Consensus-based allele detection

Abstract

The present invention provides a method for genotyping alleles in at least one homologous genetic loci set, comprising: (i) providing a DNA-containing sample that includes said at least one homologous genetic loci set; (ii) performing PCR amplification of regions of said homologous genetic loci set using consensus sequence-specific primers, wherein said consensus sequence-specific primers bind to consensus sequences that are common to a plurality of genes within the genetic loci set, thereby generating a pool of amplification products; (iii) sequencing a plurality of said amplification products in order to determine the relative proportion of each nucleotide at each position in a sequencing read; (iv) performing a sequence alignment between the sequencing read results of (iii) and at least one reference sequence, which reference sequence corresponds to one of the genes in said homologous genetic loci set; and (v) performing genotype calling of the allele or alleles in said sample based on the relative proportion of each nucleotide at each of a plurality of discriminant positions in said alignment. Also disclose are related products, kits and systems for performing the method.

Claims

1. A method for genotyping alleles in at least one homologous genetic set, comprising: (i) providing a DNA-containing sample from a subject that includes at least one homologous genetic loci set, wherein said homologous genetic loci set comprises red cell antigen-encoding RHD gene and RHCE gene; (ii) performing PCR amplification of regions of said homologous genetic loci set using consensus sequence-specific primers, wherein said consensus sequence-specific primers bind to consensus sequences that are common to the RHD gene and RHCE gene and wherein the consensus sequence-specific primers comprise at least one forward consensus sequence-specific primer and one reverse consensus sequence-specific primer, thereby generating a pool of RHD and RHCE amplification products; (iii) sequencing a plurality of said RHD and RHCE amplification products in order to determine the relative proportion of each nucleotide at each position; (iv) performing a sequence alignment between the sequencing read results of (iii) and at least one reference sequence, with said reference sequence corresponding to one of the genes in said RHD and RHCE homologous genetic loci set; and (v) performing genotype calling of the allele or alleles in said sample based on the relative proportion of each nucleotide at each of a plurality of discriminant positions in said alignment.

2. The method according to claim 1, wherein said sequencing said plurality of said amplification products comprises Next Generation Sequencing or Sanger Sequencing.

3. The method according to claim 1, wherein the homologous genetic loci set comprises a first gene and a second gene, and wherein the first gene has at least 90%, at least 95% or at least 97% nucleotide sequence identity with the second gene.

4. The method according to claim 1, wherein said at least one reference sequence comprises: (i) at least one exon or intron of the RHD gene of SEQ ID NO: 25 or the reverse complement thereof; (ii) at least one exon or intron of the RHCE gene of SEQ ID NO: 26 or of one of the RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively or the reverse complement thereof; (iii) at least one of the RHD exon 1 sequence as shown in SEQ ID NO: 27, the RHCE exon 1 sequences as shown in SEQ ID NOs: 28-31, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 1 consensus sequence as shown in SEQ ID NO: 32 or the reverse complement thereof; (iv) at least one of the RHD exon 2 sequence as shown in SEQ ID NO: 33, the RHCE exon 2 sequences as shown in SEQ ID NOs: 34-37, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 2 consensus sequence as shown in SEQ ID NO: 38 or the reverse complement thereof; (v) at least one of the RHD exon 3 sequence as shown in SEQ ID NO: 39, the RHCE exon 3 sequences as shown in SEQ ID NOs: 40-43, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 3 consensus sequence as shown in SEQ ID NO: 44 or the reverse complement thereof; (vi) at least one of the RHD exon 4 sequence as shown in SEQ ID NO: 45, the RHCE exon 4 sequences as shown in SEQ ID NOs: 46-49, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE* CE, respectively, and/or the RHCE exon 4 consensus sequence as shown in SEQ ID NO: 50 or the reverse complement thereof; (vii) at least one of the RHD exon 5 sequence as shown in SEQ ID NO: 51, the RHCE exon 5 sequences as shown in SEQ ID NOs: 52-55, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 5 consensus sequence as shown in SEQ ID NO: 56 or the reverse complement thereof; (viii) at least one of the RHD exon 6 sequence as shown in SEQ ID NO: 87, the RHCE exon 6 sequences as shown in SEQ ID NOs: 88-91, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 6 consensus sequence as shown in SEQ ID NO: 90 or the reverse complement thereof; (ix) at least one of the RHD exon 7 sequence as shown in SEQ ID NO: 93, the RHCE exon 7 sequences as shown in SEQ ID NOs: 94-97, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 7 consensus sequence as shown in SEQ ID NO: 98 or the reverse complement thereof; (x) at least one of the RHD exon 8 sequence as shown in SEQ ID NO: 99, the RHCE exon 8 sequences as shown in SEQ ID NOs: 100-103, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 8 consensus sequence as shown in SEQ ID NO: 104 or the reverse complement thereof; (xi) at least one of the RHD exon 9 sequence as shown in SEQ ID NO: 105, the RHCE exon 9 sequences as shown in SEQ ID NOs: 106-109, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 9 consensus sequence as shown in SEQ ID NO: 110 or the reverse complement thereof; (xii) at least one of the RHD exon 10 sequence as shown in SEQ ID NO: 111, the RHCE exon 10 sequences as shown in SEQ ID NOs: 112-115, being RHCE alleles RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, and/or the RHCE exon 10 consensus sequence as shown in SEQ ID NO: 116 or the reverse complement thereof; and/or (xiii) at least one of the RHD intron 2 sequence as shown in SEQ ID NO: 117, the RHCE intron 2 sequences as shown in SEQ ID NOs: 118-121, being RHCE haplotypes RHCE*ce, RHCE*Ce, RHCE*cE or RHCE*CE, respectively, or the reverse complement thereof.

