DISPLAY OF HETEROLOGOUS MOLECULES ON BACTERIAL CELLS AND MEMBRANE VESICLES

Abstract

The present invention concerns Gram-negative bacterial cells or Outer Membrane Vesicles (OMVs) which display on their outer surface an autotransporter (AT) fusion protein covalently coupled via an isopeptide bond to a heterologous molecule. These bacterial cells and OMVs are suitable for use in vaccines or targeted drug delivery of antigens or therapeutic agents to specific cells or tissues.

Claims

1. Gram-negative bacterial cells or Outer Membrane Vesicles (OMVs) which display on their outer surface an autotransporter (AT) fusion protein covalently coupled via an isopeptide bond to a heterologous molecule, wherein the AT fusion protein comprises at least one moiety of a Catcher/Tag ligation pair, and the heterologous molecule comprises the corresponding binding moiety of said Catcher/Tag ligation pair.

2. The bacterial cells or OMVs according to claim 1, wherein the Catcher/Tag pair is derived from Gram positive bacterial pilus proteins.

3. The bacterial cells or OMVs according to claim 1, wherein the Catcher/Tag ligation pair is derived from a Streptococcal protein selected from the group consisting of a major pilin protein Spy0128, a Fibronectin-binding protein FbaB of Streptococcus pyogenes, a Fibronectin-binding protein from Streptococcus dysgalactiae, and a pilus-subunit RrgA from Streptococcus pneumoniae.

4. The bacterial cells or OMVs according to claim 1, wherein the Catcher/Tag pair is selected from the group consisting of SpyTag/SpyCatcher and SnoopTag/SnoopCatcher.

5. The bacterial cell or OMV according to claim 1, wherein the autotransporter protein is a serine protease autotransporter of Enterobacteriacea (SPATE).

6. The bacterial cells or OMVs according to claim 5, wherein the SPATE protein is selected from the group consisting of hemoglobin-binding protease (Hbp), extracellular serine protease (EspC) and temperature-sensitive hemagglutinin (Tsh) from Escherichia coli.

7. The bacterial cells or OMVs according to claim 5, wherein the SPATE protein is haemoglobin-binding protease (Hbp).

8. The bacterials cell or OMVs according claim 1, wherein the autotransporter fusion protein comprises a mutated autocatalytic cleavage site which prevents cleavage.

9. The bacterial cells or OMVs according to claim 1, wherein the bacterial cell is selected from the group consisting of Escherichia coli and Salmonella spp.

10. The bacterial cells or OMVs according to claim 5, wherein the bacterial cell is a subspecies of S. enterica subsp. enterica.

11. The baterial cells or OMVs according to claim 1, wherein the heterologous molecule is selected from the group consisting of antigens, lectins, adhesins and affinity molecules.

12. The bacterial cells or OMVs according to claim 11, wherein the heterologous molecule is an antigen.

13. The bacterial cells or OMVs according to claim 11, wherein the antigen is a string of multiple antigens.

14. The bacterial cells or OMVs according to claim 11, wherein the heterologous molecule is a lectin.

16. The bacterial cells or OMVs according to claim 11. wherein the heterologous molecule is an adhesin or affinity molecule.

17. A method to prepare the Gram-negative bacterial cells or Outer Membrane Vesicles (OMVs) of claim 1, said method comprising: a) providing Gram-negative bacterial cells or Outer Membrane Vesicles (OMVs) which display on their outer surface an autotransporter (AT) fusion protein comprising at least one moiety of a Catcher/Tag ligation pair, b) contacting the Gram-negative bacterial cells or the OMVs of step (a) with a heterologous molecule comprising the corresponding binding moiety of said Catcher/Tag ligation pair under conditions which allow the formation of an isopeptide bond between the autotransporter fusion protein and the heterologous molecule, and c) recovering the Gram-negative bacterial cells or the OMVs of claim 1.

18. A method comprising a step of using bacterial cells or OMVs according to claim 1 as a display platform for antigen delivery or as a drug-delivery vehicle.

19. The bacterial cells or OMVs according to claim 1, wherein the Catcher/Tag pair is derived from Streptococcal pilus proteins.

20. The bacterial cells or OMVs according to claim 5, wherein the bacterial cell is a subspecies of a S. Typhimurium cell.

Description

LEGEND OF THE FIGURES

[0046] FIG. 1. Schematic representations of the proteins used in this study. (A) Hbp fusions. Wild-type Hbp is synthesized with an N-terminal signal sequence (ss) that is cleaved off after translocation across the inner membrane. The C-terminal -domain (black) integrates into the outer membrane facilitating translocation of the passenger domain. After translocation, autocatalytic cleavage separates the passenger and the -domain (after Asn1100). The passenger domain contains five subdomains (white, numbered 1-5) protruding from a -helical stem structure (dark grey). The derived HbpD(d1) display platform lacks subdomain 1 and the autocatalytic cleavage site (Jong et al (2012) supra). Ligation tags and catchers were integrated at the site of subdomain 1. (B) Catcher-fused model proteins. The SpyCatcher-SnoopCatcher fusion protein (SpC-SnC; SEQ ID NO: 14) was constructed by Veggiani et al. containing a 34 amino acid -helical linker (Veggiani et al. 2016, supra). GFPnanobody-SpyCatcher (GFPnb-SpC; SEQ ID NO: 15) contains an N-terminal PeIB signal sequence (ss) (Kubala et al. 2010 Protein Science: a publication of Protein Society 19(12): 2389-401) for translocation into the periplasm and a hexa-histidine tag (H6) for metal affinity purification. (C) Catcher-fused antigens. Fusion proteins containing pneumococcal antigens PspA and SP1690, SpyCatcher (SpC) and SnoopTag (SnT) for protein ligation, an HA tag (HA) for detection and a hexa-histidine tag (H6) for metal affinity purification (SEQ ID NO: 17; SEQ ID NO: 24, resp). (D) Cartoon of Hbp-mediated Spy-ligation to the surface of outer membrane vesicles. HbpD(d1)-SpT (colouring and numbering as in A) is embedded in the membrane of an outer membrane vesicle. The SpyTag has covalently bound to a chimera of the SpyCatcher and a cargo protein (model structure of SP1690) through the formation of an isopeptide bond between the SpyTag and the SpyCatcher. The protein structures were generated using PyMOL.

[0047] FIG. 2. Ligation of OMVs displaying SpyTag using increasing amounts of SpyCatcher-SnoopCatcher (SpC-SnC). (A) SDS-PAGE/Coomassie staining analysis of reaction mixes of OMVs harbouring HbpD(d1)-SpT and SpC-SnC incubated for 21 h at 4 C. Reactant proteins, the adduct and the major outer membrane protein OmpA are indicated on the right-hand side of the panel. The sizes of the molecular weight markers are indicated on the left side of the panel. (B) Quantification of ligation efficiency to HbpD(d1)-SpT. The intensities of the adduct and HbpD(d1)-SpT in the gel shown in panel A were determined by densitometry. The percentage of HbpD(d1)-SpT ligated with SpyCatcher-SnoopCatcher is plotted as a function of the molar ratio SpyCatcher-SnoopCatcher:HbpD(d1)-SpT.

[0048] FIG. 3. Ligation to OMVs displaying various Tag and Catcher moieties. Protein ligation of soluble model proteins to OMVs harbouring HbpD(d1) fusions containing SpyCatcher (SpC), SnoopCatcher (SnC), SpyTag (SpT), SnoopTag (SnT) or KTag (KT) was tested (lanes 1-6). The soluble model proteins used are indicated on the left side of the /+matrix. Ligation of soluble protein partners independent of the OMV context was tested for comparison (lanes 7-9). Reaction mixes were incubated for 24 h at 4 C. and analysed by SDS-PAGE with Coomassie staining. Reactant proteins are indicated with dots in the image and on the right-hand side of the panel (H, HbpD(d1) fusion; M, SpT/SnT-MBP; G, SnT-mEGFP-SpT; CC, SpC-SnC; S, SUMO-KT; L, SpyLigase), adducts are indicated with arrowheads. The ligation efficiencies (percentage of HbpD[d1] or SpT/SnT-MBP converted) are shown below the lanes. The sizes of the molecular weight markers are indicated on the left side of the panel.

[0049] FIG. 4. Spy-ligation of pneumococcal antigens to OMVs. OMVs harbouring HbpD(d1)-SpT were mixed with a 5- to 10-fold molar excess of SpC-PspA-SnT (), SpC-SP1690-SnT (1690) or SpC-PspA-SP1690-SNT (-1690). The reaction mixes were incubated for 24 h at 4 C. and analysed by SDS-PAGE with Coomassie staining. Reactant proteins are indicated on the right-hand side of the panel. Adducts are indicated with arrowheads. The sizes of the molecular weight markers are indicated on the left side of the figure.

[0050] FIG. 5. Adduct extension by alternating Spy-ligation and Snoop-ligation. OMVs harbouring HbpD(d1)-SpT were mixed with a 1.5-fold molar excess of SpC-PspA-SnT and incubated for 2 h at 4 C. Subsequently a similar amount of SnC-SP1690-SpT was added. After 2 h at 4 C. again the same amount of SpC-PspA-SnT was added and after another 2 h at 4 C. same amount of SnC-SP1690-SpT was added. Finally, the mix was incubated for a further 15 h at 4 C. to allow completion of the reaction. The OMVs and suspending buffer were separated by centrifugation. After centrifugation the supernatant (ligationsol) and the pellet fraction (ligationOMV) and were analysed by SDS-PAGE with Coomassie staining (A, lanes 4 and 5 respectively). (B) Immunoblotting analysis of OMV pellet fraction after ligation and reference OMVs as described under A. Monoclonal antibodies were used for immunodetection of the HA-tag in SpC-PspA-SnT and of the FLAG-tag in SnC-SP1690-SpT. The adducts are indicated with arrowheads (HbpD-P, HbpD(d1)-SpT-SpC-PspA-SnT; HbpD-P-S, HbpD(d1)-SpT-SpC-PspA-SnT-SnC-SP1690-SpT; HbpD-P-S-P, HbpD(d1)-SpT-SpC-PspA-SnT-SnC-SP1690-SpT-SpC-PspA-SnT). The sizes of the molecular weight markers are indicated on the left side of the panels.

