PROGRAMMABLE SOFT ROBOT
20200377544 ยท 2020-12-03
Inventors
- David H. Gracias (Baltimore, MD, US)
- Thao D. Nguyen (Baltimore, MD, US)
- ChangKyu Yoon (Timonium, MD, US)
- Rebecca B. Schulman (Baltimore, MD, US)
- Angelo Cangialosi (Baltimore, MD, US)
- Ruohong Shi (Baltimore, MD, US)
Cpc classification
B01J2219/00639
PERFORMING OPERATIONS; TRANSPORTING
C12Q1/6834
CHEMISTRY; METALLURGY
B01J2219/00637
PERFORMING OPERATIONS; TRANSPORTING
C07H21/00
CHEMISTRY; METALLURGY
C12Q1/6834
CHEMISTRY; METALLURGY
International classification
C07H21/00
CHEMISTRY; METALLURGY
Abstract
Described are a combinatorial library of DNA molecules that can induce shape changes within specific regions of hydrogels up to centimeter scales. The DNA molecules include polymerizing hairpins, terminating hairpins, reversal strands, and crosslink nucleic acid sequences.
Claims
1. A programmable gel comprising: a first polymer comprising a first crosslink nucleic acid sequence; a second polymer comprising a second crosslink nucleic acid sequence; a first polymerizing hairpin capable of binding to the first crosslink nucleic acid sequence; a second polymerizing hairpin capable of binding to the second crosslink nucleic acid sequence; and a terminating hairpin capable of terminating polymerization.
2. A programmable gel of claim 1 wherein the first crosslink nucleic acid sequence comprises a first stem sequence, a first anchor B sequence, and a first anchor A sequence;
3. The programmable gel of claim 1 wherein the second crosslink nucleic acid sequence comprises a second stem sequence that is complementary to the first stem sequence and the first dock A sequence.
4. The programmable gel of claim 1 wherein the first polymerizing hairpin comprises the first stem sequence and the second stem sequence, a first dock B sequence, a second anchor A sequence that is complementary to the first anchor A sequence and a second dock A sequence that is complementary to the first dock A sequence.
5. The programmable gel of claim 1 wherein the second polymerizing hairpin comprises the first stem sequence, the second stem sequence, a second dock B sequence that is complementary to the first dock B sequence, the first dock A sequence; and the first anchor B sequence.
6. The programmable gel of claim 1 wherein the terminating hairpin comprises the first stem sequence, the second stem sequence, the second dock A sequence, the second anchor A sequence and a terminating sequence.
7. The programmable gel of claim 2 wherein the first stem sequence comprises from 8 to 50 nucleic acid bases.
8. The programmable gel of claim 3 wherein the first dock A sequence comprises up to 10 nucleic acid bases.
9. The programmable gel of claim 4 wherein the first dock B sequence comprises up to 10 nucleic acid bases.
10. The programmable gel of claim 2 wherein the first anchor A sequence comprises up to 10 nucleic acid bases.
11. The programmable gel of claim 2 wherein the anchor B sequence comprises up to 10 nucleic acid bases.
12. A method of making a programmable gel comprising: providing a gel comprising a first polymer comprising a first crosslink nucleic acid sequence; a second polymer comprising a second crosslink nucleic acid sequence wherein the first polymer and the second polymer are crosslinked by the first and second crosslink nucleic acid sequences; and adding a first polymerizing hairpin, a second polymerizing hairpin; and a terminating hairpin to the gel to produce a programmable gel wherein the first and second hairpins attach to each other resulting in gel swelling; wherein a concentration ratio of the first polymerizing hairpin, the second polymerizing hairpin, and terminating hairpins are adjusted prior to addition to gel to control the timing and/or degree of swelling of the programmable gel.
13. A programmable gel of claim 12 wherein the first crosslink nucleic acid sequence comprises a first stem sequence, a first anchor B sequence, and a first anchor A sequence.
14. The programmable gel of claim 12 wherein the second crosslink nucleic acid sequence comprises a second stem sequence that is complementary to the first stem sequence and a first dock A sequence.
15. The programmable gel of claim 12 wherein the first polymerizing hairpin comprises the first stem sequence and a second stem sequence, a first dock B sequence, a second anchor A sequence that is complementary to the first anchor A sequence and a second dock A sequence that is complementary to the first dock A sequence.
16. The programmable gel of claim 12 wherein the second polymerizing hairpin comprises the first stem sequence, the second stem sequence, a second dock B sequence that is complementary to the first dock B sequence, the first dock A sequence; and the first anchor B sequence.
17. The programmable gel of claim 12 wherein the terminating hairpin comprises the first stem sequence, the second stem sequence, the second dock A sequence, the second anchor A sequence and a terminating sequence.
18. An expandable gel comprising: a first polymer comprising a first crosslink nucleic acid sequence; a second polymer comprising a second crosslink nucleic acid sequence; a first polymerizing hairpin capable of binding to the first cross link nucleic acid sequence; and a second polymerizing hairpin capable of binding to the first crosslink nucleic acid sequence.
19. A method of making an expandable gel comprising: providing a gel comprising a first polymer comprising a first crosslink nucleic acid sequence; a second polymer comprising a second crosslink nucleic acid sequence that are crosslinked by the first and second crosslink nucleic acid sequences; adding a first polymerizing hairpin and a second polymerizing hairpin; and forming a expanded gel.
20. A photo patterning process to pattern gels into precisely-defined architectures comprising: providing a surface comprising a sacrificial layer; applying a collection of monomers, a photo-initiator, and a collection of crosslink nucleic acid sequences capable of binding to the monomers; placing a mask on top of the programmable gel wherein the mask is impenetrable by light and comprises one or more shapes wherein light is able to penetrate through the shapes on the mask; applying light to the mask so that light penetrates the shapes on the mask; polymerizing the monomers; binding the cross link nucleic acids to the monomers; forming a collection of polymers comprising attached nucleic acid sequences wherein the nucleic acid sequences crosslink the polymers and the collection of polymers comprises the one or more shapes; removing the mask; adding a ratio of polymerizing hairpins and terminating hairpins; and creating a gel having one or more precisely-defined architectures.
21. The photopatterning process of claim 20 comprising the step of removing the collection of polymers from the surface prior to adding the ratio of polymerizing hairpins and terminating hairpins.
22. A method of making a programmable gel comprising: providing a gel comprising a first polymer comprising a tag; adding a first polymerizing hairpin, a second polymerizing hairpin, and a terminating hairpin to the gel; and producing a programmable gel that is expanding; wherein a concentration ratio of the first polymerizing hairpin, the second polymerizing hairpin, and terminating hairpins are adjusted prior to addition to gel to control the timing and/or degree of swelling of the programmable gel.
23. The method of claim 22 wherein the tag is single stranded nucleic acid.
24. The method of claim 23 wherein the tag is DNA.
25. The method of claim 23 wherein the tag has a tag dock B sequence and a tag anchor A sequence.
26. The programmable gel of claim 25 wherein the first polymerizing hairpin comprises a first stem sequence and a second stem sequence, a first dock B sequence, a second anchor A sequence that is complementary to the first anchor A sequence and a second dock A sequence that is complementary to a first dock A sequence.
27. The programmable gel of claim 26 wherein the first dock B sequence binds to the tag dock B sequence and where the second anchor A sequence binds to the tag anchor A sequence.
28. The programmable gel of claim 27 wherein the second polymerizing hairpin comprises the first stem sequence, the second stem sequence, a second dock B sequence that is complementary to the first dock B sequence, the first dock A sequence; and a first anchor B sequence.
29. The programmable gel of claim 28 wherein the terminating hairpin comprises the first stem sequence, the second stem sequence, the second dock A sequence, the second anchor A sequence and a terminating sequence.
30. A method of making a programmable gel that expands and contracts comprising: providing a gel comprising a first polymer comprising a first crosslink nucleic acid sequence and a second polymer comprising a second crosslink nucleic acid sequence; crosslinking the first polymer and the second polymer by the first and second crosslink nucleic acid sequences and a third crosslinker; adding a first polymerizing hairpin, a second polymerizing hairpin; and a terminating hairpin to the gel; producing a programmable gel that expands; adding a first reversal strand, a second reversal strand; and contracting the gel compared to a reference gel that does not have a first and second reversal strand added.