5. The method according to claim 4, wherein the said at least one reference sequence comprises at least two reference sequences, including: (i) at least one exon or intron of the RHD gene of SEQ ID NO: 25 or the reverse complement thereof, comprising an RHD exon sequence selected from any one of SEQ ID NOS: 27, 33, 39, 45, 51, 87, 93, 99, 105, 111 and 117; and (ii) a least one exon or intron of an RHCE gene sequence of SEQ ID NO: 26, comprising an RHCE exon sequence selected from any one of SEQ ID NOS: 28-32, 34-38, 40-44, 46-50, 52-56, 88-92, 94-98, 100-104, 106-110, 112-116, and 118-121 or the reverse complement thereof.

6. The method according to claim 4, wherein said plurality of discriminant positions in said alignment are selected from the following positions: c.48, IVS1+18, c.150, c.178, c.201, c.203, c.307, IVS2-8, c.361, c.380, c.383, c.455, c.505, c.509, c.544, c.577, c.594, c.602, c.667, c.676, c.697, c.712, c.733, c.744, c.787, c.800, c.916, c.932, IVS6+21, IVS6+22, IVS6+23, IVS6+24, c.941, c.968, c.974, c.979, c.985, c.986, c.989, c.992, c.1025, c.1048, c.1053, c.1057, c.1059, c.1060, c.1061, IVS8-67, c.1170, c.1193, and IVS9+62.

7. The method according to claim 4, wherein the method comprises sequencing each of exons 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 of the RHD gene and each of exons 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 of the RHCE gene.

8. The method according to claim 4, wherein the method further comprises determining the blood type of the sample based on the genotype.

9. The method according to claim 1, wherein the method comprises obtaining the number of reads covering reference forward bases, number of reads covering reference reverse bases, number of reads covering alternate forward bases and number of reads covering alternate reverse bases for use in genotype calling.

10. The method according to claim 1, wherein the method further comprises computing a mapping quality score for each sequence alignment and/or an overall mapping quality score for a plurality of said sequence alignments, where said mapping quality score for each sequence alignment and/or said overall mapping quality score for said plurality of sequence alignments is required to be at least 15 Phred Score units in order for said genotype calling to be considered reliable.

11. The method according to claim 1, wherein a pre-process step is performed prior to said sequence alignment in order to improve alignment quality, said pre-process step comprising excluding sequence reads shorter than 10 nucleotides in length or trimming sequence reads.

12. The method according to claim 1, wherein the method further comprises performing a quality control step to evaluate quality of the sequencing reads prior to performing said sequence alignment, and wherein evaluating the quality of each forward and/or each reverse sequencing read comprises determining one or more parameters selected from the group consisting of: Per base sequence quality, Per sequence quality score, Per base sequence content, Per base GC content, Per sequence GC content, Per base N content, Sequence Length Distribution, Sequence Duplication Level, Overrepresented sequences, and Kmer Content.

13. The method according to claim 1, wherein said sequence alignment is performed using the algorithm Burrows-Wheeler Aligner exact match (BWA MEM).

