ROBUST DIFFERENTIATION OF HUMAN PLURIPOTENT STEM CELLS INTO ENDOTHELIAL CELLS USING TRANSCRIPTION FACTOR ETV2
20200385685 · 2020-12-10
Inventors
- Kai Wang (Brookline, MA, US)
- Ruei-Zeng Lin (Brookline, MA, US)
- Juan M. Melero-Martin (Bedford, MA, US)
Cpc classification
C12N2506/45
CHEMISTRY; METALLURGY
A61K35/44
HUMAN NECESSITIES
C12N2501/165
CHEMISTRY; METALLURGY
C12N5/0692
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
C12N2501/115
CHEMISTRY; METALLURGY
A61K47/42
HUMAN NECESSITIES
International classification
Abstract
Methods for in vitro differentiation of human pluripotent stem cells into endothelial cells, using a protocol that includes transient expression of exogenous ETS translocation variant 2 (ETV2), and uses of those cells in human therapies, e.g., to treat hemophilia.
Claims
1. A method of generating induced endothelial cells, the method comprising: providing a population of induced pluripotent stem cells (iPSCs) or human embryonic stem cells (h-ES cells); incubating the iPSCs in media in the presence of a GSK3 inhibitor, under conditions sufficient for the iPSC to differentiate into intermediate mesodermal progenitor cells (MPCs); optionally dissociating the MPCs into single cells; introducing an exogenous nucleic acid encoding ETS translocation variant 2 (ETV2) to the MPCs to induce transient expression of exogenous ETV2; and maintaining the MPCs under conditions sufficient for the MPCs to differentiate into iPSCs.
2. The method of claim 1, wherein the GSK3 inhibitor is CHIR99021, BIO, NP031112, IM-12; a pyrazolopyrimidine derivative, an analog of 7-hydroxy-1H-benzimidazole, a pyridinone, a pyrimidine, an indolylmaleimide analog, an imidazopyridine, an oxadiazole, a pyrazine, a thiadiazolidinone, amodin or 4-aminoethylamino emodin, or a 5-Imino-1,2,4-Thiadiazole (ITDZ).
3. The method of claim 1, wherein the iPSCs are incubated in in the presence of the GSK3 inhibitor for about 48 hours.
4. The method of claim 1, wherein the MPCs are incubated in media comprising (i) one or more growth factors, preferably selected from the group consisting of VEGF-A, FGF-2, and EGF, and (i) a TGFbeta receptor antagonist.
5. The method of claim 4, wherein the TGFbeta receptor antagonist is selected from the goup consisting of galunisertib (LY2157299 Monohydrate); A 83-01; RepSox; SD 208; SB 505124; LY 364947; D 4476; SB 525334; GW 788388; R 268712; IN 1130; SM 16; A 77-01; and SB431542.
6. The method of claim 1, wherein the MPCs are incubated in the media for about 48 hours after introduction of the ETV2 nucleic acid.
7. The method of claim 1, wherein the ETV2 nucleic acid comprises or encodes a sequence that is at least 95% identical to SEQ ID NO:1.
8. The method of claim 7, wherein the ETV2 nucleic acid is a synthetic, chemically modified mRNA, wherein at least one pseudouridine is substituted for uridine and/or at least one 5-methyl-cytosine is substituted for cytosine.
9. The method of claim 1, wherein the iPSCs are derived from a human primary cell.
10. The method of claim 1, further comprising maintaining the iECs in culture under conditions to allow for cell proliferation.
11. A population of iECs made by the method of claim 1.
12. A method of treating a subject in need of vascular cell therapy, comprising administering to the subject a therapeutically effective amount of the population of iECs of claim 11.
13. The method of claim 12, wherein the subject is in need of vascular cell therapy to treat ischemic or vascular injury and/or endothelial denudation, optionally in limbs, retina or myocardium; or for revascularization/neovascularization.
14. The method of claim 13, wherein the revascularization/neovascularization is to treat diabetes or promote success after organ transplantation.
15. A method of treating a subject who has hemophilia A or hemophilia B, the method comprising administering to the subject a therapeutically effective amount of the population of iECs of claim 11, wherein the iECs have been engineered to express Factor VIII or Factor IX.
16. The method of claim 15, wherein the cells are administered to the subject in a hydrogel.
17. The method of claim 16, wherein the hydrogel is administered by subcutaneous implantation.
18. A composition comprising a hydrogel and the population of iECs of claim 11.
19. The composition of claim 18, wherein the iECs have been engineered to express an exogenous protein.
20. The composition of claim 19, wherein the exogenous protein is Factor VIII or Factor IX.
21. The composition of claim 17, wherein the hydrogel comprises collagen and/or fibrin.
22. The composition of claim 21, wherein the hydrogel is a collagen/fibrin hydrogel or a crosslinked collagen hydrogel.
23. The method of claim 15, wherein engineering the cells to express a protein comprises introducing into the iECs a vector, preferably a transposon vector, for expression of the exogenous protein.
Description
DESCRIPTION OF DRAWINGS
[0028] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
DETAILED DESCRIPTION
[0059] The advent of human induced pluripotent stem cells (h-iPSCs) created an exciting and non-invasive opportunity to obtain patient-specific ECs. However, differentiating h-iPSCs into ECs (herein referred to as h-iECs) with high efficiency, consistently, and in high abundance remains a challenge.sup.3.
[0060] Current differentiation protocols are inspired by vascular development and rely on sequentially transitioning h-iPSCs through two distinct stages (referred to as stages 1 and 2 or S1-S2).sup.4. During S1, h-iPSCs differentiate into intermediate mesodermal progenitor cells (h-MPCs), a process regulated by Wnt and Nodal signaling pathways. In S2, h-MPCs acquire endothelial specification principally via VEGF signaling 4. Existing protocols, however, are far from optimal. Limitations stem from the inherent complexity associated with developmental processes. First, directing h-MPCs to solely differentiate into h-iECs is not trivial. Indeed, recent reports estimate that with the canonical S1-S2 approach, less than 10% of the differentiated cells may actually be bona fide h-iECs.sup.3. In addition, achieving consistent differentiation in different h-iPSC lines continues to be a challenge.sup.5. This dependency on cellular origin makes the clinical translation of h-iECs problematic.
[0061] Herein described is the development of a protocol that enables more consistent and highly efficient differentiation of human h-iPSCs into h-iECs. The results showed that a critical source of inconsistency resided in the inefficient activation of the transcription factor E26 transformation-specific (ETS) variant 2 (ETV2) during S2. To circumvent this constraint, a chemically modified mRNA (modRNA) was used; in recent years this technology has improved the stability of synthetic RNA allowing its transfer into cells (and subsequent protein expression) in vitro and in vivo.sup.6. A synthetic modRNA was developed to uniformly activate ETV2 expression in h-MPCs, independently of VEGF signaling.
[0062] The present protocol entails a total differentiation period of about 4 days and comprises two steps: 1) differentiation of h-iPSCs into intermediate h-MPCs; and 2) conversion of h-MPCs into h-iECs upon delivery of modRNA encoding ETV2. This S1-modETV2 approach allowed widespread expression of ETV2 throughout the entire h-MPC population, thus overcoming one of the main hurdles of current protocols. Using this customized protocol, 13 different human h-iPSC clonal lines were reproducibly and efficiently (>90%) differentiated into h-iECs. Using these methods, h-iECs were produced at exceedingly high purity irrespective of the h-iPSC donor and cellular origin, and there were no statistical differences in efficiency. Of note, this high efficiency and reproducibility were absent when the standard S1-S2 protocol, which relies on VEGF signaling for endogenous ETV2 activation, was used. In addition, the resulting h-iECs could be expanded with ease, obtaining an average h-iEC-to-h-iPSC ratio of 70-fold after 3 weeks in culture. More importantly, the h-iECs were phenotypically, transcriptionally, and functionally consistent with bona fide ECs, including a robust ability to form perfused vascular networks in vivo.
[0063] Over the last decade, refinements to the standard S1-S2 differentiation protocol have steadily improved efficiency. Improvements have included, for example, the inhibition of the Notch and the TGF- signaling pathways, the activation of protein kinase A or the synergistic effects of VEGF and BMP4 during S.sup.2,7,8,18. However, most of these advances have been largely incremental, and consensus holds that the differentiation of h-iPSCs into h-iECs remains somewhat inconsistent.sup.19. The incorporation of BMP4 during S2 was shown to produce a significant improvement in differentiation efficiency; however, the mechanism behind this improvement remains unknown and thus it is unclear whether this approach can consistently produce high efficiency across multiple clonal iPSC lines, independently of their cellular origin.sup.7. One of the major difficulties is related to the necessary transition through the intermediate h-MPCs, which serve as common progenitors to not only h-iECs but also to other end-stage mesodermal cell types.sup.20,21. Thus, directing h-MPCs to solely differentiate into h-iECs is a challenge. Indeed, a recent study that used single-cell RNA analysis revealed that after S1-52, non-endothelial cell populations (including, cardiomyocytes and vascular smooth muscle cells) were in fact predominant among the differentiated cells, and less than 10% were actually identified as bona fide ECs.sup.3. Studies have also shown that EC specification is dictated by a transient activation of ETV2, which in turn depends on VEGF signaling.sup.11,22. However, our study has revealed that the activation of endogenous ETV2 during S2 is inherently inefficient and increasing the concentration of VEGF can only improve this constraint to a certain degree. This limited ability of exogenous VEGF to enhance efficiency could be explained by the fact that VEGF has also been shown to promote h-iPSC differentiation into other mesodermal fates, including cardiac progenitor cells, cardiomyocytes and hepatic-like cells.sup.3,20,23-25. Thus, in order to improve efficiency, VEGF activation of ETV2 must be accompanied by inhibition of all other competing fates, which is not trivial. The present approach, however, circumvents this challenge by transiently expressing ETV2, e.g., using modRNA, in a high percentage of h-MPCs and independently of VEGF signaling. This, in turn, allowed widespread conversion into h-iECs thereby eliminating the problem of inefficiency.
[0064] Current protocols are also limited by inconsistent results among different h-iPSC lines. Indeed, a recent study examined genetically identical h-iPSC clonal lines that were derived from various tissues of the same donor and found that by following the standard S1-S2 protocol, both differentiation efficiency and gene expression of the resulting h-iECs varied significantly depending on the source of h-iPSCs.sup.5. The present study also found inconsistencies in differentiation efficiency between h-iPSC clonal lines with different cellular origins, including lines with identical genetic make-up and lines derived from the same tissues in different donors. This lack of consistency is certainly undesirable from a clinical translation standpoint.sup.14. Also, dependency on cellular origin may explain why published results on differentiation efficiency are often mixed and rely on selecting h-iPSC clones that are particularly attuned to EC differentiation. The present method eliminated this uncertainty and consistently produced high efficiency differentiation, irrespective of the donor and cellular origin from which the h-iPSC clones are derived.
[0065] Previous studies have shown that ETV2 plays a non-redundant and indispensable role in vascular cell development.sup.10,26-28. In addition, expression of ETV2 is only required transiently, ideal for non-integrating transfection strategies such as those based on modRNA.sup.6. Recent studies have proposed reprogramming somatic cells using transducible vectors encoding ETV2.sup.29-32. Nevertheless, the efficiency of direct reprogramming somatic cells into ECs remains exceedingly low and achieving proper EC maturation requires long periods of time in culture. Alternatively, a few studies have recently introduced the idea of inducing ETV2 expression directly on h-iPSCs.sup.12,13,33. However, to date, methods have relied on early activation of ETV2 in the h-iPSCs, thus bypassing transition through an intermediate mesodermal stage. Also, the functional competence of the resulting h-iECs remains somewhat unclear. In this regard, our study provides an important new insight: that timely activation of ETV2 is critical, and bypassing the intermediate mesodermal stage is detrimental. Indeed, h-iECs generated by our S1-modETV2 methodology displayed proper blood vessel-forming ability in vivo, whereas putative h-iECs generated by the early modETV2 approach displayed impaired functionality and were unable to robustly form perfused vessels with adequate perivascular stability (
[0066] In summary, described herein is a protocol that enables highly efficient and reliable differentiation of human h-iPSCs into competent h-iECs. The protocol is simple, rapid, and entails transient expression of the transcription factor ETV2, e.g., by delivery of modified mRNA encoding ETV2, at the intermediate mesodermal stage of differentiation. This protocol has broad application in regenerative medicine because it provides a reliable means to obtain autologous h-iECs for vascular therapies.
[0067] Methods of Generating Endothelial Cells from iPSC
[0068] Described herein are two-dimensional, feeder-free, and chemically defined protocols that can be used to generate endothelial cells from pluripotent stem cells. The methods transition h-iPSCs through two distinct stages, each lasting about 48 hours. First is the conversion of h-iPSCs into h-MPCs. This step, similar to that in the standard S1-52 differentiation protocol, is mediated by the activation of Wnt and Nodal signaling pathways, e.g., using a glycogen synthase kinase 3 (GSK-3) inhibitor, e.g., CHIR99021 (
[0069] iPSC
[0070] The methods described herein can include the use of induced pluripotent stem cells (iPSCs) that can be generated using methods known in the art or described herein. In some embodiments, the methods for generating iPSC can include obtaining a population of primary somatic cells from a subject. Preferably the subject is a mammal, e.g., a human. In some embodiments, the somatic cells are fibroblasts. Fibroblasts can be obtained from connective tissue in the mammalian body, e.g., from the skin, e.g., skin from the eyelid, back of the ear, a scar (e.g., an abdominal cesarean scar), or the groin (see, e.g., Fernandes et al., Cytotechnology. 2016 March; 68(2): 223-228). Other sources of somatic cells for hiPSC include hair keratinocytes (Raab et al., Stem Cells Int. 2014; 2014:768391), blood cells, or bone marrow mesenchymal stem cells (MSCs) (Streckfuss-Bomeke et al., Eur Heart J. 2013 September; 34(33):2618-29). In some embodiments, the cells are obtained from urine. (See, e.g., Zhou et al., Nature Protocols 7: 2080-2089 (2012).
[0071] The somatic cells are then subject to dedifferentiation protocols, e.g., using the so-called Yamanaka factors, i.e., Oct4, Sox2, Klf4,and L-Myc, orh-oct4, h-sox2, h-klf4, h-myc, h-lin-28(proteinlin-28 homolog A) and EBNA-1(Epstein-Barr Nuclear Antigen-)(see, e.g., the methods below and Takahashi, K. & Yamanaka, S. Nat Rev Mol Cell Biol 17, 183-193 (2016); Tanabe, K., Nakamura, M., Narita, M., Takahashi, K. &Yamanaka, S. Proc Natl Acad Sci US A110, 12172-12179 (2013); Nakagawa, et al., Proc Natl Acad Sci US A107, 14152-14157 (2010); Takahashi, K. &Yamanaka, S. Cell 126, 663-676 (2006)).
[0072] References to exemplary sequences for OCT4, KLF4, SOX2, L-MYC, Lin-28 and EBNA-1 are provided in the following table.
TABLE-US-00001 Gene Nucleic acid .fwdarw. protein OCT4 NM_002701.6 .fwdarw. NP_ 002692.2 Isoform 1 (POU class 5 NM_001173531.2 .fwdarw. NP_001167002.1 Isoform 2 homeobox 1 NM_001285987.1 .fwdarw. NP_001272916.1 Isoform 3 (POU5F1)) NM_001285986.1 .fwdarw. NP_001272915.1 Isoform 4 KLF4 NM_001314052.1 .fwdarw. NP_001300981.1 Isoform 1 (Kruppel like NM_004235.6 .fwdarw. NP_004226.3 Isoform 2 factor 4) SOX2 NM_003106.4 .fwdarw. NP_ 003097.1 (SRY-box 2) L-MYC NM_001033081.3 .fwdarw. NP_001028253.1 Isoform 1 (MYCL NM_005376.4 .fwdarw. NP_005367.2 Isoform 2 proto- NM_001033082.2 .fwdarw. *NP_001028254.2 Isoform 3 oncogene, bHLH transcription factor) EBNA-1 NC_007605.1 (95662-97587) .fwdarw. YP_401677.1 Lin-28 NM_024674.6 .fwdarw. NP_078950.1
[0073] The presence of iPSCs can be confirmed, e.g., by expression of pluripotent transcription factors OCT4, NANOG, and SOX2 and/or by the ability to form teratomas, e.g., using a teratoma formation assay as known in the art. Once obtained, the iPSC can be maintained in culture using standard methods, e.g., iPSC culture media such as mTeSR1, mTeSR-E7, optionally in the presence of a rho-associated protein kinase (ROCK) inhibitor, e.g., Y27632, GSK429286A, Y-30141, Fasudil, Ripasudil, or Netarsudil. The ROCK inhibitors promote the survival of dissociated iPS cells, and improve the clonal growth of iPS cells.