31. The method of claim 31 wherein a third polymerizing hairpin and fourth polymerizing hairpin are added to the contracted gel and expands the contracted gel forming an expanded contracted gel.
32. The method of claim 31 wherein a third reversal strand and a fourth reversal strand are added to the expanded contracted gel contracting the expanded contracted gel.
33. The method of claim 30 wherein a concentration ratio of the first polymerizing hairpin, the second polymerizing hairpin, the terminating hairpins, the first reversal strand, and the second reversal strand is adjusted prior to addition to gel to control the timing and/or degree of swelling and/or contraction of the gel.
34. The method of claim 30 wherein the first and the second reversal strands is a nucleic acid.
35. The method of claim 34 wherein the nucleic acid is DNA.
36. The method of claim 30 wherein the third crosslink comprises a physical, ionic, chemical, or nucleic acid crosslink.
37. The method of claim 30 wherein the first and second polymerizing hairpins, terminating hairpins, and first and second reversal strands are incapable of interacting with the third crosslinker.
38. The method of claim 30 wherein the first reversal strand interacts with the first polymerizing hairpin and the second reversal strand interacts with the second polymerizing hairpin.
39. A method of gel contraction comprising: providing a gel comprising a first polymer comprising a first crosslink nucleic acid sequence and a second polymer comprising a second crosslink nucleic acid sequence wherein the first polymer and the second polymer are crosslinked by the first and second crosslink nucleic acid sequences and a third crosslinker; a first polymerizing hairpin, a second polymerizing hairpin; and a terminating hairpin; and adding a first and a second reversal strand; contracting the gel when compared to a reference gel that does not have added a first reversal strand and a second reversal strand.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
DETAILED DESCRIPTION OF THE INVENTION
[0105] The inventor's developed wire-free responsive materials by building a library of biomolecules to achieve addressable control, such that each of a combinatorial variety of biomolecular species would direct the swelling of a specific material domain. This is analogous to the way biomolecular stimuli would enable complex sensing, signal processing and feedback within biological cells and tissues.
[0106] If one region of a material shrinks or swells in response to a chemical or physical stimulus, the material can change shape to minimize its overall free energy. The ability to addressably deform different material regions can thus allow a material to take on many shapes. This principle has been used to create metamorphic materials or soft robots in which embedded wires direct local mechanical deformations. However, wires add bulk and require batteries or tethering. Chemomechanically responsive materials, in contrast, swell or shrink in response to chemical rather than electrical or pneumatic signals. Chemicals can diffuse over large distances and into small or tortuous spaces, and the huge number of chemicals that can be synthesized offers unprecedented tunability and specificity. Chemomechanical devices require no batteries and can easily be miniaturized and integrated with other devices.
[0107] Stimuli such as temperature, light, electromagnetic stimuli or pH have been used to direct shape change. These nonspecific stimuli can induce chemical or conformational changes throughout a material, leading to dramatic swelling or shrinking. However, this lack of specificity also means these stimuli cannot produce addressable control comparable to that in wired systems. The inventors asked whether they could build a combinatorial library of biomolecules, such as DNA sequences, where each species would direct the swelling of a specific material domain.
[0108] The inventors focused on hydrogels, crosslinked networks of polymers in water, where structural changes can cause extensive expansion or contraction of the material as a whole. To study biomolecular actuation, the inventors considered DNA-crosslinked polyacrylamide hydrogels (
[0109] Hence, a critical challenge in making DNA triggered shape change hydrogels was to significantly increase the degree of swelling. The inventors postulated that swelling would increase if they lengthened crosslinks successively using a DNA hybridization cascade in which multiple DNA molecules are inserted into a duplex (
[0110] Another challenge to enable addressable control was to reproducibly fabricate well-defined, multi-material DNA hydrogel shapes capable of arbitrary shape change in three dimensions. The inventors thus developed a photolithography process to pattern DNA hydrogels into precisely-defined architectures. While numerous photolithographic processes for silicon-based devices exist, protocols for photopatterning DNA hydrogels are largely absent, and the patterning process presents unique challenges. DNA-crosslinked hydrogels have orders of magnitude lower moduli as compared to silicon or even many polymers (
[0111] The inventors fabricated 0.0611 mm hydrogel squares containing system 1 crosslinks. In the presence of system 1 hairpins, the hydrogels expanded dramatically while the gels in buffer containing an alternate DNA sequence did not expand (
[0112] The inventors thus asked whether hydrogels could reliably expand to a desired final size. The inventors modified the sequences of the polymerizing hairpins to create terminator hairpins (
[0113] The inventors also found we could tune the swelling rate. Thinner films swelled slightly faster, but swelling rates do not appear limited by the diffusion of DNA hairpins (FIG. 10). Increasing the length of one of the toeholds that initiated the hairpin insertion process from 3 to 4 or 6 base pairs sped up expansion more significantly (
[0114] By designing DNA sequences for three more systems of crosslinks and hairpins, we could addressably swell multiple domains (Table 1).
TABLE-US-00001 TABLE1 DNAsequencesofcrosslinkerandhairpinsystems. AllsequenceswereorderedfromIDTintheirlyophilized formandresuspendedwithTAE/Mg.sup.2+.Sequencesforacrydite- modifiedstrandsareprecededwitha/5ACryd/designation. SEQ DNAStrand Sequence IDNO: System1Strands S1-C /5ACryd/TAAGTTCGCTGTGGCACCTGCACG 1 S1-C /5ACryd/CAACGTGCAGGTGCCACAGCGTGG 2 S1-H1 CCACGCTGTGGCACCTGCACGCACCCACGTGCAGGTGCCACAGCGAACTTA 3 S1-H2 TGGGTGCGTGCAGGTGCCACAGCGTAAGTTCGCTGTGGCACCTGCACGTTG 4 S1-H1.sub.T CCACGCTGTGGCACCTGCACGTAGACTCGTGCAGGTGCCACAGCGAACTTA 5 S1-H2.sub.T TGGGTGCGTGCAGGTGCCACAGCGGCCTAGCGCTGTGGCACCTGCACGTTG 6 S1-H1_FAM /56-FAM/CCACGCTGTGGCACCTGCACGCACCCACGTGCAGGTGCCACAG 7 CGAACTTA Control GCTATCTAGCATCGCACGCTCTTTTTTGAGCGTGCGATGCTAGATGCGTAC 8 Hairpin System2Strands S2-C /5ACryd/CTGTCTGCCTACCACTCCGTTGCG 9 S2-C /5ACryd/ATTCGCAACGGAGTGGTAGGCTTT 10 S2-H1 AAAGCCTACCACTCCGTTGCGGAACCTCGCAACGGAGTGGTAGGCAGACAG 11 S2-H2 AGGTTCCGCAACGGAGTGGTAGGCCTGTCTGCCTACCACTCCGTTGCGTTG 12 S2-H1.sub.T AAAGCCTACCACTCCGTTGCGTCAAGCCGCAACGGAGTGGTAGGCAGACAG 13 S2-H2.sub.T AGGTTCCGCAACGGAGTGGTAGGCAATCGTGCCTACCACTCCGTTGCGTTG 14 S2-H1_FAM /56-FAM/AAAGCCTACCACTCCGTTGCGGAACCTCGCAACGGAGTGGTAG 15 GCAGACAG System3Strands S3-C /5ACryd/GGAACTCGGCAGTCGTCCAAGCGA 16 S3-C /5ACryd/ATCTCGCTTGGACGACTGCCGTAT 17 S3-H1 ATACGGCAGTCGTCCAAGCGATACGGCTCGCTTGGACGACTGCCGAGTTCC 18 S3-H2 GCCGTATCGCTTGGACGACTGCCGGGAACTCGGCAGTCGTCCAAGCGAGAT 