Biosynthetic gene cluster of carrimycin

Abstract

The present disclosure provides a biosynthetic gene cluster of carrimycin. The biosynthetic gene cluster comprises 44 gene open reading frames (orf), i.e., 5 orfs (orf10-14) encoding polyketide synthase, 9 orfs (orf1, 4-6, 15 and 36-39) related to polyketone synthesis extension unit and modification, 16 orfs (orf9, 16-22, 24, 26, 28, 29, 33-35 and 41) related to glycosyl synthesis, 6 orfs (orf7, 8, 30-32 and 40) related to glycosyl transfer, 2 orfs (orf3 and 25) related to resistance, 4 orfs (orf2, 23, 27 and 42) possibly related to regulation, a tsr resistance marker gene orf (orf43) and a 4-mycaroseglucoside isovaleryl transferase gene orf (orf44).

Claims

1. A polynucleotide comprising a carrimycin biosynthetic gene cluster, comprising 44 genes comprising: 1) five polyketide synthase genes, including orf10 residues 16215-10543 of SEQ ID NO:1, orf11 residues 21076-16328 of SEQ ID NO:1, orf12 residues 32511-21124 of SEQ ID NO:1, orf13 residues 38599-32585 of SEQ ID NO:1, orf14 residues 52259-38643 of SEQ ID NO:1; 2) nine genes related to polyketone synthesis extension unit and modification, including orf1 residues 1-645 of SEQ ID NO:1, orf4 residues 3614-4840 of SEQ ID NO:1, orf5 residues 4846-5511 of SEQ ID NO:1, orf 6 residues 7150-5801of SEQ ID NO:1, orf15 residues 53099-54310 of SEQ ID NO:1, orf36 residues 83164-82052 of SEQ ID NO:1, orf37 residues 84400-83279 of SEQ ID NO:1, orf38 residues 84713-84393 of SEQ ID NO:1, orf39 residues 85576-84710 of SEQ ID NO:1; 3) sixteen genes related to glycosyl synthesis, including orf9 residues 10543-9830 of SEQ ID NO:1, orf16 residues 54495-54845 of SEQ ID NO:1, orf17 residues 54842-56041 of SEQ ID NO:1, orf18 residues 56038-56946 of SEQ ID NO:1, orf19 residues 56930-57967 of SEQ ID NO: 1, orf20 residues 57937-60174 of SEQ ID NO: 1 orf21 residues 60836-61984 of SEQ ID NO:1, orf22 residues 62796-62077 of SEQ ID NO:1, orf24 residues 67379-66318 of SEQ ID NO:1, orf26 residues 69349-70650 of SEQ ID NO:1, orf28 residues 72422-73462 of SEQ ID NO:1, orf29 residues 74601-73561 of SEQ ID NO:1, orf33 residues 78783-79775 of SEQ ID NO: 1, orf34 residues 79772-80779 of SEQ ID NO:1, orf35 residues 82055-80823 of SEQ ID NO:1 and orf41 residues 87094-87702 of SEQ ID NO:1; 4) six genes related to glycosyl transfer, including orf7 residues 8444-7179 of SEQ ID NO:1, orf8 residues 9729-8482 of SEQ ID NO:1, orf30 residues 74913-76160 of SEQ ID NO:1, orf31 residues 76218-77486 of SEQ ID NO:1, orf32 residues 77606-78781of SEQ ID NO:1 and orf40 residues 85825-87042 of SEQ ID NO:1; 5) two genes related to resistance, including orf3 residues 3133-2285 of SEQ ID NO:1 and 25 residues 69004-67352 of SEQ ID NO:1; 6) four genes related to biosynthesis regulation, including orf2 residues 1810-1208 of SEQ ID NO:1, orf23 residues 63633-65645 of SEQ ID NO:1, orf27 residues 72156-70708 of SEQ ID NO:1 and orf42 residues 89315-88143 of SEQ ID NO:1; 7) two genes, including an exogenous genetic engineering marker gene orf43 residues 866-60 SEQ ID NO:2 and a mycarose 4-O-hydroxyl isovaleryltransferase gene orf44 residues 2337-1174 of SEQ ID NO:2 linked to the orf43.