[0074] The iPSC can be made from cells from any species, e.g., any mammalian species, but are preferably human. As noted above, as an alternative to iPSC, hESC can also be used.
[0075] Stage 1Conversion of iPSCs into MPCs
[0076] The first stage of the present methods is the conversion of iPSCs (or alternatively Embryonic stem cells (h-ESCs)) into MPCs. The methods include incubating the cells in media in the presence of a GSK3 inhibitor, e.g., CHIR99021, BIO, NP31112, IM-12; pyrazolopyrimidine derivatives, Benzimidazoles (e.g., analogs of 7-hydroxy-1H-benzimidazole), Pyridinones (e.g., 4-(4-hydroxy-3-methylphenyl)-6-phenyl pyrimidin-2-ol), Pyrimidines, Indolylmaleimide analogs, Imidazopyridines, Oxadiazoles, Pyrazines, thiadiazolidinones, Emodin and 4-Aminoethylamino Emodin, and 5-Imino-1,2,4-Thiadiazoles (ITDZs). See, e.g. Pandey and DeGrado, Theranostics. 2016; 6(4): 571-593.
[0077] Other optional ingredients include ascorbic acid, to promote the differentiation of iPS cells into mesodermal intermediates (MPCs), and L-glutamine, a nutrient in cell cultures for energy production as well as protein and nucleic acid synthesis. GlutaMAX is an improved cell culture supplement that can be used as a direct substitute for L-glutamine in cell culture media. As long as the GSK3 inhibitor is included, the other components can be reformulated.
[0078] The cells are incubated in stage 1 for about 48 hours (i.e., 4812, 10, 8, 6, 4, or 2 hours), until the cells express mesodermal markers, e.g., TBXT (also known as brachyury at the protein level), MIXL1, and KDR (VEGFR2). In some embodiments, brachyury staining is used.
[0079] Stage 2Conversion of MPCs to iECs
[0080] In the second stage, the MPCs are converted into iECs. The MPCs are preferably dissociated into single cells, and then induced to transiently express exogenous ETV2. During stage 2, the cells can optionally incubated in media comprising one or more growth factors, including VEGF-A, FGF-2, and EGF, and a TGFbeta receptor antagonist, e.g., SB431542, dihydropyrrolopyrazoles (e.g., LY550410 and LY580276); imidazoles (e.g., SB-505124 from GlaxoSmithKline), pyrazolopyridines, pyrazoles, imidazopyridines, triazoles, pyridopyrimidines, and isothiazoles. Specific examples include galunisertib (LY2157299 Monohydrate); A 83-01; RepSox; SD 208; SB 505124; LY 364947; D 4476; SB 525334; GW 788388; R 268712; IN 1130; SM 16; A 77-01; and SB431542. See, e.g., de Gramont, Oncoimmunology. 2017; 6(1): e1257453. As long as ETV2 expression is induced, media for the 2 days of S2 just needs to be formulated to keep cells healthy. These components are certainly helpful, and were used in the exemplary methods below to promote endothelial cell growth; but they are not essential for differentiation of MPCs into iECs in the present protocols. After the about 48 hours of stage 2, then media should be re-formulated for endothelial cell growth.
[0081] The cells are incubated in stage 2 for about 48 hours (i.e., 484812, 10, 8, 6, 4, or 2 hours) or more (one can keep culturing cells in S2 media without having to transition into a third stage), at least until the cells have cobblestone-like morphology; express endothelial cell markers at the mRNA and (more preferably) protein levels, e.g., CD31 and/or VE-Cadherin (e.g., using flow cytometry); do not express the pluripotent marker OCT4; and/or bind Ulex europaeus agglutinin I (UEA-1).
[0082] Once differentiation to iECs is achieved, the cells can be maintained in culture, expanded, genetically modified, frozen, and/or administered to a subject.
[0083] Transient expression of ETV2
[0084] Transient expression of ETV2 can be accomplished using means known in the art, e.g., transfection with a nucleic acid encoding an ETV2 sequence, e.g., naked DNA, RNA, or a vector, e.g., a plasmid or viral vector, comprising a sequence encoding ETV2. Preferably, the nucleic acid does not persist in the cells, thus providing time-limited expression of the ETV2. In preferred embodiments, expression of ETV2 in the cells is achieved using chemically modified RNA (modRNA) to deliver the exogenous ETV2 coding sequences. In some embodiments, the ETV2 encoding sequences are linked to a regulatory sequence, e.g., a promoter, that causes expression of the ETV2 in the cells. The ETV2 nucleic acids can be delivered to the MPCs using methods known in the art, including calcium phosphate or calcium chloride precipitation, DEAE-dextrin-mediated transfection, electroporation or lipofection.
[0085] In preferred embodiments, synthetic, chemically modified mRNA, wherein at least one pseudouridine is substituted for uridine and/or at least one 5-methyl-cytosine is substituted for cytosine, is used to express the ETV2 proteins. See, e.g., Karik et al., Immunity. 2005 August; 23(2):165-75; Karik et al., Mol. Ther. 2008. 16, 1833-1840; Karik et al., Nucleic Acids Res. 2011 November; 39(21):e142. Warren et al. Cell Stem Cell. 2010 Nov. 5; 7(5):618-30; Lui et al. Cell Res. 2013 October; 23(10):1172-86; Zangi et al., Nat Biotechnol. 2013 October; 31(10):898-9071; Lui et al., Cell Res. 2013 October; 23(10):1172-86; and Chien et al., Cold Spring Harb Perspect Med. 2015 January; 5(1): a014035.
[0086] The ETV2 sequences used in the present methods and compositions can be at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to the full length wild type genomic or cDNA ETV2 sequence, respectively. In some embodiments, a suitable ETV2 gene encodes a protein sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to a full-length wild type ETV2 protein sequence, e.g., SEQ ID NO:1 (NP_055024.2). Exemplary wild type genomic, cDNA, and protein sequences of human ETV2 are provided herein. Sequences for use in other species are known in the art.
Exemplary Human ETV2 Sequences
[0087]
TABLE-US-00002 Nucleic acid Protein Variant/isoform NM_014209.4 NP_055024.2 isoform 1 NM_001300974.1 NP_001287903.1 isoform 2 NM_001304549.1 NP_001291478.1 isoform 3
[0088] Variant 1 represents the longer transcript and encodes the longer isoform 1. Variant 2 differs in the 5 UTR, lacks a portion of the 5 coding region, and initiates translation at a downstream start codon, compared to variant 1, and encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. Variant 3 lacks two in-frame exons compared to variant 1. It encodes isoform 3, which is shorter than isoform 1. In some embodiments, Variant 1/isoform 1 is used.
[0089] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. In another embodiment, the percent identity of two amino acid sequences can be assessed as a function of the conservation of amino acid residues within the same family of amino acids (e.g., positive charge, negative charge, polar and uncharged, hydrophobic) at corresponding positions in both amino acid sequences (e.g., the presence of an alanine residue in place of a valine residue at a specific position in both sequences shows a high level of conservation, but the presence of an arginine residue in place of an aspartate residue at a specific position in both sequences shows a low level of conservation). For example, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package, using a Blossum scoring matrix, e.g., with default values for gap penalty, gap extend penalty of 4, and frameshift gap penalty.
[0090] Methods of UseCell Therapy
[0091] iECs generated using a method described herein can be used for cell therapy, e.g., to treat various conditions in subjects, e.g., mammalian subjects, e.g., humans or non-human veterinary subjects such as dogs, cats, horses, pigs, sheep, cows, goats, or zoo animals. As one example, the cells can be used in vascular cell therapy, e.g., to treat ischemic or vascular injury and endothelial denudation, e.g., in limbs, retina or myocardium; or for revascularization/neovascularization, e.g., to treat diabetes or promote success after organ transplantation. See, e.g., Mund et al., Cytotherapy (2009) 11(2):103-113; Rafii and Lyden, Nat Med. 2003 June; 9(6):702-12; Reed et al., Br J Clin Pharmacol. 2013 April; 75(4):897-906. These methods can include, e.g., identifying a subject in need of such treatment, and administering to the subject a population of iECs obtained using a method described herein. In preferred embodiments, the iECs are generated from iPSCs derived from the subject's own cells, i.e., are autologous.
[0092] The cells can be genetically engineered to express a heterologous, endogenous or exogenous nucleotide sequence that encodes a therapeutic polypeptide. The sequence encoding the selected protein can be inserted in an expression vector, to make an expression construct. A number of suitable vectors are known in the art, e.g., viral vectors including recombinant retroviruses, adenovirus, adeno-associated virus, herpes simplex virus 1, adenovirus-derived vectors; or recombinant bacterial or eukaryotic plasmids; or transposons, e.g., piggyBac or Sleeping Beauty (see, e.g., Tipanee et al., Hum Gene Ther. 2017 November; 28(11):1087-1104; Zhao et al., Transl Lung Cancer Res. 2016 February; 5(1):120-5). For example, the expression construct can include: a coding region; a promoter sequence, e.g., a promoter sequence that restricts expression to a selected cell type, a conditional promoter, or a strong general promoter; an enhancer sequence; untranslated regulatory sequences, e.g., a 5untranslated region (UTR), a 3UTR; a polyadenylation site; and/or an insulator sequence. Such sequences are known in the art, and the skilled artisan would be able to select suitable sequences. See, e.g., Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14; Vancura (ed.), Transcriptional Regulation: Methods and Protocols (Methods in Molecular Biology (Book 809)) Humana Press; 2012 edition (2011) and other standard laboratory manuals. The nucleotide sequence can include one or more of a promoter sequence, e.g., a promoter sequence; an enhancer sequence, e.g., 5 untranslated region (UTR) or a 3 UTR; a polyadenylation site; an insulator sequence; or another sequence that increases the expression of an endogenous peptide or increases expression, level, or activity of an endogenous polypeptide.
[0093] The iECs can be transfected directly, or can be cultured first, removed from the culture plate and resuspended before transfection is carried out. The cells can be combined with the nucleotide sequence that encodes a therapeutic polypeptide, e.g., stably integrate into their genomes, and treated in order to accomplish transfection. As used herein, the term transfection includes a variety of techniques for introducing an exogenous nucleic acid into a cell including calcium phosphate or calcium chloride precipitation, microinjection, DEAE-dextrin-mediated transfection, lipofection, electroporation or genome-editing using zinc-finger nucleases, transcription activator-like effector nuclease or the CRIPSR-Cas system, all of which are routine in the art (Kim et al (2010) Anal Bioanal Chem 397(8): 3173-3178; Hockemeyer et al. (2011) Nat. Biotechnol. 29:731-734; Feng, Z et al. (2013) Cell Res 23(10): 1229-1232; Jinek, M. et al. (2013) eLife 2:e00471; Wang et al (2013) Cell. 153(4): 910-918); Lin et al., Vascular Stem Cell Therapy, in Stem Cells and Cell Therapy, 2014 (pp. 49-69), DOI: 10.1007/978-94-007-7196-3_3.
[0094] Transfected cells can be allowed to undergo sufficient numbers of doubling to produce either a clonal cell strain or a heterogeneous cell strain of sufficient size to provide the therapeutic protein to an individual in effective amounts. The number of required cells in a transfected clonal heterogeneous cell strain is variable and depends on a variety of factors, including but not limited to, the use of the transfected cells, the functional level of the exogenous DNA in the transfected cells, the site of implantation of the transfected cells (for example, the number of cells that can be used is limited by the anatomical site of implantation), and the age, surface area, and clinical condition of the patient. The genetically modified iECs cells, e.g., cells produced as described herein, can be introduced into an individual to whom the product is to be delivered. Various routes of administration and various sites (e.g., renal sub capsular, subcutaneous, central nervous system (including intrathecal), intravascular, intrahepatic, intrasplanchnic, intraperitoneal (including intraomental), intramuscularly implantation) can be used; in general terms, the iECs can be injected into any vascularized tissue (i.e., tissue with blood vessels) so the new iECs can make capillaries that hook up with the existing vessels. Once implanted in an individual, the transfected cells produce the product encoded by the heterologous nucleic acid or are affected by the heterologous nucleic acid itself.
[0095] Hemophilia A
[0096] Hemophilia A is an inherited X-chromosome-linked bleeding disorder caused by mutations in the F8 gene encoding coagulation factor VIII (FVIII) (Gitschier, J. et al. (1985)). Hemophilia A has an incidence of 1 in 5,000 liveborn males and patients with severe hemophilia A (60% of all hemophiliacs) present frequent spontaneous bleeds into joints and soft tissues (hemarthrosis), which can lead to serious complications and even death (Soucie et al., 2000). Current treatments for Hemophilia A patients are infusions of FVIII concentrates (Gouw et al., 2013). However, patients require repeated intravenous injections of the factor throughout life, which creates continuous discomfort, augments morbidity, and impairs overall quality of life (Barr et al., 2002; von Mackensen et al., 2012). Moreover, prophylaxis for severe patients involves injections of FVIII concentrates every other day and adherence is a constant challenge (Lindvall et al., 2006; Walsh and Valentino, 2009). Therefore, hemophilia A remains an appealing target disease for the application of gene therapy (High, 2012; Matrai et al., 2010).
[0097] Most preclinical studies of hemophilia A gene therapy have focused on the use of viral vectors, including adenovirus (Hu et al., 2011; Brown et al., 2004) and adeno-associated virus (AAV) (Sarkar et al., 2004; Jiang et al., 2006; Lu et al., 2008). However, F8 is a relatively large gene (7.0 kb cDNA) and thus it cannot be effectively packaged into most existing viral vectors (High, 2012). Consequently, most efforts in hemophilia A gene therapy have been conducted with a truncated version of FVIII that lacks the B-domain (referred to as BDD-FVIII)(Miao et al., Blood. 2004 May 1; 103(9):3412-9).
[0098] Nevertheless, mounting evidence indicates that although the B-domain is not essential for coagulation, it is involved in multiple critical post-translational functions, including FVIII secretion into the bloodstreams and its later clearance from plasma (Pipe, 2009). Thus, the interest for a full-length version of FVIII (FL-FVIII) that is applicable to gene therapy remains.
[0099] Herein described is an ex vivo gene therapy approach that uses hemophilia A patients' cells to deliver full-length FVIII into the bloodstream of hemophilic subjects. In brief, patient-specific induced pluripotent stem cells (HA-iPSCs) were generated from epithelial cells isolated from severe hemophilia A patients' urine samples, and a non-viral piggyBac DNA transposon vector (PB) was used to deliver F8 into these patients' iPSCs. Of note, PBs have a large cargo size (9.1 kb) and thus were able to deliver full-length F8 with reasonable integration efficiency. The full-length F8 gene edited HA-iPSCs (HA-F8FL-iPSCs) were then differentiated into competent FVIII-secreting endothelial cells (HA-FLF8-iECs) with high efficiency. These genetically modified HA-FLF8-iECs were combined in a collagen hydrogel and subcutaneously injected into immunodeficient hemophilic (SCID-f8ko) mice. Following implantation, HA-FLF8-iECs self-assembled into vascular networks and the newly-formed microvessels had the capacity to deliver FVIII directly into the bloodstream of the mice, effectively correcting the clotting deficiency from an excisable subcutaneous implant. Collectively, these studies established the feasibility of using implants containing drug-secreting vascular networks as a novel autologous ex vivo gene therapy approach to treat hemophilia A.
[0100] Thus, provided herein are methods for treating an individual who suffers from a blood clotting disorder (e.g., hemophilia A or hemophilia B) by implantation of cells producing a compound described herein, e.g., a functional factor VIII polypeptide for hemophilia A or a functional factor IX polypeptide for hemophilia B, as described herein.
