ggcaagtccaagaaactgaagagtgtgaaagagctgctggggatcaccat catggaaagaagcagcttcgagaagaatcccatcgactttctggaagcca agggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtac tccctgttcgagctggaaaacggccggaagagaatgctggcctctgccgg cgaactgcagaagggaaacgaactggccctgccctccaaatatgtgaact tcctgtacctggccagccactatgagaagctgaagggctcccccgaggat aatgagcagaaacagctgtttgtggaacagcacaagcactacctggacga gatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacg ctaatctggacaaagtgctgtccgcctacaacaagcaccgggataagccc atcagagagcaggccgagaatatcatccacctgtttaccctgaccaatct gggagcccctgccgccttcaagtactttgacaccaccatcgaccggaaga ggtacaccagcaccaaagaggtgctggacgccaccctgatccaccagagc atcaccggcctgtacgagacacggatcgacctgtctcagctgggaggcga c sequencingprimer SEQIDNO:27 cacctcagcagaaacaaagttatc, sequencingprimer SEQIDNO:28 gggaagctccaaactctcaa,
[0224] C. According to the above experimental results, Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5 and Enhancer-6 with relatively high gene editing efficiency are selected. The umbilical cord blood-derived hematopoietic stem cells are transfected with Cas9 mRNA and Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5 or Enhancer-6 by electroporation under the electroporation conditions of 300V, 1 ms; and the Indels efficiency is determined after 4 days, and the results are shown in
[0225] The results in
[0226] Based on this, Enhancer-2 sgRNA is used as a target in the subsequent experiments.
Example 2: In Vitro Colony-Formation of the Genetically Modified Hematopoietic Stem Cells Derived from Cord Blood
[0227] This experiment involves the detection of colony forming unit (CFU) of the genetically modified hematopoietic stem cells derived from cord blood.
[0228] The hematopoietic stem cells are transfected with Cas9 mRNA and Enhancer-2 under the electroporation conditions of 300 V, 1 ms. 800-1000 cells are resuspended in 1 ml of the mixture of H4434 (available from STEM CELLS TECHNOLOGY, Canada), IMDM (available from Thermo Fisher) and FBS (available from Thermo Fisher). The number of the formed colonies with different morphologies such as CFU-M, BFU-E, CFU-E, CFU-Q CFU-GM are observed under microscope after 14 days, and the results are shown in
[0229] According to the data shown in example 2, compared with that of the hematopoietic stem cells not being genetically modified, the in vitro differentiation function of the genetically modified cells is normal, and the cells are differentiated into colonies of different lineages of blood system.
Example 3: The Reconstruction of Hematopoietic System in Mouse Model with Genetically Modified Hematopoietic Stem Cells Derived from Cord Blood
[0230] The cord blood-derived hematopoietic stem cells are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300 V, 1 ms; transplanting into an irradiated NPG immunodeficient mouse model (purchased from Beijing Vitalstar Biotechnology, Inc.). The expression of human CD45 and mouse CD45 in peripheral blood is detected 6 weeks, 8 weeks, 10 weeks, 12 weeks and 16 weeks after the transplantation, while the expression of human CD45 and mouse CD45 in bone marrow and spleen is detected 16 weeks after transplantation; and the results are shown in
[0231] The results of
[0232] Meanwhile, in mice transplanted with genetically modified cells, the expression of cell membrane proteins such as human CD3, CD4, CD8, CD33, CD19, CD56 is detected after 16 weeks, as shown in
[0233] In addition, the genetically modified cells are capable of rapidly and efficiently repopulating the hematopoietic system of a mouse model. The result shown in
Example 4: The Erythroid Differentiation of the Genetically Modified Hematopoietic Stem Cells Derived from Cord Blood and the Detection of Globin and Fetal Hemoglobin Expression
[0234] 4-1. Differentiation of Erythrocytes
[0235] The cord blood-derived hematopoietic stem cells are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300 v, 1 ms, differentiating the cells by using the two-step differentiation protocol described below.
[0236] In the two-step method, firstly the HSPCs erythroid expansion and differentiation medium is used for differentiation, then the HSPCs erythroid differentiation and enucleation medium is used for differentiation.
[0237] The basal medium of the HSPCs erythroid expansion and differentiation culture medium is StemSpan SFEM II, including the growth factors of 50-200 ng/ml SCF, 10-100 ng/ml IL-3, and 1-10U EPO/ml. The culture conditions: the hematopoietic stem cells are cultured with a density of 1.0 10.sup.5 cells/ml in the erythroid expansion and differentiation medium for 7 days.
[0238] The basal medium of HSPCs erythroid differentiation and enucleation medium is StemSpan SFEM II including the growth factors of 1-10 U EPO, 100-1000 g/ml human transferrin, 0.5-10 m the small molecule of mifepristone.
[0239] The cells cultured in the previous step with a density of 1.010.sup.6 cells/ml are differentiated in the HSPCs erythroid differentiation and enucleation medium for 5 days.
[0240] Then, the expression of CD71 and CD235a is detected, as shown in
[0241] In the experimental group and the control group, the cells are differentiated into erythrocytes efficiently, and the proportion of CD71 and CD235a expression is 90% or more.