[0051] FIG. 6. Binding of GFP to bacterial cells upon ligation and display of a GFP nanobody. (A) S. Typhimurium cells expressing HbpD(d1)-SpT were incubated with GFPnb-SpC or with the unreactive GFPnb-SpC EQ for 60 min at 25 C. The cells were subsequently incubated for 5 min at 4 C. in the presence of GFP and analysed by SDS-PAGE with Coomassie staining (A). HbpD(d1)-SpT is indicated on the right hand side of the panel, the adduct is indicated with an arrowhead. The sizes of the molecular weight markers are indicated on the left side of the panel. (B) Fluorescence microscopy analysis of cells produced under A. Phase-contrast images (upper panels) and the corresponding fluorescence images (lower panels) are shown. The lower right panel, showing the fluorescence of the cells incubated with GFPnb-SpC EQ, is split into two parts. In the upper left half the contrast is enhanced to visualize the weak fluorescence signal (autofluorescence of the cells), while the lower right half shows the (absence of) signal at the same settings as the left panel.

[0052] FIG. 7. Analysis of OMVs and purified proteins by SDS-PAGE with Coomassie staining. A) S. Typhimurium derived OMVs harboring HbpD(d1)-SpyCatcher (SpC), -SnoopCatcher (SnC), -SpyTag (SpT), -SnoopTag (SnT) or Ktag (KT). The HbpD(d1) variants and the major outer membrane proteins OmpA, OmpC and OmpF are indicated on the right-hand side of the panel. B) SUMO-KTag (S-KT), SnoopTag-mEGFP-SpyTag (GFP), SpyLigase (SpL), SpyCatcher-SnoopCatcher (SpC-SnC), SpyTag-MBP (SpT-MBP) and SnoopTag-MBP (SnT-MBP) as purified from E. coli BL21 (DE3) cells. The sizes of the molecular weight markers are indicated on the left side of the panels.

[0053] FIG. 8. Surface exposure analysis of HbpD(d1) fusion proteins carrying Tag and Catcher moieties. The exposure of the HbpD(d1) fusion proteins containing SpyCatcher (SpC), SnoopCatcher (SnC), SpyTag (SpT), SnoopTag (SnT) or KTag (KT) on the exterior surface of the OMVs was analysed by Proteinase K treatment. OMVs were diluted in 50 mM Tris.Cl, pH 7.5, 1 mM CaCl.sub.2to obtain a concentration of approximately 2 pmol of HbpD(d1) fusion protein per L. The suspension was split into three aliquots. To one aliquot Triton X-100 was added to a concentration of 1% to dissolve the OMVs. After incubating all aliquots on ice for 15 min, Proteinase K was added (0.1 mg/mL final concentration) to the dissolved membranes and to one of the other two aliquots. After 30 min of incubation at 37 C., PMSF was added to 0.2 mM. The reaction was stopped by the addition of phenylmethanesulfonylfluoride (PMSF) to 0.2 mM and incubation on ice for 10 min. The samples were analysed by SDS-PAGE with Coomassie staining. Successful exposure of HbpD(d1) fusion proteins follows from their degradation upon treatment of OMVs with Proteinase K. A Proteinase K sensitive intracellular loop of OmpA is not accessible under these conditions, unless the OMVs were dissolved with Triton X-100 first, indicating that OMVs remained intact throughout the procedure. Full-length HbpD(d1) fusion proteins, OmpA and Proteinase K, as well as degradation products of the HbpD(d1) fusion proteins (1) and of OmpA (2) are indicated on the right side of the panel. The sizes of the molecular weight markers are indicated on the left.

[0054] FIG. 9. Presence of the Hiss-tag in the HbpD(d1)-SpT-SpC-GFPnb adduct. S. Typhimurium SL3261 toIRA derived OMVs harbouring HbpD(d1)-SpT were incubated with GFPnb-SpC or with the unreactive GFPnb-SpC EQ for 60 min at 25 C. and analysed by SDS-PAGE followed by Coomassie staining (A) or by electroblotting onto a nitrocellulose membrane, Ponceau S staining and immunodetection using anti-polyHistidine antibody (B). The C-terminal Hiss-tag of GFPnb-SpC was detected in HbpD(d1)-SpT-SpC-GFPnb. HbpD(d1)-SpT and the adduct are indicated on the right-hand side of the panels. The sizes of the molecular weight markers are indicated on the left.

[0055] FIG. 10. Adduct extension by alternating Spy-ligation and Snoop-ligation in the absence of OMVs harboring HbpD(d1)-SpT. Equimolar amounts of SpC-PspA-SnT and SnC-SP1690-SpT were mixed and incubated for 2 hours at 25 C. The reaction mix and the purified proteins separately were analyzed by SDS-PAGE with Coomassie staining. For comparison, to show the similarity, the sol sample of FIG. 5A is shown in lane 4. The sol sample is the supernatant after centrifugation of the reaction mix containing OMVs harboring HbpD(d1)-SpT and SpC-PspA-SnT and SnC-SP1690-SpT (for details see FIG. 5A). The sizes of the molecular weight markers are indicated on the left.

[0056] FIG. 11. Coupling of rat antibody to the surface of bacterial cells or OMVs harboring HbpD(d1)-SpC. (A) cartoon of anti-mouse CD180 antibody comprising heavy chain Fc domains carrying a SpyTag at the extreme C-terminus. (B) SDS-PAGE analysis of cells displaying SL3261toIRAHbpD(d1)-SpC before addition of aCD180-SpT (lane 1), of the crude SL3261,6,to/RA-HbpD(d1)-SpC+CD180-SpT mix (lane 2) and pellet (p) and supernatant (s) after centrifugation (lanes 3 and 4) and PBS washing (lanes 5 and 6). Molecular weight markers (kDa) are indicated at the left side of the panel. (C) SDS-PAGE analysis of OMVs of SL3261 toIRA-HbpD(d1)-SpC before addition of CD180-SpT of CD180-SpT (lane 1). Samples of the crude SL3261toIRA-HbpD(d1)-SpC OMVs+CD180-SpT mix (lane 2) and pellet (p) and supernatant (s) after centrifugation (lanes 3 and 4) and Salt washing (lanes 5 and 6) were analyzed in parallel by Coomassie stained SDS-PAGE. Molecular weight markers (kDa) are indicated at the left side of the panel.

[0057] FIG. 12. Median Fluorescence intensity per HeLa cell. Mammalian HeLa cells expressing murine CD180 (Hela/CD180) were incubated with bacterial cells harboring SL3261toIRA-HbpD(d1)-SpC carrying covalently coupled CD180-SpT. HeLa cells not expressing murine CD180 (HeLa) were used as a control. The HeLa cells, grown on IBIDI microscopy slides, were incubated with various loads of SL3261toIRA-HbpD(d1)-SpC-CD180-SpT (multiplicity of infection, MOI: 5000, 500, 50 or 5) (2 h, 37 C., 8% CO.sub.2).

[0058] FIG. 13. Coupling of Catcher-equipped model proteins to Tag sequences inserted at position d2 and d4 of HbpD. (A) Schematic representation of wild-type Hbp lacking the autocatalytic cleavage site (HbpD) and Hbp fusion proteins carrying a SpyTag (SpT; flanked by GSGSS and GSGSG linkers), a SpyTag with extended linkers (EL.SpT; flanked by GSGSSGSASG and GEGTGGSGSG linkers), or a SnoopTag (SnT; flanked by GSGSS and GSGSG linkers) at either position d2 (HbpD(d2)) or d4 (HbpD(d4) of the passenger domain. (B) SDS-PAGE/Coomassie blue analysis of covalent coupling of the model protein comprising a SpyCatcher-SnoopCatcher fusion (SpC-SnC) to OMVs displaying the respective HbpD variants on the surface. The adduct (>) corresponds with a covalent fusion product between the (EL.)SpT-carrying HbpD-variants and the SpyCatcher containing model protein. (C) SDS-PAGE/Coomassie blue analysis of covalent coupling of the model protein comprising a SpyCatcher-SnoopCatcher fusion (SpC-SnC) to OMVs displaying HbpD(d2)-SnT. The adduct (*) corresponds with a covalent fusion product between the SnT-carrying HbpD-variant and the SnoopCatcher containing model protein.

[0059] FIG. 14. Improved display of a complex protein using isopeptide bonding technology (A) Swissmodel (https://swissmodel.expasy.org/interactive) structure of S. pneumoniae TIGR4 antigen SP1690 (UniProt KB A0A0H2URB7). (B). SDS-PAGE and Coomassie blue staining analysis of S. Typhimurium SL3261toIRA OMVs displaying HbpD(d1), HbpD-SP1690-F1-F2 or HbpD-SP1690-F3-F4. (C) SDS-PAGE and Coomassie blue staining analysis of coupling of SP1690 carrying an N-terminal SpyCatcher (SpC-SP1690-SnT) to S. Typhimurium SL3261toIRA OMVs displaying HbpD(d1) equipped with an N-terminal SpyTag (HbpD(d1)-SpT). Molecular weight markers (kDa) are indicated at the left side of the panels. Bands corresponding with endogenous Salmonella outer membrane proteins (OMPs) are indicated. Of note, the folding state of bacterial OMPs is known to be sensitive to subtle changes in SDS concentration and heat encountered during SDS-PAGE analysis (Burgess et al; J Biol Chem. 2008 Sep. 26;283(39):26748-58). This explains the varying migration behaviors of the indicated OMPs in panels B and C, respectively.

[0060] FIG. 15. Coupling of an adhesin to the surface of Gram-negative bacteria. SDS-PAGE and Coomassie blue staining analysis of E. coli TOP10F cells displaying HbpD(d1) with a SpyTag (HbpD(d1)-SpT) following incubation in the absence () or the presence (+) of FimH.sub.L equipped with a SpyCatcher (FimH.sub.L-SpC).

EXAMPLES

General Methods and Material

[0061] Strains. E. coli BL21(DE3), S. Typhimurium SL3261 (Hoiseth et al. 1981 Nature 291(5812): 238-9) and the isogenic SL3261 toIRA (Daleke-Schermerhorn et al 2014, supra) were grown in Lysogeny Broth (LB; 10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl).