[0101] The following table shows exemplary sequences for factors VIII and IX.
TABLE-US-00003 Nucleic acid Protein Variant/isoform NM_000132.3 NP_000123.1 coagulation factor VIII isoform a preproprotein NM_019863.2 NP_063916.1 coagulation factor VIII isoform b NM_000133.3 NP_000124.1 coagulation factor IX isoform 1 preproprotein NM_001313913.1 NP_001300842.1 coagulation factor IX isoform 2 precursor
[0102] Factor VIII variant 1 of has 26 exons and encodes the full-length isoform a, while variant 2 contains an unique 5 exon located within intron 22 of transcript variant 1 that codes for eight amino acids and is spliced to exons 23-26 maintaining the reading frame. Isoform b is considerably shorter compared to isoform a, and includes the phospholipid binding domain. Factor VIII has a domain structure of A1-A2-B-A3-C1-C2; deletion of the B domain (the BDD form, for B domain deleted) produces a form that has improved secretion (Miao et al., Blood. 2004 May 1; 103(9):3412-9).
[0103] Factor IX variant 1 is the longer transcript and encodes the longer isoform 1; variant 2 lacks an alternate in-frame exon in the 5 coding region, and encodes isoform 2, which is shorter than isoform 1.
[0104] Any of the above sequences, or variants thereof that are at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to the above sequences and have the same or substantially the same clotting activity (e.g., at least 50%, 60% 70%, 80%, 90%, 95% or more of the clotting activity, e.g., as measured in a clotting assay such as the 1-stage aPTT clotting assay or 2-stage assay using the COAMATIC chromogenic assay) can be used in the present methods and compositions.
[0105] In some embodiments, the bioengineered cells are delivered inside a hydrogel-based implant; in some embodiments, the implant is placed subcutaneously and in some embodiments remains easily accessible and thus could be retrievable. A number of hydrogels are known in the art for cell implantation; for example, natural hydrogels can be made using proteins (e.g., collagen, gelatin, fibrin, or fibronectin (Fn)) or polysaccharides (e.g., hyaluronic acid (HA), agarose, alginate, chitosan, or HA-methyl cellulose (HAMC)) and combinations thereof (e.g., collagen/Ha hybrid polymers, gelatin/chitosan and fibrin/alginate polymers); synthetic hydrogels can be made using polydimethylsiloxane (PDMS), polyethylene glycol (PEG), poly(lactic-co-glycolic acid) (PLGA), polyglycerol sebacate (PGS), and Poly(propylene fumarate-co-ethylene glycol) (p(PF-co-EG), and self-assembling peptide hydrogels (self-complementary peptides (SCP) and peptide amphiphiles (PAs)), and combinations thereof, as well as natural/synthetic hybrids, e.g., PEGylated fibrinogen, elatin electrospun together with poly(L-lactic acid), hydrazide-modified gelatin with aldehyde-modified HA, and Gelatin methacrylate (GelMA). See, e.g., Liu et al., Int J Mol Sci. 2015 July; 16(7): 15997-16016; and El-Sherbiny and Yacoub, Glob Cardiol Sci Pract. 2013; 2013(3): 316-342. In some embodiments, a collagen/fibrin hydrogel or enzymatically crosslinked collagen hydrogel derived from dermal extracellular matrix. is used. See, e.g., Allen et al., J Tissue Eng Regen Med. 2011 April; 5(4):e74-86; Kuo et al., Acta Biomater. 2015 November; 27:151-166; Lin et al., Proc Natl Acad Sci USA. 2014 Jul. 15; 111(28):10137-42.
[0106] Compositions
[0107] Compositions comprising the iECS generated using a method described herein, e.g., genetically engineered iECs, and a carrier, optionally a hydrogel, are also provided herein. In some embodiments, the compositions also comprise other cell types in combination with the iECs, for example beta-cells+iECs for treating type 1 diabetes; cardiomyocytes+iECs for myocardial repair; and mesenchymal stem cells+iECs for bone regeneration.
EXAMPLES
[0108] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0109] Methods
[0110] The following materials and methods were used in the Examples below.
[0111] Isolation and Culture of Human MSCs, ECFCs and uEPs
[0112] Human MSCs (h-MSCs) were isolated from the white adipose tissue as previously described (Lin, R.-Z. et al. Proc Natl Acad Sci USA 111, 10137-10142 (2014)). h-MSCs were cultured on uncoated plates using MSC-medium: MSCGM (Lonza, Cat No. PT-3001) supplemented with 10% GenClone FBS (Genesee, Cat No. 25-514), 1penicillin-streptomycin-glutamine (PSG, ThermoFisher, Cat No. 10378106). All experiments were carried out with h-MSCs between passage 6-10. Human ECFCs were isolated from umbilical cord blood samples in accordance with an Institutional Review Board-approved protocol as previously described (Melero-Martin, J. M. et al. Blood 109, 4761-4768 (2007)). ECFCs were cultured on 1% gelatin-coated plates using ECFC-medium: EGM-2 (except for hydrocortisone; PromoCell, Cat No. C22111) supplemented with 10% FBS, 1PSG. All experiments were carried out with ECFCs between passage 6-8. Human urine-derived epithelial cells (uEPs) were isolated from urine samples and were cultured on 1% gelatin-coated plates using ECFC-medium. All experiments were carried out with uEPs up to passage 4.
[0113] Generation and Culture of Human iPSCs
[0114] Human induced pluripotent stem cells (h-iPSCs) were generated via non-integrating episomal transferring of selected reprogramming factors (Oct4, Sox2, Klf4, L-Myc, Lin28). Briefly, four plasmids encoding h-oct4, h-sox2, h-klf4, h-myc, h-lin-28 and EBNA-1 (Addgene plasmids #27077, #27078, #27080, and #37624 deposited by Shinya Yamanaka) were introduced via electroporation into h-MSCs, ECFCs and uEPs. Transfected cells were then cultured with mTeSR-E7 medium (STEMCELL, Cat No. 05910). H-iPSC colonies spontaneously emerged between days 15-25. Colonies were then picked and transferred to a Matrigel-coated (Corning, Cat No. 354277), feeder-free culture plate for expansion and were routinely checked for absence of mycoplasma. H-iPSCs were cultured in mTeSR1 medium (STEMCELL, Cat No. 85850) on 6-well plates coated with Matrigel. At 80% confluency, h-iPSCs were detached using TrypLE select (ThermoFisher, Cat No. 12563-029) and split at a 1:6 ratio. Culture media were changed daily. h-iPSCs phenotype was validated by expression of pluripotent transcription factors OCT4, NANOG, and SOX2 and by the ability to form teratomas. Teratoma formation assay was performed by injecting 1 million h-iPSCs mixed in 100 L Matrigel into the dorsal flank of nude mice (Jackson Lab). Four weeks after the injection, tumors were surgically dissected from the mice, weighed, fixed in 4% formaldehyde, and embedded in paraffin for histology. Sections were stained with hematoxylin and eosin (H&E).
[0115] Electroporation
[0116] Electroporation was routinely used to introduce plasmids, modified mRNA and proteins into the cells as described for each experiment. Electroporation was carried out with a Neon electroporation system (ThermoFisher). Unless specified otherwise, electroporation parameters were set as 1150 v for pulse voltage, 30 ms for pulse width, 2 for pulse number, 3 mL of electrolytic buffer and 100 L resuspension buffer R in 100 L reaction tips (ThermoFisher, Cat No. MPK10096).
[0117] Establishment of KDR and ETV2 Knock Out h-iPSC Lines
[0118] Alt-R CRISPR-Cas9 system (Integrated DNA Technologies, IDT) was used to knock out KDR and ETV2 in h-iPSCs. Briefly, guide RNA (gRNA) was prepared by mixing crRNA (Table 1) and tracrRNA (IDT, Cat No. 1072533) to a final duplex concentration of 40 M. Ribonucleoprotein (RNP) complex was prepared with 1 L volume of 61 M Cas9 protein (IDT, Cat No. 1074181) complexed with 2.5 L of gRNA for 15 min at room temperature. Following incubation, RNP complexes were diluted with 100 L R buffer and mixed with one million pelleted h-iPSCs for electroporation. Two days later, h-iPSCs were dissociated into single cells and plated at 2,000 cells per 10 cm dish in mTeSR1 supplemented with CloneR (STEMCELL, Cat No. 5888). Single cells were able to grow and form single visible colonies after 10 days. 48 colonies were randomly picked based on morphology and were then mechanically disaggregated and replated into individual wells of 48-well plates. Colonies were then expanded in culture as described above. To validate the knock out genes in each clone, genomic DNA templates were prepared by lysing cells in QuickExtract DNA extraction solution (Lucigen, Cat No. QE0905T). Target regions were amplified by using specific PCR primers (Table 1) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz) was performed to identify mutant clones.
TABLE-US-00004 TABLE1 SequencesofgRNA,PCRprimers,andsequencingprimers usedinCRISPR-Cas9geneknockdown Sanger Target gRNA PCRforward PCRreverse sequencing Gene sequence PAM primer primer primer ETV2 ACGGACTGT GGG CACTCGGGAT GTTCGGAGCAA GTTCGGAG ACCATTTCG CCGTTACTCC ACGGTGAGA CAAACGGT TG(SEQID (SEQIDNO:11) (SEQIDNO:12) GAGA(SEQ NO:10) IDNO:13) KDR GAGCCTACA CGG CAAGCCCTTT ATTAATTTTTC ATTAATTTT AGTGCTTCT GTTGTACTCA AGGGGACAGA TCAGGGGA AC(SEQID ATTCT(SEQID GGGA(SEQID CAGAGGGA NO:14) NO:15) NO:16) (SEQID NO:17)
[0119] Establishment of h-iPSC Line Expressing GFP
[0120] h-iPSCs were dissociated and filtered through 40 m cell strainer to get single cells. For electroporation, 1 million h-iPSCs were resuspended in 100 L buffer mixed with 2 g PB-EF1A-GFP-puro plasmid (VectorBuilder) and 1 g transposase plasmid (VectorBuilder). The electroporated cells were then plated on a 35-mm Matrigel-coated dish in mTeSR1 medium with 10 M Y27632. After 48 hours, culture medium was replaced by mTeSR1 medium with 10 g/mL puromycin (Sigma, Cat No. P8833) and changed daily for 3 to 4 days.
[0121] Modified mRNA Synthesis and Formulation
[0122] Chemically modified mRNA encoding ETV2 (modRNA(ETV2)) was generated by TriLink BioTechnologies, LLC. In brief, modRNA(ETV2) was synthesized in vitro by T7 RNA polymerase-mediated transcription from a linearized DNA template, which incorporates the 5 and 3 UTRs and a poly-A tail. Specifically, the sequence used for ETV2, transcript variant 1 (NM_014209.3); ORF:
TABLE-US-00005 (SEQIDNO:1) ATGGACCTGTGGAACTGGGATGAGGCATCCCCACAGGAAGTGCCTCCAGG GAACAAGCTGGCAGGGCTTGAAGGAGCCAAATTAGGCTTCTGTTTCCCTG ATCTGGCACTCCAAGGGGACACGCCGACAGCGACAGCAGAGACATGCTGG AAAGGTACAAGCTCATCCCTGGCAAGCTTCCCACAGCTGGACTGGGGCTC CGCGTTACTGCACCCAGAAGTTCCATGGGGGGCGGAGCCCGACTCTCAGG CTCTTCCGTGGTCCGGGGACTGGACAGACATGGCGTGCACAGCCTGGGAC TCTTGGAGCGGCGCCTCGCAGACCCTGGGCCCCGCCCCTCTCGGCCCGGG CCCCATCCCCGCCGCCGGCTCCGAAGGCGCCGCGGGCCAGAACTGCGTCC CCGTGGCGGGAGAGGCCACCTCGTGGTCGCGCGCCCAGGCCGCCGGGAGC AACACCAGCTGGGACTGTTCTGTGGGGCCCGACGGCGATACCTACTGGGG CAGTGGCCTGGGCGGGGAGCCGCGCACGGACTGTACCATTTCGTGGGGCG GGCCCGCGGGCCCGGACTGTACCACCTCCTGGAACCCGGGGCTGCATGCG GGTGGCACCACCTCTTTGAAGCGGTACCAGAGCTCAGCTCTCACCGTTTG CTCCGAACCGAGCCCGCAGTCGGACCGTGCCAGTTTGGCTCGATGCCCCA AAACTAACCACCGAGGTCCCATTCAGCTGTGGCAGTTCCTCCTGGAGCTG CTCCACGACGGGGCGCGTAGCAGCTGCATCCGTTGGACTGGCAACAGCCG CGAGTTCCAGCTGTGCGACCCCAAAGAGGTGGCTCGGCTGTGGGGCGAGC GCAAGAGAAAGCCGGGCATGAATTACGAGAAGCTGAGCCGGGGCCTTCGC TACTACTATCGCCGCGACATCGTGCGCAAGAGCGGGGGGCGAAAGTACAC GTACCGCTTCGGGGGCCGCGTGCCCAGCCTAGCCTATCCGGACTGTGCGG GAGGCGGACGGGGAGCAGAGACACAATAA;1029bp
was cloned into the mRNA expression vector pmRNA, which contains a T7 RNA polymerase promoter, an unstructured synthetic 5 UTR, a multiple cloning site, and a 3 UTR that was derived from the mouse -globin 3 gene. In vitro transcriptional (IVT) reaction (1 mL-scale) was performed to generate unmodified mRNA transcripts with wild type bases and a poly-A tail. Co-transcriptional capping with CleanCap Cap1 AG trimer yields a naturally occurring Cap1 structure. DNase treatment was used to remove DNA template. 5-triphosphate were removed by phosphatase treatment to reduce innate immune response. After elution through silica membrane, the purified RNA was dissolved in RNase-free sodium citrate buffer (1 mM, pH 6.4).
[0123] Differentiation of h-iPSCs into h-iECs
[0124] The following protocols were used for differentiation.
[0125] S1-modETV2 protocol (4 days)h-iPSCs were dissociated into single cells with TrypLE select and plated on Matrigel at a density of 60,000 cells/cm.sup.2 in mTeSR1 medium with 10 M Y27632. After 24 h, the medium was changed to S1 medium consisting of basal medium supplemented with 6 M CHIR99021. Basal medium was prepared by adding 1 GlutaMax supplement and 60 g/mL L-Ascorbic acid into Advanced DMEM/F12. After 48 h, h-MPCs were dissociated into single cells and then transfected with modRNA(ETV2) by either electroporation or lipofection. For electroporation, 2 million h-MPCs were resuspended in 100 L buffer mixed with 1 g modETV2. Electroporated cells were then seeded on a 60-mm Matrigel-coated dish in modETV2 medium consisting of basal medium supplemented with 50 ng/mL VEGF-A, 50 ng/mL FGF-2, 10 ng/mL EGF and 10 M SB431542. For lipofection, 3 L lipofectamine RNAiMax (ThermoFisher, Cat No. 13778030) were diluted in 50 L Opti-MEM (ThermoFisher, Cat No. 31985062) and 0.6 g modRNA(ETV2) diluted in another 50 L Opti-MEM. Lipofectamine and modRNA(ETV2) were then mixed and incubated for 15 min at room temperature. The lipid/RNA complex was added to 0.5 million h-MPCs in modETV2 medium and transfected cells were then seeded on a 35-mm Matrigel-coated dish. Upon transfection (electroporation or lipofection), cells were cultured for another 48 h before purification. Medium was changed every day throughout this protocol (Table 2). modRNA encoding GFP (TriLink, Cat No. L-7601) at a concentration of 0.2 g per million h-MPCs served as negative control.
TABLE-US-00006 TABLE 2 S1-modETV2 protocol Basal Stages Days Supplements medium S0 0 Y27632 (Seed 60,000 h-iPSCs/cm.sup.2 on mTeSR1 10 M matrigel-coated 6-well plates) S1 1 CHIR99021 Advanced 6 M DMEM/ 2 Repeat Day 1 F12 Ascorbic acid 60 g/mL GlutaMax 1 h-MPCs were dissociated into single cells and then transfected with modRNA(ETV2) by either electroporation or lipofection ModETV2 3 VEGF- FGF-2 EGF SB431542 A 50 50 10 10 M ng/mL ng/mL ng/mL 4 Repeat Day 3
[0126] Early modETV2 protocol (2 days)h-iPSCs were dissociated into single cells and then transfected with modRNA(ETV2) by electroporation. For electroporation, 2 million h-iPSCs were resuspended in 100 L buffer and mixed with 1.5 g modRNA(ETV2). Electroporated cells were then plated on a 60-mm Matrigel-coated dish in mTeSR1 medium with 10 M Y27632. After 24 h, the medium was changed to mTeSR1 medium with 10 M SB431542 for another 24 h.