19 S3-H1.sub.T ATACGGCAGTCGTCCAAGCGACTGAGTTCGCTTGGACGACTGCCGAGTTCC 20 S3-H2.sub.T GCCGTATCGCTTGGACGACTGCCGCAGATCCGGCAGTCGTCCAAGCGAGAT 21 System4Strands S4-C /5ACryd/ATCGGACCAGCACTTCGCCTACGG 22 S4-C /5ACryd/TGACCGTAGGCGAAGTGCTGGATG 23 S4-H1 CATCCAGCACTTCGCCTACGGCTCTACCCGTAGGCGAAGTGCTGGTCCGAT 24 S4-H2 GTAGAGCCGTAGGCGAAGTGCTGGATCGGACCAGCACTTCGCCTACGGTCA 25 S4-H1.sub.T CATCCAGCACTTCGCCTACGGAAGGTGCCGTAGGCGAAGTGCTGGTCCGAT 26 S4-H2.sub.T GTAGAGCCGTAGGCGAAGTGCTGGTGTATGCCAGCACTTCGCCTACGGTCA 27 System1:4BasepairToehold S1_4bp-C /5ACryd/ACAACGTGCAGGTGCCACAGCGTGGA 28 S1_4bp-H1 TCCGCGCTGTGGCACCTGCACGCACCCACGTGCAGGTGCCACAGCGAACTTA 29 S1_4bp-H2 TGGGTGCGTGCAGGTGCCACAGCGTAAGTTCGCTGTGGCACCTGCACGTTGT 30 S1-4bp-H1.sub.T TCCGCGCTGTGGCACCTGCACGAAACGGCGTGCAGGTGCCACAGCGAACTTA 31 S1-4bp-H2.sub.T TGGGTGCGTGCAGGTGCCACAGCGCGACAACGCTGTGGCACCTGCACGTTGT 32 System1:6BasepairToehold S1_6bp-C /5ACryd/GTACAACGTGCAGGTGCCACAGCGTGGATC 33 S1_6bp-H1 GATCCGCGCTGTGGCACCTGCACGCACCCACGTGCAGGTGCCACAGCGAACTTA 34 S1_6bp-H2 TGGGTGCGTGCAGGTGCCACAGCGTAAGTTCGCTGTGGCACCTGCACGTTGTAC 35 S1-6bp-H1.sub.T GATCCGCGCTGTGGCACCTGCACGAAACGGCGTGCAGGTGCCACAGCGAACTTA 36 S1-6bp-H2.sub.T TGGGTGCGTGCAGGTGCCACAGCGGCCTAGCGCTGTGGCACCTGCACGTT 37 3-StrandCrosslinkSystemStrands SA1 ACGGAGGTGTATGCAATGTC 38 SA2 CATGCTTAGGGACGACTGGA 39 L3 TCCAGTCGTCCCTAAGCATGTGTTCGACGGTACAAGAAGAGGGTTACGCT 40 AATGAGTGCTGACATTGCATACACCTCCGTA F1 AGCACTCATTAGCGTAACCCTCTTCTTGTACCGTCGAACAGATAGAGCTG 41
[0115] Hydrogels with each crosslink type swelled extensively in response to their corresponding hairpins but not to others (
[0116] To investigate how to design the shape change of composite multi-domain architectures, the inventors characterized DNA sequence-driven curling of model bilayer beams (
[0117] The inventors applied finite element analysis to study bilayer curving caused by DNA-induced swelling (see a description of Finite Element Analysis provided below). The stress response of the gel was assumed to be the sum of an elastic component for the entropic response of the polymer network, and the solvent pressure acting on the network derived from Flory-Huggins theory. The inventors determined the final shape of a structure after DNA-driven swelling by changing the Flory-Huggins parameter in the DNA- and BIS-crosslinked gel layers to achieve the experimentally measured volumetric swelling ratios within the different layers (
[0118] To set the remaining model parameters, the inventors measured the Young's modulus of a BIS-crosslinked gel via an unconfined compression test as 2.2 kPa (
[0119] The inventors found that the effects of varying DNA gel thickness, modulus, and the degree of swelling (
E.sub.DNA and E.sub.BIS are the Young's modulus (Pa) of the DNA and BIS gels, t.sub.DNA and t.sub.BIS the thickness (mm) of the DNA and BIS gels, and the difference in the volumetric swelling ratio between the DNA and BIS gels. The initial curvature K.sub.0=0.2 mm.sup.1 and proportionality constant C=0.21 were obtained from a linear regression of our simulation results (
[0120] This design rule indicates that curvature is more sensitive to the DNA gel swelling ratio (), with which the curvature varied linearly, than to the shear modulus or thickness of the DNA gel layer. The high degree of swelling was thus essential for extensive shape change. Further, there is an optimum thickness of the DNA gel for which curvature is maximized (
[0121] The inventors next explored how structures with multiple, different DNA sequence-responsive hydrogels would differentially change shape in response to different hairpin inputs. The inventors fabricated flowers where two groups of petals responded to two different sequences (
[0122] Biological tissues demonstrate the versatility and functionality of shape change driven by biomolecules, where different cues and their concentrations determine which responses occur. The inventors have demonstrated how specific biomolecular signals can also determine which domains of a synthetic material should change in shape and by how much. The DNA oligonucleotide signals used could be the outputs or inputs to molecular sensors and circuits. Coupling these circuits to hydrogels could allow materials to exhibit multistage, goal-directed behaviors currently impossible to achieve. Because hairpin insertion and removal can occur without the crosslink breaking, altering the extension reaction's bias could allow crosslink contraction and potentially, reversible actuation. Finally, our wafer-scale patterning approach offers the potential for scale-up and integration with existing optical, logic and memory devices.
Description of Finite Element Analysis:
[0123] Finite Element Model of BIS/DNA Bilayer Actuation Various theoretical hydrogel models have been developed in recent years to explain the coupled mechanical and stimuli-responsive swelling behavior of hydrogels and to support the design of active hydrogel structures. The inventors previously developed a constitutive theory for thermoresponsive hydrogels and showed that it can accurately predict the equilibrium configuration of pNIPAM gels and composite structures in response to a temperature and mechanical stimuli. In their model, the inventors neglected the kinetics of diffusion and assumed that the hydrogel remained in equilibrium throughout the deformation, which was justified by the short diffusion time permitted by micrometer-scale thickness of the bilayer structures.
[0124] For the constitutive model, the inventors first defined a deformation field x=(X), that maps material points X in the initial undeformed dry polymer network configuration to spatial points x in the current deformed hydrogel configuration. The deformation gradient tensor is defined as F=z/X from the initial configuration to the current configuration. To model the stress-free swelling of the gel, the deformation gradient tensor F is further decomposed into a mechanical part, F.sub.e, and a swelling part, F.sub.s:
F=F.sub.eF.sub.s,(1)
where F.sub.s=.sup.1/3I and is the polymer network volume fraction of the hydrogel. The polymer network volume fraction is expressed as =1/(1+vc), where v is the volume per solvent molecule and c is the number of solvent molecules per polymer network volume. Since the gel is initially swollen, the inventors define the swollen undeformed configuration as the reference configuration, and a deformation gradient f mapping from the stress-free reference configuration to the final swollen deformed configuration:
f=.sub.0.sup.1/3F,(2)
where .sub.0 is the polymer network volume fraction in the reference state. The left Cauchy-Green deformation tensor and its first invariant are defined as, b=FF.sup.T and I.sub.b=tr(b). The b tensor can be expressed in terms of its principle values and principle directions as:
b=.sub.i=1.sup.3.sub.i.sup.2.Math.n.sub.i,(3)
and
The inventors assumed that the free energy density of hydrogel could be additively decomposed into a mechanical term arising from the stretching of a polymer network and a term describing the mixing energy of the polymer network and solvent system:
=.sub.mechanical(I.sub.b,J.sub.e)+.sub.mixing().(4)
The quasi-incompressible Neo-Hookean model is used to describe the strain energy of the network (39):
where G and K are the shear modulus and bulk modulus of the polymer network respectively. The Flory-Huggins model (23) is used to express the free energy of mixing:
where R is the gas constant, and is the Flory-Huggins parameter.