14. The method according to claim 1, wherein the method further comprises evaluating one or more of said sequence alignments to determine at least one parameter selected from the group consisting of: coverage, variant frequency, genotype average quality call, mapping quality, and calling quality.

15. The method according to claim 1, wherein cutoff criteria are set such that in order to define a homozygous call, a minimum of 50% of reads must support the called allele.

16. The method according to claim 1, wherein cutoff criteria are set such that in order to define a heterozygous call, between 30% and 70% of reads must support the alternative allele.

17. The method according to claim 1, wherein cutoff criteria are set such that in order to define a hemizygous call, between 15% and 45% of reads must support the called allele.

18. The method according to claim 1, wherein coverage is evaluated independently for forward and for reverse strand alignment, and wherein the forward-to-reverse coverage ratio is between 0.6 and 1.4.

19. The method according to claim 1, wherein the homologous genetic loci set comprises the RHD gene and the RHCE gene, and wherein said consensus sequence-specific primers comprise at least one forward consensus sequence-specific primer and one reverse consensus sequence-specific primer selected from the group consisting of: SEQ ID NOs: 3-24 and 59-86.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows an agarose gel image demonstrating PCR amplification products of exon 1 primers. Lane 1100 bp ladder; lane 2Ex01 F1R1; lane 3Ex01 F1R2; lane 4Ex01 F2R1; lane 5Ex01 F2R2; lane 6Ex01 F3R1; lane 7Ex01 F3R2. All primer combinations other than Ex01 F3R1 of lane 6 showed successful exon 1 amplification.

(2) FIG. 2 shows an agarose gel image demonstrating PCR amplification products of exon 1 primers (repeat) and exon 2 primers. Lane 1100 bp ladder; lane 2Ex01 F3R1 (sample 1); lane 3Ex01 F3R1 (sample 2); lane 4Ex02 F1R1; lane 5Ex02 F1R2; lane 6Ex02 F2R1; lane 7Ex02 F2R2. All primer combinations other than the repeat runs of Ex01 F3R1 of lanes 2 and 3 showed successful amplification.

(3) FIG. 3 shows an agarose gel image demonstrating PCR amplification products of exon 3 primers. Lane 1100 bp ladder; lane 2Ex03 F1R1; lane 3Ex03 F1R2; lane 4Ex03 F1R3; lane 5Ex03 F2R1; lane 6Ex03 F2R2; lane 7Ex03 F3R3. All primer combinations showed successful exon 3 amplification.

(4) FIG. 4 shows an agarose gel image demonstrating PCR amplification products of exon 4 primers. Lane 1100 bp ladder; lane 2Ex04 F1R1; lane 3Ex04 F1R2; lane 4Ex04 F2R1; lane 5Ex04 F2R2. All primer combinations showed successful exon 4 amplification.

(5) FIG. 5 shows an agarose gel image demonstrating PCR amplification products of exon 5 primers. Lane 1100 bp ladder; lane 2Ex05 F1R1; lane 3Ex05 F1R2; lane 4Ex05 F2R1; lane 5Ex05 F2R2. All primer combinations showed successful exon 5 amplification.

(6) FIG. 6 shows an electropherogram illustrating detection of heterozygote allele at position 48 of exon 1 (see double peak, circled) discriminating between RHD and the C allele of RHCE in a sample with the genotype DDCCee. The sample sequence reads: TGTCCGGCGCTGCCTGCCCCTCTGSGCCCTAACACTGGAAGCA (SEQ ID NO: 132).

(7) FIG. 7 shows an electropherogram illustrating detection of homozygote position 48 of exon 1 of RHCE (see circled G peak) in a sample with the genotype ddccee. The sample sequence reads: CCGGCGCTGCCTGCCCCTCTGGGCCCTAACACTGGAAG (SEQ ID NO: 133).

(8) FIG. 8 shows an electropherogram illustrating detection of heterozygote positions 201 and 203 of exon 2 (see circled peaks) discriminating between RHD and the c allele of RHCE in a sample with the genotype DDCCee. The sample sequence reads: GGGCTTCCTCACCTCRARTTTCCGGAGACACAGCTGGAGCA (SEQ ID NO: 134).