[0127] S1-S2, method #1 (4 days)h-iPSCs were dissociated into single cells with TrypLE select and plated on Matrigel at a density of 60,000 cells/cm.sup.2 in mTeSR1 medium with 10 M Y27632. After 24 h, the medium was changed to S1 medium consisting of basal medium supplemented with 6 M CHIR99021. Basal medium was prepared by adding 1 GlutaMax supplement and 60 g/mL L-Ascorbic acid into Advanced DMEM/F12. After 48 h, the differentiation medium was changed to S2 medium for 48 h. S2 medium consisted of basal medium supplemented with 50 ng/mL VEGF-A, 50 ng/mL FGF-2, 10 ng/mL EGF and 10 M SB431542. Medium was changed every day throughout this protocol. Details for this protocol are provided in Table 3.
TABLE-US-00007 TABLE 3 S1-S2 method #1 Basal Stages Days Supplements medium S0 0 Y27632 (Seed 60,000 h-iPSCs/cm.sup.2 on mTeSR1 10 M matrigel-coated 6-well plates) S1 1 CHIR99021 Advanced 6 M DMEM/ 2 Repeat Day 1 F12 Ascorbic acid 60 g/mL S2 3 VEGF-A FGF-2 EGF SB431542 GlutaMax 50 ng/mL 50 10 ng/mL 10 M 1 ng/mL 4 Repeat Day 3
[0128] S1-S2, method #2 (4 days)h-iPSCs were dissociated into single cells with TrypLE select and plated on Matrigel at a density of 60,000 cells/cm.sup.2 in mTeSR1 medium with 10 M Y27632. After 24 h, the medium was changed to STEMdiff APEL2 medium supplemented with 6 M CHIR99021. After 48 h, the differentiation medium was changed to S2 medium for 48 h. S2 medium consisted of STEMdiff APEL2 medium supplemented with 50 ng/mL VEGF-A, 10 ng/mL FGF-2, and 25 ng/mL BMP4. Medium was changed every day throughout this protocol. Details for this protocol are provided in Table 4. This protocol was adopted from Harding et al. Stem Cells 35, 909-919 (2017).
TABLE-US-00008 TABLE 4 S1-S2 method #2 Stages Days Supplements Basal medium S0 0 Y27632 (Seed 60,000 h-iPSCs/cm.sup.2 mTeSR1 10 M on matrigel-coated 6-well plates) S1 1 CHIR99021 STEMdiff 6 M APEL2 Media 2 Repeat Day 1 S2 3 VEGF-A FGF-2 BMP4 50 ng/mL 10 ng/mL 25 ng/mL 4 Repeat Day 3
[0129] S1-S2, method #3 (4 days)h-iPSCs were dissociated into single cells with TrypLE select and plated on Matrigel at a density of 60,000 cells/cm.sup.2 in mTeSR1 medium with 10 M Y27632. After 24 h, the medium was changed to basal medium supplemented with 1 M CP21R7 and 20 ng/mL BMP4. Basal medium was prepared by adding 1B27 supplement and 1N2 into DMEM/F12. After 48 h, the differentiation medium was changed to S2 medium for 48 h. S2 medium consisted of StemPro-34 SFM supplemented with 50 ng/mL VEGF-A, and 10 M DAPT. Medium was changed every day throughout this protocol. Details for this protocol are provided in Table 5. This protocol was adopted from Sahara et al. Cell Res 24, 820-841 (2014).
TABLE-US-00009 TABLE 5 S1-S2, method #3 Basal Stages Days Supplements medium S0 0 Y27632 (Seed 60,000 h-iPSCs/cm.sup.2 mTeSR1 10 M on matrigel-coated 6-well plates) S1 1 CP21R7 BMP4 DMEM/F12 1 M 20 ng/mL 1 B27 2 Repeat Day 1 1 N2 S2 3 VEGF-A DAPT StemPro-34 50 ng/mL 10 M 4 Repeat Day 3
[0130] S1-S2, method #4 (4 days)h-iPSCs were dissociated into single cells with TrypLE select and plated on Matrigel at a density of 60,000 cells/cm.sup.2 in mTeSR1 medium with 10 M Y27632. After 24 h, the medium was changed to basal medium supplemented with 8 M CHIR99021. Basal medium was prepared by adding 1B27 supplement and 1N2 into DMEM/F12. After 48 h, the differentiation medium was changed to S2 medium for 48 h. S2 medium consisted of StemPro-34 SFM supplemented with 200 ng/mL VEGF-A, and 2 M forskolin. Medium was changed every day throughout this protocol. Details for this protocol are provided in Table 6. This protocol was adopted from Patsch et al. Nat Cell Biol 17, 994-1003 (2015).
TABLE-US-00010 TABLE 6 S1-S2, method #4 Stages Days Supplements Basal medium S0 0 Y27632 (Seed 60,000 h-iPSCs/cm.sup.2 mTeSR1 10 M on matrigel-coated 6-well plates) S1 1 CHIR99021 DMEM/F12 8 M 1 B27 2 Repeat Day 1 1 N2 S2 3 VEGF-A Forskolin StemPro-34 200 ng/mL 2 M 4 Repeat Day 3
[0131] Purification and Expansion of h-iECs
[0132] At indicated time points after differentiation, h-iECs were dissociated into single cells and sorted into CD31+ and CD31 cells using magnetic beads coated with anti-human CD31 antibodies (DynaBeads, ThermoFisher, Cat No. 11155D). The purified CD31+ h-iECs were then expanded in culture on 10-cm dishes coated with 1% gelatin. Culture medium for h-iECs was prepared by adding Endothelial Cell Growth medium 2 kit supplements into basal medium (except for hydrocortisone, PromoCell, Cat No. C22111) with 1GlutaMax supplement and 10 M SB431542.
[0133] RNA-Seq Analysis
[0134] The following groups were analysed: h-iPSCs, human ECFCs, and h-iECs generated with three protocols: S1-S2, S1-modETV2, and early modETV2. Each group consists of 3 biological replicates. Total RNA from h-iECs which have been expanded for 7 days was extracted using Rneasy Mini Kit (Qiagen) following the manufacturer's protocol. RNA quantity and quality were checked with nanodrop and Agilent Bioanalyzer instrument. Libraries were prepared and sequenced by GENEWIZ (NJ, USA). Library preparation involved mRNA enrichment and fragmentation, chemical fragmentation, first and second strand Cdna synthesis, end repair and 5 phosphorylation, Da-tailing, adaptor ligation and PCR enrichment. The libraries were then sequenced using Illumina HiSeq2500 platform (Illumina, CA) using 2150 paired end configuration. The raw sequencing data (FASTQ files) was examined for library generation and sequencing quality using FastQC (bioinformatics.babraham.ac.uk/projects/fastqc/) to ensure data quality was suitable for further analysis. Reads were aligned to UCSC hg38 genome using the STAR aligner (Dobin, A. et al. Bioinformatics 29, 15-21 (2013)). Alignments were checked for evenness of coverage, rRNA content, genomic context of alignments, complexity, and other quality checks using a combination of FastQC, Qualimap (Garcia-Alcalde, F. et al. Bioinformatics 28, 2678-2679 (2012).) and MultiQC (Ewels, P., et al. Bioinformatics 32, 3047-3048 (2016)). The expression of the transcripts was quantified against the Ensembl release GRCh38 transcriptome annotation using Salmon. These transcript abundances were then imported into R (version 3.5.1) and aggregated to the gene level with tximport. Differential expression at the gene level was called with DESeq2 (Love, et al. Genome Biol. 15, 550 (2014)). Pairwise differential expression analysis between groups was performed using Wald significance test. The P values was corrected for multiple hypothesis testing with the Benjamini-Hochberg false-discovery rate procedure (adjusted P value). Genes with adjusted P value <0.05 were considered significantly different. Hierarchical clustering and PCA analysis were performed on DESeq2 normalized, rlog variance stabilized reads. All samples comparison was performed using Likelihood Ratio Test (LRT). Heat maps of the differential expressed genes and enriched gene sets were generated with pheatmap package. Functional enrichment of differential expressed genes, using gene sets from Gene Ontology (GO), was determined with Fisher's exact test as implemented in the clusterProfiler package. The RNA-Seq datasets are deposited online with SRA accession number: PRJNA509218.
[0135] Chemicals and Media Components
[0136] Chemicals and media components used herein are shown in Table 7.
TABLE-US-00011 TABLE 7 Chemicals and media components Components Vendor Cat. No. mTesR1 STEMCELL 85870 Y27632 Selleckchem S1049-50 mg Matrigel Corning 354277 Advanced DMEM/F12 ThermoFisher 12634010 GlutaMax ThermoFisher 35050061 Ascorbic acid phosphate Millipore-Sigma A8960 CHIR99021 Millipore-Sigma SML1046 VEGF-A PeproTech 100-20 EGF PeproTech AF-100-15 FGF-2 PeproTech 100-18B SB431542 Selleckchem S1067-50 mg STEMdiff APEL2 Media STEMCELL 05275 DMEM/F12 ThermoFisher 11330032 N2 ThermoFisher 17502048 B27 ThermoFisher 17504044 CP21R7 Selleckchem S7954-5 mg BMP4 PeproTech 120-05ET StemPro-34 ThermoFisher 10639011 DAPT Selleckchem S2215-25 mg Forskolin Millipore-Sigma F3917-10 MG EGM2 kit PromoCell C-22111 Gelatin Millipore-Sigma G2500-500G
[0137] Flow Cytometry
[0138] Cells were dissociated into single-cell suspensions using TrypLE and washed with PBS supplemented with 100BSA and 0.2 mM EDTA. In indicated experiments, cells were stained with flow cytometry antibodies and analyzed using a Guava easyCyte 6HT/2L flow cytometer (Millipore Corporation, Billerica, Mass.) and FlowJo software (Tree Star Inc., Ashland, Oreg.). Antibody labeling was carried out for 10 min on ice followed by 3 washes with PBS buffer. Antibody information is detailed in Table 8.
TABLE-US-00012 TABLE 8 List of antibodies used in the study Antibody Vendor Cat.No. Clone Dilution R-PE anti-CD31 Ancell 180-050 158-2B3 1:100 (FC) APC anti-CD31 Biolegend 303116 WM-59 1:100 (FC) APC anti-human CD309 Biolegend 359916 7D4-6 1:100 (FC) (VEGFR2) PE anti-human CD309 Biolegend 359903 7D4-6 1:100 (FC) (VEGFR2) PE anti-CD144(VE-CAD) ThermoFisher 12-1449-80 16B1 1:100 (FC) PE anti-TRA-1-81 ThermoFisher 12-8883-80 1:100 (FC) PE anti-human CD62E (E- ThermoFisher 12-0627-41 P2H3 1:100 (FC) Selectin) PE anti-CD54 (ICAM-1) ThermoFisher 12-0549-41 HA58 1:100 (FC) PE anti-CD106 (VCAM-1) Biolegend 305805 1:100 (FC) Rabbit anti-smooth muscle Abcam Ab133567 EPR5336(B) 1:200 (IF) myosin heavy chain 11 Rabbit anti-alpha smooth Abcam Ab5694 1:300(IHC-P) muscle actin Mouse anti-alpha smooth Sigma A2547 1A4 1:300(IHC-P) muscle actin Rabbit anti-SM22-alpha Abcam Ab14106 1:200(IF) Mouse anti-VE-cadherin Santa Cruz Sc-9989 F-8 1:200(IF) Rabbit anti-human Von DAKO A0082 1:200(IF) Willebrand Factor Mouse anti-human CD31 Agilent M082329-2 JC70A 1:50(IHC-P) (human specific) 1:200(IF) Mouse anti-human CD31 Abcam Ab9498 JC70A 1:200(IHC-P) (human specific) Rabbit anti-human CD31 Abcam Ab76533 EPR3094 1:200(IHC-P) (human specific) Rhodamine labeled Ulex Vector RL-1062 (Human specific) 1:100(IHC-P) Europaeus Agglutinin I 1:200(IF) (UEA I) Mouse anti-human Abcam Ab8069 V9 1:300 (IHC-P) vimentin (human specific) Rabbit anti-GFP Abcam Ab183734 EPR14104 1:200 (IHC-P) Rabbit anti-ETV2 Abcam Ab181847 EPR5229(3) 1:300(IF) Rabbit anti-Oct4 Stemgent 09-0023 1:300(IF) Rabbit anti-Sox2 Stemgent 09-0024 1:300(IF) Mouse anti-Klf4 Stemgent 09-0021 1:300(IF) Rabbit anti-Nanog Stemgent 09-0020 1:300(IF) Goat anti-Brachyury (T) R&D AF2085 5 g/mL (IF) Donkey anti-mouse IgG, ThermoFisher A-21202 1:500 (IF, IHC- AlexaFluor 488 P) Donkey anti-goat IgG, ThermoFisher A-11058 1:500 (IF, IHC- AlexaFluor 594 P) Donkey anti-rabbit IgG, ThermoFisher A-21206 1:500 (IF, IHC- AlexaFluor 488 P) Horse anti-mouse IgG Vector TI-2000 1:400 (IF, IHC- Texas Red P) Horse anti-rabbit IgG Vector DI-1094 1:400 (IF, IHC- DyLight 594 P)
[0139] Microscopy
[0140] Images were taken using an Axio Observer Z 1 inverted microscope (Carl Zeiss) and AxioVision Rel. 4.8 software. Fluorescent images were taken with an ApoTome.2 Optical sectioning system (Carl Zeiss) and 20 objective lens. Non-fluorescent images were taken with an AxioCam MRc5 camera using a 5 or 10 objective lens.
[0141] Immunofluorescence Staining
[0142] Cells were seeded in 8-well LAB-TEK chamber slides at a density of 60,000 cell s/cm.sup.2. After confluency, cells were fixed in 4% paraformaldehyde (PFA), permeabilized with 0.1% Triton X-100 in PBS, and then blocked for 30 min in 5% horse serum (Vector, Cat No. 5-2000). Subsequently, cells were incubated with primary antibodies for 30 min at room temperature (RT). Cells were washed 3 times with PBS and then incubated with secondary antibodies for 30 min at RT. Cells were washed 3 times with PBS and stained with 0.5 g/mL DAPI for 5 min. Slides were mounted with DAKO fluorescence mounting medium (Agilent, Cat No. 5302380-2). Antibody information is detailed in Table 8, above.
[0143] Spheroid Sprouting Assay
[0144] EC spheroids were generated by carefully depositing 500 h-MSCs and 500 h-iECs-GFP in 20 L spheroid-forming medium on the inner side of a 10-cm dish lid. The spheroid-forming medium contained 0.24% (w/v) methyl cellulose (Sigma, Cat No. M0512). The lid was then turned upside down and placed on top of the plate filled with 10 mL sterile water. EC spheroids were collected after 2 days in culture and embedded in fibrin gel prepared with 5 mg/mL fibrinogen (Sigma, Cat No. F8630) and 0.5 U/mL thrombin (Sigma, Cat No. T-9549). A 100 L-fibrin gel/spheroid solution was spotted into the center of a 35-mm glass bottom dish (MatTek, Cat No. P35G-1.5-10-C) and incubated for 10 mins at 37 C. for solidification. Gel/spheroid constructs were kept in culture for 3 days. GFP+ sprouts were imaged using an inverted fluorescence microscope and sprout lengths were measured by ImageJ.
[0145] Shear Stress Response Assay
[0146] Confluent monolayers of h-iECs in a 100-mm culture dish were subjected to orbital shear stress for 24 h at a rotating frequency of 150 rpm using an orbital shaker (VWR, Model 1000) positioned inside a cell culture incubator. After 24 h, cells were fixed in 4% PFA and stained using an anti-human VE-Cadherin antibody. Alignment of ECs was visualized using an inverted fluorescence microscope under a 10 objective. Only the cells in the periphery of the culture dish were imaged. Cell orientation angles were measured by ImageJ.
