Methods of purifying recombinant alpha-Galactosidase A
10851360 ยท 2020-12-01
Assignee
Inventors
Cpc classification
B01D15/3814
PERFORMING OPERATIONS; TRANSPORTING
International classification
Abstract
In one embodiment, the invention provides a method of purifying recombinant alpha-galactosidase A. The method includes obtaining a lysate from cells recombinantly expressing alpha-galactosidase A grown in a cell culture medium having non-precipitating phosphate; contacting said lysate with a first chromatography media that binds -D-mannopyranosyl or -D-glucopyranosyl; eluting alpha-galactosidase A from the first chromatography media to generate a first eluate having alpha-galactosidase A, wherein said eluting includes at least one elution pause between 4 and 16 hours; contacting the first eluate with a second chromatography media that binds galactose binding proteins; and eluting alpha-galactosidase A from said second chromatography media to generate a second eluate containing said recombinant alpha-galactosidase A.
Claims
1. A method of purifying recombinant alpha-galactosidase A, said method comprising: (a) obtaining a supernatant from cells recombinantly expressing alpha-galactosidase A grown in a cell culture medium comprising non-precipitating phosphate; (b) contacting said supernatant with a chromatography media, wherein said chromatography media comprises media that binds -D-mannopyranosyl or -D-glucopyranosyl; and (c) eluting alpha-galactosidase A from said chromatography media to generate an eluate comprising alpha-galactosidase A, wherein said eluting comprises at least one elution pause between 4 and 16 hours.
2. The method of claim 1, wherein said supernatant is clarified prior to contacting the chromatography media.
3. The method of claim 1, wherein said non-precipitating phosphate comprises sodium hexametaphosphate.
4. The method of claim 1, wherein said chromatography media comprises Concanavalin A.
5. The method of claim 1, wherein said eluate is contacted with a chromatography media comprising D-galactose.
6. The method of claim 1, wherein said elution pause is between 10 and 14 hours.
7. The method of claim 1, wherein the eluate is subject to diafiltration.
8. The method of claim 1, wherein the eluate is subject to buffer exchange.
9. The method of claim 1, wherein the alpha-galactosidase A is truncated.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION
(14) The invention provides a method of purifying recombinant alpha-galactosidase A. The alpha-galactosidase A may be human alpha-galactosidase A, non-human alpha-galactosidase A, or a chimeric alpha-galactosidase A having similarity to human and non-human sequences. The recombinant alpha-galactosidase A may also have mutations that alter the catalytic activity. The recombinant alpha-galactosidase A may be full length or truncated. Examples of truncated alpha-galactosidase A include those having C-terminal truncations of 2, 4, 6, 8, 10, 12, or 14 amino acids.
(15) A lysate is obtained from cells recombinantly expressing alpha-galactosidase A grown in a cell culture medium having non-precipitating phosphate. Any suitable cell capable of stably expressing alpha-galactosidase A may be used. An example of a suitable cell includes Pichia pastoris. Any suitable expression system capable of expressing alpha-galactosidase A may be used. Expression systems include plasmid borne expression systems or expression systems integrated within the genome. In some embodiments, non-precipitating sodium hexametaphosphate is the phosphate source for the culture medium. In other embodiments, phosphate glass may be used as the phosphate source. Sodium trimetaphosphate and/or sodium orthophosphate have also been contemplated as the phosphate source. The lysate may be generated by any known means. For example, cells recombinantly expressing alpha-galactosidase A may be harvested and the cells lysed by mechanical means or chemical means. An example of mechanical lysis includes sonication. The lysate may be clarified by at least one of centrifugation or filtration. Examples of filtration include passing the lysate through a 0.2 m hollow fiber filter, and diafiltration across a 50 kDa pore size hollow fiber filter.
(16) The lysate is then contacted with a first chromatography media to bind alpha-galactosidase A to the first chromatography media. As used herein, chromatography media may be in the form of a packed column or free-flowing slurry. The first chromatography media includes any media that binds -D-mannopyranosyl, or -D-glucopyranosyl. Examples of such media include Concanavalin A (ConA) immobilized on Sepharose 4B; and mannose-specific lectin from the snowdrop (Galanthus nivalus) bulb immobilized on a solid matrix. The first chromatography media may then be washed to remove any material non-specifically bound to it.