(9) FIG. 9 shows an electropherogram illustrating detection of homozygote positions 201 and 203 of exon 2 of RHCE (see circled peaks) in a sample with the genotype ddccee. The sample sequence reads: GGCTTCCTCACCTCAAATTTCCGGAGACACAGCTGGAGC AG (SEQ ID NO: 135) FIG. 10 shows an electropherogram illustrating detection of heterozygote positions 380 and 383 in exon 3 (see circled peaks) discriminating between RHD and RHCE in a sample with the genotype DDCCee. The sample sequence reads: CGGTGCTGATCTC AGYGGRTGCTGTCTTGGGGAAGGTC (SEQ ID NO: 136).

(10) FIG. 11 shows an electropherogram illustrating detection of homozygote positions 380 and 383 of exon 3 of RHCE (see circled peaks) in a sample with the genotype ddccee. The sample sequence reads: GGTGCTGATCTCAGCGGGTGCTGTCTTGGGGAA (SEQ ID NO: 137).

(11) FIG. 12 shows an electropherogram illustrating detection of heterozygote positions 577, 594, and 602 of exon 4 (see circled peaks) discriminating between RHD and RHCE in a sample with the genotype DDCCee. The sample sequence reads: GCCTCTACCCRAGGGAACGGAGGATAAWGATCAGASAGCAACG (SEQ ID NO: 138).

(12) FIG. 13 shows an electropherogram illustrating detection of homozygote positions 577, 594, and 602 of exon 4 of RHCE (see circled peaks) in a sample with the genotype ddccee. The sample sequence reads: GCCTGCCAAAGCCTCTACCCAAGGGAACGGAGGATAAT GATCAGAGAGCAAC (SEQ ID NO: 139).

(13) FIG. 14 shows an electropherogram illustrating detection of heterozygote position 712, 733, 744 of exon 5 (see circled peaks) discriminating between RHD and RHCE in a sample with the genotype DDCCee. The sample sequence reads: GAATGCCRTGTT CAACACCTACTATGCTSTAGCAGTCAGYGTGGTGA (SEQ ID NO: 140).

(14) FIG. 15 shows an electropherogram illustrating detection of homozygote positions 712, 733, 744 of exon 5 of RHCE (see circled peaks) in a sample with the genotype ddccee. The sample sequence reads: GAAGAATGCCATGTTCAACACCTACTATGCTCTAGCAGT CAGTGTGGTGACA (SEQ ID NO: 141).

(15) FIG. 16A-B shows a sequence alignment of exon 1 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 27), RHCE gene alleles RHCE*ce (SEQ ID NO: 28), RHCE*cE (SEQ ID NO: 29), RHCE*Ce (SEQ ID NO: 30), and RHCE*CE (SEQ ID NO: 31), and the consensus sequence for RHCE (SEQ ID NO: 32). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(16) FIG. 17A-B shows a sequence alignment of exon 2 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 33), RHCE gene alleles RHCE*ce (SEQ ID NO: 34), RHCE*cE (SEQ ID NO: 35), RHCE*Ce (SEQ ID NO: 36), and RHCE*CE (SEQ ID NO: 37), and the consensus sequence for RHCE (SEQ ID NO: 38). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(17) FIG. 18A-B shows a sequence alignment of exon 3 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 39), RHCE gene alleles RHCE*ce (SEQ ID NO: 40), RHCE*cE (SEQ ID NO: 41), RHCE*Ce (SEQ ID NO: 42), and RHCE*CE (SEQ ID NO: 43), and the consensus sequence for RHCE (SEQ ID NO: 44). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(18) FIG. 19A-B shows a sequence alignment of exon 4 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 45), RHCE gene alleles RHCE*ce (SEQ ID NO: 46), RHCE*cE (SEQ ID NO: 47), RHCE*Ce (SEQ ID NO: 48), and RHCE*CE (SEQ ID NO: 49), and the consensus sequence for RHCE (SEQ ID NO: 50). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(19) FIG. 20A-B shows a sequence alignment of exon 5 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 51), RHCE gene alleles RHCE*ce (SEQ ID NO: 52), RHCE*cE (SEQ ID NO: 53), RHCE*Ce (SEQ ID NO: 54), and RHCE*CE (SEQ ID NO: 55), and the consensus sequence for RHCE (SEQ ID NO: 56). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(20) FIG. 21A-B shows a sequence alignment of exon 6 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 87), RHCE gene alleles RHCE*ce (SEQ ID NO: 88), RHCE*cE (SEQ ID NO: 89), RHCE*Ce (SEQ ID NO: 90), and RHCE*CE (SEQ ID NO: 91), and the consensus sequence for RHCE (SEQ ID NO: 92). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(21) FIG. 22A-B shows a sequence alignment of exon 7 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 93), RHCE gene alleles RHCE*ce (SEQ ID NO: 94), RHCE*cE (SEQ ID NO: 95), RHCE*Ce (SEQ ID NO: 96), and RHCE*CE (SEQ ID NO: 97), and the consensus sequence for RHCE (SEQ ID NO: 98). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(22) FIG. 23A-B shows a sequence alignment of exon 8 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 99), RHCE gene alleles RHCE*ce (SEQ ID NO: 100), RHCE*cE (SEQ ID NO: 101), RHCE*Ce (SEQ ID NO: 102), and RHCE*CE (SEQ ID NO: 103), and the consensus sequence for RHCE (SEQ ID NO: 104). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash.