[0147] Nitric Oxide (NO) Production Assay
[0148] Cells were cultured on gelatin-coated 12-well plates (210.sup.5 cells per well) in h-iECs media. To measure nitric oxide (NO), media were changed to fresh media containing 1 M DAF-FM (Cayman, Cat No. 18767). Cells were cultured for 30 min and then harvested for flow cytometric analysis and fluorescent imaging. In order to suppress NO production, h-iECs were cultured in the presence of 5 mM L-NAME (Cayman, Cat No. 80210) for 24 h. DAF-FM is nonfluorescent until it reacts with NO to form a fluorescent benzotriazole (FITC channel). The mean fluorescence intensities (MFIs) were measured by calculating the geometric mean in FlowJo.
[0149] Leukocyte Adhesion Molecules and Leukocyte Adhesion Assays
[0150] Cells were cultured on a gelatin-coated 48-well plate (10.sup.5 cells per well) in h-iEC medium. At confluency, cells were treated with or without 10 ng/mL TNF- (Peprotech, Cat No. 300-01A) for 5 h. Cells were then lifted and treated with anti-ICAM1, anti-E-selectin or anti-VCAM1 antibodies for flow cytometry. For leukocyte adhesion assay, human HL-60 leukocytes were used. HL-60 cells were culture in leukocyte medium consisting of RPMI-1640 (ThermoFisher, Cat No. 11875093) supplemented with 20% FBS. 210.sup.5 HL-60 cells were suspended in 0.2 mL fresh leukocyte medium and added to each well. After gentle shaking for 45 min in cold room, plates were gently washed twice with cold leukocyte media. Cells were fixed in 2.5% (v/v) glutaraldehyde at RT for 30 min and then imaged. Bound leukocytes were quantified by ImageJ analysis software.
[0151] Smooth Muscle Cell Differentiation Assay
[0152] 210.sup.4 h-MSCs and 510.sup.4 h-iECs were plated in one well of 8-well LAB-TEK chamber slide coated by 1% gelatin and cultured in h-iECs medium without SB431542 for 7 days. Smooth muscle cell positive cells were stained with an anti-smooth muscle myosin heavy chain 11 antibody and ECs and nucleus were stained by anti-VECAD antibody and DAPI, respectively. h-MSCs that were transduced with lentivirus to express GFP (h-MSCs-GFP) were used in indicated experiments. Antibody information is detailed in Table 8, above.
[0153] Tube Formation Assay
[0154] 810.sup.3 h-iECs were plated in one well of 96-well plate on top of solidified Matrigel (50 L) with h-iECs media. After 6 h, cells were incubated with 1 M Calcein-AM (Biolegend, Cat No. 425201) for 10 min and then imaged using a fluorescence microscope. Numbers of branches were counted by ImageJ.
[0155] In Vivo Vascular Network-Forming Assay
[0156] Six-week-old NOD/SCID mice were purchased from Jackson Lab (Boston, Mass.). Mice were housed in compliance with Boston Children's Hospital guidelines, and all animal-related protocols were approved by the Institutional Animal Care and Use Committee. H-iECs were pretreated with 20 M caspase inhibitor/Z-VAD-FMK (APExBio, Cat No. A1902) and 0.5 M BCL-XL-BH4 (Millipore, Cat No. 197217) in h-iECs medium overnight before implantation. Briefly, h-iECs and h-MSCs (210.sup.6 total per mice, 1:1 ratio) or h-iECs alone (110.sup.6 cells per mice) were resuspended in 200 L of pH neutral pre-gel solution containing 3 mg/mL of bovine collagen I (Trevigen, Cat No. 3442-050-01), 3 mg/mL of fibrinogen, 50 L Matrigel (Corning, Cat No. 354234), 1 g/mL of FGF2 (Peprotech, Cat No. 100-18B) and 1 g/mL EPO (ProSpec, Cat No. CYT-201). During anesthesia, mice were firstly injected with 50 L of 10 U/mL thrombin (Sigma, Cat No. T4648) subcutaneously and then injected with 200 L cell-laden pre-gel solution into the same site. All experiments were carried out in 5 mice and explants were harvested after 1 week and 1 month.
[0157] Histology and Immunofluorescence Staining
[0158] Explanted grafts were fixed overnight in 10% buffered formalin, embedded in paraffin and sectioned (7-m-thick). Microvessel density was reported as the average number of erythrocyte-filled vessels (vessels/mm.sup.2) in H&E-stained sections from the middle of the implants as previously described. For immunostaining, sections were deparaffinized and antigen retrieval was carried out with citric buffer (10 mM sodium citrate, 0.05% Tween 20, pH 6.0). Sections were then blocked for 30 min in 5% horse serum and incubated with primary and secondary antibodies for 30 min at RT. Fluorescent staining was performed using fluorescently-conjugated secondary antibodies followed by DAPI counterstaining. Human-specific anti-CD31 antibody and UEA-1 lectin were used to stain human blood vessels. Perivascular cells were stained by anti-alpha smooth muscle actin antibody. Primary and secondary antibodies are detailed in Table 8, above. The Click-It Plus TUNEL assay (ThermoFisher, Cat No. C10617) was used to detect apoptotic cells in tissue.
[0159] Quantitative RT-PCR
[0160] Quantitative RT-PCR (qRT-PCR) was carried out in RNA lysates prepared from cells in culture. Total RNA was isolated with a RNeasy kit (Qiagen, Cat No. 74106) and cDNA was prepared using reverse transcriptase III (ThermoFisher, Cat No. 4368814), according to the manufacturer's instructions. Quantitative PCR was performed using SRBR Green Master Mix (ThermoFisher, Cat No. A25776), and detection was achieved using the StepOnePlus Real-time PCR system thermocycler (Applied Biosystems). Expression of target genes was normalized to GAPDH. Real-time PCR primer sequences are listed in Table 9.
TABLE-US-00013 TABLE9 SequencesofprimersusedforqRT-PCR Gene Forward(5.fwdarw.3) # Reverse(5.fwdarw.3) # POU5F1 GGGCTCTCCCATGCATTCAAAC 18 CACCTTCCCTCCAACCAGTTGC 19 MIXL1 ACGTCTTTCAGCGCCGAACAG 20 TTGGTTCGGGCAGGCAGTTCA 21 TBXT GTGCTGTCCCAGGTGGCTTACAGATG 22 CCTTAACAGCTCAACTCTAACTACTTG 23 ACTA2 TGACAATGGCTCTGGGCTCTGTAA 24 TTCGTCACCCACGTAGCTGTCTTT 25 GAPDH CATGTTCGTCATGGGTGTGAACCA 26 ATGGCATGGACTGTGGTCATGAGT 27 ERG AACCATCTCCTTCCACAGTGCCCAAA 28 TTTGCAAGGCGGCTACTTGTTGGT 29 ETV2 CCGACGGCGATACCTACTG 30 CGGTGGTTAGTTTTGGGGCAT 31 NOS3 TGACCCTCACCGCTACAACATCCT 32 CGTTGATTTCCACTGCTGCCTTGTCT 33 CLDN5 CTCTGCTGGTTCGCCAACAT 34 CAGCTCGTACTTCTGCGACA 35 ENG CGGTGGTCAATATCCTGTCGAG 36 AGGAAGTGTGGGCTGAGGTAGA 37 TEK GCTTGCTCCTTTCTGGAACTGT 38 CGCCACCCAGAGGCAAT 39 PECAM1 CACCTGGCCCAGGAGTTTC 40 AGTACACAGCCTTGTTGCCATGT 41 CDH5 GAACCCAAGATGTGGCCTTTAG 42 GATGTGACAACAGCGAGGTGTAA 43 VWF GTCGAGCTGCACAGTGACATG 44 GCACCATAAACGTTGACTTCCA 45 KDR ATCCAGTGGGCTGATGACCAAGAA 46 ACCAGAGATTCCATGCCACTTCCA 47 #, SEQ ID NO:
[0161] Statistical Analyses
[0162] Unless otherwise stated, data were expressed as meanstandard deviation of the mean (s.d.). For comparisons between two groups, means were compared using unpaired two-tailed Student's t-tests. Comparisons between multiple groups were performed by ANOVA followed by Bonferroni's post-test analysis. Samples size, including number of mice per group, was chosen to ensure adequate power and were based on historical data. No exclusion criteria were applied for all analyses. No specific methods of randomization were applied to group/animal allocation. Investigators were not blinded to group allocation. All statistical analyses were performed using GraphPad Prism v.5 software (GraphPad Software Inc.). P<0.05 was considered statistically significant.
Example 1. Rapid and Highly Efficient Differentiation of Human h-iPSCs into h-iECs
[0163] We developed an exemplary two-dimensional, feeder-free, and chemically defined protocol that relied on a timely transition of h-iPSCs through two distinct stages, each lasting about 48 h. First is the conversion of h-iPSCs into h-MPCs. This step is similar to that in the standard S1-52 differentiation protocol and thus is mediated by the activation of Wnt and Nodal signaling pathways using the glycogen synthase kinase 3 (GSK-3) inhibitor CHIR99021 (
[0164] This customized two-step protocol (herein referred to as S1-modETV2) rapidly and uniformly converted human h-MPCs into h-iECs. Indeed, 48 h after transfection of h-MPCs with modRNA(ETV2), 95% of the cells were endothelial (VE-Cadherin+/CD31+ cells;
[0165] Transfection with modRNA(ETV2) enabled rapid, transient, and uniform expression of ETV2, in contrast to delayed and sparse expression with the S1-52 method (
Example 2. Differentiation Reproducibility with Clonal h-iPSC Lines from Various Cellular Origins
[0166] Current S1-S2 differentiation protocols lack consistency between different h-iPSC lines. To address this limitation, we generated multiple human clonal h-iPSC lines from three distinct cellular origins corresponding to subcutaneous dermal fibroblasts (FB), umbilical cord blood-derived endothelial colony-forming cells (cbECFC), and urine-derived epithelial cells (uEP) (
[0167] We generated 13 clones (referred to as C1-C13) to collectively represent variations due to different individual donors, cellular origins, and clone selection (
[0168] To further corroborate these findings, we examined three additional S1-S2 methodologies corresponding to protocols described by Harding et al. 2017.sup.7 (Method #2), Sahara et al. 2014 s (Method #3), and Patsch et al. 2015.sup.4 (Method #4). These methods were compared to our S1-S2 method (referred to as Method #1 in
Example 3. Inefficient Activation of Endogenous ETV2 in Intermediate h-MPCs
[0169] To further evaluate the issue of inefficiency, we carried out a transcriptional examination of the standard S1-52 differentiation protocol. As expected, conversion of h-iPSCs into h-MPCs coincided with transient activation of mesodermal transcription factors MIXL1 and TBXT (
[0170] Collectively, we found that while conversion of h-iPSCs into TBXT+ h-MPCs occurs very efficiently (>95%), activation of endogenous ETV2 in h-MPCs is clearly limited (30%) during the S1-S2 protocol and did not improve by simply increasing VEGF concentration. Thus, we concluded that in order to improve the conversion of h-iPSCs into h-iECs, emphasis should be put on finding new means to effectively activate ETV2 in the intermediate h-MPCs.
Example 4. Transient Expression of Exogenous ETV2 Uniformly Convert h-MPCs into h-iECs
[0171] Our approach to more uniformly activate ETV2 in h-MPCs is to use modRNA. Indeed, 6 h after transfection of h-MPCs with modRNA(ETV2), >85% of the cells expressed ETV2 (
[0172] Taken together, we showed that delivery of modRNA(ETV2) is an effective means to robustly and transiently express ETV2 in intermediate h-MPCs, which in turn initiates widespread conversion into h-iECs. Our S1-modETV2 protocol renders the differentiation process independent of VEGF signaling and of endogenous ETV2, thus overcoming one of the main limitations in current protocols.
Example 5. Time of ETV2 Activation Affects the Transcriptional Profile of h-iECs
[0173] Previous studies have suggested that inducing ETV2 expression directly on h-iPSCs could generate h-iECs without transition through an intermediate mesodermal stage. However, it remains unclear whether this strategy produces functionally competent h-iECs. To address this question, we generated putative h-iECs by transfecting h-iPSCs with modRNA(ETV2) (protocol herein referred to as early modETV2) (
[0174] To further elucidate potential differences between h-iECs generated from our S1-modETV2, the S1-S2, and the early modETV2 protocols, we performed RNAseq analysis across multiple h-iECs samples generated from three independent h-iPSC lines using all three differentiation protocols. Human ECFCs and the parental undifferentiated h-iPSCs served as positive and negative controls, respectively. Globally, there were thousands of differentially expressed genes across all the h-iEC groups (
[0175] To gain more insight into the transcriptional differences, we carried out gene ontology (GO) enrichment analysis between h-iECs generated with our S1-modETV2 and the early modETV2 differentiation protocols. Of note, analysis of all differentially expressed genes revealed that h-iECs generated with our S1-modETV2 displayed significant enrichment in genes associated with positive regulation of cell migration (
Example 6. Early Activation of ETV2 Renders Putative h-iECs with Impaired Functionality
[0176] Next, we examined whether the transcriptional differences observed between h-iECs generated from different protocols affected their capacity to function as proper ECs. Specifically, we compared h-iECs that were generated with the standard S1-52, our S1-modETV2, and the early modETV2 protocols. Of note, ETV2 expression is transient in both differentiation protocols, and thus at the time of h-iEC characterization, ETV2 expression was completely absent (
[0177] We then evaluated the performance of h-iECs using an array of standard endothelial functional assays, including ability to: (i) assemble into capillary-like structures (
Example 7. Timely Activation of ETV2 is Critical for Proper Vascular Network-Forming Ability
[0178] Lastly, we examined the capacity of the different h-iECs to assemble into functional blood vessels in vivo (
[0179] It is important to note that although co-transplantation with MSCs facilitates engraftment, h-iECs derived from the S1-modETV2 protocol were also able to engraft and form perfused vessels when implanted alone, without MSCs (
[0180] We also examined the presence of mural cell investment around the newly-formed human vessels, a hallmark of proper vessel maturation and stabilization.sup.16. There was a striking difference between h-iECs generated with the S1-modETV2 protocol and those generated with the early modETV2 with regard to perivascular investment (
[0181] Taken all together, we demonstrated that during the differentiation of h-iPSCs into h-iECs, the ETV2 activation stage is critical. With our optimized S1-modETV2 protocol, activation of ETV2 occurred at the intermediate mesodermal stage, which produced h-iECs that were phenotypically and functionally competent. In contrast, bypassing transition through the mesodermal stage by early activation of ETV2 produced putative h-iECs with a transcriptional profile further away from that of bona fide ECs, and, more importantly, with impaired functionality.
Example 8. Bioengineering Hemophilia a Patient-Specific Vascular Networks that Express High Levels of Full-Length Coagulation Factor VIII
[0182] Over the last few decades, Hemophilia A has been a particularly appealing target for gene therapy and a plethora of approaches have been proposed with various degrees of pre-clinical and clinical success.sup.25. Most efforts have focused on direct in vivo gene therapy with the use of viral vectors, including AAV vectors. However, notwithstanding the remarkable progress achieved in this field thus far, most in vivo gene therapy approaches for hemophilia A remain limited by a number of challenges that hamper their clinical translation.