2. The polynucleotide according to claim 1, wherein the five polyketide synthase genes are responsible for synthesis of a 16-membered lactone ring of carrimycin, and amino acid sequences of the five polyketide synthase genes orf10-14 comprise IA-W10 defined in SEQ ID NO:12, IA-W11 defined in SEQ ID NO:13, IA-W12 defined in Seq. ID NO: 14, IA-W13 defined in SEQ ID NO:15, and IA-W14 defined in SEQ ID NO: 16.

3. The polynucleotide according to claim 1, wherein amino acid sequences of the genes related to polyketone synthesis extension unit and modification including orf1, orf4-6, 15 and 36-39 comprise IA-W1 defined in SEQ ID NO:3, IA-W4 defined in SEQ ID NO:6, IA-W5 defined in SEQ ID NO:7, IA-W6 defined in SEQ ID NO:8, IA-W15 defined in SEQ ID NO:17, IA-W36 defined in SEQ ID NO:38, IA-W37 defined in SEQ ID NO:39, IA-W38 defined in SEQ ID NO:40, and IA-W39 defined in SEQ ID NO:41.

4. The polynucleotide according to claim 1, wherein amino acid sequences of the genes related to glycosyl synthesis including orf9, 16-22, 24, 26, 28, 29, 33-35 and 41 comprise IA-W9 defined in SEQ ID NO:11, IA-W16 defined in SEQ ID NO:18, IA-W17 defined in SEQ ID NO:19, IA-W18 defined in SEQ ID NO:20, IA-W19 defined in SEQ ID NO:21, IA-W20 defined in SEQ ID NO:22, IA-W21 defined in SEQ ID NO:23, IA-W22 defined in SEQ ID NO:24, IA-W24 defined in SEQ ID NO:26, IA-W26 defined in SEQ ID NO:28, IA-W28 defined in SEQ ID NO:30, IA-W29 defined in SEQ ID NO:31, IA-W33 defined in SEQ ID NO:35, IA-W34 defined in SEQ ID NO:36, IA-W35 defined in SEQ ID NO:37, and IA-W41 defined in SEQ ID NO:43.

5. The polynucleotide according to claim 1, wherein amino acid sequences of the genes related to glycosyl transfer including orf7, 8, 30-32 and 40 comprise IA-W7 defined in SEQ ID NO:9, IA-W8 defined in SEQ ID NO:10, IA-W30 defined in SEQ ID NO:32, IA-W31 defined in SEQ ID NO:33, IA-W32 defined in SEQ ID NO:34, and IA-W40 defined in SEQ ID NO:42.

6. The polynucleotide according to claim 1, wherein amino acid sequences of the genes related to resistance including orf3 and 25 comprise IA-W3 defined in SEQ ID NO:5 and IA-W25 defined in SEQ ID NO:27.

7. The polynucleotide according to claim 1, wherein amino acid sequences of the genes related to biosynthetic regulation including orf2, 23, 27 and 42 comprise IA-W2 defined in SEQ ID NO:4, IA-W23 defined in SEQ ID NO:25, IA-W27 defined in SEQ ID NO:29, and IA-W42 defined in SEQ ID NO:44.

8. The polynucleotide according to claim 1, wherein amino acid sequences of the exogenous genetic engineering marker gene orf43 and the orf44 linked to the orf43 comprise IA-W43 defined in SEQ ID NO:45 and IA-W44 defined in SEQ ID NO:46.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: A structure of a biosynthetic gene cluster of carrimycin.

(2) FIG. 2: A structure of a polyketide synthase gene of carrimycin.

(3) FIG. 3: A schematic diagram of the construction of blocking recombinant plasmids of IA-W4, 3-O-acyltransferase gene and double exchange. by

(4) FIG. 4: A schematic diagram of construction of blocking recombinant plasmids of IA-W42 transcription regulation and control gene and so on.

(5) FIG. 5A: Verification of blocking of an IA-W4 3-O-acyltransferase gene by PCR,

(6) In which: 1: original strain; 2, 3, 4: gene blocked mutant; and 5: DNA marker III.