(17) The alpha-galactosidase A bound to the first chromatography media is eluted by contacting the first chromatography media with an elution buffer to generate an eluate containing alpha-galactosidase A. Eluate, as used herein, is defined as elution buffer that has contacted the chromatography media and contains alpha-galactosidase A. This eluate is the first eluate. Any elution buffer capable of disrupting the binding of alpha-galactosidase A to the first chromatography media may be used. For example, the elution buffer may contain an increasing gradient (linear or step) of -D-methylmannoside or -D-methylglucoside. The use of glucose and mannose has also been contemplated. The elution buffer may also have a pH less than 6, less than 5, less than 4.5, or less than 4. The elution buffer contains non-near-saturating concentration of sugar.
(18) Elution of alpha-galactosidase A from the first chromatography media may include at least one elution pause. An elution pause, as used herein, is defined as contacting elution buffer with the chromatography media, and pausing the flow of the elution buffer such that there is no flow across the chromatography media. By way of further explanation, the chromatography media is incubated with the elution buffer. In the case of column chromatography, for example, one or more column volumes of elution buffer are flowed through the chromatography column, and the flow is paused. In the case of batch chromatography, a defined volume of elution buffer is contacted with the media and maintained for an amount of time (pause). In one embodiment, the pause may be from 4-16 hours. In another embodiment, the pause is from 12-14 hours. In one embodiment, the flow is paused for at least 4 hours, preferably for at least 8 hours, and most preferably at least 12 hours.
(19) The first eluate is contacted with a second chromatography media to bind alpha-galactosidase A to the second chromatography media. The first eluate may be subject to diafiltration, dialysis, or buffer exchange prior to contacting the second chromatography media. The second chromatography media is any media that binds galactose binding proteins. Examples of such media include D-galactose or C-type lectins. C-type lectin mutants engineered to have increased affinity for galactose have also been contemplated.
(20) The alpha-galactosidase A is eluted from said second chromatography media by contacting it with a second elution buffer. Any elution buffer capable of disrupting the binding of alpha-galactosidase A to the second chromatography media may be used. The second elution buffer may contain an increasing gradient (linear or step) of D-galactose. The elution buffer may also have a pH less than 6, less than 5, less than 4.5, or less than 4.
(21) In the specification, numerous specific details are set forth in order to provide a thorough understanding of the present embodiments. It will be apparent, however, to one having ordinary skill in the art that the specific detail need not be employed to practice the present embodiments. In other instances, well-known materials or methods have not been described in detail in order to avoid obscuring the present embodiments.
(22) Throughout this specification, quantities are defined by ranges, and by lower and upper boundaries of ranges. Each lower boundary can be combined with each upper boundary to define a range. The lower and upper boundaries should each be taken as a separate element.
(23) Reference throughout this specification to one embodiment, an embodiment, one example, or an example means that a particular feature, structure or characteristic described in connection with the embodiment or example is included in at least one embodiment of the present embodiments. Thus, appearances of the phrases in one embodiment, in an embodiment, one example, or an example in various places throughout this specification are not necessarily all referring to the same embodiment or example. Furthermore, the particular features, structures or characteristics may be combined in any suitable combinations and/or sub-combinations in one or more embodiments or examples. In addition, it is appreciated that the figures provided herewith are for explanation purposes to persons ordinarily skilled in the art and that the drawings are not necessarily drawn to scale.
(24) As used herein, the terms comprises, comprising, includes, including, has, having, or any other variation thereof, are intended to cover a non-exclusive inclusion. For example, a process, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such process, article, or apparatus.
(25) Further, unless expressly stated to the contrary, or refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).
(26) Additionally, any examples or illustrations given herein are not to be regarded in any way as restrictions on, limits to, or express definitions of any term or terms with which they are utilized. Instead, these examples or illustrations are to be regarded as being described with respect to one particular embodiment and as being illustrative only. Those of ordinary skill in the art will appreciate that any term or terms with which these examples or illustrations are utilized will encompass other embodiments which may or may not be given therewith or elsewhere in the specification and all such embodiments are intended to be included within the scope of that term or terms. Language designating such nonlimiting examples and illustrations includes, but is not limited to: for example, for instance, e.g., and in one embodiment.
(27) In this specification, groups of various parameters containing multiple members are described. Within a group of parameters, each member may be combined with any one or more of the other members to make additional sub-groups. For example, if the members of a group are a, b, c, d, and e, additional sub-groups specifically contemplated include any one, two, three, or four of the members, e.g., a and c; a, d, and e; b, c, d, and e; etc.
EXAMPLES
(28) The present invention is illustrated in further details by the following non-limiting examples.
Example 1. Materials and Methods
(29) Cell Strains and Plasmids
(30) The P. pastoris host strain X-33 (No. K1740-01), E. coli strains TOP10 (No. C4040-50) and TOP10F (No. C665-11), plasmid pPICZA (No. K1740-01), and TOPO XL PCR cloning kit (No. K4700-10) were purchased from Invitrogen.