[0125] The Cauchy stress tensor is derived from the free energy density as =(1/J)(/F)F.sup.T, and the chemical potential is defined as =/c, where c is the number of solvent molecules per polymer network volume:
The constitutive model was implemented into TAHOE (Sandia National Laboratories) for finite element simulation of hydrogel structures. The shear modulus of the DNA hydrogel was obtained from swelling experiments and finite element analysis of the folding of DNA/BIS hydrogel bilayer beams. For the swelling experiments of DNA/BIS hydrogel bilayer beams, the dimensions in the hydrated state before adding DNA hairpins were l=4.925 mm in contour length and w=0.528 mm in width. The thicknesses of the DNA and BIS layers were t.sub.DNA=60.6 m, t.sub.BIS=71.6 m. The initial bilayer curvature in the hydrated state was measured to be 0.2 mm.sup.1. DNA hairpins were added to the bilayer bars to induce sequence-driven swelling. The average curvature of swollen bilayer bars under equilibrium was measured to be 1.0 mm.sup.1. The dimensions of both layers in equilibrium were also measured and the volumetric swelling ratios of the DNA gel and BIS gel were calculated to be 6.91 and 4.42 respectively. The sequence-induced swelling of the BIS gel was caused by the interpenetration of DNA and BIS gels during the layer-by-layer fabrication process, which was confirmed by confocal imaging.
Finite Element Model of Swelling-Induced Folding of a Hydrogel Bilayer
[0126] For the finite element model of the bilayer beam, the simulation started from the initial hydrated configuration, where the initial curvature of bilayer was 0.2 nm.sup.1 as measured in the experiments. The model geometry had the same dimensions as measured for the fully hydrated photopatterned bilayers (
TABLE-US-00002 TABLE S2 Parameters determined for DNA and BIS hydrogels. for the for the DNA- Parameters G (Pa) hydrated state actuated state DNA gel 229 0.55 0.51 BIS gel 733 0.55 0.51
[0127] The initial polymer network volume fraction coo was obtained by solving equations and with the conditions =0 and =0. The Flory-Huggins interaction parameters were continuously decreased from 0.55 to 0.51, and at each value the deformation gradient field f(X) and polymer network volume fraction (X) were determined by the finite element analysis. The inventors performed the finite element simulations while varying the shear modulus of the DNA gel from 2.29 to 350 Pa, and calculated for each case the equilibrium curvature of the bilayer bar at the equilibrium swelling. The equilibrium curvature of the bilayer was calculated as follows. The deformed positions of the points on the midline of the bilayer inner surface were obtained from the simulation result. The inventors determined the radius of the best fit circle to the points using the method of least squares. The curvature was then calculated by taking the inverse of the radius. The calculated curvature of the bilayer was compared to the curvature of the actuated bilayer measured in experiments to determine the equilibrium shear modulus of the DNA gel. A shear modulus of 229 Pa produced the best fit to the experimentally measured bilayer average curvature at steady state.
Parameter Study
[0128] The inventors applied the model to investigate the effect of the thickness, shear modulus and volumetric swelling ratio of DNA gel on the curvature of folding BIS/DNA gel bilayer bars. The inventors first varied the DNA gel thickness from 13 m to 70 m while keeping the BIS layer thickness of 71.6 m, DNA gel shear modulus of 229 Pa and volumetric swelling ratio of 6.91 unchanged. Next, the inventors kept the DNA gel thickness and volumetric swelling ratio constant at 60.6 m and 6.91, respectively, and adjusted the DNA gel shear modulus from 2.29 to 350 Pa. The inventors then kept the DNA gel thickness of 60.6 m and shear modulus of 229 Pa unchanged, and varied the DNA gel volumetric swelling ratio from 5 to 12. These parameters were varied independently and in each simulation the average equilibrium curvature of actuated DNA/BIS gel bilayer was calculated using the method described in the above section.
Theoretical solutions for the curving of thin film-thick substrate bilayer system have been derived based on the century-old Stoney formula for stresses in the deposited thin film. This formula assumes small strains and rotations, and that the material of each layer is isotropic, homogeneous, and linear elastic. For the case where the thicknesses of each layer are comparable (e.g., t.sub.BISt.sub.DNA), Freund et al. (24) derived the modified Stoney formula for the bilayer curvature, which for an initially flat bilayer can be expressed as, K=2. The bilayer ratio, , is given by,
for the case when the Poisson's ratio is the same in each layer. The E.sub.DNA and E.sub.BIS are the Young's moduli of the DNA and BIS gels (Pa); t.sub.DNA and t.sub.BIS are the thicknesses of DNA and BIS gel layers (mm); and is the difference in the volumetric swelling ratio between the DNA and BIS gels. The modified Stoney formula provided a poor prediction of the simulation results for the curvature of the BIS/DNA gel bilayer, likely because the simulations exhibited large deformation and nonlinear elastic behavior, which violated the assumptions of the theory. However, the inventors found that the simulation results for the curvature change scaled with the bilayer ratio. Plots of the curvature as a function of the bilayer ratio for all cases of the parameter study fell on a straight line of the form K=C+K.sub.0 (
The bilayer ratio depends nonlinearly on the modulus and thickness ratio of the DNA and BIS gels, and depends linearly on the difference in the volumetric swelling ratio.
[0129] The parameter study also showed that the high degree of swelling of the DNA gel should allow millimeter to centimeter sized bilayer structures to achieve a large shape change. For example, we asked whether a 10 mm long flat bilayer beam that was also several millimeters thick (as opposed to 0.1 mm or less as we had studied previously) could fold into a complete circle. The relation obtained from the parameter study was K=0.21+0.2, where 0.2 mm.sup.1 represents the initial curvature of the bilayers in the hydrated state. Using the relation K=0.21 and assuming the 10 mm long bilayer beam was initially flat, the inventors determined that the 10 mm long bilayer with the optimum DNA gel thickness can be as thick as 7.23 mm and still fold into a complete circle for the maximum experimentally measured swelling ratio of 3.720.11.
[0130] For similar DNA-crosslinked polyacrylamide gels, the average molecular weight between crosslinks was measured using diffusion ordered NMR spectroscopy (DOSY) to be roughly 160,000 (Adv. Funct. Mater., 2015, 25 (44), pp 6867-6874), so the inventors anticipate that the molecular weight of the gels or the present invention prior to swelling would be in a similar range. An extensive study of the molecular weight of the gels of the present invention after swelling will be performed using NMR. The inventors' experiments in which they varied the relative concentrations of terminator and polymerizing hairpins suggest bounds on the average number of DNA molecules incorporated at each crosslink. Classic results from polymer chemistry predict that in a reaction where a fraction p of the monomers are terminating or incorporate without allowing for further extension, the average length of the polymer in monomer units will be 1/p. This expected chain length is actually consistent with what we observe in our experiments. Because the DNA is much more rigid than the polyacrylamide, one might guess that the uniaxial change in film size would be proportional to change in the length of the crosslinks. We indeed see that this is the case. We plotted the expected chain length 1/p where p ranges from 0.02 to 0.50.
[0131] The inventors did not use the 0% (or p=0) values for the plot, since, as the inventors mentioned, without terminators the structures did not stop growing, which also supports this interpretation. These predictions suggest that the average polymer size is on order 50 hairpins based on the current experiments with gels actuated in a 2% terminator solution.