[0062] S. Typhimurium SL3261 toIRA AmsbB (Kuipers et al. 2017 Infect Immun 85(10)) was grown in TYMC (10 g/L tryptone, 5 g/L yeast extract, 2 mM MgSO.sub.4, 2 mM CaCl.sub.2). The growth medium was supplemented with 0.2% of glucose. Where appropriate antibiotics were added to the following concentrations: ampicillin, 100 g/mL; kanamycin, 50 g/mL; chloramphenicol 30 g/mL. Unless stated otherwise cultures were incubated at 37 C. with shaking.

[0063] Construction of expression plasmids: pET28a SpyCatcher-SnoopCatcher, pET28a-SpyTagMBP, pET28a SnoopTag-MBP, pET28a SnoopTag-mEGFP-SpyTag, pET28a SUMO-KTag and pDEST14 SpyLigase were obtained from Addgene. Table 1 gives an overview of the expression plasmids used in the examples. DNA primers which have been used are listed in Table 2.

TABLE-US-00001 TABLE 1 Overview of the plasmids used in the examples. His.sub.6 Name Protein expressed tag* Reference pET28a SpyCatcher- SpyCatcher-SnoopCatcher fusion linked via a L9 N Veggiani et al. SnoopCatcher alpha-helix linker supra, Addgene #72324 pET28a-SpyTagMBP SpyTag-MBP N Zakeri et al. supra, Addgene #35050 pET28a SnoopTag-MBP SnoopTag-MBP N Veggiani et al. supra, Addgene #72323 pET28a SnoopTag- SnoopTag-mEGFP-SpyTag N Veggiani et al. mEGFP-SpyTag supra, Addgene #72325 pET28a SUMO-KTag SUMO-KTag N Fierer et al. supra, Addgene #51723 pDEST14 SpyLigase SpyLigase N Fierer et al. supra, Addgene #51722 pHbpD(d1)-SpT Hbp display platform with the SpyTag at the site of this work domain 1 (amino-terminus) pHbpD(d1)-SnT Hbp display platform with the SnoopTag at the site this work of domain 1 (amino-terminus) pHbpD(d1)-SpC Hbp display platform with the SpyCatcher at the this work site of domain 1 (amino-terminus) pHbpD(d1)-SnC Hbp display platform with the SnoopCatcher at the this work site of domain 1 (amino-terminus) pHbpD(d1)-KT Hbp display platform with the KTag at the site of this work domain 1 (amino-terminus) pET22b GFPnb PelB signal sequence (PelBss)-GFP-binding C Kubala et al. nanobody (GFPnb) supra pET22b GFPnb-SpC PelBss-GFPnb-SpyCatcher fusion C this work pET22b GFPnb-SpC EQ PelBss-GFPnb fused to SpyCatcher E77Q mutant C this work (E77 is a key residue for isopeptide bond formation) pET22b GFPnb-SpT PelBss-GFPnb-SpyTag fusion C this work pET22b GFPnb-SnT PelBss-GFPnb-SnoopTag fusion C this work pET28 SpC-PspA-SnT SpyCatcher-HA-PspA.sub.32-244-SnoopTag C this work pET28 SnC-PspA-SpT SnoopCatcher-FLAG-PspA.sub.32-244-SpyTag C this work pET28 SpC-SP1690-SnT SpyCatcher-HA-SP1690-SnoopTag C this work pET28 SnC-SP1690-SpT SnoopCatcher-FLAG-SP1690-SpyTag C this work pET20b GFP-His6 GFP-His.sub.6 C kind gift from J. W. de Gier pET22b FimH.sub.L-SpC PelBss-FimH.sub.L-SpyCatcher C This work pcDNA3.3 CD180.sub.Hc CD180 heavy chain-SortaseTag-SpyTag Gift C. Kuijl pcDNA3.3 CD180.sub.Lc CD180 light chain Gift C. Kuijl pHbpD(d2)-SnT Hbp display platform with the SnoopTag at the site This work of domain 2 pHbpD(d2)-SpT Hbp display platform with the SpyTag at the site of This work domain 2 pHbpD(d4)-SpT Hbp display platform with the SpyTag at the site of This work domain 4 pHbpD(d2)-EL.SpT Hbp display platform with the SpyTag at the site of This work domain 2, flanked by extended linkers pHbpD(d4)-EL.SpT Hbp display platform with the SpyTag at the site of This work domain 4, flanked by extended linkers *N, His.sub.6-tag on the amino-terminus; C, His.sub.6-tag on the carboxy-terminus

[0064] To construct pHbpD(d1)-SpC, a SpyCatcher-encoding fragment was amplified by PCR using pET28a-SpyCatcher-SnoopCatcher as a template and the primers SpyCat fw and SpyCat rv. Using the In-Fusion method (Clontech), the resulting fragment was cloned into Sacl/BamHI digested pHbpD(d1)-Ag85B, a derivative of pHbpD(d1)-ESAT6 carrying mycobacterial ag85B between the SacI/BamHI restriction sites (Jong et al. 2012 supra). This yielded pHbpD(d1)-SpC. The same strategy was followed for construction of pEH3-HbpD(d1)-SnC but now the primers used were SnoopCat fw and SnoopCat rv.

[0065] For construction of pHbpD(d1)-SpT, a PCR fragment was generated encoding a fusion product between an N-terminal segment of Hbp and a down-stream SpyTag. Plasmid pEH3-Hbp (Jong et al. 2007 supra) was the template and the primers used were pEH_Xba_InFu fw and Hbp-SpyTag rv. The product was cloned into the XbaI/BamHI sites of pHbpD(d1)-Ag85B using In-Fusion methodology to yield pHbpD(d1)-SpT. The same strategy was used to create pHbpD(d1)-KT but now using the primer pair pEH_Xba_InFu fw and Hbp-KTag rv. To construct pHbpD(d1)-SnT, a SnoopTag-encoding fragment was generated by annealing the long oligo's SnoopTag S/B fw and SnoopTag S/B rv. The resulting product was ligated into the Sacl/BamH sites of pHbpD(d1)-Ag85B, yielding pHbpD(d1)-SnT. The same annealed oligo product was ligated into the SacI/BamH sites of pHbpD(d2)-ESAT6 (Jong et al., Microb Cell Fact. 2012 Jun 18;11:85) to yield pHbpD(d2)-SnT. To construct pHbpD(d2)-SpT and pHbpD(d4)-SpT, a SpyTagencoding fragment was generated by annealing the long oligo's SpyTag S/B fw and SpyTag S/B rv. The resulting fragment was ligated into the SacI/BamHI sites of pHbpD(d2)-ESAT6 and pHbpD(d4in) (Jong et al., Microb Cell Fact. 2014 Nov. 25;13:162), yielding pHbpD(d2)-SpT and pHbpD(d4)-SpT, respectively. To construct pHbpD(d2)-EL.SpT and pHbpD(d4)-EL.SpT the same strategy was followed using the long primers EL.SpyTag S/B fw and EL.SpyTag S/B rv.

[0066] pET22b GFPnb (kind gift from Hansjorg Gotzke, Center for Biomembrane Research, Department of Biochemistry and Biophysics, Stockholm University, Stockholm, Sweden).

[0067] pET22b GFPnb-SpC: the gene encoding a GFP-nanobody (GFPnb) was PCR amplified from pET22b GFPnb using primers ACYC Duet UP1 and GFPnb rv. The SpyCatcher-encoding sequence was PCR amplified from pET28a SpyCatcher-SnoopCatcher using primers SpyC fw and SpyC rv introducing a carboxy-terminal Hiss-tag. After overlap PCR the GFPnb-SpC sequence was cloned XbaI-HindIII into pET22b (Novagen) yielding pET22b GFPnb-SpC.

[0068] pET22b GFPnb-SpC EQ: The E77Q codon mutation was introduced by PCR amplification from pET28a SpyCatcher-SnoopCatcher using either primers SpyC fw and SpyC EQ rv or SpyC EQ fw and SpyC rv followed by overlap PCR using both PCR products. The final product was cloned KpnI-HindIII into pET22b GFPnb-SpC, replacing SpC, yielding pET22b GFPnb-SpC EQ.

[0069] pET22b GFPnb-SpT and pET22b GFPnb-SnT: Oligonucleotides SpT-H6 us and SpT-H6 Is or SnT-H6 us and SnT-H6 Is were mixed at 0.25 mM concentration in 100 mM potassium acetate, 30 mM HEPES, pH7.5, heated to 100 C. and allowed to gradually cool down to ambient temperature. The annealed oligonucleotides were cloned into KpnI-HindIII opened pET22b GFPnb-SpC yielding pET22b GFPnb-SpT and pET22b GFPnb-SnT respectively.

[0070] pcDNA3.3 CD180.sub.HC and pcDNA3.3 CD180.sub.LC: a synthetic DNA fragment was obtained (IDT) encoding the heavy chain of mouse CD180-directed rat IgG2a antibodies carrying a SortaseTag and a SpyTag at the C-terminus (SEQ ID NO: 27). Similarly, a synthetic DNA fragment was obtained (IDT) encoding the light chain of mouse CD180-directed rat IgG2a antibodies. To allow antibody production according to the method by Vink et al. (Methods. 2014 Jan. 1;65(1):5-10), both fragments were ligated under control of a CMV promoter into a derivative of mammalian expression vector pcDNA3.3, yielding pcDNA3.3 CD180.sub.HC and pcDNA3.3 CD180.sub.LC, respectively.

[0071] pcDNA3.3 CD180.sub.LC: a synthetic DNA fragment was obtained (IDT) encoding the light chain of mouse CD180-directed rat IgG2a antibodies. To allow antibody production according to method by Vink et al. (Methods. 2014 Jan. 1;65(1):5-10), the fragment was ligated into mammalian expression vector pcDNA3.3, yielding pcDNA3.3 CD180.sub.HC.