[0183] Described herein is an alternative to current hemophilia A treatments that is non-viral, scalable, autologous, and reversible. Although Hemophilia A is a primary disease focus, the massive insertion capacity of the piggyBac gene engineering platform described herein allows more flexibility when coupled with bioengineered vascular implants. The differentiation of HA-iPSCs into HA-iECs was carried out with high efficiency across all patients and independently of the HA-iPSC clones selected. Importantly, the HA-iECs could be expanded in culture with ease to generate the necessary cells for our grafts. As mentioned earlier, the usage of HA-iECs was deliberate and the reasons twofold: 1) ECs are the natural producers of FVIII in the body. Thus, ECs contain the appropriate cellular machinery to package FVIII with von Willebrand factor (vWF) into Weibel-Palade bodies and to carry out an effective secretion, activation, and protection of FVIII once in the blood plasma.sup.21. Indeed, we showed that upon transduction, overexpressed FVIII partially co-localized with vWF in the modified HA-FLF8-iECs (
[0184] A second important focus of our study was avoiding the use of viral vectors. Once more, the reasons were twofold: 1) to eliminate adverse immunological reactions; and 2) to circumvent the limitation imposed by a restricted viral cargo size; avoiding size restriction would, in turn, open up the possibility of transducing cells with the full-length version of the F8 gene. With this in mind, we implemented a non-viral piggyBac DNA transposon strategy to genetically engineer patients' HA-iPSCs for FVIII overexpression. Unlike most viral vectors, piggyBac vectors can insert large genetic cargos, reportedly up to 100 kb (9.1 kb without a loss of efficiency) 20, and thus we were not limited by cargo size. Indeed, by using the piggyBac transposon system, not only we were able to encode for the full-length version of the human F8 gene, but also, we were able to insert multiple copies (ranging from 8-160), which highlights one of the most notable advantages of the piggyBac system (
[0185] A third focus of our study was related to the engraftment of genetically-engineered HA-FLF8-iECs, with special considerations to accessibility and the overall reversibility potential of the treatment. For years, our group has worked intensively on the question of engraftment, and our solution entails combining ECs with supporting stromal cells (i.e., MSCs) into a suitable collagen-based hydrogel.sup.30-32 In this configuration, upon subcutaneous transplantation of the grafts, HA-FLF8-iECs are able to self-assemble into a vascular network that forms anastomoses and connects with the host circulatory system. This mode of engraftment, in turn, allows the implanted ECs to rapidly adopt a proper physiological role, lining the lumen of perfused vessels, which facilitates integration with the host. Moreover, we previously demonstrated that this mode of engraftment results in tight cellular confinement, which reduces potential safety concerns and allows effective monitoring and reversibility by a simple implant excision.sup.33. Alternative modes of EC engraftment have been proposed. For example, Xu et al., (2009) injected normal (non-hemophilic) murine iPSC-derived ECs into the liver of hemophilic mice, correcting their bleeding deficiency.sup.34. However, although the cells were injected into the liver, higher levels of FVIII mRNA were detected in spleen, heart, and kidney tissues of injected animals, suggesting widespread dissemination and thus complicating accessibility and reversibility.
[0186] There are other ex vivo gene therapy studies that use ECs and that are of significant importance in the field. However, the majority of these studies used viral vectors, and none produced full-length FVIII, which are two distinctive features of our approach. For example, a recent study by Olgasi et al., (2018) used a lentiviral vector to genetically modified patients' HA-iPSC-derived ECs to express BDD-FVIII.sup.35. The modified cells were then transplanted either via portal vein or intraperitoneally, where they engrafted and in turn were able to correct the coagulation deficiency in the recipient animals. Engrafting cells in the liver, however, compromises confinement and the possibility of graft retrieval. In another study, Ozelo et al., (2014) isolated blood outgrowth ECs (BOECs) from hemophilic dogs and genetically modified them to express BDD-FVIII via lentiviral vectors.sup.36. In this case, the modified BOECs were embedded into fibrin gels, which facilitated confinement. This study showed exceptional potential upon surgical implantation of the grafts into the omentum of the dogs; nevertheless, concerns around the use of viral vectors and a truncated version of FVIII remains. A study by Park et al. (2015) utilized CRISPR technology to correct the FVIII inversion in patient iPSCs followed by endothelial differentiation and subsequent injection for correction of the disease phenotype.sup.37. Although, these cells were injected into the hindlimb without confinement, where engraftment of endothelial cells and the connection to the host bloodstream are unclear.
[0187] Previous ex vivo gene therapy studies have also included the use of alternative non-endothelial cells as gene delivery vehicles, including hemopoietic stem cells (HSCs).sup.38-40. For example, Shi et al., (2014) transduced human cord blood-derived CD34+ HSCs with a lentiviral construct in which the human platelet glycoprotein IIb gene promoter (IIb.sup.pr) was used to direct megakaryocyte-specific synthesis of human BDD-F8.sup.40. Upon transplantation into irradiated recipients, the modified HSCs engrafted and created blood cell chimerism, including human megakaryocytes that produced BDD-FVIII-containing platelets. This platelet gene therapy was shown to correct bleeding deficiency in immunocompromised hemophilia A mice. The use of HSCs is particularly appealing in several respects. First, long-term engraftment of HSCs is feasible, and the process is reasonably well understood; and second, once HSCs engraft, in principle they can permanently replenish the cells producing the FVIII-containing platelets. Additionally, our piggyBac transposon approach to inserting full-length F8 offers advantages in scalability. Other EC ex-vivo approaches, due to a singular gene correction 37 or low lentiviral insertion number of BDD-F8, report restoring mice to a non-severe hemophilia pathology at 6-30% healthy levels of FVIII in mouse models (EC sources above). Instead, our platform can insert up to 160 copies of full-length F8 cDNA, allowing us to raise circulating protein levels up to 1,300% of the phenotypic level of a healthy mouse.
[0188] Materials and Methods for Example 8
[0189] The following materials and methods were used for Example 8.
[0190] Isolation and Culture of Human Urine-Derived Epithelial Cells
[0191] De-identified urine samples were obtained from patients with severe hemophilia A and from healthy individuals in accordance with Institutional Review Board-approved protocols at Boston Children's Hospital. Informed consent was obtained from all donors. The list of hemophilic patients with their corresponding mutant genotype is in
[0192] Isolation and Culture of Human MSCs and ECs
[0193] Human MSCs (h-MSCs) were isolated from white adipose tissue as previously described.sup.1. h-MSCs were cultured on uncoated plates using MSC-medium: MSCGM (Lonza, Cat No. PT-3001) supplemented with 10% GenClone FBS (Genesee, Cat No. 25-514), and 1 penicillin-streptomycin-glutamine (PSG, ThermoFisher, Cat No. 10378106). All experiments were carried out with h-MSCs between passages 6-10. Control ECs were isolated from cord blood as previously described.sup.1 and grown in EGM-2 on 1% gelatin-coated plates.
[0194] Generation and Culture of Human HA-iPSCs
[0195] Human urine-derived epithelial cells from patient #1 (genotype F8 c.6429+1G>A; Table A), #5, and #6 (both with intron 22 inversion, type 1) were used to generate Human hemophilia A patient induced pluripotent stem cells (HA-iPSCs) via non-integrating episomal expression of selected reprogramming factors 2. Briefly, four plasmids encoding hOCT4, hSOX2, hKLF4, hL-MYC, hLIN-28, and EBNA-1 (Addgene plasmids #27077, #27078, #27080, and #37624 deposited by Shinya Yamanaka) were introduced via electroporation into HA-UECs. Transfected cells were then cultured with TeSR-E7 medium (STEMCELL, Cat No. 05910). HA-iPSC colonies spontaneously emerged between days 15-25. Colonies were then transferred to a Matrigel-coated (Corning, Cat No. 354277), feeder-free culture plate for expansion and were routinely checked for absence of mycoplasma using a PCR Mycoplasma Detection Kit (abm, Cat No. G238). HA-iPSCs were cultured in mTeSR1 medium (STEMCELL, Cat No. 85850) on 6-well plates coated with Matrigel. At 80% confluency, h-iPSCs were detached using ReLeSR reagent (STEMCELL, Cat No. 05872), split at 1:6 ratio, and plated in media supplemented with 10 M Y27632 (Selleckchem, Cat No. S1049).Culture medium was changed daily. The iPSC phenotype was validated by expression of pluripotent transcription factors OCT4, NANOG, and SOX2; and by the ability to form teratomas. A teratoma formation assay was performed by injecting million h-iPSCs mixed in 100 L Matrigel into the dorsal flank of nude mice Four weeks after the injection, tumors were surgically dissected from the mice, weighed, fixed in formalin, and embedded in paraffin for histology. Sections were stained with hematoxylin and eosin (H&E). Antibody information is detailed in Table 12.
TABLE-US-00014 TABLE 12 List of Antibodies used in the study Antibody Vendor Cat.No. Clone Dilution R-PE anti-CD31 Ancell 180-050 158-2B3 1:100 (FC) APC anti-CD31 Biolegend 303116 WM-59 1:100 (FC) PE anti-CD144(VE-CAD) ThermoFisher 12-1449- 16B1 1:100 (FC) 80 PE anti-TRA-1-81 ThermoFisher 12-8883- 1:100 (FC) 80 PE anti-human SSEA-4 Antibody Biologend 330405 MC- 1:100 (FC) 813-70 Rabbit anti-alpha smooth muscle actin Abcam Ab5694 1:200(IF) Mouse anti-alpha smooth muscle Sigma A2547 1A4 1:200(IF) actin Mouse anti-VE-cadherin Santa Cruz Sc-9989 F-8 1:200(IF) Rabbit anti-human Von Willebrand DAKO A0082 1:200(IF) Factor Mouse anti-human CD31 Agilent M082329- JC70A 1:50(IHC-P) 2 1:200(IF) Rhodamine labeled Ulex Europaeus Vector RL-1062 (Human 1:100(IHC- Agglutinin I (UEA I) specific) P) 1:200(IF) Mouse anti-human vimentin Abcam Ab8069 V9 1:300 (IHC-P) (human specific) Rabbit anti-Oct4 Stemgent 09-0023 1:300(IF) Rabbit anti-Sox2 Stemgent 09-0024 1:300(IF) Rabbit anti-Nanog Stemgent 09-0020 1:300(IF) 1:200 (IF) Mouse anti-human Factor VIII Green Mountain GMA- 1:200 Antibodies 8006 (WB) Donkey anti-mouse IgG, AlexaFluor ThermoFisher A-21202 1:500 (IF, 488 IHC-P) Donkey anti-goat IgG, AlexaFluor ThermoFisher A-11058 1500 (IF, 594 IHC-P) Donkey anti-rabbit IgG, AlexaFluor ThermoFisher A-21206 1500 (IF, 488 IHC-P) Horse anti-mouse IgG Vector TI-2000 1:400 (IF, IHC-P) Texas Red Horse anti-rabbit IgG Vector DI-1094 1:400 (IF, IHC-P) DyLight 594
[0196] Differentiation of h-iPSCs into h-iECs
[0197] Basal medium for differentiation of HA-iPSCs into HA-iECs was prepared by adding 1 GlutaMax supplement (ThermoFisher, Cat No. 35050061) and 60 g/mL L-Ascorbic acid (Sigma, Cat No. A8960) into Advanced DMEM/F12 (ThermoFisher, Cat No. 12634010). Culture medium for HA-iECs was prepared by mixing EGM-2 with 1 GutaMax supplement and 10 M SB431542 (Selleckchem, Cat No. S1067).
[0198] For the differentiation, HA-iPSCs were dissociated with ReLeSR reagent (STEMCELL, Cat No. 05872) and plated on Matrigel at a density of 40,000 cells/cm.sup.2 in mTeSR1 medium with 10 M Y27632. After 24 h of allowing the cells to plate, the medium was changed to S1 medium consisting of basal medium supplemented with 6 M CHR99021 (Sigma, Cat No. SML1046). After 48 h of culture in S1 media changed daily, h-MPCs were dissociated into single cells and then transfected with modRNA(ETV2) by electroporation. For electroporation, 2 million cells were resuspended in 100 L buffer mixed with 0.8 g modETV2. Electroporated cells were then seeded on a100-mm Matrigel-coated dish in S2 medium consisting of basal medium supplemented with 50 ng/mL VEGF-A (Peprotech, Cat No. 100-20), 50 ng/mL FGF-2, 10 ng/mL EGF and 10 M SB431542. [Ref.: our ETV2 paper]
[0199] Genotyping of F8 c.6429+1G>A Mutation in the iPSCs-Derived from Patient #1
[0200] Genomic DNA (gDNA) was isolated from HA-iPSCs derived from patient #1 and control iPSCs. The junction region of Exon22 and Intron22 was amplified by PCR using primers listed in Table 11 (Exon 22 FWD1 and Intron 22 REV). The purified PCR product was then sequenced by Sanger method using Exon 22 FWD1 primer. In the control iPSCs, the first base of Intron22 (F8 c.6429+1) is G. In HA-iPSCs derived from patient #1, a point G>A mutation should be detected at this position.
[0201] Genotyping of Type 1 Intron 22 Inversion Mutation in the iPSCs-Derived from Patients #5 and #6
[0202] mRNA was isolated and converted to cDNA from HA-iPSCs derived from patients #5,6 and control iPSCs. If the specimen carries Type 1 Intron 22 inversion mutation, the junction of Exon22 and Intron 22 will be amplified by PCR using primersExon 19 FWD1 and Intron 22 REV (PCR product size 378 bp; Table 12). The same primer set cannot amplify any fragment from cDNA of control iPSCs. On the other hand, primers Exon 22 FWD1 and Exon 23 REV can amplify a 225-bp PCR product of Exon22-Exon23 junction from control iPSCs. However, the Exon22-Exon23 junction doesn't exist in iPSCs of Type 1 Intron 22 inversion mutation.
[0203] Modified mRNA Synthesis and Formulation
[0204] Chemically modified mRNA encoding ETV2 (modRNA(ETV2)) was generated by TriLink BioTechnologies, LLC. In brief, modRNA(ETV2) was synthesized in vitro by T7 RNA polymerase-mediated transcription from a linearized DNA template, which incorporates the 5 and 3 UTRs and a poly-A tail. Specifically, ETV2(NM_014209.3;
TABLE-US-00015 (SEQIDNO:1) ORF:ATGGACCTGTGGAACTGGGATGAGGCATCCCCACAGGAAGTGCCTC CAGGGAACAAGCTGGCAGGGCTTGAAGGAGCCAAATTAGGCTTCTGTTTC CCTGATCTGGCACTCCAAGGGGACACGCCGACAGCGACAGCAGAGACATG CTGGAAAGGTACAAGCTCATCCCTGGCAAGCTTCCCACAGCTGGACTGGG GCTCCGCGTTACTGCACCCAGAAGTTCCATGGGGGGCGGAGCCCGACTCT CAGGCTCTTCCGTGGTCCGGGGACTGGACAGACATGGCGTGCACAGCCTG GGACTCTTGGAGCGGCGCCTCGCAGACCCTGGGCCCCGCCCCTCTCGGCC CGGGCCCCATCCCCGCCGCCGGCTCCGAAGGCGCCGCGGGCCAGAACTGC GTCCCCGTGGCGGGAGAGGCCACCTCGTGGTCGCGCGCCCAGGCCGCCGG GAGCAACACCAGCTGGGACTGTTCTGTGGGGCCCGACGGCGATACCTACT GGGGCAGTGGCCTGGGCGGGGAGCCGCGCACGGACTGTACCATTTCGTGG GGCGGGCCCGCGGGCCCGGACTGTACCACCTCCTGGAACCCGGGGCTGCA TGCGGGTGGCACCACCTCTTTGAAGCGGTACCAGAGCTCAGCTCTCACCG TTTGCTCCGAACCGAGCCCGCAGTCGGACCGTGCCAGTTTGGCTCGATGC CCCAAAACTAACCACCGAGGTCCCATTCAGCTGTGGCAGTTCCTCCTGGA GCTGCTCCACGACGGGGCGCGTAGCAGCTGCATCCGTTGGACTGGCAACA GCCGCGAGTTCCAGCTGTGCGACCCCAAAGAGGTGGCTCGGCTGTGGGGC GAGCGCAAGAGAAAGCCGGGCATGAATTACGAGAAGCTGAGCCGGGGCCT TCGCTACTACTATCGCCGCGACATCGTGCGCAAGAGCGGGGGGCGAAAGT ACACGTACCGCTTCGGGGGCCGCGTGCCCAGCCTAGCCTATCCGGACTGT GCGGGAGGCGGACGGGGAGCAGAGACACAATAA;1029bp)
[0205] was cloned into the mRNA expression vector pmRNA, which contains a T7 RNA polymerase promoter, an unstructured synthetic 5 UTR, a multiple cloning site, and a 3 UTR that was derived from the mouse -globin 3 gene. Co-transcriptional capping with CleanCap Cap1 AG trimer yields a naturally occurring Cap1 structure. 5-triphosphate were removed to reduce innate immune response. Modified mRNA was dissolved in RNase-free sodium citrate buffer (1 mM, pH 6.4).