(23) Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(24) FIG. 24A-B shows a sequence alignment of exon 9 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 105), RHCE gene alleles RHCE*ce (SEQ ID NO: 106), RHCE*cE (SEQ ID NO: 107), RHCE*Ce (SEQ ID NO: 108), and RHCE*CE (SEQ ID NO: 109), and the consensus sequence for RHCE (SEQ ID NO: 110). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(25) FIG. 25A-B shows a sequence alignment of exon 10 (in bold), as well as upstream and downstream intronic positions (non-bold), for RHD (SEQ ID NO: 111), RHCE gene alleles RHCE*ce (SEQ ID NO: 112), RHCE*cE (SEQ ID NO: 113), RHCE*Ce (SEQ ID NO: 114), and RHCE*CE (SEQ ID NO: 115), and the consensus sequence for RHCE (SEQ ID NO: 116). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash.

(26) Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment as well as its exonic position (in parenthesis).

(27) FIG. 26A-B shows a sequence alignment of the 109 base pair insert (in bold) as well as upstream and downstream intronic positions (non-bold) in intron 2, for RHD (SEQ ID NO: 117), RHCE gene alleles RHCE*ce (SEQ ID NO: 118), RHCE*cE (SEQ ID NO: 119), RHCE*Ce (SEQ ID NO: 120), and RHCE*CE (SEQ ID NO: 121). Identical nucleotides are indicated with an asterisk. Gaps are indicated with a dash. Numbers at the end of rows indicate, for the last nucleotide in said row, its position in the alignment.

(28) FIG. 27 shows an agarose gel image demonstrating PCR amplification products of exons 6 to 10 with different primer combinations. All primer combinations showed successful amplification.

(29) FIG. 28 shows an agarose gel image demonstrating PCR amplification products of intron 2 with different primer combinations. All primer combinations showed successful amplification.

(30) The Sequence Listing is submitted as an ASCII text file in the form of the file named Sequence_Listing.txt, which was created on Feb. 10, 2017, and is 226,919 bytes, which is incorporated by reference herein.

DETAILED DESCRIPTION OF THE INVENTION

(31) The present invention finds use in the determination alleles in highly homologous gene sets, such as the clinically relevant RHD and RHCE genes that encode blood antigens. The invention provides a method for genotyping alleles in at least one homologous genetic loci set, comprising: (i) providing a DNA-containing sample that includes said at least one homologous genetic loci set; (ii) performing PCR amplification of regions of said homologous genetic loci set using consensus sequence-specific primers, wherein said consensus sequence-specific primers bind to consensus sequences that are common to a plurality of genes within the genetic loci set, thereby generating a pool of amplification products; (iii) sequencing a plurality of said amplification products in order to determine the relative proportion of each nucleotide at each position in a sequencing read; (iv) performing a sequence alignment between the sequencing read results of (iii) and at least one reference sequence, which reference sequence corresponds to one of the genes in said homologous genetic loci set; and (v) performing genotype calling of the allele or alleles in said sample based on the relative proportion of each nucleotide at each of a plurality of discriminant positions in said alignment.

(32) Advantageously, the method of the present invention may further comprise genotyping a sample obtained from a human subject at one or more positions in intron 7 of the RHD gene and/or in intron 7 of the RHCE gene. Blood typing by making use of intron 7 polymorphisms is described in WO2012/171990, the entire contents of which is expressly incorporated herein by reference. Blood typing by making use of a combination of polymorphisms in the RHD gene and/or the RHCE gene are described in US2012/0172239 and EP2471949, the entire contents of which are both expressly incorporated herein by reference.