[0072] pET22b FimH.sub.L-SpC: a synthetic DNA fragment was obtained (IDT) encoding a FimH.sub.L (residues 23-181 of SEQ ID NO: 30). The fragment was ligated into pET22b GFPnb-SpC using In-Fusion cloning, yielding pET22b-FimH.sub.L-SpC, which encodes a translational fusion between PelBss, FimH.sub.L, SpyCatcher and a Hiss tag (SEQ ID NO: 30). pET28 SpC-PspA-SnT, pET28 SnC-PspA-SpT, pET28 SpC-SP1690-SnT and pET28 SnC-SP1690-SpT: The SpyCatcher-encoding sequence was PCR amplified from pET28a SpyCatcher-SnoopCatcher using primers NcoI SpyC fw and EcoRI HA SpyC rv introducing an HA tag. The product was cloned Ncol-EcoRl into pET28a yielding pET28 SpC-HA. Next, a SnoopTag-His6-encoding sequence was PCR amplified from pET22b GFPnb-SnT using primers SalI SpT fw and T7 Terminator. The product was cloned SalI-XhoI into pET28 SpC-HA yielding pET28 SpC-HA-SnT-His.sub.6. The SnoopCatcher-encoding sequence was PCR amplified from pET28a SpyCatcher-SnoopCatcher using primers NcoI SnC fw and EcoRI FLAG SnC rv introducing a FLAG tag. The product was cloned NcoI-EcoRI into pET28a yielding pET28 SnC-FLAG. Next, a SnoopTag-His6-encoding sequence and a SpyTag-His6-encoding sequence were PCR amplified from pET22b GFPnb-SnT and pET22b GFPnb-SpT respectively using primers SalI SpT fw and T7 Terminator. The products were cloned SalI-XhoI into pET28 SpC-HA and pET28 SnC-FLAG yielding pET28 SpC-HA-SnT-His.sub.6 and pET28 SnC-FLAG-SpT-His.sub.6 respectively. Last, DNA encoding amino acids 32-244 of PspA or encoding amino acids 24-445 of SP1690 (both Streptococcus pneumoniae serotype 4 [TIGR4] sequences), were PCR amplified using primers EcoRI TIGR4 fw and SalI TIGR4 rv or EcoRI SP1690 fw and SalI SP1690 rv respectively. The products were cloned EcoRI-SalI into pET28 SpC-HA-SnT-His.sub.6 and pET28 SnC-FLAG-SpT-His.sub.6 yielding pET28 SpC-alpha-SnT, pET28 SnC-alpha-SpT, pET28 SpC-SP1690-SnT and pET28 SnC-SP1690-SpT.

TABLE-US-00002 TABLE2 DNAprimersusedintheexamples. Name 5-3sequence* ACYCDuetUP1 GGATCTCGACGCTCTCCCT GFPnbrv cggtaccaccactacctTTGCTGCTAACGGTAACC SpyCfw gcadcadtggtaccggcGATAGTGCTACCCATATTAAATTCTC SpyCrv GCGGCCGCAAGCTTTTACTAATGATGGTGATGATGATGaccgc tgccAATATGAGCGTCACC SpyCEQfw GAAAATATACATTTGTCcAAACCGCAGC SpyCEQrv GCTGCGGTTTgGACAAATGTATATTTTC SpT-H6us cggcgcccacatcgtgatggtggacgcctacaagccgacgaag ggtagtggtgaaagtggtCATCATCATCACCATCATTAGTAAA SpT-H6ls AGCTTTTACTAATGATGGTGATGATGATGaccactttcaccac tacccttcgtcggcttgtaggcgtccaccatcacgatgtgggc gccggtac SnT-H6us cggcAAACTGGGCGATATTGAATTTATTAAAGTGAACAAAggt agtggtgaaagtggtCATCATCATCACCATCATTAGTAAA SnT-H6ls AGCTTTTACTAATGATGGTGATGATGATGaccactttcaccac taccTTTGTTCACTTTAATAAATTCAATATCGCCCAGTTTgcc ggtac NcolSpyCfw atatatccatgggCGATAGTGCTACCCATATTAAATTCTC EcoRlHASpyCrv atatatgaattcGCCGGACCCCGCATAGTCAGGAACATCGTAT GGGTATCCCGAACCAATATGAGCGTCACCTTTAG SallSpTfw atatatgtcgacggcagcggtggtacc T7Terminator GCTAGTTATTGCTCAGCGG NcolSnCfw atatatccatgggCAAGCCGCTGCGTGG EcoRlFLAGSnCrv atatatgaattccCCGCCGCTACCGCCTTTATCGTCATCATCC TTATAGTCACCGCCGCTACCGCCTTTCGGCGGTATCGG SallSpTfw atatatgtcgacggcagcggtggtacc EcoRlTlGR4fw atatatgaattcGAAGAAAGTCCGCAGGTTG SallTlGR4rv atatatgtcgacGGTGCCATCATCCGG EcoRlSP1690fw atatatgaattcTCAGGAAAAAAAGAAGCTACAACTAGTAC SallSP1690rv atatatgtcgacCTGAACAGCCTCAAATAAATCATTTAATTG SpyCatfw ggaagtcttgcggggagctccGATAGTGCTACCCATATTAAAT TC SpyCatrv taccgctgccggatccAATATGAGCGTCACCTTTAGTtg SnoopCatfw ggaagtcttgcggggagctccAAGCCGCTGCGTGGTGCC SnoopCatrv taccgctgccggatccTTTCGGCGGTATCGGTTCATTG pEH_Xba_lnFufw ttgctaactttctagattacaaaac Hbp-SpyTagrv taccgctgccggatcccttcgtcggcttgtaggcgtccaccat cacgatgtgggcggagctccccgcaagacttc Hbp-KTagrv taccgctgccggatccatcacgttttgagaatttaatatgggt agcggagctccccgcaagacttc SnoopTagS/Bfw CCAAACTGGGCGATATTGAATTTATTAAAGTGAACAAAG SnoopTagS/Brv GATCCTTTGTTCACTTTAATAAATTCAATATCGCCCAGTTTG GAGCT SpyTagS/Bfw CCGCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAGG SpyTagS/Brv GATCCCTTCGTCGGCTTGTAGGCGTCCACCATCACGATGTGGG CGGAGCT EL.SpyTagS/Bfw CCGGCTCGGCTAGCGGTGCCCACATCGTGATGGTGGACGCCTA CAAGCCGACGAAGGGTGAGGGAACCGGCG EL.SpyTagS/Brv GATCCGCCGGTTCCCTCACCCTTCGTCGGCTTGTAGGCGTCCA CCATCACGATGTGGGCACCGCTAGCCGAGCCGGAGCT *Overlapping regions for overlap FOR are underlined; restriction enzyme recognition sites used for cloning are in bold and overhangs used for In-Fusion cloning are in italics; mutagenic nucleotides are in lower case.

TABLE-US-00003 TABLE 3 List of sequences name SEQ ID No Hbp (wild-type) 1 HbpD 2 HbpD(d1) 3 HbpD(d1)-SpT 4 HbpD(d1)-SnT 5 HbpD(d1)-KT 6 HbpD(d1)-SpC 7 HbpD(d1)-SnC 8 HbpD(d2)-SpT 9 HbpD(d2)-EL.SpT 10 HbpD(d2)-SnT 11 HbpD(d4)-SpT 12 HbpD(d4)-EL.SpT 13 SpC-SnC 14 GFPnanobody-SpC 15 GFPnanobody-SpC_EQ 16 SpC-PSpAa-SnT 17 SpC-PspAa-SP1690-SnT 18 SpT-MBP 19 SnT-MBP 20 SnT-EGFP-SpT 21 SUMO-KT 22 SpyLigase 23 SpC-SP1690-SnT 24 SnC-SP1690-SpT 25 GFP-His.sub.6 26 Rat-IgG2A_heavy_chain_constant_region_aCD180-SpT 27 HbpD-SP1690-F1-F2 28 HbpD-SP1790-F3-F4 29 FimH.sub.L-SpC 30 ACYC Duet UP1 31 GFPnb rv 32 SpyC fw 33 SpyC rv 34 SpyC EQ fw 35 SpyC EQ rv 36 SpT-H6 us 37 SpT-H6 Is 38 SnT-H6 us 39 SnT-H6 Is 40 NcoI SpyC fw 41 EcoRI HA SpyC rv 42 SalI SpT fw 43 T7 Terminator 44 NcoI SnC fw 45 EcoRI FLAG SnC rv 46 SalI SpT fw 47 EcoRI TIGR4 fw 48 SalI TIGR4 rv 49 EcoRI SP1690 fw 50 SalI SP1690 rv 51 SpyCat fw 52 SpyCat rv 53 SnoopCat fw 54 SnoopCat rv 55 pEH_Xba_InFu fw 56 Hbp-SpyTag rv 57 Hbp-KTag rv 58 SnoopTag S/B fw 59 SnoopTag S/B rv 60 SpyTag S/B fw 61 SpyTag S/B rv 62 EL.SpyTag S/B fw 63 EL.SpyTag S/B rv 64

[0073] Protein purification cytoplasmic proteins. E. coli BL21 (DE3) cells harboring a pET28 or pDEST14 expression plasmid were grown in LB containing 0.2% glucose and kanamycin to an OD.sub.600 of 0.4-0.5. Protein expression was induced by the addition of isopropyl -D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM and the cells were incubated for a further two hours.

[0074] Subsequently the cells were washed with PBS (pH 7.4) and stored at 20 C. The cells were resuspended in buffer A (50 mM NaPO.sub.4, 300 mM NaCl, pH 7.4) and phenylmethylsulfonyl fluoride (PMSF) was added to a concentration of 125 M. The cells were disrupted by two passages through a One Shot cell disruptor (Constant Systems Ltd.) at 1.2 kbar. Cell debris and membranes were removed by centrifugation at 10,000 g and 293,000 g respectively at 4 C. His.sub.6-tagged proteins were isolated from the cleared lysate using TALON Superflow medium (GE Healthcare Life Sciences) according to the manufacturer's instructions. Eluates were dialyzed overnight at 4 C. against 500 to 1000 volumes of PBS (pH 7.4). After dialysis glycerol was added to 10% and aliquots were stored at 80 C.

[0075] E. coli BL21 (DE3) cells harboring a pET20b GFP-His.sub.6 expression plasmid were grown at 30 C. in LB containing 0.2% glucose and ampicillin to an OD.sub.600 of 0.2-0.3. Protein expression was induced by the addition of IPTG to a final concentration of 0.4 mM and the cells were incubated for a further four hours. GFP-His.sub.6 was purified from the cells as described above.