(31) TABLE-US-00001 TABLE 1 Table 1. Strains and Plasmids. Strain Species Plasmid Description CC878 E. coli pCC248 pCR-XL-TOPO derivative plasmid a modified cDNA using primers AAF and AARD4 to generate C-terminal deletion of 4 amino acids (4) CC892 E. coli pCC262 pPICZA derivative plasmid with 4 CDNA insert CC970 E. coli pCC278 pCR-XL-TOPO derivative plasmid a modified cDNA using primers AAF and AARD6 to generate C-terminal deletion of 6 amino acids (6) CC973 E. coli pCC281 pCR-XL-TOPO derivative plasmid a modified cDNA using primers AAF and AARD10 to generate C-terminal deletion of 10 amino acids (10) CC983 E. coli pCC291 pPICZA derivative plasmid with 6 CDNA insert CC990 E. coli pCC298 pPICZA derivative plasmid with 10 CDNA insert CC993 E. coli pCC301 pCR-XL-TOPO derivative plasmid a modified cDNA using primers AAF and AARD2 to generate C-terminal deletion of 2 amino acids (2) CC994 E. coli pCC302 pCR-XL-TOPO derivative plasmid a modified cDNA using primers AAF and AARD8 to generate C-terminal deletion of 8 amino acids (8) CC995 E. coli pCC303 pPICZA derivative plasmid with 2 cDNA insert CC997 E. coli pCC305 pPICZA derivative plasmid with 8 cDNA insert PC626 P. pastoris pCC106 Integrated pPICZA derivative with WT cDNA insert [53] PC897 P. pastoris pCC262 Integrated pPICZA derivative with 4 cDNA insert PC958 P. pastoris pCC291 Integrated pPICZA derivative with 6 cDNA insert PC960 P. pastoris pCC298 Integrated pPICZA derivative with 10 cDNA insert PC971 P. pastoris pCC303 Integrated pPICZA derivative with 2 cDNA insert PC973 P. pastoris pCC305 Integrated pPICZA derivative with 8 cDNA insert TOP10 E. coli None E. coli host for modified 2, 6, 8, 10 cDNA plasmids TOP10F E. coli None E. coli host for pCC106 and modified 4 cDNA plasmid X-33 P. pastoris None Expression host for Gal expression Doi: 10.1371/journal.pone.0118341.t001
(32) TABLE-US-00002 TABLE2 PrimersUsedforDNASequenceAnalysis. Primer Sequence Function 5AOX 5GACTGGTTCCAATTGACAAGC3 DNAsequencingprimerforpPICZA (SEQIDNO:1) 3AOX 5GCAAATGGCATTCTGACATCC3 DNAsequencingprimerforpPICZA (SEQIDNO:2) -factor 5TACTATTGCCAGCATTGCTGC3 DNAsequencingprimerforpPICZA (SEQIDNO:3) M13:forward 5GTAAAACGACGGCCAG3 DNAsequencingprimerforpCR-XL-TOPO (SEQIDNO:4) M13:reverse 5CAGGAAACAGCTATGAC3 DNAsequencingprimerforpCR-XL-TOPO (SEQIDNO:5) Note. Primers were HPLC purified, 50 nmoles from Invitrogen Doi:10.1371/journal.pone.0118341.t002
Bioreactor Expression of Recombinant Gal in P. pastoris
(33) High-cell-density fermentation was carried out as previously described [53] with a modified growth medium utilizing non-precipitating sodium hexametaphosphate as a phosphate source [64] and modified for a 7 L Applikon bioreactor. Fermentation medium of 3.5 L (0.93 g/l CaSO4, 18.2 g/l K2SO4, 14.9 g/l MgSO4.7 H2O, 9 g/l (NH4)2SO4, 40.0 g/l glycerol) was autoclaved at 121 C. for 20 min in the vessel. After cooling to room temperature, filter sterilized sodium hexametaphosphate (25 g/l of fermentation basal salt medium dissolved in 500 ml of deionized water) and 0.435% PTM1 trace elements (CuSO4.5 H2O 6.0 g, NaI 0.08 g, MgSO4.H2O 3.0 g, Na2MoO4.2 H2O 0.2 g, H3BO3 0.02 g, CoC12 0.5 g, ZnCl2 20.0 g, FeSO4.7 H2O 65.0 g, biotin 0.2 g, 5.0 ml H2SO4 per liter) were added to complete the fermentation medium. The pH was adjusted to 6.0 using ammonium hydroxide (28%).