[0206] Purification and Expansion of h-iECs
[0207] At 48 hours after ETV2 electroporation, HA-iECs were dissociated with ReLeSR reagent (STEMCELL, Cat No. 05872) into single cells and sorted into CD31+ and CD31 cells using magnetic beads coated with anti-human CD31 antibodies (DynaBead, ThermoFisher, Cat No. 11155D). The purified CD31+ HA-iECs were then expanded in culture on 10-cm dishes coated with 1% gelatin and maintained in HA-iEC culture medium.
[0208] Electroporation
[0209] Electroporation was routinely used to introduce plasmids, modified mRNA, and proteins into the cells as described for each experiment. Electroporation was carried out with a Neon electroporation system (ThermoFisher). Unless specified otherwise, electroporation parameters were set as 1150 v for pulse voltage, 30 ms for pulse width, 2 for pulse number, 3 mL of electrolytic buffer, and 100 L resuspension buffer R in 100 L reaction tips (ThermoFisher, Cat No. MPK10096).
[0210] Construction of Full Length F8-Expressing PiggyBac Vector
[0211] A full-length factor 8 gene fragment was isolated from pCDNA4/Full length FVIII (Addgene, Plasmid #41036) through PCR with attB-F8 primers (Table 11) and subsequent gel isolation.sup.4. This fragment was inserted into a pDONR 221 vector (ThermoFisher, Cat. No. 12536017) through BP cloning using BP Clonase II enzyme mix (ThermoFisher, Cat. No. 11789020), then inserted into the pPB-PGK-destination vector (Addgene, Plasmid #60436) through LR cloning using LR Clonase enzyme mix (ThermoFisher, Cat. No. 11791019).sup.5. The final construct PB-PGK-F8-Hyg contains a full-length F8 ORF driven by a CAG promoter and a hygromycin resistance gene driven by a PGK promoter, all flanked by 5 and 3 internal repeats (ITRs). A PiggyBac vector containing B domain-deleted FVIII (BDD-F8) was generated by the same method using pCDNA4/BDD-FVIII (Addgene, Plasmid #41035) as a PCR template.sup.4.
TABLE-US-00016 TABLE11 SequencesofPCRprimers Name/target Sequence(5.fwdarw.3) # F8attBForward GGGGACAAGTTTGTACAAAAAAGCA 48 GGCTTAATGCAAATAGAGCTCTCCA CCT F8attBReverse GGGGACCACTTTGTACAAGAAAGCT 49 GGGTTTCAGTAGAGGTCCTGTGCCT CG BDDvsFLgelP1 AGACTTTCGGAACAGAGGCA 50 BDDvsFLgelP2 TTCTGTGTGCAAACCAAGGG 51 BDDvsFLgelP3 GGCAAAGCAAGGTAGGACTG 52 BDDvsFLgelP4 GAGCCCTGTTTCTTAGAACATG 53 Exon22FWD1 GTGGATCTGTTGGCACCAATG 54 Exon24REV CTCCCTTGGAGGTGAAGTCG 55 Exon22FWD2 ACCAATGATTATTCACGGCATCAAGA 56 Exon23REV TGCAAACGGATGTATCGAGCAATAA 57 Exon19FWD1 TCCAAAGCTGGAATTTGGCG 58 Intron22REV ACACAGTCCTGAATCACATA 59 #, SEQ ID NO:
[0212] Establishment of HA-iPSC Line Expressing Full Length F8
[0213] HA-iPSCs (clones from patient #1 with genotype F8 c.6429+1G>A) were dissociated and filtered through 40 m cell strainer to obtain a single cell suspension. For electroporation, 1 million HA-iPSCs were resuspended in 100 L buffer mixed with 2.5 g PB-PGK-F8-Hyg PiggyBac transposon vector and 0.5 g super PiggyBac transposase expression vector (PB210PA-1, System Biosciences). The electroporated cells were then plated on a 35-mm Matrigel-coated dish in mTeSR1 medium with 10 M Y27632. The expression of SPT will mobilize the transposon part of PB-PGK-F8-Hyg vector and insert them into TTAA sites on genome. After 24 hours, the culture medium was changed to mTeSR1 medium supplemented with 200 ug/mL Hygromycin B (ThermoFisher, Cat No. 10687010) and changed daily for 2 to 4 days until nontransfected cells were killed. Hygromycin selection was performed twice during expansion until all cells without PiggyBac integration were killed. Several F8 expressing HA-iPSC clones were isolated and cultured separately for further characterization. Upon clonal expansion, gene-edited HA-F8FL-iPSCs and HA-F8FL-iECs were characterized similarly to unedited HA-iPSCs and HA-iECs (
[0214] Verification of F8 Expression in HA-FLF8-iECs
[0215] To verify that the insertion of F8 in HA-FLF8-iECs corresponded to expression of a full length version of the gene, mRNA was isolated and converted to cDNA from HA-FLF8-iECs. Combinations of primers that recognize the transition between the A2 and B domains (P1-P2 primers; Table 11), between the B and A3 domains (P3-P4) of the F8 gene (
[0216] Measurement of PiggyBac Integration Copy Number
[0217] To test the number of PiggyBac insertions, HA-FLF8-iPSC clonal cell pellets from culture were first lysed. With the lysate, a quantitative PCR based system was used to measure the transposon copy number relative to a genomic counting primer set. We used reagents and primers provided by the PiggyBac qPCR Copy Number Kit according to the manufacturer's instructions (SBI, Cat No. PBC100A-1).
[0218] Generation of Immunodeficient Hemophilia a Mouse Model for Human Cell Engraftment
[0219] B6; 129S-F8tm1Kaz/J (FVIIIKO) mice were purchased from The Jackson Laboratory.
[0220] These mice are homozygous for the targeted, X chromosome-linked F8 mutant allele and they are viable and fertile. Homozygous females and carrier males have less than 1% of normal factor VIII activity and exhibit prolonged clotting times.
[0221] Immunodeficient hemophilic (FVIIIKO-SCID) mice were developed by crossing FVIIIKO female mice with NOD.SCID male mice (NOD.CB17-Prkdcscid/J). The F1 mice then crossed with each other to generate F2 progenies. Within F2, homozygous females (Prkdc.sup.scid/scid F8.sup./) and carrier males (Prkdc.sup.scid/scid F8.sup./Y) were screened out by genotyping (performed by Transnetyx Inc) and crossed for 6 additional generations to obtain a stable line (
[0222] In Vivo Vasculogenic Assay
[0223] FVIIIKO-SCID mice (6 to 12 weeks) were housed in compliance with Boston Children's Hospital guidelines, and all animal-related protocols were approved by the Institutional Animal Care and Use Committee. Vasculogenesis was evaluated in vivo using our xenograft model as previously described [Ref R Z Lin, Methods 56 (2012) 440-451]. Briefly, h-iECs and MSCs (2M total; 2:3 ECFC/MSC ratio) were resuspended in 200 of collagen/fibrin/laminin-based solution (1.5 mg/mL of bovine collagen (Trevigen, Cat No. 3442-050-01), 2 mg/mL of laminin-1, 30 ug/mL of human fibronectin, 25 mM HEPES, 10% 10DMEM, 10% FBS, 5 g/mL of EPO (ProSpec, Cat No. CYT-201), 1 g/mL of FGF2 (Peprotech, Cat No. 100-18B), and 3 mg/mL of fibrinogen, pH neutral). Before cell injection, 50 uL of 10 U/mL thrombin was subcutaneously injected.
[0224] Histology and Immunofluorescence Staining
[0225] Explanted grafts were fixed overnight in 10% buffered formalin, embedded in paraffin, and sectioned (7-m-thick). Microvessel density was reported as the average number of erythrocyte-filled vessels (vessels/mm.sup.2) in H&E-stained sections from the middle of the implants as previously described.sup.9 (Ref. R Z Lin, Methods 56 (2012) 440-451). For immunostaining, sections were deparaffinized and antigen retrieval was carried out with citrate buffer (10 mM sodium citrate, 0.05% Tween 20, pH 6.0). Sections were then blocked for 30 min in 5% horse serum and incubated with primary antibodies overnight at 4 C. The sections were then incubated with fluorescently-conjugated secondary antibodies for 1 hour followed by DAPI counterstaining. Human-specific anti-CD31 antibody and UEA-1 lectin were used to stain human blood vessels. Perivascular cells were stained by anti-alpha smooth muscle actin antibody. Primary and secondary antibodies are detailed in Table 12.
[0226] Tail Clip Bleeding Assay and Blood Plasma Analysis
[0227] Mice were anesthetized with ketamine/xylazine at 100-120 mg/kg. When the animal was no longer moving involuntarily, it was weighed then placed on a paper towel in a prone position. A distal 10-mm segment of the tail was amputated with a scalpel. The tail was immediately immersed in a 50-mL Falcon tube containing isotonic saline pre-warmed in a water bath to 37 C. The position of the tail was vertical with the tip positioned about 2 cm below the body horizon. Each animal was monitored for 20 min even if bleeding ceased, in order to detect any re-bleeding. Bleeding time was determined using a stop clock. If bleeding on/off cycles occurred, the sum of bleeding times within the 20-min period was used. The assay terminated at the end of 20 min. Body weight, including the tail tip, was measured again, and the volume of blood loss during the experimental period was estimated from the reduction in body weight. At the end of experiment, animals were euthanized with CO2, and 0.5 mL of blood was collected from the heart to collect blood plasma supplemented with 10% sodium citrate to avoid clotting. This plasma was then analyzed for FVIII activity using the Chromogenix Coamatic Factor VIII assay (diapharma, Cat No. K822585) according to manufacturer's instructions with recombinant protein (Kogenate, Bayer) as a standard curve control.
[0228] Flow Cytometry
[0229] Cells were dissociated into single-cell suspensions using TrypLE and washed with PBS supplemented with 1% BSA and 0.2 mM EDTA. In indicated experiments, cells were stained with flow cytometry antibodies and analyzed using a Guava easyCyte 6HT/2L flow cytometer (Millipore Corporation, Billerica, Mass.) and FlowJo software (Tree Star Inc., Ashland, Oreg.). Antibody labeling was carried out for 10 min on ice followed by 3 washes with PBS buffer. Antibody information is detailed in Table 12.
[0230] Immunofluorescence Staining of Cells in Culture
[0231] Cells were seeded in LAB-TEK chamber slides. After confluency, cells were fixed in 4% paraformaldehyde (PFA), permeabilized with 0.1% Triton X-100 in PBS, and then blocked for 30 min in 5% horse serum (Vector, Cat No. S-2000). Subsequently, cells were incubated with primary antibodies for 1 hour at room temperature (RT). Cells were washed 3 times with PBS and then incubated with secondary antibodies for 1 hour at RT. Cells were washed 3 times with PBS and stained with 0.5 g/mL DAPI for 10 min. Slides were mounted with DAKO fluorescence mounting medium (Agilent, Cat No. S302380-2). Antibody information is detailed in Table 12.
[0232] Microscopy
[0233] Images were taken using an Axio Observer Z1 inverted microscope (Carl Zeiss) and AxioVision Rel. 4.8 software. Fluorescent images were taken with an ApoTome 2. Optical sectioning system (Carl Zeiss) and 20objective lens. Non-fluorescent images were taken with an AxioCam MRc5 camera using a 5 or 10 objective lens.
[0234] Quantitative RT-PCR
[0235] Quantitative RT-PCR (qRT-PCR) was carried out in RNA lysates prepared from cells in culture. Total RNA was isolated with a RNeasy kit (Qiagen, Cat No. 74106) and cDNA was prepared using reverse transcriptase III (ThermoFisher, Cat No. 4368814), according to the manufacturer's instructions. Quantitative PCR was performed using SRBR Green Master Mix (ThermoFisher, Cat No. A25776), and detection was achieved using the StepOnePlus Real-time PCR system thermocycler (Applied Biosystems). Expression of target genes was normalized to GAPDH. Real-time PCR primer sequences are listed in Table 10.
TABLE-US-00017 TABLE10 SequencesofqPCRprimers Gene Forward(5.fwdarw.3) # Reverse(5.fwdarw.3) # F8-P1 CCAGAATCAGCAAGGTGGAT 60 AGGTTTCTGCTGCTTGGAAA 61 F8-P2 CACTCTTCGCATGGAGTTGA 62 AGTCCACTTGCAGCCACTCT 63 SPT CAGAGAACCATCAGAGGCAAG 64 TCACCAGGATGCCGAAGAAG 65 GAPDH CATGTTCGTCATGGGTGTGAA 66 ATGGCATGGACTGTGGTCAT 67 CCA GAGT #, SEQ ID NO:
[0236] Statistical Analyses
[0237] Unless otherwise stated, data were expressed as mean standard deviation of the mean (s.d.). For comparisons between two groups, means were compared using unpaired two-tailed Student's t-tests. Comparisons between multiple groups were performed by ANOVA followed by Bonferroni's post-test analysis. Samples size, including number of mice per group, was chosen to ensure adequate power and were based on historical data. No exclusion criteria were applied for all analyses. No specific methods of randomization were applied to group/animal allocation. Investigators were not blinded to group allocation. All statistical analyses were performed using GraphPad Prism v.5 software (GraphPad Software Inc.). P<0.05 was considered statistically significant.
Example 8A. Generation of HA-iPSCs and HA-iECs from Hemophilia A Patients
[0238] In order to bioengineer our FVIII-secreting implants, we developed a method to abundantly generate ECs from patients with hemophilia A. To this end, we followed an iPSC approach. In principle, human iPSCs could be generated from multiple donor cell types such as skin fibroblasts; however, acquiring cells from hemophilic patients is not trivial due to their bleeding disorder. Thus, to avoid invasive biopsies, we resorted to a protocol that uses exfoliated renal epithelial cells present in urine (cells referred to as HA-UECs).sup.18. We isolated HA-UECs from urine collected from seven patients with severe hemophilia A (see
Example 8B. Stable Expression of Full-Length FVIII in HA-iECs by piggyBac Vectors
[0239] In order to achieve stable expression of FVIII in HA-iECs, we used a non-viral piggyBac DNA transposon system. The strategy was first to transduce HA-iPSCs, and then select clones with high-level transgene expression of FLF8. The selected HA-FLF8-iPSC clones were subsequently differentiated into HA-FLF8-iECs using our modRNA (ETV2) method (
[0240] We then verified that insertion of F8 in the resulting HA-FLF8-iECs corresponded to expression of a full-length version of the gene (
[0241] Next, we examined the level of F8 expression in HA-FLF8-iECs derived from 5 independent HA-FLF8-iPSC clones (
[0242] Lastly, expression of FVIII was also corroborated in HA-FLF8-iECs at the protein level (
Example 8C. Bioengineering Hemophilia A Patient-Specific FVIII-Secreting Vascular Networks in Hemophilic Mice
[0243] Next, we examined the capacity of HA-FLF8-iECs to engraft as functional blood vessels in vivo (
[0244] We examined our implants after 7 days in vivo. Macroscopic observation of the explants suggested similarities in the degree of vascularization between implants containing HA-FLF8-iECs (n=10) or unedited HA-iECs (n=5) (
[0245] Importantly, HA-FLF8-iECs maintained expression of FVIII upon engraftment. Indeed, the expression of FVIII was significantly different between implants containing HA-FLF8-iECs or unedited HA-iECs. In grafts formed with HA-FLF8-iECs, human microvesselsidentified by expression of h-CD31displayed noticeable expression of FVIII at their lumens (
Example 8D. Secretion of FL-FVIII into the Bloodstream and Correction of Coagulation Deficiency in Hemophilic Mice
[0246] We next sought to determine whether our subcutaneous microvascular grafts were able to effectively release functional full-length FVIII into the bloodstream of the implant-bearing mice, and whether the amount released was sufficient to correct their bleeding deficiency. To address these questions, we subjected each implant-bearing mouse to a standardized tail bleeding assay in which a distal 10-mm segment of the tail is amputated to assess bleeding and coagulation (
[0247] Of note, the capacity to secrete functional FVIII by HA-FLF8-iECs was only observed in vivo. In contrast, in vitro, we did not find differences in FVIII secretion between the edited HA-FLF8-iECs and the unedited HAiECs (Supplemental
[0248] Taken together these results show significant restoration of hemostasis and validate the proof-of-concept that our bioengineered microvessels can produce and secrete functional FVIII, restoring therapeutic levels of FVIII activity and treating hemophilia A.