[0076] Protein purification periplasmic proteins. A procedure based on that described by Pardon et al. in Nature Protocols was used..sup.38 E. coli BL21 (DE3) cells harboring a pET22b GFPnb-SpC or pET22b GFPnb-SpC EQ expression plasmid were grown in LB containing 0.2% glucose and ampicillin to an OD.sub.600 of 0.8-0.9. Both fusion proteins were equipped with a cleavable PeIB signal sequence for translocation into the periplasmic space. Isolation of the GFPnb-SpC fusions from the oxidizing periplasmic environment allowed formation of an intramolecular disulphide bond ensuring nanobody functionality. Protein expression was induced by the addition of IPTG to a final concentration of 0.5 mM and the cells were incubated for a further 20 hours at 12 C. with shaking. The cells were harvested by centrifugation and stored at 20 C. The cells were resuspended in PBS (pH 7.4) and incubated for 30 min at 21 C. in a Thermomixer (Eppendorf) at 1400 rpm. Next, the cells were removed by centrifugation (10,000 g) and the His.sub.6-tagged proteins were isolated as described above (Protein purification cytoplasmic proteins).

[0077] OMV isolation. S. Typhimurium SL3261 toIRA cells harboring the HbpD(d1) expression plasmid were grown in LB containing glucose and kanamycin to an OD.sub.600 of 0.2-0.3. Protein expression was induced by the addition of IPTG to a final concentration of 0.1 mM and the cells were incubated for a further two hours. Cells were removed by two successive centrifugation steps at 5000 g. OMVs were isolated from the second supernatant by centrifugation at 235,000 g, resuspended in PBS (pH 7.4) containing 15% glycerol and stored at 80 C. The same strategy was followed for the production of OMVs from S. Typhimurium SL3261 toIRA cells harboring plasmids for the expression of HbpD(d2)-SpT, HbpD(d2)-EL.SpT HbpD(d2)-SnT HbpD(d4)-SpT and HbpD(d4)-EL.SpT, HbpD(d1)-SpC, HbpD(d1)-SnT, HbpD(d1)-SnC and HbpD(d1)-KT.

[0078] Alternatively, in view of future therapeutic purposes, OMVs were isolated from S. Typhimurium SL3261 toIRA msbB cells harboring the pHbpD(d1)-SpT expression plasmid. These cells were grown at 30 C. in TYMC containing glucose and kanamycin. Fresh medium containing 1 mM of IPTG was inoculated to an OD.sub.600 of 0.02 and incubated at 30 C., shaking, for 17 hours. Cells were removed by two successive centrifugation steps at 5000 g. The supernatant was passed through 0.45 m pore size filters (Millipore) and centrifuged at 235,000 g for 75 min to sediment the OMVs. The vesicles were resuspended in PBS (pH 7.4) containing 15% glycerol.

[0079] Spy-ligation with OMVs containing Hbp(d1)-SpT and increasing amounts of SpC-SnC. To OMVs (isolated from S. Typhimurium SL3261 toIRA cells) containing approximately 62 pmol of Hbp(d1)-SpT purified SpC-SnC was added in the ratios indicated in FIG. 2A. The mixes were supplemented with PBS (pH 7.4) to reach a final volume of 20 L. After 21 hours of incubation at 4 C. the reaction mixes were analyzed by SDS-PAGE with Coomassie staining.

[0080] Protein ligation with Hbp(d1)-SpC, -SnC, -SpT, -SnT or -KT in OMVs. To OMVs (isolated from S. Typhimurium SL3261 toIRA cells) containing approximately 200 pmol of Hbp(d1)-SpC, -SnC, -SpT, -SnT or KT a 2-fold molar excess of purified SnT-mEGFP-SpT, SpC-SnC, or SUMO-KT was added (for the specific combinations see FIG. 3). Where appropriate, 800 pmol of purified SpyLigase was added and the mixes were supplemented with PBS (pH 7.4) to reach a final volume of 50 L. After 24 hours of incubation at 4 C. the reaction mixes were analyzed by SDS-PAGE with Coomassie staining.

[0081] Spy-ligation of antigens to Hbp in OMVs. To 500 L of OMVs (isolated from S. Typhimurium SL3261 toIRA msbB cells) containing HbpD(d1)-SpyTag, obtained from a 1000 OD.sub.600 equivalent (OD.sub.600mL) of cell culture 900 L of purified SpC-PspA-SnT (140 M), SpC-SP1690-SnT (176 M) or SpC-PspA-SP1690-SnT (72 M), was added and incubated for 24 h at 4 C. The reaction mixes were analyzed by SDS-PAGE with Coomassie staining and with immunodetection after western blotting. For immunodetection anti-polyHistidine antibody (H1029, Sigma) was used. Using similar strategy Spy- and Snoop ligation was achieved of the model fusion protein SpyCatcher-SnoopCatcher (Spc-SnC) to S. Typhimurium SL3261 toIRA OMVs displaying HbpD(d2)- or HbpD(d4)-variants, respectively, carrying either a SpyTag (SpT), SpyTag with extended linkers (EL.SpT), or a SnoopTag (SnT). In these cases OMVs obtained from a 1 OD.sub.600 equivalent (OD.sub.600mL) of cell culture were incubated with 15.47 M of Spc-SnC in a total reaction volume of 50 l.

[0082] Adduct extension by alternating Spy-ligation and Snoop-ligation. To 100 L of OMVs (isolated from S. Typhimurium SL3261 toIRA cells) containing HbpD(d1)-SpyTag, obtained from a 100 OD.sub.600 equivalent (OD.sub.600mL) of cell culture 80 L of purified SpC-PspA-SnT (86 M) was added. After two hours of incubation at 4 C., 120 L of purified SnC-SP1690-SpT (57 M) was added. After two hours of incubation at 4 C. another 80 L of purified SpC-PspA-SnT. After a further two hours of incubation at 4 C. another 120 L of purified SnC-SP1690-SpT was added and the mix was incubated for 15 h at 4 C. The OMVs were isolated by centrifugation at 293,000 g for 45 min at 4 C. The OMVs were resuspended in PBS (pH 7.4) containing 15% glycerol and analyzed by SDS-PAGE with Coomassie staining and with immunodetection after western blotting. For immunodetection monoclonal anti-FLAG M2 antibody (F3165, Sigma), HA-tag monoclonal antibody (2-2.2.14) (ThermoFisher Scientific) and anti-polyHistidine antibody (H1029, Sigma) were used.

[0083] Spy-ligation of GFPnb-SpC to Hbp in cells. S. Typhimurium SL3261 cells harboring pHbpD(d1)-SpyTag were grown in LB containing 0.4% glucose and chloramphenicol to an OD.sub.600 of 0.3-0.4. Protein expression was induced by the addition of IPTG to a final concentration of 1 mM and the cells were incubated for a further two hours. Subsequently the cells were harvested, resuspended to an OD.sub.600 of 10 in PBS (pH 7.4) containing 3 M of GFPnb-SpC or GFPnb-SpC EQ and incubated for 60 min at 25 C. in a Thermomixer (Eppendorf) at 1000 rpm. After incubation with the nanobody-SpyCatcher protein the cells were resuspended to an OD.sub.600 of 10 in PBS (pH 7.4) containing 3 M of GFP and incubated at 4 C. for 5 min. Last, the cells were resuspended to an OD.sub.600 of 10 in PBS (pH 7.4) and analyzed by SDS-PAGE with Coomassie staining and microscopy.

[0084] Spy-ligation of GFPnb-SpC to Hbp in OMVs. 1 L of OMVs containing HbpD(d1)-SpyTag, obtained from a 1 OD.sub.600 equivalent (OD.sub.600mL) of cell culture, were diluted in 100 L of PBS (pH 7.4) containing 3 M of GFPnb-SpC or GFPnb-SpC EQ. The mixes were incubated for 60 min at 25 C. in a Thermomixer (Eppendorf) at 1000 rpm and analyzed by SDS-PAGE with Coomassie staining and with immunodetection after western blotting. For immunodetection anti-polyHistidine antibody (H1029, Sigma) was used.

[0085] Spy-ligation of FimH.sub.L to Hbp on E. coli cells. To allow coupling, 1.0 OD.sub.660 unit of E. coli TOP10F cell material displaying HbpD(d1)-SpT was incubated overnight with 50 g of FimH.sub.L-SpC at 4 C. Successful coupling was assessed by SDS-PAGE/Coomassie staining analysis.

[0086] Spy-ligation of CD180 to Hbp on OMVs. To couple SpyTagged anti-mouse CD180 (CD180-SpT) to bacterial cells, 2 OD.sub.660 units of Salmonella SL3261AtoIRA cells expressing HbpD(d1)-SpC at the surface were overnight incubated with 200 l of CD180-SpT (0.5 mg/ml) at 4 C.). Next day, to separate cell-coupled and non-coupled material, the mixture was centrifuged at low speed (5,000 rpm, 5 min) and the bacterial pellet and supernatant fraction were recovered. Subsequently, the bacterial pellet was resuspended in PBS to wash off loosely associated material. The cell suspension was subjected to low speed centrifugation (5,000 rpm, 5 min) and the bacterial pellet and supernatant were recovered. Coupling of CD180-SpT to HbpD(d1)-SpC was analyzed by Coomassie stained SDS-PAGE.

[0087] Quantitation of ligation efficiency. After SDS-PAGE proteins and staining Coomassie Brilliant Blue G250 gels were scanned on a GS-800 Calibrated Densitometer (BioRad). The intensities of protein bands were determined using ImageJ (http://imagej.nih.gove/ij/). After correction for the difference in molecular weight the fractions of Hbp (unmodified and ligated) were calculated.

[0088] Microscopy. Cells were photographed using an F-View II CCD camera (Olympus) mounted on a BH2 microscope with a RFCA fluorescence attachment using a DApo100UV PL 1.30 oil 160/0.17 objective and a GFP fluorescence filter cube (BP495/DM505) (Olympus). Image files were processed using ImageJ (http://imagej.nih.gov/ij/).

Example 1

Spy- and Snoop-Ligation to Hbp on the Surface of OMVs

[0089] The E. coli Hemoglobin protease (Hbp) was used as a carrier. The autocatalytic cleavage site was mutated to create an Hbp carrier that is displayed at the cell surface rather than being released, providing permanent exposure of fused antigens at some distance of the cell surface.