(34) Four frozen MGY cultures of 4 ml each were used to inoculate four 100 ml MGY cultures in 1-liter baffled flasks and grown at 250 rpm and 30 C. until the OD600 reached 2 to 6. The cultivation was divided into three phases, the glycerol batch, glycerol-fed batch, and methanol-fed batch. The glycerol batch phase was initiated with 400 ml of inoculum shake-flask culture added to 4 L of the fermentation medium containing 4% glycerol and an initial value of 100% dissolved oxygen until a spike was observed indicating complete consumption of glycerol. Next, the glycerol-fed batch phase was initiated and a 50% w/v glycerol feed rate of 18.15 ml/h/liter initial fermentation volume and maintained until a cell yield of 180 to 220 g/liter wet cells was achieved. At this point the glycerol feed was terminated manually and a methanol-fed batch phase was initiated by starting a 100% methanol feed containing 12 ml PTM1 trace salts per liter. Methanol was initially fed at 3.6 ml/h/liter of initial fermentation volume, then increased to 7.3 ml/h/liter and finally increased to 10.9 ml/h/liter of initial fermentation volume for the remainder of the fermentation. Dissolved oxygen spikes were used during the glycerol-fed batch phase and methanol-fed batch phase and to monitor substrate levels. A dissolved oxygen level of 40%, pH of 6, and temperature of 25 C. were maintained by an ADI 1030 regulator. Sampling was performed at the end of each phase and at least twice daily and analyzed for cell wet weight and increased Gal activity over time. Cultivation was terminated once a plateau in Gal activity was observed.
(35) Construction of Strains
(36) Plasmid pMS118 [48] contains the Gal cDNA cloned as an EcoRI fragment to the EcoRI site of plasmid pUC9. PCR primers (
(37) Purification of Gal Using Double Affinity Chromatography
(38) Purification was as described [53, 65] with minor modifications (below). Bioreactor supernatant was passed through a 0.2 m hollow fiber filter (Spectrum Labs, No. M22M-300-01N) and subjected to diafiltration using a 50 kDa pore size hollow fiber filter (Spectrum Labs, No. M25S-300-01N) against wash buffer (0.1 M sodium acetate buffer, pH 6.0, 0.1 M NaCl, 1 mM MgCl2, 1 mM CaCl2, 1 mM MnCl2). The resulting supernatant was applied to a Con A Sepharose 4B (GE Healthcare No. 17-0440-01) column, pre-equilibrated with wash buffer, and washed with 5 column volumes of wash buffer. It was observed that near-saturating sugar eluent concentrations do not improve glycoprotein recovery as compared to lower concentrations and that elution phase pauses improve recovery [66]. In accordance with these findings, elution of Gal was carried out using modified elution buffer I (0.5 M methyl--D-mannopyranoside, 0.25 M methyl--D-glucopyranoside in wash buffer) over 1.5 column volume blocks separated by 12-hour interval soaks. Elution was discontinued when the absorbance at 280 nm and enzyme assays showed negligible presence of protein and Gal activity. No substantial difference in recovered enzyme was observed between purifications carried out with modified elution buffer I versus sugar saturated elution buffer I (data not shown). The Con A pool was subjected to diafiltration using a 50 kDa pore size hollow fiber filter (Spectrum Labs, No. M25S-300-01N) against binding buffer (25 mM citrate-phosphate buffer, pH 4.8 containing 0.1 M NaCl).
(39) The Con A pool was applied to an immobilized-D-galactose gel column (Thio-Gal, Pierce No. 20372) pre-equilibrated with binding buffer. The column was washed with 5 column volumes of binding buffer and Gal was eluted with elution buffer II (25 mM citrate-phosphate buffer, pH 5.5, 0.1M NaCl, 0.1MD-galactose) over 1.5 column volume blocks separated by 12 hour soaks. Fractions were assayed for enzyme activity and protein concentration and a peak tube with high specific activity was chosen as the sample to be used in a substrate saturation curve.
(40) Electrophoresis Analysis
(41) Samples (8 g) were mixed with an equal volume of reducing sample buffer (Bio-Rad Laemmli sample buffer with 5% -mercaptoethanol) and heated for 5 minutes at 95 C. before loading on a Mini-Protean TGX Precast Gel 4-20% (w/v) (Bio-Rad No. 456-1094). Bands were visualized by Coomassie blue staining via the modified Fairbanks protocol [67].