(7) FIG. 5B: Verification of blocking of other genes by PCR,

(8) In which: III: DNA marker III; C: original strain; and M: gene blocked mutant.

(9) FIG. 6: HPLC analysis of fermented products of an IA-W4 3-O-acyltransferase gene blocked mutants,

(10) In which: a: a carrimycin control; and b: fermented extract of gene blocked mutant, I, II and III are absorption peaks of three main ingredients, i.e., isovaleryl spiramycin I, isovaleryl spiramycin II and isovaleryl spiramycin III of carrimycin, respectively.

(11) According to the present disclosure, mutant strains are obtained through gene blocking experiments; and it is proven by the experiments that carrimycin ingredient change of the mutant strains is caused by gene blocking, or carrimycin is not produced any more. And thus, it is prompted that obtained gene cluster information is related to biosynthesis of carrimycin. According to the present disclosure, an exogenous thiostrepton resistance marker gene (orf43) and a mycarose 4-O-hydroxyl isovaleryl transferase gene (orf44) linked to the orf43 are integrated to chromosomes of the carrimycin producing bacteria through genic homologous recombination. Our laboratory has proven that the orf43 and the orf44 are essential to the biosynthesis of carrimycin through researches (Chinese Journal of Biotechnology, volume 15, issue 2, 1999, 171-176).

DETAILED DESCRIPTION

(12) Embodiments provided below are only used for helping those skilled in the art to better comprehend the present disclosure, rather than limiting the present disclosure in any way.

<Embodiment 1> Extraction of Total DNA of Carrimycin Producing Bacteria (S. spiramyceticus)

(13) Formula of R.sub.2YE culture medium (g/100 ml):

(14) TABLE-US-00002 Saccharose 10.3 Glucose 1.0 Yeast extract 0.4 Tryptone 0.2 Peptone 0.4 Casein hydrolyzate 0.1 K.sub.2SO.sub.4 0.025 CaCl.sub.2 0.216 KH.sub.2PO.sub.4 0.005 MgCl.sub.26H.sub.2O 1.012 NaOH(1M) 0.5 ml Tris-HCl(0.25 mol/L pH 7.2) 10 ml
0.2 ml of trace element solution is added, and distilled water is added until the volume is 100 ml and the pH is 6.5

(15) Trace element solution (g/100 ml):

(16) TABLE-US-00003 ZnCl.sub.2 0.004 FeCl.sub.36H.sub.2O 0.02 CuCl.sub.22H.sub.2O 0.001 MnCl.sub.24H.sub.2O 0.001 Na.sub.2B.sub.4O.sub.710H.sub.2O 0.001 (NH.sub.4).sub.6Mo.sub.7O.sub.24H.sub.2O 0.001

(17) 15-pound sterilization is performed for 20 min at a temperature of 121 DEG C.

(18) S. spiramyceticus was inoculated into 25 ml of R.sub.2YE culture medium, shaking-table culture was performed for 48 h at a temperature of 28 DEG C. Then sub-cultivating was performed in 100 ml R.sub.2YE culture medium, shaking-table culture was performed for 24 h at a temperature of 28 DEG C. Then the thalli (about 10 g) were collected after centrifuging for 10-15 min at a rate of 5,000 rpm. The operation was performed mainly according to product specification of UPTECH life science company. 50 ml of 25 mM EDTA solution was added into the thalli for washing under vibrating, and then the solution was centrifuged, and the supernatant was discarded. Themycelia were suspended with 25 ml of lysozyme solution (10 mg/ml, prepared from 10 mM Tris-HCl with pH of 8.0, 2 mM EDTA and 1.2% TritonX-100 through adding 0.5 ml of 100 mg/ml RNase), and cultured for about 1-2 h at a temperature of 37 DEG C. until cells were translucent. Then 2.5 ml of protease K solution was added, and culturing was performed for 30 min at a temperature of 55 DEG C. Then 20 ml of 10% SDS solution was added, and culturing was performed for 10 min at a temperature of 70 DEG C. An equal volume of anhydrous ethanol was added, and full vibrating was performed. Then the solution was transferred to a DNA purification column, centrifuging for 1 min at a rate of 12,000 rpm. Then 50 ml of protease-containing solution was added to wash the column, and centrifuging was performed for 1 min at a rate of 12,000 rpm at room temperature. Then, the column was washed twice with 50 ml of rinsing solution, and centrifuging was performed for 1 min at a rate of 12,000 rpm at a time. Then 5-10 ml of TE eluent was added, and was placed was for 2-5 min at room temperature, and centrifuging was performed for 1 min at a rate of 12,000 rpm. The solution was collected, and the total DNA was saved at a temperature of 20 DEG C.