REFERENCES FOR EXAMPLE 8
[0249] 1. Gitschier, J. et al. Detection and sequence of mutations in the factor VIII gene of haemophiliacs. Nature 315, 315427a0 (1985). [0250] 2. Soucie, J. et al. Mortality among males with hemophilia: relations with source of medical care. The Hemophilia Surveillance System Project Investigators. Blood 96, 437-42 (2000). [0251] 3. Gouw, S. C. et al. Factor VIII Products and Inhibitor Development in Severe Hemophilia A. The New England Journal of Medicine 368, 231-239 (2013). [0252] 4. Barr, R. D. et al. Health status and health-related quality of life associated with hemophilia. American Journal of Hematology 71, 152-160 (2002). [0253] 5. von Mackensen, S., Gringeri, A., Siboni, Mannucci, P. & (AICE), I. Health-related quality of life and psychological well-being in elderly patients with haemophilia.
[0254] Haemophilia 18, 345-352 (2012). [0255] 6. Lindvall, K. et al. Compliance with treatment and understanding of own disease in patients with severe and moderate haemophilia. Haemophilia 12, 47-51 (2006). [0256] 7. Walsh, C. & Valentino, L. Factor VIII prophylaxis for adult patients with severe haemophilia A: results of a US survey of attitudes and practices. Haemophilia 15, 1014-1021 (2009). [0257] 8. High, K. A. The gene therapy journey for hemophilia: are we there yet? Blood 120, 4482-4487(2012). [0258] 9. Mtrai, J., Chuah, M. K. & VandenDriessche, T. Preclinical and clinical progress in hemophilia gene therapy. Curr Opin Hematol 17, 387-392 (2010). [0259] 10. Hu, C., Cela, R. G., Suzuki, M., Lee, B. & Lipshutz, G. S. Neonatal helper-dependent adenoviral vector gene therapy mediates correction of hemophilia A and tolerance to human factor VIII. Proceedings of the National Academy of Sciences 108, 2082-2087 (2011). [0260] 11. Brown, B. D. et al. Helper-dependent adenoviral vectors mediate therapeutic factor VIII expression for several months with minimal accompanying toxicity in a canine model of severe hemophilia A. Blood 103, 804-810 (2004). [0261] 12. Sarkar, R. et al. Total correction of hemophilia A mice with canine FVIII using an AAV 8 serotype. Blood 103, 1253-1260 (2004). [0262] 13. Jiang, H. et al. Multiyear therapeutic benefit of AAV serotypes 2, 6, and 8 delivering factor VIII to hemophilia A mice and dogs. Blood 108, 107-115 (2006). [0263] 14. Lu, H. et al. Complete correction of hemophilia A with adeno-associated viral vectors containing a full-size expression cassette. Human gene therapy 19, 648-54 (2008). [0264] 15. PIPE, S. Functional roles of the factor VIII B domain. Haemophilia 15, 1187-1196 (2009). [0265] 16. Roth, D. et al. Nonviral Transfer of the Gene Encoding Coagulation Factor VIII in Patients with Severe Hemophilia A. The New England Journal of Medicine 344, 1735-1742 (2001). [0266] 17. Lin, Y. et al. Use of blood outgrowth endothelial cells for gene therapy for hemophilia A. Blood 99, 457-462 (2002). [0267] 18. Zhou, T. et al. Generation of human induced pluripotent stem cells from urine samples. Nat Protoc 7, 2080 (2012). [0268] 19. Dutta, D., Gunasekera, D., Ragni, M. V. & Pratt, K. P. Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers. Blood Advances 1, 231-239 (2016). [0269] 20. Matsui, H. et al. Delivery of Full-Length Factor VIII Using a piggyBac Transposon Vector to Correct a Mouse Model of Hemophilia A. Plos One 9, e104957 (2014). [0270] 21. Turner, N. A. & Moake, J. L. Factor VIII Is Synthesized in Human Endothelial Cells, Packaged in Weibel-Palade Bodies and Secreted Bound to ULVWF Strings. Plos One 10, e0140740 (2015). [0271] 22. Melero-Martin, J. M. et al. Engineering Robust and Functional Vascular Networks In Vivo With Human Adult and Cord Blood-Derived Progenitor Cells. Circ Res 103, 194-202(2008). [0272] 23. Lin, R.-Z. et al. Human endothelial colony-forming cells serve as trophic mediators for mesenchymal stem cell engraftment via paracrine signaling. Proc National Acad Sci 111, 10137-10142 (2014). [0273] 24. Liu, Y., Jennings, N. L., rt, A. & Du, X.-J. Standardizing a simpler, more sensitive and accurate tail bleeding assay in mice. World J Exp Medicine 2, 30 (2012). [0274] 25. Rangarajan, S. et al. AAV5-Factor VIII Gene Transfer in Severe Hemophilia A. New Engl J Medicine 377, 2519-2530 (2017). [0275] 26. Perrin, G. Q., Herzog, R. W. & Markusic, D. M. Update on clinical gene therapy for hemophilia. Blood 133, 407-414 (2018). [0276] 27. Thomas, C. E., Birkett, D., Anozie, I., Castro, M. G. & Lowenstein, P. R. Acute Direct Adenoviral Vector Cytotoxicity and Chronic, but Not Acute, Inflammatory Responses Correlate with Decreased Vector-Mediated Transgene Expression in the Brain. Mol Ther 3, 36-46 (2001). [0277] 28. LIRAS, A. & OLLLAS, S. Gene therapy for haemophilia . . . yes, but . . . with non-viral vectors? Haemophilia 15, 811-816 (2009). [0278] 29. Wilson, M. H., Coates, C. J. & George, A. L. PiggyBac Transposon-mediated Gene Transfer in Human Cells. Molecular Therapy 15, 139-145 (2007). [0279] 30. Chen, Y. et al. Functional Human Vascular Network Generated in Photocrosslinkable Gelatin Methacrylate Hydrogels. Adv Funct Mater 22, 2027-2039 (2012). [0280] 31. Lin, R.-Z., Chen, Y.-C., Moreno-Luna, R., Khademhosseini, A. & Melero-Martin, J. M. Transdermal regulation of vascular network bioengineering using a photopolymerizable methacrylated gelatin hydrogel. Biomaterials 34, 6785-6796 (2013). [0281] 32. Lin, R.-Z. et al. Host non-inflammatory neutrophils mediate the engraftment of bioengineered vascular networks. Nat Biomed Eng 1, s41551-017-0081 (2017). [0282] 33. Lin, R.-Z. et al. Induction of erythropoiesis using human vascular networks genetically engineered for controlled erythropoietin release. Blood 118, 5420-5428 (2011). [0283] 34. Xu, D. et al. Phenotypic correction of murine hemophilia A using an iPS cell-based therapy. Proc National Acad Sci 106, 808-813 (2009). [0284] 35. Olgasi, C. et al. Patient-Specific iPSC-Derived Endothelial Cells Provide Long-Term Phenotypic Correction of Hemophilia A. Stem Cell Rep 11, 1391-1406 (2018). [0285] 36. Ozelo, M. C. et al. Omental implantation of BOECs in hemophilia dogs results in circulating FVIII antigen and a complex immune response. Blood 123, 4045-4053 (2014). [0286] 37. Park, C.-Y. et al. Functional Correction of Large Factor VIII Gene Chromosomal Inversions in Hemophilia A Patient-Derived iPSCs Using CRISPR-Cas9. Cell Stem Cell 17, 213-220 (2015). [0287] 38. SHI, Q. et al. Lentivirus-mediated platelet-derived factor VIII gene therapy in murine haemophilia A. Journal of Thrombosis and Haemostasis 5, 352-361 (2007). [0288] 39. Shi, Q. et al. Syngeneic transplantation of hematopoietic stem cells that are genetically modified to express factor VIII in platelets restores hemostasis to hemophilia A mice with preexisting FVIII immunity. Blood 112, 2713-2721 (2008). [0289] 40. Shi, Q. et al. Platelet gene therapy corrects the hemophilic phenotype in immunocompromised hemophilia A mice transplanted with genetically manipulated human cord blood stem cells. Blood 123, 395-403 (2014).
GENERAL REFERENCES
[0290] 1. Aird, W. C. Endothelium in health and disease. Pharmacol Rep 60, 139-143 (2008). [0291] 2. Ding, B.-S. et al. Endothelial-derived angiocrine signals induce and sustain regenerative lung alveolarization. Cell 147, 539-553 (2011). [0292] 3. Paik, D. T. et al. Large-Scale Single-Cell RNA-Seq Reveals Molecular Signatures of Heterogeneous Populations of Human Induced Pluripotent Stem Cell-Derived Endothelial Cells. Circ Res 123, 443-450 (2018). [0293] 4. Patsch, C. et al. Generation of vascular endothelial and smooth muscle cells from human pluripotent stem cells. Nat Cell Biol 17, 994-1003 (2015). [0294] 5. Hu, S. et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight 1, 915 (2016). [0295] 6. Chien, K. R., Zangi, L. & Lui, K. O. Synthetic chemically modified mRNA (modRNA): toward a new technology platform for cardiovascular biology and medicine. Cold Spring Harbor Perspectives in Medicine 5, a01403 5-a01403 5 (2014). [0296] 7. Harding, A. et al. Highly Efficient Differentiation of Endothelial Cells from Pluripotent Stem Cells Requires the MAPK and the PI3K Pathways. Stem Cells 35, 909-919(2017). [0297] 8. Sahara, M. et al. Manipulation of a VEGF-Notch signaling circuit drives formation of functional vascular endothelial progenitors from human pluripotent stem cells. Cell Res 24, 820-841 (2014). [0298] 9. Rasmussen, T. L. et al. ER71 directs mesodermal fate decisions during embryogenesis. Development 138, 4801-4812 (2011). [0299] 10. Kataoka, H. et al. Etv2/ER71 induces vascular mesoderm from Flk1+PDGFR+ primitive mesoderm. Blood 118, 6975-6986 (2011). [0300] 11. Rasmussen, T. L. et al. VEGF/Flk1 signaling cascade transactivates Etv2 gene expression. PLoS ONE 7, e50103 (2012). [0301] 12. Elcheva, I. et al. Direct induction of haematoendothelial programs in human pluripotent stem cells by transcriptional regulators. Nat Commun 5, 4372 (2014). [0302] 13. Suknuntha, K. et al. Optimization of Synthetic mRNA for Highly Efficient Translation and its Application in the Generation of Endothelial and Hematopoietic Cells from Human and Primate Pluripotent Stem Cells. Stem Cell Rev 14, 525-534 (2018). [0303] 14. Lin, Y., Gil, C.-H. & Yoder, M. Differentiation, Evaluation, and Application of Human Induced Pluripotent Stem Cell-Derived Endothelial Cells. Arterioscler Thromb Vasc Biol 37, 2014-2025 (2017). [0304] 15. Melero-Martin, J. M. et al. Engineering robust and functional vascular networks in vivo with human adult and cord blood-derived progenitor cells. Circ Res 103, 194-202 (2008). [0305] 16. Stratman, A. N. et al. Interactions between mural cells and endothelial cells stabilize the developing zebrafish dorsal aorta. Development 144, 115-127 (2017). [0306] 17. Lin, R.-Z. et al. Host non-inflammatory neutrophils mediate the engraftment of bioengineered vascular networks. Nat. biomed. eng. 1, 0081 (2017). [0307] 18. Yamamizu, K., Kawasaki, K., Katayama, S., Watabe, T. & Yamashita, J. K.
[0308] Enhancement of vascular progenitor potential by protein kinase A through dual induction of Flk-1 and Neuropilin-1. Blood 114, 3707-3716 (2009). [0309] 19. Klein, D. iPSCs-based generation of vascular cells: reprogramming approaches and applications. Cell Mol Life Sci 75, 1411-1433 (2018). [0310] 20. Yang, L. et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature 453, 524-528 (2008). [0311] 21. Vodyanik, M. A. et al. A mesoderm-derived precursor for mesenchymal stem and endothelial cells. Cell Stem Cell 7, 718-729 (2010). [0312] 22. Casie Chetty, S. et al. Vegf signaling promotes vascular endothelial differentiation by modulating etv2 expression. Dev Biol 424, 147-161 (2017). [0313] 23. Chen, Y. et al. Vascular endothelial growth factor promotes cardiomyocyte differentiation of embryonic stem cells. Am J Physiol Heart Circ Physiol 291, H1653-8 (2006). [0314] 24. Lee, J. H., Protze, S. I., Laksman, Z., Backx, P. H. & Keller, G. M. Human Pluripotent Stem Cell-Derived Atrial and Ventricular Cardiomyocytes Develop from Distinct Mesoderm Populations. Cell Stem Cell 21, 179-194.e4 (2017). [0315] 25. Han, S. et al. Generation of functional hepatic cells from pluripotent stem cells. J Stem Cell Res Ther Suppl 10, 1-7 (2012). [0316] 26. Oh, S.-Y., Kim, J. Y. & Park, C. The ETS Factor, ETV2: a Master Regulator for Vascular Endothelial Cell Development. Mol. Cells 38, 1029-1036 (2015). [0317] 27. Ferdous, A. et al. Nkx2-5 transactivates the Ets-related protein 71 gene and specifies an endothelial/endocardial fate in the developing embryo. Proc Natl Acad Sci USA 106, 814-819 (2009). [0318] 28. Lee, D. et al. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. Cell Stem Cell 2, 497-507 (2008). [0319] 29. Morita, R. et al. ETS transcription factor ETV2 directly converts human fibroblasts into functional endothelial cells. Proc Natl Acad Sci USA 112, 160-165 (2015). [0320] 30. Lee, S. et al. Direct Reprogramming of Human Dermal Fibroblasts Into Endothelial Cells Using ER71/ETV2. Circ Res 120, 848-861 (2017). [0321] 31. Yan, G. et al. Engineering vascularized skeletal muscle tissue with transcriptional factor ETV2-induced autologous endothelial cells. Protein Cell 122, 3982-222 (2018). [0322] 32. Le Bras, A. et al. Adventitial Sca1+ Cells Transduced With ETV2 Are Committed to the Endothelial Fate and Improve Vascular Remodeling After Injury. Arterioscler Thromb Vasc Biol 38, 232-244 (2018). [0323] 33. Lindgren, A. G., Veldman, M. B. & Lin, S. ETV2 expression increases the efficiency of primitive endothelial cell derivation from human embryonic stem cells. Cell Regen (Lond) 4, 1 (2015). [0324] 34. Lin, R.-Z. et al. Human endothelial colony-forming cells serve as trophic mediators for mesenchymal stem cell engraftment via paracrine signaling. Proc Natl Acad Sci USA 111, 10137-10142 (2014). [0325] 35. Melero-Martin, J. M. et al. In vivo vasculogenic potential of human blood-derived endothelial progenitor cells. Blood 109, 4761-4768 (2007). [0326] 36. Harding, A. et al. Highly Efficient Differentiation of Endothelial Cells from Pluripotent Stem Cells Requires the MAPK and the PI3K Pathways. Stem Cells 35, 909-919(2017). [0327] 37. Sahara, M. et al. Manipulation of a VEGF-Notch signaling circuit drives formation of functional vascular endothelial progenitors from human pluripotent stem cells. Cell Res 24, 820-841 (2014). [0328] 38. Patsch, C. et al. Generation of vascular endothelial and smooth muscle cells from human pluripotent stem cells. Nat Cell Biol 17, 994-1003 (2015). [0329] 39. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013). [0330] 40. Garcia-Alcalde, F. et al. Qualimap: evaluating next-generation sequencing alignment data. Bioinformatics 28, 2678-2679 (2012). [0331] 41. Ewels, P., Magnusson, M., Lundin, S. & Kller, M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32, 3047-3048 (2016). [0332] 42. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Other Embodiments
[0333] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims.
[0334] Other aspects, advantages, and modifications are within the scope of the following claims.