(42) Western Blot Analysis
(43) Western blot analysis was performed using an anti-Gal polyclonal antibody produced in chicken (Pierce/ThermoSci #PA1-9528) and horseradish peroxidase-conjugated anti-Chicken IgY antibody (Sigma #9046). After SDS-PAGE (2 g of samples loaded), the gel was incubated with a nitrocellulose membrane (Whatman, No. 10402594) for 15 minutes at room temperature in Transfer Buffer (48 mM Tris, 39 mM glycine, 20% MeOH, pH 9.2) and the proteins were then transferred to the nitrocellulose membrane using a Bio-Rad Trans Blot SD Semi-Dry Transfer Cell. The membrane was blocked with 8% (w/v) non-fat dried milk in PBST [10 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl and 0.2% Tween 20 (pH 7.4)] at room temperature for 20 minutes. The membrane was then treated with primary antibody diluted in a milk/blot solution [1% (w/v) non-fat dried PBST] for 2 h at room temperature with mild shaking. After rinsing with PBST solution, the membrane was treated for 1 h at room temperature with secondary antibody diluted in the milk/blot solution. Protein bands were visualized on Kodak BioMax XAR film (VWR #1B1651454) with a Konica SRX-101A processor.
(44) Enzyme and Protein Assays
(45) Activity of Gal was assayed using the synthetic substrate, 4-methylumbelliferyl--D-galactopyranoside (MUG) as described [53] with modifications to a microtiter plate format (below).
(46) Enzyme activity is measured in units/ml where one unit is defined as the amount of enzyme required to convert 1 nmole of MUG to 4-methylumbelliferone in one hour at 37 C. An aliquot of 3 l was added to 27 l of enzyme assay buffer (5 mM MUG in 40 mM sodium acetate buffer, pH 4.5). This mixture was incubated at 37 C. and 10 l aliquots were taken at two time points and added to 290 l of 0.1M diethylamine in a microtiter plate to stop the reaction. Typically time points were chosen as 1-4 minutes and values that were proportional to time were considered valid. The fluorescence of each sample was measured at an excitation wavelength of 365 nm and an emission wavelength of 450 nm using a Tecan Infinite F200 microtiter plate reader. A standard curve of 10 l of 0-0.5 nmol 4-methylumbelliferone dissolved in MeOH in 290 l of 0.1 Mdiethylamine was used to quantitate MUG cleavage at specific time intervals. Analysis of the effects of MeOH indicated no effect on the 4-methylumbelliferone standard curve.
(47) For samples containing higher protein concentrations, the BioRad DC Protein Assay (No. 500-0116) with a standard curve of (0.2-1.5) mg/ml was used according to the manufacturer's specifications. For dilute samples of purified Gal, a more sensitive fluorescence-based fluorescamine assay [68] with a standard curve containing lower protein concentrations of (4.0-160) g/ml was used. Briefly, 150 l of 0.05 Msodium phosphate buffer and 50 l of 1.08 mM fluorescamine dissolved in acetone were added to an aliquot of 50 l of the sample and standards, mixed and incubated for 12 minutes. The fluorescence of each sample was measured at an excitation wavelength of 400 nm and an emission wavelength of 460 nm. Bovine serum albumin (Bio-Rad No. 500-0112) was used as the standard in both assays. Absorbance and fluorescence measurements were conducted on a Tecan Infinite F200 microplate reader using 96-well plates.
(48) Mass Spectrometry of a Purified Mutant Enzyme
(49) The 6 mutant was selected for mass spectrometry analysis conducted at the Rockefeller University Proteomics Resource Center in collaboration with M. T. Mark. SDS-PAGE gel slices were washed, de-stained, reduced using 10 mM dithiothreitol, alkylated using 100 mM iodoacetamide, and digested using trypsin. Peptides were then extracted from the gel two times, dried, and re-suspended in a 5% acetonitrile and 2% formic acid mixture. One third of each sample was loaded onto a C18 PepMap1000 micro-precolumn (300 m I.D., 5 mm length, 5 m beads, Thermo Scientific) at a flow-rate of 5 l/min, and subsequently onto an analytical C18 column (75 m I.D., 3 m beads, Nikkyo Technos Co.) at a flow rate of 300 nl/min. The gradient was 40 min long in the range 5 to 45% B (buffer A was 0.1% formic acid in water, and buffer B was 0.1% formic acid in acetonitrile). Eluted peptides were applied by electrospray directly into the LTQ-Orbitrap XL mass spectrometer from Thermo Scientific, operating in a 300 to 1800 m/z mass range. Tandem mass spectrometry was performed by collision induced dissociation using nitrogen as a collision gas. The resulting spectra were analyzed using Mascot and Proteome Discoverer 1.3 (Thermo Scientific) to identify the peptides in the sample.