[0242] 4-2. Detection of the Expression of Globin and Fetal Hemoglobin mRNA of the cells differentiated from the above erythrocytes is extracted and reverse-transcribed into cDNA. The expression of BCL11A, HBB, HBG and other genes is detected by quantitative fluorescence PCR, as shown in
[0243] Fetal hemoglobin expression in cells after erythroid differentiation is detected, as shown in
Example 5: Gene Editing of the BCL11A Enhancer Locus in the Hematopoietic Stem Cells Derived from Thalassemia Patients
[0244] 5-1. Isolation of the Hematopoietic Stem Cells from Peripheral Blood of Patients with Thalassemia
[0245] CD34-positive hematopoietic stem cells are obtained by conventional magnetic bead sorting. The results are shown in
[0246] 5-2. Transfecting the Hematopoietic Stem Cells Derived from the Peripheral Blood of Thalassemia Patients by Electroporation
[0247] The peripheral blood-derived hematopoietic stem cells from patients with thalassemia are transfected with Cas9 mRNA and Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5, or Enhancer-6 by electroporation under the electroporation conditions of 300 V, 1 ms. Indels efficiency is detected 4 days later, as shown in
Example 6: The Erythroid Differentiation of the Genetically Modified Hematopoietic Stem Cells Derived from Peripheral Blood of Patients with Anemia and the Detection of Globin and Fetal Hemoglobin Expression
[0248] The genetically modified hematopoietic stem cells of Example 5 are subjected to erythroid differentiation in vitro as described in Example 4-1. Differentiation results are shown in
[0249] 12 days later, mRNA of cells after erythroid differentiation is extracted and reverse-transcribed into cDNA. The expressions of BCL11A, HBB, HBQ HBA and other genes are determined by quantitative fluorescence PCR, as shown in
[0250] In addition, in order to more accurately evaluate the effects on the protein expression levels of fetal hemoglobin (HbF) and normal hemoglobin (HbA) caused by the gene editing of BCL11A enhancer locus with Enhancer-2, Enhancer-3, Enhancer-4, Enhancer-5 and Enhancer-6, in the present invention, we extract the proteins of the erythrocytes obtained 12 days after differentiation of the hematopoietic stem cells, performing HPLC assay (High Performance Liquid Chromatography), as shown in
Example 7: In Vitro Colony-Formation of Genetically Modified Hematopoietic Stem Cells Derived from Peripheral Blood of Anemia Patients
[0251] The hematopoietic stem cells derived from peripheral blood of anemia patients are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300 V, 1 ms. 500-800 cells are resuspended in 1 ml of the mixture of H4434 (available from STEM CELLS TECHNOLOGY, Canada), IMDM (available from Thermo Fisher) and FBS (available from Thermo Fisher). The number of the formed colonies with different morphologies such as CFU-M, BFU-E, CFU-E, CFU-Q CFU-GM, and GEMM are observed under microscope 14 days later. The results are shown in
[0252] The experimental data show that, compared with the hematopoietic stem cells not being genetically modified, the in vitro differentiation function of the genetically modified cells is normal, and the cells are differentiated into colonies of different lineages in blood system.
Example 8: Off-Target Effect of the Genetically Modified Hematopoietic Stem Cells Derived from Peripheral Blood of Anemia Patients
[0253] The experiment relates to a gene sequencing method, in particular to an off-target effect analysis of the genetically modified hematopoietic stem cells derived from peripheral blood of an anemia patient by the next generation sequencing (NGS) technology.
[0254] The hematopoietic stem cells from peripheral blood of anemia patients are transfected with Cas9 mRNA and Enhancer-2 by electroporation under the electroporation conditions of 300 V, 1 ms. After 4 days of expansion, the genome of the cells is extracted and analyzed by next generation sequencing. 14 potential off-target sites are predicted by software, and the results are shown in
[0255] The experimental data shows that, the on-target efficiency of gene editing is 76%, and the proportion of the 14 potential off-target sites is less than 0.3%, which is equivalent to the error of the next generation sequencing per se. Therefore, in the range of the sequencing error, off-target phenomenon caused by gene editing is not detected. Thus, this gene editing scheme is safe.
[0256] As shown in the data of the above examples, as for cells derived from different sources, Enhancer-2 shows the best effect.
INDUSTRIAL APPLICABILITY
[0257] According to the invention, the method provided herein has the following advantages: firstly, the method may be used for gene editing of the hematopoietic stem cells derived from thalassemia patients, and it completely meets the requirements for the clinical treatment of thalassemia and sickle cell anemia; secondly, by using the chemically modified sgRNA, the gene editing efficiency of the method is high, the expression of fetal hemoglobin is remarkably improved, and the cells can be used for repopulating the hematopoietic system of a mouse model; and finally, the off-target analysis shows a high degree of safety. Accordingly, the method developed in the present invention has the potential to replace the conventional hematopoietic stem cell transplantation therapy technique for curing patients with severe thalassemia and sickle cell anemia.
[0258] Although the invention has been described in detail with reference to specific features, it is obvious to those skilled in the art that this description is intended for the illustration of the preferred embodiments only, and is not intended to limit the scope of the invention. Therefore, the essential scope of the invention is defined by the appended claims and their equivalents.