[0090] As host for the Hbp antigen display carrier an attenuated Salmonella Typhimurium strain was used that provokes strong mucosal and systemic responses of both cellular and humoral nature (Jong et al (2014) supra; Hoiseth et al. (1981) supra; Moreno et al. 2010 Curr Gene Ther 10(1): 56-76). Furthermore, as an alternative non-living platform, we have explored OMVs derived from the same strain. To increase the production of OMVs a toIRA derivative of the attenuated S. Typhimurium strain was used.

[0091] To investigate the suitability of the SpyCatcher/SpyTag system for ligation of proteins to Hbp fixed on the surface of OMVs, we fused the SpyTag (SpT) to the N-terminus of the Hbp display construct HbpD(d1) (FIG. 1A). In our experience, this position in Hbp is the most tolerant towards fusion of heterologous sequences. To test display in the context of OMVs, the fusion construct was expressed in the hypervesiculating S. Typhimurium toIRA strain and OMVs were collected by ultracentrifugation. As expected, the small (13 aa long) tag did not impede expression and surface display of Hbp (FIG. 2A, compare lane 1 and 8 and FIG. 8, lanes 7-9 providing a density of the SpyTag at the OMV surface that is similar to the major outer membrane protein OmpA. Importantly, the SpyTag is located at the tip of the -helical stem structure of Hbp providing considerable distance to the membrane surface and consequent accessibility towards cognate coupling partners.

[0092] As proof of concept for Spy-mediated ligation, OMVs decorated with HbpD(d1)-SpT (SEQ ID NO: 4) were incubated with purified SpyCatcher-SnoopCatcher hybrid protein (SpC-SnC, FIG. 1B) (SEQ ID NO: 14) in incremental molar ratios and subsequently the samples were analyzed by SDS-PAGE and total protein staining. An adduct with an electrophoretic mobility corresponding to that expected of the HbpD(d1)-SpT-SpyCatcher-SnoopCatcher ligation product, 145.7 kDa, appeared at the expense of HbpD(d1)-SpT (FIG. 2A, lanes 2-7). In a control reaction containing OMVs displaying the carrier HbpD(d1) without a SpyTag (SEQ ID NO: 3) this ligation product was not detected (FIG. 2A, lanes 8 and 9). The amount of unligated and ligated Hbp protein was determined by densitometric scanning. Saturation of coupling, at a maximum of 85% of the Hbp molecules ligated, was reached at an approximate 4-fold molar excess of cargo protein relative to the Hbp carrier (FIG. 2B). This level of ligation efficiency comes close to the levels observed upon co-incubation of purified cognate ligation partners (e.g. FIG. 3, lanes 7 and 8). These results indicate that the SpyTag fused to displayed Hbp is well accessible for coupling at the surface of OMVs.

[0093] To investigate if the Spy and Snoop ligation systems are more generally compatible with the Hbp display platform, the SpyCatcher (SpC), KTag (KT), SnoopCatcher (SnC) and SnoopTag (SnT) were also individually introduced at the N-terminus of the Hbp display construct HbpD(d1) (SEQ ID NO: 7; SEQ ID NO: 6; SEQ ID NO: 8; and SEQ ID NO: 5, resp) and expressed on OMVs. All fusion proteins were present in the OMV fraction in a density similar to the major OMPs (FIG. 7). For all fusion proteins, protease accessibility experiments confirmed their localization at the cell surface indicating that the Tags and Catchers did not impede translocation of Hbp across the cell envelope (FIG. 8). To further substantiate surface localization and suitability for ligation of cognate partner proteins, ligation tests were carried out. OMVs decorated with the Hbp fusion proteins (FIG. 7A) were incubated with purified recombinant proteins that were used by Howarth and co-workers (FIG. 11B) as tools to demonstrate bipartite and tripartite ligation: SpyCatcher-SnoopCatcher (SEQ ID NO: 14), SpyTag-MBP (SEQ ID NO: 19), SnoopTag-MBP (SEQ ID NO: 20), SnoopTag-mEGFP-SpyTag (SEQ ID NO: 21), SUMO-KTag (SEQ ID NO: 22) and SpyLigase (SEQ ID NO: 23) (Veggiani et al. 2016 supra; Zackeri et al. 2012 supra; Feirer et al. 2014 supra). Summarizing, in the context of OMVs the highest efficiency of display of ligated product was obtained with the HbpD(d1)-SpT construct (FIG. 3, lane 3).

[0094] Comparing the display efficiencies of (bipartite) ligated adducts, the constructs rank HbpD(d1)-SpT> HbpD(d1)-SpC>HbpD(d1)-SnT>HbpD(d1)-SnC (FIG. 3, lanes 1-4). Apparently, the 10.0 kDa SpyCatcher and the 12.6 kDa SnoopCatcher had no major impact on the display of the Hbp carrier and folded into their catalytic structure at the OMV surface enabling binding to Spy or Snoop-tagged partner proteins.

[0095] In tripartite ligation the SpyCatcher domain is further split up in the so-called KTag harboring the lysine residue that is part of the isopeptide bond and the larger catalytic SpyLigase domain. The isolated SpyLigase is able to couple a KTagged protein and a SpyTagged protein in trans expanding the potential applications of this technology (Fierer et al. 2014 supra). In contrast to the bipartite system, the tripartite system did not yield any appreciable ligation product in the OMV context (FIG. 3, lanes 5 and 6). To verify the activity of the SpyLigase used, purified SUMO-KTag and SpT-MBP were shown to be coupled upon co-incubation, though not very efficiently (FIG. 3, lane 9).

Example 2

Ligation of Antigens to Hbp

[0096] Encouraged by the efficient enzymatic coupling of the various cargo proteins in Example 1 to surface-exposed Hbp using Spy/Snoop technology, this approach was tested for the decoration of OMVs with complex antigens. As proof of concept, coupling of the large N-terminal 12-domain (213 amino acid, 24.4 kDa, further referred to here as the PspA -domain) of the surface exposed pneumococcal PspA antigen (from strain TIGR4) to OMVs pre-decorated with Hbp using Spy technology was explored. Previously, efficient display required splitting up the PspA -domain and incorporating the two resulting fragments at different sites in Hbp (HbpD-PspA[1-2]) (Kuipers et al. 2015 supra). Yet, the highest achievable concentration of HbpD-PspA[1-2] in OMVs was still only one third of that of antigen-free HbpD. For coupling we fused the SpyCatcher to the complete PspA -domain. For purposes described in the next section we further included an HA-tag and a SnoopTag at the C-terminus of the fusion construct (FIG. 1C, SpC-PspA-SnT; SEQ ID NO: 17). Incubation of S. Typhimurium OMVs decorated with HbpD(d1)-SpT (SEQ ID NO: 4) with a 10-fold molar excess of SpC-PspA-SnT (SEQ ID NO: 17) resulted in efficient (85%) ligation as judged by SDS-PAGE analysis (FIG. 4, lane 2). For further proof of principle we followed the same strategy using the conserved pneumococcal antigen SP1690 (WO/2008/127094). SP1690 is a 47.3 kDa component of an ABC-type oligosaccharide transport system belonging to the type 2 periplasmic-binding fold superfamily (Marchler-Bauer et al. 2017 Nucl Acid Res 45(D1): D200-D203). Initial attempts to display intact SP1690 as a fusion to Hbp were unsuccessful necessitating the splitting of SP1690 in four fragments that were inserted in two Hbp carriers (two fragments per carrier). However, even upon splitting, only moderate amounts of SP190 were displayed at the surface (data not shown). For Spy-ligation we created a fusion protein of SpyCatcher and full-length SP1690 (only omitting the N-terminal Cys residue that is most likely acylated in the native protein as predicted from its lipoprotein-like signal peptide) (Juncker et al. 2003 Proten Science: a publication of the Protein Society, 12(8):1652-62). A FLAG-tag and a SnoopTag were included at the C-terminus of the fusion construct (FIG. 1C, SpC-SP1690-SnT; SEQ ID NO: 24). Similar to SpC-PspA-SnT, efficient (85% coupling) was observed upon incubation with OMVs decorated with HbpD(d1)-SpT (FIG. 4, lane 3). A further increase in complexity of the fusion partner was achieved by fusing the complete PspA domain and full-length SP1690 in one construct. The resultant 87 kDa bivalent antigen (SEQ ID NO: 18) was coupled through Spy technology to Hbp-decorated OMVs at equally high efficiency (FIG. 4, lane 4).

[0097] Together the data indicate that large complex antigens and even chimeras of complex antigens can be displayed at high density the combined Hbp and Spy technologies. By combining the Hbp display technology with protein ligation via isopeptide bond formation, such as the Spyand Snoop Catcher/Tag technology, antigens and even chimeras of complex antigens can be displayed at high density on the surface of bacterial cells and OMVs.

Example 3

Ligation of Multiple Antigens to Hbp

[0098] The combined use of the Spy and Snoop ligation systems was investigated to see whether they allow a more attractive iterative approach to couple multiple antigens to the Hbp platform while maintaining high antigen concentrations per OMV. First, HbpD-PspA formed by the ligation of SpC-PspA-SnT (SEQ ID NO: 17) to HbpD(d1)-SpT (SEQ ID NO: 4) was tested to see whether it could be further extended by adding SP1690 fused to SnoopCatcher. To allow subsequent coupling of purified SpC-PspA-SnT, the SP1690 fusion protein also contained a SpyTag at its C-terminus (SEQ ID NO: 25). A similar iterative extension approach was shown by Veggiani et al. to efficiently polymerize affibodies into multimeric chains (Veggiani et al. 2016 supra). Importantly, the process was started with an affibody fused to a SpyCatcher immobilized on a solid support. Subsequently the material was incubated with affibody containing both a SpyTag and a SnoopTag at the N- and C-terminus, respectively. After the unreacted affibody was washed away the material was incubated with a SpyCatcher-SnoopCatcher chimera to extend the chain. By iterating this process chains of affibodies were formed. Since immobilizing and washing the OMVs is technically more challenging we explored the principle of the strategy in one reaction mix. This approach therefore has the disadvantage that SpC-PspA-SnT and SnC-SP1690-SpT may link to each other, but not to HbpD(d1)-SpT. Moreover, polymers of SpC-PspA-SnT and SnC-SP1690-SpT might cyclize and form unreactive end products that are not linked to the Hbp platform. To limit undesirable product formation OMVs containing HbpD(d1)-SpT were incubated sequentially with SpC-PspA-SnT and SnC-SP1690-SpT in two rounds, followed by centrifugation and analysis of the OMVs and the spent medium by SDS-PAGE. In both fractions a complex pattern of adducts was observed, which likely resulted from polymer formation combined with limited proteolysis (FIG. 5A, lanes 4 and 5).