(50) Thermostability and pH Optimum of WT and Mutant Gal
(51) Purified enzyme samples were diluted in 25 mM citrate-phosphate buffer, pH 5.5, 0.1 MNaCl, 0.01 MD-galactose. Samples of 50 l were incubated in triplicate at 50 C., 30 C. and 40 C. Aliquots of 3 l were removed for enzyme assays every 15 minutes for two hours. Samples were assayed in 0.02 M citrate buffer, pH 3.0-pH 6.5, containing 2 mM MUG.
(52) Characterization of Kinetic Properties
(53) Substrate saturation curves for Gal have been reported using MUG at concentrations up to 2 mM, 5 mM, and 10 mM (in the presence of 0.1% BSA and 0.67% EtOH [24]). We noted that under our experimental conditions MUG is fully soluble at 2 mM, partially soluble at 5 mM, and chemically oversaturated at higher concentrations. Other investigators reported the use of sonication or detergent treatment to increase the solubility of MUG (e.g., [69]) but we avoided this approach in order to avoid potential artifacts due to the use of these techniques. Substrate saturation curves using 2 mM and 5 mM MUG as the highest concentrations were carried out and the kinetic parameters for Gal were calculated separately obtaining similar values. The values reported here (Table 3a) were obtained using a substrate saturation curve of 0.3 to 2 mM MUG since this is the highest concentration that is fully soluble under our experimental conditions. The Km and Vmax values were calculated using Lineweaver-Burk and non-linear regression through the program Sigma-Plot (Systat Software, San Jose, Calif.).
(54) Kinetic parameters were also determined using the colorimetric substrate, para-nitrophenyl--D-galactopyranoside (PNPGal) [70]. Purified enzymes were diluted to approximately 20,000 units/mL as determined by fluorescent MUG assay. These diluted samples were then added at a proportion of 1:9 citrate-phosphate buffer (0.1 M) containing 7-50 mM PNPGal. Aliquots of 20 l of the enzymatic reaction were removed at 15 minute intervals to terminate the reaction over the course of an hour and added to 320 l of borate buffer (pH 9.8) in a microplate [71]. Product formation was monitored by absorbance at 400 nm. Linear reaction velocities were observed for all measurements. A standard curve of 0-150 Mp-nitrophenylate in borate buffer (pH 9.8) [71] was used to quantitate product formation. Km and Vmax parameters were determined through non-linear regression using Sigma-Plot (Systat Software, San Jose, Calif.).
(55) Protein Structure Analysis
(56) The crystal structure of Gal (PDB 1R47) was viewed and analyzed in PyMOL (Delano Scientific). The MSLDKLL and QMSLKDLL peptides corresponding to the last 7 or 8 C-terminal amino acids of Gal were built in PyRosetta [72] and visualized in PyMOL [73]. Interatomic distances were measured using the PyMOL wizard distance command.
(57) A homology model of the coffee bean -galactosidase was generated on the Phyre2 server[74]. The primary sequence of coffee bean -galactosidase (GenBank No. AAA33022.1) was set as the query. The crystal structure of rice -galactosidase (73% sequence identity to coffee -galactosidase, PDB#1UAS) was set as the template. Superposition of the coffee homolog and human crystal structure of Gal (PDB#1R47) was conducted in PyMOL [73]. Primary sequence alignments were carried out in ClustalOmega (EMBL-EBI).
Example 2. Purification of WT and Mutant Gal
(58) The WT and mutant enzymes were obtained from a 7 L bioreactor and purified (Table 4,
(59) The non-glycosylated form of Gal (41.8 kDa) is purified from cells as multiple glycosylated species with a predominant band of about 50 kDa and multiple higher molecular weight forms that differ in extent of glycosylation (
Example 3. Mass Spectrometry of a Purified Mutant Enzyme
(60) Two possible amino terminal amino acids, glutamate or leucine, could be produced in P. pastoris depending upon the selection of the signal peptidase, Kex2 or Ste13 (
(61) The mature form of the enzyme (signal peptide removed; [75]) produced in humans begins with a leucine codon (
(62) A search for a 6 C-terminal tryptic peptide of SHINPTGTVLLQLENTMQM (
(63) Thus, the purified 6 Gal mutant possesses an N-terminal sequence corresponding to the mature form of Gal and a C-terminal sequence truncated by six amino acids.