[0132] There are many commercial applications of the nucleic-acid directed gel expansion and/or contraction technology of the present invention. Gel contraction technology is further discussed in the section titled, Methods and Examples. Nucleic acid directed expansion of hydrogels, for example, may be used in biological applications such as a part of a stent. When the gel is position within the body or near a tissue of a subject, it may prevent blood flow or cell migration as the gel expands in response to a specific stimulus such as a nucleic acid. The expandable and/or contractable gels may be applied directly to tissue or cells in vitro or in vivo as a gel, patch, or part of a surgical instrument such as a stent or implant, for example. The gels of the present invention may comprise therapeutic agents and be programmed to release these agents such as small molecules, nanoparticles or antibodies upon the gel's expansion and or contraction to a specific stimulus such as a nucleic acid including one or more DNA hairpins or reversal strands. For example, a DNA cross linked hydrogel in the shape of a patch could be use in biological applications including drug release and may be in contact with tissue that is locate inside or outside (such as skin) of a body and could be used to enhance the healing of internal or external wounds. The gels of the present invention may be used to fill in internal wounds such as vascular aneurysms or be used to close surgical wounds by expanding in the presence of signal such as DNA hairpins. The gels of the present invention may alter cell migration, cell invasion, cell signaling based on material mechanics, modulus, pore size or mesh size as the gel expands creating barriers that affect the movement of biological materials. The gels of the present invention are perfectly suitable for directing gel expansion and/or contraction in robot devices providing biological alternatives to using mechanical principles in robotic design. The gels of the present invention can be programmed to orient, align or change the density of molecules or particles embedded within a gel, such as a hydrogel, for chemical or optical applications based on the specific nucleic acid stimulus chosen prior to gel formation. Other applications of the gels of the present invention are described in
[0133] In current practice, aneurysms are often managed by inserting a coil of flexible wire into the aneurysm through an endovascular approach. A hydrogel-based expander of the present invention would be helpful in this context. For example, the hydrogel could be placed in the aneurysm and expanded (by adding DNA hairpins) to fill the aneurysm.
METHODS/EXAMPLES
[0134] The following Methods/Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Methods/Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The following Examples are offered by way of illustration and not by way of limitation.
DNA Sequences and Sequence Design.
[0135] All oligonucleotide sequences are listed in Table 1. The sequences for system 1 crosslinks and polymerizing hairpins, H1 and H2, are based on those used by Venkataraman et al. Oligonucleotides were supplied by Integrated DNA Technologies (IDT) in their lyophilized form. Sequences for all terminating hairpins and the sequences for the crosslinks and hairpins in systems 2-4 were designed using the DNADesign package, available at: www.dna.caltech.edu/DNAdesign/. This program produces sequences with the necessary complementarity to form the desired secondary structures, while minimizing other potential interactions.
Preparation of DNA-Crosslinked and N, N-Methylenebisacrylamide (BIS)-Crosslinked Pregel Solutions.
[0136] Both sets of gels were prepared by UV-initiated, free radical copolymerization of acrylamide along with either N, N-methylenebisacrylamide (BIS) or a DNA duplex as the crosslinker (Fig. S1). To enable its copolymerization with acrylamide, the pre-annealed DNA duplex crosslinker contained oligonucleotides modified at the 5 end with an acrydite moiety. For the DNA pregel solution, stock solutions of the crosslink strands A and R (which contain acrydite modifications), or the crosslink strands for the corresponding system, were first prepared by resuspending lyophilized DNA samples to a final concentration of approximately 25 mM in TAE buffer (40 mM tris-acetate, 1 mM EDTA) that had been previously diluted from 50 stock (Life Technologies, Catalog #24710-030) and supplemented with 12.5 mM magnesium acetate tetrahydrate (Sigma #228648), herein referred to as TAE/Mg.sup.2+. Oligonucleotide concentrations were verified by absorbance spectroscopy at 260 nm. To prepare the DNA copolymer gel, referred to as poly(Am-co-DNA), to the crosslink strands were added TAE/Mg.sup.2+ buffer supplemented with calcium chloride (Sigma #C1016)herein referred to as TAE/Mg.sup.2+/Ca.sup.2+and MilliQ water. The calcium chloride was added to prevent premature dissolution of the poly(acrylic acid) (PAA) sacrificial layer. This solution was then annealed by incubating the solution at 90 C. for five minutes, followed by cooling the solution from 90 C. to 20 C. at 1 C. per minute to allow crosslinks to hybridize. Immediately before photopolymerization, acrylamide (Bio-Rad Catalog #161-0100), Irgacure 2100 (Ciba), and, if applicable, methacryloxyethyl thiocarbamoyl rhodamine B (Polysciences, Inc., catalog #23591) were added to the solution. In cases where the gels were stained with SYBR Green I nucleic acid stain (Invitrogen catalog #S7563), the rhodamine B monomer was omitted. The solution was then mixed via pipet and degassed under vacuum for 5 minutes to minimize the effect of 02 on radical chain polymerization. The final concentrations of all pregel components are as follows: 1.154 mM of strands A and R, 1TAE/Mg.sup.2+ buffer, 11.1 mM calcium chloride, 1.41 M acrylamide, 3 vol % of Irgacure 2100, and, if applicable, 2.74 mM methacrylated rhodamine B.
The BIS-crosslinked gel solutions were prepared by mixing MilliQ water, TAE/Mg.sup.2+/Ca.sup.2+ buffer, 40% (w/v) 19:1 Am:BIS (BioRad Laboratories, Inc., catalog #1610144), 50% (v/v) Irgacure 2100 in 1-butanol, and, if applicable, 50 mM fluorescein-O-methacrylate (Sigma, catalog #568864) into a test tube. The final concentrations of TAE/Mg.sup.2+ buffer, and calcium chloride are the same as in the poly(Am-co-DNA) pregel solution. The final concentrations of the other species are as follows: 5% (w/v) of 19:1 Am:BIS, 1.5% (v/v) Irgacure 2100, and, if applicable, 2.74 mM fluorescein-O-methacrylate. The BIS and acrylamide pregel solution was then mixed and degassed following the same protocol of the DNA pregel solution.
Photolithography Chamber Preparation.
[0137] The photolithography chambers were prepared according to a previously published protocol. The bottom glass slide served as a substrate onto which the hydrogel samples adhered after photopatterning, while the top slide served as a chromium (Cr) photomask to selectively expose regions of the pregel solution to ultraviolet (UV) light and initiate radical chain polymerization. The top slide of the photolithography chamber was prepared by spin coating SC 1827 (Microposit 51800 Series) on a clean glass slide at 3500 rpm for 3 minutes, followed by baking at 115 C. for 60 seconds. The coated slides were irradiated with a 317 mJ/cm.sup.2 dose of 365 nm UV light through film masks designed using AutoCAD and printed by Fineline Imaging. After UV exposure, the glass slides were developed with a 1:10 (w/w) solution of Microposit 351 Developer (Shipley) and DI water, and were dried with N.sub.2 gas. Next, a 200 nm layer of Cr was deposited on the glass slide by physical vapor deposition (PVD), after which the slides were consecutively rinsed with acetone and isopropyl alcohol, and were dried under N.sub.2 gas to remove the unexposed regions of 1827 positive photoresist. Once prepared, the Cr mask was spin-coated with CYTOP (Type M, Bellex International Corp.) at 4000 rpm and baked at 90 C. for 2 hours to ensure evaporation of the organic solvent. The CYTOP-coated chromium mask prevented the DNA gel from sticking to the mask and allowed for minimal edge roughness.
[0138] The bottom slides of the photolithography chamber (Catalog #16004-424, VWR) were prepared by sonicating them in 10% (w/w) NaOH for 30 minutes, rinsing them with MilliQ water, and drying under N.sub.2 gas. The bottom slide was then treated with 02 plasma for 5 minutes to fully oxidize the glass surface. Next, a single layer of polyimide tape (60 m thick) was placed along the width of the glass slide to act as a spacer. For thinner hydrogels, aluminum foil (14 m thick) was used as a spacer. A roughly 200 nm thick layer of 5% (w/w) PAA crosslinked with calcium was then deposited onto the substrate according to a previously reported protocol. Additional washing (3 min in DI water) and baking steps (5 min at 150 C.) were added to the protocol to remove calcium salt deposits present on the substrate after crosslinking the PAA in a solution of CaCl.sub.2. The final photolithography chamber was assembled by clipping the top Cr mask and bottom PAA-covered substrate together with binder clips (Office Depot). The chrome layer of the mask faced inward and came into direct contact with the pregel solution.
Photopatterning of Poly(am-Co-DNA) Monolayer and Poly(am-Co-BIS)/Poly(am-Co-DNA) Bilayers.