[0099] Importantly, in the OMV fraction (FIG. 5A, lane 5) three major adducts that probably correspond to single, double and triple ligation events dominate. Omitting the Spy/Snoop-ligation terms from the nomenclature for clarity, these probably represent HbpD-PspA with an expected molecular mass of 157 kDa, HbpD-PspA-SP1690 of 222 kDa and HbpD-PspA-SP1690-PspA of 262 kDa, respectively. The identity of these three adducts was confirmed by immunodetection using anti-HA and anti-FLAG antibodies that recognize the HA- and FLAG epitopes integrated in SpC-PspA-SnT and SnC-SP1690-SpT, respectively (FIG. 5B). Quantification of HbpD(d1)-SpT and the three major adducts (FIG. 5A, lanes 3 and 5) indicated a total ligation efficiency of 85% and a ratio of 5:1:1 (157 kDa/222 kDa/262 kDa) for the adducts. The data thus show that the principle of polymerization worked, and that isopeptide formation can be used for iterative extension of two or more antigens to the Hbp fusion protein.

Example 4

Ligation of Nanobodies to Hbp

[0100] Decoration of bacteria or OMVs with lectins, adhesins or affinity molecule handles, such as antibodies or nanobodies, could be used as a tool for OMV targeting to certain tissues and immune cells, thereby increasing the efficacy of antigen delivery. Nanobodies are particularly attractive for this purpose because of their versatility and ease of recombinant production. They are much smaller (15 kDa) than regular antibodies since they consist only of a single variable domain fragment (V.sub.HH) as found in heavy-chain-only antibodies that occur naturally in camelids and sharks. Previous attempts to incorporate nanobodies in Hbp by gene fusion have met with variable and generally low display efficiencies (data not shown).

[0101] To provide proof of concept for coupling of nanobodies to Hbp on OMVs through Spy technology, we produced a fusion construct in which SpyCatcher and a GFP-specific nanobody (GFPnb; Kubala et al 2010, supra) are connected through a flexible linker to enable independent folding (SEQ ID NO: 15). Sequential incubation of HbpD(d1)-SpT decorated bacteria with purified GFPnb-SpC and GFP should lead to covalent coupling of GFPnb-SpC and binding of GFP provided that GFPnb is correctly folded in the context of the fusion construct. Consequently, the bacteria should get a green coat, which can be visualized by whole cell immunofluorescence. S. Typhimurium cells expressing HbpD(d1)-SpT (SEQ ID NO: 4) were first incubated with GFPnb-SpC (residues 25-245 of SEQ ID NO: 15) to allow coupling, which was confirmed by SDS-PAGE. As expected, an adduct of 140 kDa was detected consistent with the combined mass of Hbp-SpT (117.1 kDa) and GFPnb-SpC (24.2 kDa) (FIG. 6A, lane 1). The cells were harvested and briefly incubated in PBS containing purified GFP (SEQ ID NO: 26). Whole cell immunofluorescence revealed a clear circumferential staining as expected for cells decorated with GFP (FIG. 6B).

[0102] As a control for non-specific interaction of GFP with the bacterial surface in this procedure, the same sequential labelling was carried out using a catalytically inactive SpyCatcher fused to GFPnb (SEQ ID NO: 16). The catalytic Glu77 in SpyCatcher was substituted by a Gln (SpC EQ) which has been shown to abolish covalent bond formation (Zackeri et al. 2012, supra). Using purified GFPnb-SpC EQ (residues 25-245 of SEQ ID NO: 16), the 140 kDa adduct was not detected (FIG. 6A, lane 2) and surface labelling with GFP did not occur (FIG. 6B) confirming the specificity of the labelling procedure. Although GFP labelling is better suited for visualization using whole cells, the GFPnb-SpC coupling step was also shown to occur on the surface of OMVs decorated with Hbp-SpT again depending on the catalytic integrity of the SpyCatcher part of the GFPnb-SpC hybrid (FIG. 9).

[0103] Previously, a nanobody was inserted into Hbp to achieve display, but with limited success (Jong et al., PLoS One. 2018 Feb 7;13(2):e0191622) indicating that the nanobody is largely translocation-incompetent. In contrast, the observed efficient coupling of Catcher-nanobody chimeras to vesicles, shown in this example, will permit for instance targeted drug delivery in tumor tissue (Kijanka et al. 2015 Nanomedicine (London) 10(1): 161-74). For OMV vaccine development it will be interesting to include surface exposed nanobodies that recognize receptors specific for certain dendritic cell types. In this way, specific T-cell responses can be induced towards the presented antigens (Goyvaerts et al. 2015 J Immunol Res 2015:785634).

Example 5

Coupling of a Rat Antibody to the Surface of Bacterial Cells or Outer Membrane Vesicles

[0104] This example illustrates successful and high-density coupling of a rat antibody (anti-mouse CD180) to the surface of bacterial cells or derived OMVs using isopeptide bonding technology. Furthermore, the example shows that the coupled antibodies are functional and, as a consequence, allows targeting of bacterial cells decorated with the antibodies to human cells expressing the antibody ligand.

[0105] To allow coupling of antibodies using isopeptide bonding technology, SpyTagged rat IgG2a antibodies were isolated directed against mouse CD180. To this end, plasmid constructs encoding anti-mouse CD180 antibodies comprising heavy chain Fc domains carrying a SpyTag at the extreme C-terminus (FIG. 11A) (SEQ ID NO: 27) were transfected to mammalian HEK cells and antibodies were produced and isolated as described (Vink et al., Methods. 2014 Jan. 1;65(1):5-10).

[0106] To couple SpyTagged anti-mouse CD180 (CD180-SpT) to bacterial cells, 2 OD.sub.660 units of Salmonella SL3261doIRA cells expressing HbpD(d1)-SpC (SEQ ID NO: 7) at the surface were overnight incubated with 200 l of CD180-SpT (0.5 mg/ml) at 4 C. (crude mix). Next day, to separate cell-coupled and non-coupled material, the mixture was centrifuged (centrifuge.) at low speed (5,000 rpm, 5 min) and the bacterial pellet and supernatant fraction were recovered. Subsequently, the bacterial pellet was resuspended in PBS to wash off loosely associated material (PBS wash). The cell suspension was subjected to low speed centrifugation (5,000 rpm, 5 min) and the bacterial pellet and supernatant were recovered. A sample of SL3261to/RA-HbpD(d1)-SpC before addition of CD180-SpT of CD180-SpT was analyzed by Coomassie stained SDS-PAGE (lane 1). Samples of the crude SL3261doIRA-HbpD(d1)-SpC+CD180-SpT mix (lane 2) and pellet (p) and supernatant (s) after centrifugation (lanes 3 and 4) and PBS washing (lanes 5 and 6) were analyzed in parallel (FIG. 11, B). Molecular weight markers (kDa) are indicated at the left side of the panel.

[0107] The SDS-PAGE analysis shows that CD180-SpT is covalently coupled to the 125 kDa cell surface expressed HbpD(d1)-SpC. This is illustrated by the appearance of a higher molecular weight adduct in the crude mix sample (lane 2), corresponding with a covalent fusion product comprising HbpD(d1)-SpC and the CD180-SpT heavy chain. The appearance of the adduct coincides with the disappearance of non-coupled HbpD(d1)-SpC (c.f. lane 2 and 1). The adduct remains detectable in the bacterial pellet following centrifugation and PBS washing, underscoring the covalent association of CD180-SpT with HbpD(d1)-SpC and association with the bacterial cell. Moreover, a band corresponding with the CD180-SpT light chain remains detectable in the bacterial pellet following centrifugation and PBS washing. The non-covalently associated light chain is dissociated from the coupled HbpD(d1)-SpC CD180-SpT fusion in denaturing conditions analysis, explaining its existence as a separate lower molecular weight protein entity upon SDS-PAGE analysis. Together, the data indicate that complete CD180-SpT antibodies were successfully coupled to cell surface-exposed HbpD(d1) using isopeptide bonding technology.

[0108] To couple SpyTagged anti-mouse CD180 (CD180-SpT) to OMVs, 20 l of Salmonella SL3261toIRA OMVs expressing HbpD(d1)-SpC at the surface, obtained from a 20 OD.sub.600 equivalent (OD.sub.600mL) of cell culture, were overnight incubated with 100 l of CD180-SpT (0.5 mg/ml) at 4 C. (crude mix). Next day, to separate cell-coupled and non-coupled material, the mixture was centrifuged (centrifuge.) at high speed (200.000g, 30 min, 4 C.) and the OMV pellet and supernatant fraction were recovered. Subsequently, the OMV pellet was resuspended in PBS supplemented with 0.5 M NaCl to wash off material associated by electrostatic protein-protein interactions (Salt wash). The OMV suspension was subjected to high speed centrifugation (200.000g, 30 min, 4 C.) and the bacterial pellet and supernatant were recovered. A sample of SL3261toIRA-HbpD(d1)-SpC OMVs before addition of CD180-SpT of CD180-SpT was analyzed by Coomassie stained SDS-PAGE (lane 1). Samples of the crude SL3261toIRA-HbpD(d1)-SpC OMVs +CD180-SpT mix (lane 2) and pellet (p) and supernatant (s) after centrifugation (lanes 3 and 4) and Salt washing (lanes 5 and 6) were analyzed in parallel (FIG. 11). Molecular weight markers (kDa) are indicated at the left side of the panel.

[0109] The SDS-PAGE analysis shows that CD180-SpT is covalently coupled to the 125 kDa HbpD(d1)-SpC expressed at the surface of OMVs. This is illustrated by the appearance of a higher molecular weight adduct in the crude mix sample (lane 2), corresponding with a covalent fusion product comprising HbpD(d1)-SpC and the CD180-SpT heavy chain. The appearance of the adduct coincides with the disappearance of non-coupled HbpD(d1)-SpC (c.f. lane 2 and 1). The adduct remains detectable in the OMV pellet following centrifugation and Salt wash, underscoring the covalent association of CD180-SpT with HbpD(d1)-SpC and association with the OMV particle. Moreover, a band corresponding with the CD180-SpT light chain remains detectable in the OMV pellet following centrifugation and Salt washing. Together, the data indicate that complete CD180-SpT antibodies were successfully coupled to HbpD(d1) at the OMV surface using isopeptide bonding technology.