<Embodiment 2> Verification of Functions of Information of Genes in Seq. 1 Through Blocking Gene

(19) It is carried out blocking genes such as IA-W1, IA-W42 at two ends of gene clusters, and IA-W4, 17, 21, 23 and 27 selected for to obtain mutant strains. It is proven by experiments, the capability of these blocked strains for producing carrimycin has changed carrimycin or is disappear. Thus, the obtained gene cluster information is essential to carrimycin production. Primers are designed according to the above-mentioned encoding genes and upstream and downstream sequences thereof and are inserted into appropriate enzyme digestion sites, and primer sequences are shown in table 2.

(20) TABLE-US-00004 TABLE2 Primersequencesdesignedforgeneblockingexperiment Gene Primersequence Gene Primersequence IA- CCGGAATTCGCCCTTGAACGCTTGTCCG IA- CTAGTCTAGACCGCCGACCGCAAAC W1 EcoRI W42 TCTCXbaI CGCGGATCCGCTCACTCGGCAGGATGGG AACTGCAGCGACGTTCTCCTCCTCA BamHI CCGPstI AACTGCAGTCCGTCTACAAGGCGTGGTT CGGGGTACCCGACCTGTGGCTGACC PstI GACKpnI CTAGTCTAGACGTATCGGTTCGTCGAGG CCGGAATTCGTGGACGACACCTGTA TCTXbaI TGAACEcoRI IA- AGTGTCTAGACGGCGCGCGGCACGGGGT IA- CCGGAATTCATCCCCTTCCTCGACGC W4 TGAACTCXbaI W17 AGEcoRI GACAAGCTTTGGATTCTCGCTCCTCTITC AACTGCAGGGCGGTACGGGGTAGTG GGGATGGHindIII GATPstI GACAAGCTTTGAGCGTGGCAGACCAGAC CGCGGATCCGCAGAGCCTCAGCCTT CGCTCTHindIII CCCBamHI AGTGGAATTCCACCAGGGCAAGGTCGGC CTAGTCTAGACCGTACTCCCTGGCG GTGCTCTGEcoRI TTGTTXbaI IA- CCGGAATTCGACCGCATCCGCTACGACG IA- CCGGAATTCTTACCTGGATTATGGTG W21 EcoRI W23 AAGEcoRI CGCGGATCCGAGCCATTGGTCGTCGAAG CGGCCGAGCGGGCTGCAGA ABamHI PstI AACTGCAGACCGACGGCATCTACACCAC CGGGGTACCGGAGTACAACGCCGG PstI CTTCKpnI CTAGTCTAGACCAGGACCGCAAGGACTA CTAGTCTAGACCGAGCACGGTCCGG CGXbaI GAGGXbaI IA- CCGGAATTCGCGTGCTCACCGACAACCT AACTGCAGTCGGGCCATCTTGTCGTTG W27 GEcoRI PstI CGCGGATCCGGGAAGTCCTCACTGCTCA CTAGTCTAGACCTTCAGGGTGCCGTAGTC ACBamHI XbaI

(21) Corresponding homologous gene fragments are separately obtained through PCR amplification, and recombinant plasmid containing homologous genes was obtained through adopting corresponding enzyme digestion sites, inserting screened marked resistant genes (Apramycin-Am) and connecting the genes to a temperature-sensitive vector pKC1139 [Bierman M. et al., Gene, 1992; 116(1): 43-9] or Escherichia coli/Streptomyces vector pGH112 [Youbao Biology Company]. Recombinant plasmid was transformed with protoplasts and transferred into the carrimycin producing bacteria. After cultivation, single colonies were isolated to obtain the homologous fragment double exchange gene blocking strain. A schematic diagram of the construction of blocking recombinant plasmids of an IA-W4 3-O-acyltransferase gene and double exchange was shown in FIG. 3. A schematic diagram of construction of blocking recombinant plasmids of genes such as an IA-W42 transcription regulation and control gene were shown in FIG. 4.