[0139] To photopattern DNA hydrogel monolayers, the DNA pregel solution was injected via pipet into the photolithography chamber. The chamber was then exposed to 365 nm UV light (Neutronix Quintel aligner) for a total light dose of 240 mJ/cm.sup.2 as determined by multiplying the measured UV intensity (Vari-Wave II, 365 nm sensor; Quintel) by the exposure time. The chamber was then gently disassembled and 1 mL of 1M NaCl was aliquoted onto the substrate to dissolve the PAA sacrificial layer and yield freestanding samples. The monolayers were then placed into a PDMS-coated polystyrene dish to which approximately 2 mL of TAE/Mg.sup.2+ was added.
[0140] To prepare the first hydrogel layer of a bilayer structure, the previous photopatterning protocol was followed using Am-co-BIS-co-fluorescein pregel solution except that after UV exposure the substrate was washed with approximately 200 L of TAE/Mg.sup.2+/Ca.sup.2+ to remove unreacted pregel solution from the patterned structures. The UV dose for all BIS-crosslinked hydrogel structures is approximately 280 mJ/cm.sup.2. The first gel layer was then allowed to dry at room temperature for approximately 20 minutes. The second layer of the hydrogel bilayer structures was fabricated using Am-co-DNA-co-rhodamine pregel solution. Prior to photopatterning, another layer of polyimide tape was placed on the substrate and the second Cr mask was then aligned with the first gel layer using a mask aligner. After satisfactory alignment was achieved, the Am-co-DNA-co-rhodamine solution was injected via pipet into the photolithography chamber and exposed to UV light for a total dose of 240 mJ/cm.sup.2. At this point, when the bilayer bar structures were fabricated, the chamber was gently disassembled and approximately 1 mL of 1M NaCl was aliquoted onto the substrate to dissolve the sacrificial layer and yield freestanding bilayer bar structures (
Quantifying the DNA-Driven Expansion and Shape Change of Poly(am-Co-DNA) Hydrogels.
[0141] To measure the rate of expansion and final uniaxial swelling rate of poly(Am-co-DNA) hydrogels driven by DNA polymerization, Am-co-DNA pregel solution was prepared as previously described, without methacryloxyethyl thiocarbamoyl rhodamine B, and gels were patterned into either 60 m or 14 m thick, 11 mm square shapes using appropriate photomasks. After fabrication, the DNA gels were stained overnight in a solution of 2 SYBR Green (Invitrogen catalog #S7563) and TAE/Mg.sup.2+ buffer. The SYBR staining solution was then removed and the samples were washed several times with TAE/Mg.sup.2+ buffer. After the last washes, 2 mL of fresh TAE/Mg.sup.2+ was added to the Petri dish.
[0142] All DNA hairpin monomers were supplied by IDT in their lyophilized form, and were resuspended to a final concentration of 2 mM in TAE/Mg.sup.2+ buffer. All swelling and actuation experiments contained a final hairpin concentration (polymerizing hairpin monomer plus terminator hairpin monomer) of 20 M. Prior to adding the hairpin solution to the DNA gel samples, the hairpin monomers were snap-cooled in order to remove any aggregates or polymers that may have formed by heating oligonucleotide solutions at 95 C. for at least five minutes, followed by cooling on ice for 2 minutes. Next, the hairpin solution was gently added via syringe so as not to disturb the gel samples. Swelling was recorded via time-lapse fluorescence imaging using a gel imager (Syngene EF2 G:Box) equipped with a blue light transilluminator (Clare Chemical, emission max 450 nm) and a UV032 filter (Syngene, bandpass 572-630 nm). Images were captured in 20 minute intervals until a steady-state was reached or the gels were no longer visible. The uniaxial swelling ratio of the samples was measured manually in either MATLAB or ImageJ. Fluorescent micrographs in
The volumetric swelling ratios of the BIS and DNA gels were measured by immersing 12 bilayers in DNA-free buffer and imaging bilayers using Nikon AZ100 multi-zoom epifluorescence microscope and Zeiss AxioObserver Yokogawa CSU-X1 spinning disc confocal microscope. Some of the bilayers lain on their sides, which allowed us to image them top-down and others side-on (see the figure below). We measured the contour lengths, widths and thicknesses of the BIS and DNA layers of all the bilayers before and after adding DNA hairpins (20 M solution composed of 98% polymerizing monomers and 2% terminating monomers) and averaged the values. The average volumetric swelling ratio was calculated by dividing the volume of the gels after and before adding DNA hairpins.
[0143] Images of bilayer structures, flowers and crab structures were captured using a Nikon AZ100 multi-zoom epifluorescence microscope equipped with a Nikon DS-Fi1 camera. Fluorescent images of poly(Am-co-DNA-co-rhodamine) gel samples were captured using a Nikon B-2E/C filter cube (excitation 465-495 nm, bandpass emission filter 515-555 nm), whereas images for poly(Am-co-BIS-co-fluorescein) samples were captured using a Nikon G-2E/C filter cube (excitation filter 528-553 nm, bandpass emission filter 590-650 nm). Domains with different crosslink sequences patterned in different sequence steps were false colored in the fluorescent micrographs in
SEM Imaging of Poly(Am-co-DNA) Hydrogels.
[0144] Two 5 mm5 mm hydrogel samples, each 600 m thick, were fabricated by photopolymerization within a PDMS micromold. The pregel solutions were prepared as previously described without methacryloxyethyl thiocarbamoyl rhodamine B. Prior to photopolymerization the PDMS mold was treated with air plasma for five minutes using a surface corona treater (Electro-Technic Products, model BD-20). The pregel solution was then aliquoted into sample wells of the PDMS mold and exposed to 365 nm UV light (Neutronix Quintel aligner) at an intensity of 7.55 mW/cm.sup.2 and dose of 680 mJ/cm.sup.2 to ensure complete curing of the pregel solution. The samples were then gently excised from the mold and placed into separate Petri dishes containing 2 mL of fresh TAE/Mg.sup.2+ buffer. The gels were allowed to swell overnight to equilibrium via solvent uptake. To one DNA gel sample was added two 500 L hairpin solutions, each containing 117.6 M of the regular hairpin monomer and 2.4 M of the respective terminator hairpin (e.g., 117.6 M H1 and 2.4 M H1.sub.T) for a final concentration of 19.6 M and 0.4 M of the polymerizing hairpin monomer and terminator monomer, respectively. One milliliter of TAE/Mg.sup.+2 was added to the other sample as a control. The two samples were left out at room temperature for two weeks, at which point the swelling solution was removed and the gels were frozen in liquid nitrogen for five minutes. The gel samples were then lyophilized for 24 hours to fully remove the swelling solution (Labconco, Freezone Benchtop Freeze Dry System, Catalog #7382021).
Additional Sequences
[0145]
TABLE-US-00003 System5Strands DNA SEQ STRAND SEQUENCE IDNO: S5_10BP-C /5Acryd/CTCTATCTATCCATCACCCTCA 42 CCTTAC S5-C /5Acryd/GGTGTAAGGTGAGGGTGATGGT 43 AA S5_10BP-H1 TTACCATCACCCTCACCTTACTTGTAGATT 44 GGTAAGGTGAGGGTGATGGATAGATAGAG S5_10BP-H2 CAATCTACAAGTAAGGTGAGGGTGATGGCT 45 CTATCTATCCATCACCCTCACCTTACACC S5_8BP-H1 TTACCATCACCCTCACCTTACTTGTAGATG 46 TAAGGTGAGGGTGATGGATAGATAG S5_8BP-H2 ATCTACAAGTAAGGTGAGGGTGATGGCTAT 47 CTATCCATCACCCTCACCTTACACC S5_6BP-H1 TTACCATCACCCTCACCTTACTTGTAGGTA 48 AGGTGAGGGTGATGGATAGAT S5_6BP-H2 CTACAAGTAAGGTGAGGGTGATGGATCTAT 49 CCATCACCCTCACCTTACACC
PEGDA-Based Hydrogels:
Chemicals and DNA
[0146] Polyethylene glycol diacrylate Mn 10,000 (PEGDA10k) was obtained from Sigma-Aldrich (Cat. No. 729094). The fluorophore RhodamineB-methacrylate was purchased from PolySciences, Inc. (Cat. No. 25404-100) and used to visualize the hydrogels. The UV-sensitive initiator Irgacure 2100 (BASF) was used to polymerize hydrogels. All DNA strands were purchased with standard desalting purification from Integrated DNA Technologies, Inc. Acrydite-modified strands were solubilized using 1TAE buffer (Life Technologies, Cat. No. 24710-030) supplemented with 12.5 mM magnesium acetate tetrahydrate (Sigma-Aldrich, Cat. No. M5661). All unmodified DNA strands were solubilized using MilliQ purified water. DNA sequences were adapted from previous literature.sup.1,2 or designed using NUPACK.sup.3 as previously described.