Example 4. Thermostability and pH Optima of WT and Deletion Mutants of Gal
(64) Preparations of purified WT and mutant Gal show similar thermostability profiles at 30 C., 40 C., and 50 C., with activity half-lives of 30, 25 and 17 minutes, respectively (
Example 5. Kinetic Analysis of WT and C-Terminal Deletion Mutants
(65) The values for Km and Vmax for WT enzyme (Table 3a) are in accord with published values (Table 5). The range of Km and Vmax values for the enzymes purified from several sources in various laboratories over a period of more than 30 years (Table 5) are in good agreement and the observed subtle variations are in the range expected. However, more precision is expected for measurements recorded for enzymes purified from the same source in a single laboratory at one given time (Table 3a). Substrate saturation curves (
(66) Without wishing to be bound by theory, the effects of the C-terminal deletions on the kinetic properties of the enzyme using the artificial substrate MUG (Table 3a) could be due to alterations in the inherent catalytic mechanism of the enzyme [85]. Alternatively, the altered kinetic properties could be due to changes in the affinity of the enzyme for specific structural components of the artificial substrate, MUG. In this context, it is of interest to measure these kinetic parameters with an alternative substrate such as PNPGal. The results (Table 3b,
(67) TABLE-US-00003 TABLE 3 Table 3. Values of K.sub.m, V.sub.max, k.sub.cat and the specificity constant (k.sub.cat/K.sub.m) for WT and C-Terminal Deletion Mutants of Gal. K.sub.m V.sub.max k.sub.cat k.sub.cat/K.sub.m Comments (mM) (mmole/hr/mg) (s.sup.1) (mM.sup.1s.sup.1) A) MUG WT 2.44 0.44 3.36 0.29 84.0 34.4 2 4.52 0.62 5.56 0.73 139 30.8 4 3.51 0.29 7.29 0.74 182 51.9 6 4.21 0.52 4.89 0.32 122 29.0 8 3.89 0.27 0.742 0.21 18.6 4.78 10 2.96 0.29 6.90 0.71 173 58.3 B) PNPGal WT 15.0 2.0 2.51 0.17 62.8 4.18 2 13.3 1.2 5.14 0.82 128 9.65 4 15.7 1.0 5.74 0.39 143 9.13 6 13.4 1.1 1.89 0.23 47.3 3.53 8 13.0 1.5 0.68 0.08 17.0 1.31 10 17.0 3.0 6.24 0.12 156 9.18 The values given are for the human enzyme purified from P. pastoris and assayed in triplicate followed by Lineweaver-Burk and non-linear regression analysis. Comparison of both Lineweaver-Burk and non-linear regression kinetic parameters show good general agreement (data not shown). Non-linear regression results are displayed above. The k.sub.cat was calculated using 90 kDa as the MW of Gal. A) MUG was used as the substrate for enzyme assay. Mean and standard deviation measurements are from multiple assays of three independent enzyme preparation for the 8 enzyme, two independent enzyme preparations for the WT enzyme, and single enzyme preparations for the other mutant enzymes. B) PNPGal was used as the substrate for enzyme assay. Doi: 10.1371/journal.pone.0118341.t003
(68) TABLE-US-00004 TABLE 4 Table 4. Purification on Table for WT Gal Expressed in P. pastoris. Specific Total Total Activity Purifi- Protein Activity (Units/ cation Yield Step (mg) (Units 10.sup.6) mg 10.sup.3) (Fold) (%) Supernatant 10,928 134 610 1.0 100 Con A Pool 138 30.4 221 18.1 22.8 Thio-Gal 4.18 15.7 3,771 309 11.8 Pool Note. 5 mM MUG was used as the substrate for enzyme assay. Doi: 10.1371/journal.pone.011834.t004 PLOS ONE | DOI: 10.1371/journal.pone.0118341 Feb. 26, 2015 10/26