(22) Total DNA of blocked strains and total DNA of original strains were subjected to PCR verification by separately adopting corresponding primers, as shown in FIG. 5A and FIG. 5B. Shown by a result of FIG. 5A, 613 bp was deleted in the encoding gene orf4 of a mutant strain with IA-W4 gene blocked. A PCR verification result is illustrated in FIG. 5B, compared with the original strains, length of PCR products increases as the screened marked resistant genes were inserted into mutant strain with related encoding genes blocked.

(23) Proven by fermentation experiments and HPLC detection of products, IA-W4 blocked mutant strains do not produce 4-isovaleryl spiramycin III and II any more and are dominated with 4-isovaleryl spiramycin I as a major ingredient (FIG. 6). It is proven that an IA-W4 3-O-acyltransferase gene in gene information in Seq. 1 provided by the present disclosure participates in the biosynthesis of carrimycin. Due to the blocking of the gene, mutant strains lose the function of acylating 3-position hydroxyl of a lactone ring of carrimycin.

(24) Proven by fermentation experiments on other gene blocked strains and antibacterial activity and HPLC detection on products, the blocked strains do not produce activated carrimycin any more. It is proven that the gene cluster in Seq. 1 provided by the present disclosure participates in the biosynthesis of carrimycin.

<Embodiment 3> Screening of Gene Transfer and Block Strains of Carrimycin Producing Bacteria

(25) 3.1 Preparation of Protoplast:

(26) Fresh slant spores of carrimycin producing bacteria was inoculated in R.sub.2YE liquid culture medium and shaken for 48 h at a temperature of 28 DEG C. at a rate of 220 rpm. The culture fluid was inoculated at an inoculation rate of 10% in fresh R.sub.2YE liquid culture medium containing 0.5% glycine and shaken for 20 h at a temperature of 28 DEG C. 10 ml of bacterium solution was taken into a centrifuge tube, and centrifuged at a rate of 3,000 rpm to collected mycelium. The mycelium was washed with P-buffer.

(27) TABLE-US-00005 Tris-HCl (pH 8.0) 1 mol/L 3.1 ml CaCl.sub.22H.sub.2O 3.68 MgCl.sub.26H.sub.2O 2.04 Saccharose 103 Glucose 1.0 Trace element solution 2.0 ml PH 7.6

(28) 15-pound sterilization is performed for 30 min at a temperature of 121 DEG C.

(29) After washing twice, the mycelium was suspended with a proper volume of P-buffer, a P-buffer solution with lysozyme (final concentration is 2 mg/ml) was added, mixed uniform, and incubated for 30-45 min in a water bath at a temperature of 37 DEG C., and shaken once every 10-15 min. Forming conditions of protoplast were observed with a 1040 phase-difference microscope. Enzymolysis was stopped when microscopic examination shows that the majority of mycelia have formed protoplast. After filtering through absorbent cotton, the filter liquor was subjected to centrifugal washing twice with P-buffer. Finally, the protoplast was suspended with 1 ml of P-buffer, and the suspension was separately loaded to EP tubes by 100 l/tube, and preserved at a temperature of 70 DEG C. for later use.

(30) 3.2 Transformation of Protoplast by Plasmid DNA:

(31) 100 l of protoplast was taken and added into 10 l of plasmid DNA solution, a tube wall was flipped to perform uniform mix. 400 l of P-buffer containing 25% PEG-1000 (a product of Britain Koch-light company) was rapidly added, blowing-suction and uniform mixing were performed, and placing for 5 min at room temperature. A dehydrated R.sub.2YE flat plate was coated with 200 l of mixture, cultured for 20 h at a temperature of 28 DEG C., covered with 50 g/ml tsr sterile water, cultured for 5-7 days at a temperature of 28 DEG C., and transformants were picked up.