Preparation of DNA Complexes
[0147] DNA crosslink complexes were annealed in 1TAE buffer supplemented with 12.5 mM magnesium acetate tetrahydrate (TAEM) from 90 to 20 C. in an Eppendorf PCR at 1 C./minute at a concentration of 3 mM per strand. Hairpin forming strands were heated to 95 C. for 15 minutes at a concentration of 200 or 600 M followed by flash cooling on ice for 3 minutes.
Polymerization of poly(PEGDA10k-co-DNA) Hydrogels
[0148] PEGDA10k powder was mixed with MilliQ purified water and 10TAEM. After the PEGDA10k was fully dissolved, acrydite-modified DNA (3 mM), RhodamineB-methacrylate (29.9 mM), and Irgacure 2100 (75% v/v in butanol) were mixed into the solution. The final concentrations were 10% w/v PEGDA10k, 2.74 mM RhodamineB, and 3% v/v Irgacure 2100. The final concentration of DNA was 1.154 mM unless noted otherwise. After mixing with a pipette, the pre-gel solution was sonicated for 10 minutes and degassed for 15 minutes. The pre-gel solution was then UV polymerized using a mask aligner as previously described..sup.1 The polymerized hydrogel shape and size, as per the mask design, was an equilateral triangle with 1 mm side lengths.
Swelling DNA-Integrated Hydrogels
[0149] Hydrogel swelling experiments were conducted with one hydrogel per well in 96-well plates (Fisher Scientific). Hydrogels were swelled in TAEM supplemented with 0.001% v/v Tween20 (TAEM-T20) to prevent hydrogel sticking to the well's surface. Hairpins were added such that at least 604 of the 1004 total in each well was TAEM-T20 and the remaining solution was hairpin stock solution. Images were captured every 30 minutes using a humidified Syngene G:Box EF2 gel imager equipped with a blue light transilluminator (Clare Chemical, Em. max 450 nm) and UV032 filter (Syngene, bandpass 572-630 nm) or on an Olympus IX73 fluorescence microscope.
Analysis of Hydrogel Swelling
[0150] The uniaxial swelling ratio of the hydrogels was measured using custom-written MATLAB code. The edge of the hydrogel was determined using standard intensity-based thresholding and mask image analysis. First, the intensity values of the image were globally adjusted using imadjust to saturate the bottom and top 1% of all pixel values. A gaussian low-pass filter was applied to this adjusted image to reduce or remove background noise and generate the filtered image (FiltImg).
[0151] A two-step process was used to determine the threshold used to find the hydrogel's edges. A general mask was generated from the filtered image using:
Genmask=FiltImg1.35*mean(FiltImg)(1)
The general mask (GenMask) is a logical matrix where values of one indicate the bulk hydrogel plus some extra background pixels. The threshold value was then calculated using equation 4.
The parameter alpha varied from image to image in order to provide good agreement between the calculated boundary and the estimated boundary of the hydrogel. The matrix PixZero generally represents the background pixels of the image. The mask with values of one indicating at least the pixels belonging to hydrogel object was calculating using the threshold Thresh:
HydMask=FiltImgThresh*mean(FiltImg)(5)
Objects were removed (values set to 0) from HydMask if their total area was less than 700 pixels. The area of the hydrogels were at least 800 pixels in size. The boundary of the hydrogel was determined using MATLAB's bwboundaries function using a connectivity of 8.
[0152] The vertices of the hydrogel were determined from the extrema of the hydrogel object. The extrema and centroids of the objects in HydMask were determined using MATLAB's function regionprops. If background objects (e.g., the side of the well) were found in HydMask, the object with a centroid closest to the center of the image was chosen to be the hydrogel object. k-means clustering was used to determine the location of the vertices from 8 locations provided by the extrema of the hydrogel object. The algorithm was set to detect 4 clusters and the 3 clusters that were the farthest apart were the vertices of the hydrogel. The average distance between these three clusters was used as the measure of the side length of the hydrogel. The uniaxial swelling ratio was calculated using this side length for each image in a time-series (L) relative to the side length prior to adding hairpins (L.sub.0).
[0153] To investigate the tunability of hydrogel expansion directed by DNA hairpin incorporation by the hybridization chain reaction (
[0154] Using a constant base polymer network (e.g., PEGDA10k), there are three major DNA-based parameters that can be tuned to control the rate and extent of DNA-induced hydrogel swelling (
[0155] Second, the design of the hairpins, notably the length of the toeholds that initiate hairpin incorporation, can significantly affect the kinetic and thermodynamic properties of the DNA-based polymerization reaction. Increasing the length of the initiating toeholds should increase the rate of hairpin incorporation by increasing the rate constant for DNA strand-displacement. However, increasing the initiating toeholds also increases the size of the loop domain in the hairpins which can lead to undesired hairpin-hairpin polymerization reactions even in the absence of initiators.
[0156] The inventors first investigated the effect of DNA crosslink concentration on the rate and degree of DNA hairpin induced hydrogel swelling. The inventors prepared PEGDA10k hydrogels containing 0.25, 0.75, or 1.154 mM double-stranded DNA sequence set A crosslinks and incubated the hydrogels with hairpins containing set A sequences at 20 M each (
[0157] The inventors next investigated whether longer initiating toeholds would enable faster and more swelling of the hydrogels upon hairpin addition. The inventors designed a new set of sequences, termed System 5, with a longer primary initiating toehold on one of the crosslink strands (
[0158] The inventors next designed hairpins containing System 5 sequences with 8 bp or 10 bp long primary initiating toeholds (
Effect of Salt Concentration/Buffer on DNA-Induced Hydrogel Expansion
[0159] Synthesis of poly(acrylamide-co-S1dsDNA1.154) hydrogel particles
[0160] DNA crosslinks (System 1 sequences) were mixed to a final concentration of 1.154 mM with water, 10TAEM, acrylamide, rhodamine methacrylate, and Irgacure 2100 (75% v/v in butanol). The final concentrations of acrylamide, rhodamine methacrylate, and Irgacure 2100 were 1.41 M, 2.74 mM, and 3% (v/v), respectively. After mixing, the pre-polymer solutions were degassed under vacuum for 5 minutes. Pre-polymer droplets were prepared using a water-in-oil method (
Synthesis of poly(PEGDA10k-co-S1dsDNA1.154) hydrogel particles
[0161] DNA crosslinks (System 1 sequences) were mixed to a final concentration of 1.154 mM with water, 10TAEM, PEGDA10k, rhodamine methacrylate, and Irgacure 2100 (75% v/v in butanol). The final concentrations of PEGDA10k, rhodamine methacrylate, and Irgacure 2100 were 10% (w/v), 2.74 mM, and 3% (v/v), respectively. After sonicating for 5 minutes, the pre-polymer solutions were degassed under vacuum for 5 minutes. Pre-polymer droplets were prepared using a water-in-oil method (
Particle Area Measurement and Analysis
[0162] Images of the fluorescent particles were considered to be accurate 2D projections of the particle size near the center xy-plane. To decrease the sensitivity and bias involved in measuring the diameter, especially of an irregular or non-circular projection, the area of the 2D projection was chosen as the representative variable of particle size and calculated as a function of time for each particle.
[0163] The area of the 2D projection of each particle in the fluorescence micrographs was calculated using custom written MATLAB scripts developed using standard edge-detection algorithms. The algorithm used thresholding to determine the boundaries of the particles. This threshold value was calculated using the following method:
[0164] 1. Normalize the image to the highest and lowest intensity.