[0110] To demonstrate the functionality of surface-coupled CD180-SpT for the targeting of bacterial antigen delivery platforms to specific ligands, mammalian HeLa cells expressing murine CD180 were incubated with above-described SL3261toIRA-HbpD(d1)-SpC carrying covalently coupled CD180-SpT. HeLa cells not expressing murine CD180 were used as a control. The HeLa cells, grown on IBIDI microscopy slides, were incubated with various loads of SL3261toIRA-HbpD(d1)-SpC-CD180-SpT (multiplicity of infection, MO/: 5000, 500, 50 or 5) (2 h, 37 C., 8% CO.sub.2). Upon incubation, the slides were washed with cell culture medium (DMEM+GlutaMAX, 10% FBS, penicillin/streptavidin) and fixed with 4% PFA in PBS (30 minutes, RT) before immersion into fresh PBS. HeLa cells were permeabilized with PBS+0.1% Triton-X100 (10 minutes, RT) before surface localized and internalized SL3261toIRA-HbpD(d1)-SpC-CD180-SpT were detected by indirect immunofluorescence. In this procedure rabbit polyclonal Hbp (J40) was used as the primary antibody and goat-a-rabbit Alexa 488 as the secondary antibody. Hoechst stain and Phalloidin Alexa 568 were used to stain the DNA and actin content of the HeLa cells, respectively. Post-staining with 0.7% PFA was performed before analysis of the samples at an Olympus IX83 microscope. The median of the green fluorescence intensity per HeLa cell was determined making use of Cell profiler software (FIG. 12).

[0111] The data show significantly enhanced fluorescence intensity for HeLa cells expressing murine CD180 compared to HeLa cells not expressing the protein at MOI 5000 and 500. This result demonstrates that more SL3261toIRA-HbpD(d1)-SpC-CD180-SpT bacteria were localized to the HeLa cells when CD180 was present at the cell surface. In turn, this demonstrates the functionality of CD180-SpT coupled to SL3261toIRA-HbpD(d1)-SpC using isopeptide bonding technology. Moreover, the data indicate that covalent coupling of affinity molecule handles such as antibodies to bacterial cells and derived OMVs by isopeptide bonding technology is a valid approach to mediate the targeting of these bacterial cells or derived OMVs to specific ligands, cell types or tissues.

Example 6

Coupling of Catcher-Equipped Model Proteins to Tag Sequences Inserted at Position d2 and d4 of HbpD

[0112] This example illustrates that ligation Tags expressed internally in OMV-surface exposed HbpD are functional for isopeptide bonding of model proteins carrying a cognate Catcher moiety.

[0113] To demonstrate the functionality of internally inserted ligation tags, HbpD variants carrying a SpyTag (SpT; flanked by GSGSS and GSGSG linkers corresponding to residues 534-556 of SEQ ID NO: 9 and residues 760-782 of SEQ ID NO: 12, respectively) or SpyTag with extended linkers (EL.SpT; flanked by GSGSSGSASG and GEGTGGSGSG linkers corresponding to residues 534-566 of SEQ ID NO: 10 and residues 760-792 of SEQ ID NO: 13, respectively) at either position d2 (SEQ ID NO: 9; SEQ ID NO: 10, respectively) or d4 (SEQ ID NO: 12; SEQ ID NO: 13, respectively) of the passenger domain (FIG. 13A) were expressed in Salmonella Typhymurium SL3261toIRA. The resulting OMVs displaying the respective HbpD variants on the surface were harvested and incubated with a model protein comprising a SpyCatcher-SnoopCatcher fusion (SpC-SnC). Along same lines OMVs displaying HbpD carrying SnoopTag (SnT; flanked by GSGSS and GSGSG linkers corresponding to residues 534-555 of SEQ ID NO: 11) at position d2 of the passenger domain (SEQ ID NO: 11) (FIG. 13A) were prepared and incubated with SnoopCatcher-containing model protein. Following overnight incubations at 4 C., OMV-model protein mixtures were subjected to SDS-PAGE/Coomassie analysis to assess covalent coupling of the model protein to the respective HbpD variants. Successful isopeptide bonding of the model protein to internal SpT and EL.SpT inserted at either position d2 or d4 of HbpD was observed (FIG. 13B). This is illustrated by the appearance of a higher molecular weight adduct (>) in the OMV samples upon incubation with the model protein. The adduct corresponds with a covalent fusion product between the (EL.)SpT-carrying HbpD-variants and the SpyCatcher containing model protein. Similarly, successful coupling to SnT inserted at position d2 was observed, as illustrated by the appearance of a higher molecular weight adduct (*) upon incubation of OMVs expressing HbpD(d2)-SnT with SnC-model protein (FIG. 13C).

Example 7

Improved Display of a Complex Protein Using Isopeptide Bonding Technology

[0114] This example illustrates vastly improved display of complex proteins on the OMV surface when using isopeptide technology compared to conventional translational fusion to the passenger of an autotransporter.

[0115] The 47.3-kDa conserved pneumococcal antigen SP1690 is a bulky and complex protein as shown by 3D structural modelling (Swissmodel of S. pneumoniae TIGR4 SP1690; FIG. 14A). Attempts to display intact TIGR4 SP1690 as a translational fusion to the passenger of HbpD were unsuccessful, necessitating the splitting of SP1690 into four fragments F1 (residues 30-130), F2 (residues 161-257), F3 (246-386) and F4 (residues 370-445) that were inserted into the passenger of two separate Hbp carriers (two fragments per carrier). The resulting fusion proteins HbpD-SP1690-F1-F2 (SEQ ID NO: 28) and HbpD-SP1690-F3-F4 (SEQ ID NO: 29) were displayed at the surface of OMVs but only in moderate amounts. This follows from SDS-PAGE/Coomassie analysis of Salmonella Typhimurium SL3161-derived OMVs displaying either HbpD-SP1690-F1-F2 or HbpD-SP1690-F3-F4 showing that both fusions are present in significantly lower amounts than the endogenous outer membrane proteins (OMPs) of the OMVs (FIG. 14B, lanes 2 and 3). In contrast, antigen-less HbpD(Ad1) (SEQ ID NO: 3) expressed in parallel under identical expression conditions (FIG. 14B, lane 1) is detected at a levels vastly exceeding those of the OMPs, indicating that the integration of antigens adversely affects the display capacity of the Hbp platform. In comparison to the translational fusion approach, clearly more favorable results are obtained when isopeptide bonding technology was used to mediate display of SP1690 at the OMV surface. To achieve this, Salmonella Typhimurium SL3161-derived OMVs displaying SpyTagged HbpD variant HbpD(d1)-SpT (SEQ ID NO: 4) at the surface were incubated with purified SP1690 carrying a SpyCatcher moiety (SpC-SP1690-SnT; SEQ ID NO: 24). Following a washing step to remove non-bound SpC-SP1690-SnT, the OMVs were analyzed by SDS-PAGE and Coomassie staining (FIG. 14C). An adduct was detected comprising a covalent fusion between HbpD(d1)-SpT and SpC-SP1690-SnT. The amounts of the adduct detected far exceeded those of the endogenous OMPs and were similar to those of antigen-less HbpD(d1) (FIG. 14B, lane 1).

[0116] These data clearly indicate that an isopeptide bonding approach favorably compares to translational fusion to Hbp because it allows for: 1) high-density display of complex proteins at bacterial-derived surfaces, and 2) surface display of complete complex proteins.

Example 8

Coupling of an Adhesin to the Surface of Gram-Negative Bacteria

[0117] This example illustrates that isopeptide bonding technology can be used to couple adhesins to the surface of Gram-negative bacteria. Furthermore it demonstrates that molecules that are incompatible with surface display upon integration into the autotransporter passengers can be displayed at the Gram-negative bacterial cell surface using isopeptide-bonding technology.

[0118] The fimbrial adhesin FimH is the best characterized adhesin derived from bacteria. FimH is responsible for D-mannose sensitive adhesion, which is mediated by its lectin domain FimH.sub.L. The lectin domain contains two cysteine residues that form a disulphide bond in the bacterial periplasmic space. Integration of the domain into the passenger of an autotransporter can therefore not be used as a strategy to translocate the adhesin domain across at the bacterial cell envelope. As an alternative approach, we used isopeptide bond-mediated coupling to display FimH.sub.L at the surface of Escherichia coli cells. To this end, a chimeric protein was constructed and purified comprising FimH.sub.L, a C-terminally attached SpyCatcher and a HisTag for purification purposes (FimH.sub.L-SpC; residues 23-300 of SEQ ID NO: 30). Furthermore, E. coli TOP10F cells displaying HbpD(d1)-SpT (SEQ ID NO: 4) were prepared. To allow coupling, 1.0 OD660 unit of cell material was incubated overnight with 50 g of FimH.sub.L-SpC at 4 C. Successful coupling was assessed by SDS-PAGE/Coomassie staining analysis of the sample in parallel to a TOP10F/HbpD(d1)-SpT mock sample lacking FimH.sub.L-SpC (FIG. 15).

[0119] Successful covalent coupling of SpyCatchered FimH.sub.L SpyTagged HbpD at the bacterial cell surface was demonstrated by the occurrence of higher molecular weight adduct upon incubation of TOP10F/HbpD(d1)-SpT with FimH.sub.L-SpC, comprising a covalent fusion between the two proteins. As expected, the appearance of the adduct coincides with the disappearance of significant amounts of non-coupled HbpD(d1)-SpT material compared to the situation in which no FimH.sub.L-SpC was added to the cells. As a further control, no higher molecular weight adduct appeared under these latter conditions. Molecular weight markers (kDa) are indicated at the left side of the panel.

Incorporation of Material of ASCII Text Sequence Listing by Reference

[0120] The material in the ASCII text file sequence listing named, DVME1076US_Corrected_Sequence_Listing_ST25 created on Jun. 30, 2020, which is 216 kb in size, is hereby incorporated by reference in its entirety herein.