(32) 3.3 Screening of Gene Blocked Mutant Strains

(33) The transformants are picked into a culture medium containing 50 g/ml of Tsr

(34) TABLE-US-00006 Soyabean cake powder 20 Glucose 10 Starch 30 CaCO.sub.3 5.0 NaCl 4.0 agar 18
Deionized water is used for preparing, and 15-pound sterilization is performed for 30 min at a temperature of 121 DEG C. at a natural pH value.

(35) Culturing was performed for 5-7 days at a temperature of 28 DEG C., 4-5 generation passing was carried out in an undosed culture medium. Monospores were separated. The monospores were separately and correspondingly screened in an Am-containing (Am 50 g/ml) culture medium to screen out gene blocked strains grown in Am and not grown in Tsr. Blocked strains with stable resistance marker expression were picked, the DNA of the blocked strains was extracted from genomes, PCR amplification was performed by adopting corresponding primers in the embodiment 2, and the correctness of gene blocking was judged according to product sizes and DNA sequencing.

<Embodiment 4> Fermentation of Carrimycin Producing Bacteria and Gene Blocked Strains and Detection and Identification of Product Activity

(36) 4.1 Fermentation

(37) TABLE-US-00007 Soyabean cake powder 20.0 Glucose 10.0 Starch 30.0 CaCO.sub.3 5.0 NaCl 4.0 Agar 18.0

(38) Deionized water is used for preparing, and 15-pound sterilization was performed for 30 min at a temperature of 121 DEG C. at a natural pH value.

(39) Strains were cultured in slant culture medium for 10-12 d at a temperature of 28 DEG C. After strains were grown, the strains was inoculated by dicing into a 100 mL triangular flask containing 30 ml of fermentation culture medium, and shaken culture for 96-120 h at a temperature of 28 DEG C.

(40) Fermentation Culture Medium (g/L):

(41) TABLE-US-00008 Glucose 5.0 Sodium chloride 10 Starch 60 Magnesium sulfate 1.0 Calcium carbonate 5.0 Ammonium nitrate 6.0 Potassium dihydrogen phosphate 0.5 Yeast powder 5.0 Fish meal 20.0 natural pH value

(42) Deionized water is used for preparing, and 15-pound sterilization was performed for 30 min at a temperature of 121 DEG C.

(43) 4.2 Detection on Activity of Fermentation Product:

(44) Fermentation liquor was centrifuged, the supernatant was taken and diluted, and then, detection was performed by taking Bacillus subtilis as detection bacteria referring to an acetyispiramycin microbiological assay (II), 2005<Pharmacopoeia of People's Republic of China>. Detection is performed by adopting a cylinder plate method with a standard curve method.

(45) 4.3 Extraction and Identification of Fermentation Product:

(46) Fermentation liquor was centrifuged for 15 min at a rate of 3000 rpm at room temperature, the pH of supernatant was adjusted to 8.5 with 1M NaOH. Then, the supernatant was extracted with volume of ethyl acetate. An ethyl acetate phase was taken out, and was subjected to blow-drying in a flat dish, then the dried substance was dissolved in chromatographically-pure methanol, and then 10-20 l of a sample was introduced after filtering. Chromatograph instruments: a Shimadzu LC-10ATvp liquid chromatograph and a diode array detector; a chromatographic column: Kromasil C.sub.18(4.5 mm150 mm, 5 m); flowing phase: CH.sub.3OH/1% NaH.sub.2PO.sub.4 (55:45); detection wavelength: 231 nm; flow velocity: 1 ml/min; and column temperature: 25 DEG C. Fermentation products of mutant strains are identified by taking a carrimycin standard product as a control (purchased from National Institute for the Control of Pharmaceutical and Biological Products).

(47) Genes and proteins involved in the present disclosure are shown in a sequence table.