Use MATLAB's built-in global threshold calculator graythresh.
globalThresh=graythresh(normImage)(2)
Convert the normalized global threshold into an absolute global threshold and perform image-specific adjustments.
where corresponds to a manual input that was adjusted until a close match between the visible particle boundaries and the calculated boundaries was found. By converting the normalized global threshold (which can be used to threshold the normalized image) into the absolute global threshold, the values chosen for a are more standard between image sets and our measurements are more robust against irregularly bright pixels. particlePixels is a logical image mask where values corresponding to 1 indicate pixels that are within the particle's boundary. For particles that did not have significant intensity changes over the course of the experiment (i.e., particles that did not swell to a significant extent), a did not need to be adjusted between images in a time series. For some particles that did swell, and thus did have significant intensity changes, a was manually adjusted about every 5 images. After determining the pixels corresponding to the particle, the particle's area and boundary were extracted using the functions regionprops and bwboundaries.
[0165] The area as determined by regionprops was converted into square micrometers using the image's pixel size (4.44 m/pixel) and the relative change in area as a function of time was calculated using:
Area measurements for each particle were normalized to the initial time point. The curves showing the change in size as a function of time are taken from measurements made every 30 minutes, averaged over multiple particles. The curves were smoothed with a window size of 3.
Swelling Hydrogels Using Anchored Single-Stranded Nucleic Acid (Tags) and the Hybridization Chain Reaction:
[0166] Nucleic Acid Tag (or Anchored Single-Stranded Nucleic Acid):
[0167] A single-stranded nucleic acid strand, for example the C strand as per the sequence tables and in the table above, that is anchored to the hydrogel matrix and is capable of initiating the hairpin polymerization reaction. In terms of tag structure, this single-stranded nucleic acid strand contains a dock sequence A and a stem sequence (e.g., the C strand referenced in the tables). Programmable gels of the present invention may also include tags. For example, a gel may include a first polymer comprising a tag; a first polymerizing hairpin, a second polymerizing hairpin; and a terminating hairpin. The addition of a first polymerizing hairpin, a second polymerizing hairpin and a terminating hairpin to a polymer comprising a tag produces a programmable gel. Gels of the present invention are programmable because the concentration ratio of starting materials are predetermined. In the instant case, the first polymerizing hairpin, the second polymerizing hairpin, and the terminating hairpins are adjusted prior to addition of these elements to a gel. This predetermine concentration ratio controls the timing and/or degree of swelling (or contraction as shown below) of a programmable gel. A suitable tag is single stranded nucleic acid such as an RNA or a DNA. Programmable gels made with tags typically have first polymerizing hairpins comprising a first stem sequence and a second stem sequence, a first dock B sequence, a second anchor A sequence that is complementary to the first anchor A sequence and a second dock A sequence that is complementary to the first dock A sequence. A second polymerizing hairpin may comprise the first stem sequence, the second stem sequence, a second dock B sequence that is complementary to the first dock B sequence, the first dock A sequence; and the first anchor B sequence. The terminating hairpin may comprises the first stem sequence, the second stem sequence, the second dock A sequence, the second anchor A sequence and a terminating sequence.
[0168] As shown in
Reversible Gels or Gel Contraction:
[0169] Examples of nucleic acid sequences involved in gel contraction or present in reversible gels are provide below.
Additional Sequences:
[0170]
TABLE-US-00004 DNA SEQ STRAND SEQUENCE IDNO: System1:ReversibleHairpinsandReversalStrands S1_H1R_36 CCACGCTGTGGCACCTG 50 CACGCACCCACGTGCAG GTGCCACAGCGAACTTA ATGATTGTGTATAGT S1_H2R_36 AGTTAAGAGAATGATTG 51 GGTGCGTGCAGGTGCCA CAGCGTAAGTTCGCTGT GGCACCTGCACGTTG S1_H1R_36_2TSPC CCACGCTGTGGCACCTG 52 CACGCACCCATTCGTGC AGGTGCCACAGCGAACT TAATGATTGTGTATAGT S1_H2R_36_2TSPC AGTTAAGAGAATGATTG 53 GGTGCGTGCAGGTGCCA CAGCGTTTAAGTTCGCT GTGGCACCTGCACGTTG S1_H1R_36_5TSPC CCACGCTGTGGCACCTG 54 CACGCACCCATTTTTCG TGCAGGTGCCACAGCGA ACTTAATGATTGTGTAT AGT S1_H2R_36_5TSPC AGTTAAGAGAATGATTG 55 GGTGCGTGCAGGTGCCA CAGCGTTTTTTAAGTTC GCTGTGGCACCTGCACG TTG S1_REVH1_A6B ACTATACACAATCATTA 56 AGTTCGCTGTGGCACCT GCACG S1_REVH2_C6B CGCTGTGGCACCTGCAC 57 GCACCCAATCATTCTCT TAACT System2:ReversibleHairpinsandReversalStrands S2_Q1R_36_5NSPC AAAGCCTACCACTCCGT 88 TGCGGAACCTCTAAGCG CAACGGAGTGGTAGGCA GACAGGTAAGGTAAGAT AGG S2_Q2R_36_5NSPC GGGTAGTGTGATGTGAG 59 GTTCCGCAACGGAGTGG TAGGCCTAAGCTGTCTG CCTACCACTCCGTTGCG AAT S2_REVQ1_A6B CCTATCTTACCTTACCT 60 GTCTGCCTACCACTCCG TTGCG S2_REVQ2_C6B GCCTACCACTCCGTTGC 61 GGAACCTCACATCACAC TACCC System5:ReversibleHairpinsandReversalStrands S5_H1R_AC8BP TTACCATCACCCTCACC 62 TTACTTGTAGATGTAAG GTGAGGGTGATGGATAG ATAGGGTAGGTGAATGG GA S5_H2R_AC8BP TATGAGTGAGTTAGGAT 63 CTACAAGTAAGGTGAGG GTGATGGCTATCTATCC ATCACCCTCACCTTACA CC S5_H1R_5TSPC_AC8BP TTACCATCACCCTCACC 64 TTACTTGTAGATTTTTT GTAAGGTGAGGGTGATG GATAGATAGGGTAGGTG AATGGGA S5_H2R_5TSPC_AC8BP TATGAGTGAGTTAGGAT 65 CTACAAGTAAGGTGAGG GTGATGGTTTTTCTATC TATCCATCACCCTCACC TTACACC
[0171] The methods the inventors describe for reversible swelling requires at least two orthogonal types of crosslinks within the hydrogel. One type of crosslink is expandable by the hairpins that can later be reversed, such as crosslink nucleic acid sequences as an example. The second type of crosslink must be incapable of interacting with the hairpins or reversal strands sometimes referred to as a third crosslinker (e.g., physical/covalent crosslinks (PEGDA, bis-acrylamide), a second set of DNA crosslinks of a different sequence, ionic crosslinks).
[0172] The inventors have created methods of reversible swelling by adding reversal strands to an expanded gel thereby reducing the size of the gel or contracting the gel. For example, a gel may comprise a first polymer including a first crosslink nucleic acid sequence and a second polymer comprising a second crosslink nucleic acid sequence. The first polymer and the second polymer are crosslinked by the first and second crosslink nucleic acid sequences and a third crosslinker. The gel may also include a first polymerizing hairpin, a second polymerizing hairpin; and a terminating hairpin. The addition of these element to the gel produces a programmable gel that undergoes expansion. The gel may further comprise a first reversal strand and a second reversal strand. The addition of the reversal strands to the programmable, expanded gel breaks polymer cross links and results in shrinkage or contraction of the gel. The concentration ratio of the first polymerizing hairpin, the second polymerizing hairpin, the terminating hairpins, the first reversal strand, and the second reversal strand is determined prior to addition to a gel to control the timing and/or degree of swelling or contraction of a programmable gel. Suitable third crosslinker used in the present invention include a physical, ionic, chemical, or nucleic acid crosslinker. In addition, it is preferably that the first and second polymerizing hairpins, terminating hairpins, and first and second reversal strands are incapable of interacting with the third crosslinker. In addition it is suitable for the first reversal strand to interact with the first polymerizing hairpin and the second reversal strand to interact with the second polymerizing hairpin.
[0173] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0174] The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0175] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.