(69) TABLE-US-00005 TABLE 5 Table 5. Literature Values for K.sub.m and V.sub.max for the WT Human Gal. K.sub.m (mM) V.sub.max (mmole/hr/mg) Source Reference Year 1.6 NA Placenta [80] 1978 2.9 1.7 Liver [78] 1979 1.9 NA Plasma [60] 1979 2.5 NA Spleen [60] 1979 2.0 2.8 Spleen [69] 1981 2.3 2.3 Sf9 insect cells [81] 2000 2.0 4.8 Replagal [24] 2003 2.0 4.8 Fabrazyme [24] 2003 4.0 3.3 Fabrazyme [82] 2009 2.8 2.6 COS-7 cells [83] 2007 4.5 3.3 COS-7 cells [84] 2011 Note. The values given are for the human enzyme purified directly from human tissues or from the indicated recombinant sources. Replagal is produced in human foreskin fibroblasts and Fabrazyme is produced in CHO cells. The average from these literature values are 2.6 0.9 mM (K.sub.m) and 3.2 1.1 mmole/hr/mg (V.sub.max). NA: not available. MUG was used as the substrate to determine the K.sub.m and V.sub.max values. Doi: 10.1371/journal.pone.0118341.t005
(70) TABLE-US-00006 TABLE 6 Table 6. Literature Values of K.sub.m, k.sub.cat, and the specificity constant (k.sub.cat/K.sub.m) for Glycosyl Hydrolase Family 27 Gal Enzymes. Pubmed Accession Colloquial K.sub.m k.sub.cat k.sub.cat/K.sub.m Relative code Genus and species name (mM) (s.sup.1) (mM.sup.1s.sup.1) K.sub.cat/K.sub.m Ref. NP_000160 Homo sapiens Human 6.88 37.8 5.49 10.sup.3 1 [95] NP_038491 Mus musculus Mouse 1.40 N/A N/A N/A [96] WP_004844583.1 Ruminococcus gnavus Bacteria 1.80 30.1 1.67 10.sup.4 3 [92] AAC99325 Saccharopolyspora erythraea Bacteria 0.650 23.3* 3.58 10.sup.4 6 [98] P41947 Saccharomyces cerevisiae Yeast 4.50 286 6.36 10.sup.4 12 [99] BAB83765 Clostridium josuil (Catalytic Bacteria 0.810 61.9* 7.64 10.sup.4 14 [100] Domain) AAG24511 Phanerochaete Fungus 0.198 272 1.37 10.sup.6 250 [101] chrysosporium Note. PNP Gal substrate was used to calculate kinetic values. Family 27 enzymes include the human Gal and related enzymes in the CAZy database [102] that are most closely related as indicated by BLAST analysis [94]. *k.sub.cat values for S. erythraea and C. josuil were calculated based on the reported V.sub.max, and molecular weights. Doi: 10.1371/journal.pone.0118341.t006
(71) TABLE-US-00007 TABLE 7 39.X, WT aGal from FR41 Aliquot# Contents Date Page# Vol (mL) U/mL Total Units mg/mL mg 39.1 Sup from FR41 7,000 72,825 509,775,000 39.2 Sup after Centrifugation 26-Jan 5,500 91,575 503,662,500 39.3 Sup after 27-Jan III-240 438 304,800 133,502,400 25.0 10,935 diafiltration + AC + buffer exchange to wash buffer 39.4 pool B2-E3 (FT 24-Feb 1,100 20,280 22,308,000 load + wash ConA) 39.5 pool A4-F1 + G2-65 (E1- 5-Mar III-243 1,800 26,640 47,952,000 E4, E6 ConA) 39.6 39.5 AC + buffer 5-Mar III-243 150 202,650 30,397,500 0.919 138 exchange to binding 39.7 Thiogal Elution tube A6 15-Mar MMII70 14 95775 1340850 0.0504 0.706 39.8 Thiogal Elution tube A7 15-Mar MMII70 14 109725 1536150 0.0323 0.452 39.9 Thiogal Elution tube A8 15-Mar MMII70 14 118,725 1,662,150 0.0168 0.235 39.10 Thiogal Elution A5 29-Mar III-243 4 110,100 440,400 0.0336 0.134 39.11 Thiogal Elution A9 29-Mar III-243 14 101,475 1,420,650 0.0135 0.189 39.12 Thiogal Elution A10 29-Mar III-243 14 104,250 1,459,500 0.0109 0.153 39.13 Thiogal Elution A11 29-Mar III-243 14 2,823 39,517 39.14 Thiogal Elution A12 29-Mar III-243 14 2,065 28,908 39.15 Thiogal pool Tubes A4-B12 240 65,625 6,969,600 0.017 4.176 39.16 Thiogal Elution Tube A5 3-Apr III-244 0.0470 2.780 0.131 2 mL----->47 uL 39.17 Thiogal Elution Tube A6 3-Apr III-244 0.0410 3.530 0.145 1.5 mL---->41 uL 39.18 Thiogal Elution Tube A7 3-Apr III-244 0.0450 4.270 0.192 2 mL------>45 uL 39.19 Thiogal Elution Tube A8 3-Apr III-244 0.0390 5.450 0.213 3.5 mL---->39 uL 39.20 Thiogal pool 39.15 4-Apr III-244 60.0 277,050 16,623,000 0.0366 2.196 AC + buffer exchange to 39.21 1700 uL of 39.20 -----> 5-Apr III-244 0.0390 1.938 0.0756 39 uL of 39.21 39.22 500 uL of 39.6 ------> 5-Apr III-244 0.0510 5.560 0.284 51 uL of 39.22 39.23 500 uL of 39.20 -----> 2-May III-244 0.212 200 uL of 39.23 39.24 250 uL of 39.20 -----> 9-May ES219 0.070 70 uL of 39.24