(33) The Rh blood group D antigen is encoded by the RHD gene, which comprises 10 exons. The complete RHD gene sequence is available at NCBI Reference Sequence: No. NG_007494.1, GI:171184448, (SEQ ID NO: 25), the entire contents of which is incorporated herein by reference. The RHD gene exons 1-5 and 6-10, and intron 2 have the sequences set forth in bold in FIGS. 16-20 and 21-26.

(34) The Rh blood group C antigen is encoded by the RHCE gene, which comprises 10 exons. The complete RHCE gene sequence is available at NCBI Reference Sequence: NG_009208.2, GI:301336136, (SEQ ID NO: 26), the entire contents of which is incorporated herein by reference. An updated RHCE gene sequence is available at: NG_009208.3. The RHCE gene alleles RHCE*ce, RHCE*Ce, RHCE*cE, and RHCE*CE have the exon nucleotide sequences set forth in FIGS. 16-20 and 21-26 (exons 1-5 and 6-10, and intron 2, respectively). The RHCE consensus sequences of exons 1-5 and 6-10 are also shown in FIGS. 16-20 and 21-26, respectively.

(35) The term sample as used herein is intended to encompass any material (solid, liquid or aspirate) obtained directly or indirectly from a subject, such as a human subject, in which the genetic loci set of interest is found. In particular, the term sample includes any biological fluid such as blood, plasma, urine, saliva, cerebrospinal fluid and interstitial fluid, any solid matter, such as tissue, bone and hair, any cell or cell extract, any derived cell line, such as an immortalised tumour cell line and stem cell line, an extract of any of the preceding sample types, such as fixed or paraffin-embedded tissue. In certain preferred embodiments, the sample is an extract of human genomic DNA, optionally amplified and/or purified.

(36) As used herein, the term genotyping is intended to encompass any method for determining the identity of the nucleotide at a particular position such as a polymorphic position at a specified locus. Thus, genotyping includes identifying one or both alleles of a particular gene. Genotyping may employ any of a variety of techniques, including but not limited to, allele-specific hybridisation, allele-specific PCR, sequencing of all or part of a gene. Preferably, genotyping is carried out in accordance with the method of the first aspect of the invention.

(37) Unless specified otherwise, all nucleic acid sequences, such as primer sequences, are set forth herein in the direct 5 to 3. Thus, for example, the primer sequence TCCCTCAAGCCCTCAAGTAG (SEQ ID NO: 3) may equally be written as 5-TCCCTCAAGCCCTCAAGTAG-3 (SEQ ID NO: 3).

(38) As described herein, certain blood type alleles are less common and a typically referred to as variants (e.g. RHD*r.sup.S). Variant blood type alleles are in some cases referred to herein simply as blood type variants.

EXAMPLES

Examples

(39) For the following examples, two genes related to the human Rh blood group system were chosen: the RHD and RHCE genes. These genes, which are arranged in tandem, are structural paralogs resulting from a duplication of a common gene ancestor. Both genes are very similar (identical in 97% of their sequence), each containing 10 exons and spanning approximately 75 kb. These genes encode the highly polymorphic and antigenic RhD and RhCE proteins, which differ by more than 30 amino acids. RHD encodes the D antigen and RHCE encodes the antithetical C and c, and E and e antigens, in several combinations (ce, cE, Ce, or CE). There exist tens of additional Rh system antigens besides theses five principal ones.

(40) The C and c antigens are codominant and encoded by alleles (alternative forms) of the RHCE gene. Thus, if both alleles are present (one on each chromosome) both antigens are expressed on the red blood cell. The E and e antigens also are codominant and encoded by alleles of the RHCE gene. However, most D negative individuals are due to deletion of the RHD gene (although there are exceptions, including non-expression due to point mutations, indels, or rearrangements with RHCE). The C and c antigens differ by four amino acids: one encoded by exon 1 and three encoded by exon 2. Additionally, the C antigen differs from c and D due to a 109 base pair insertion in intron 2. The E and e antigens differ by one amino acid encoded by exon 5. Additionally, exon 2 is shared between RHD and RHCE in the case of RHCE*Ce and RHCE*CE alleles. Exon 8 and 10 are shared between RHD and all the RHCE alleles. In fact, transfer of exons between RHD and RHCE, creating hybrid genes, is known to occur in both directions.

(41) Throughout the text, antigens are referred to as D, C, c, E, and e. The two mentioned genes are referred to as RHD and RHCE. Alleles of the RHCE gene are designated as RHCE*ce, RHCE*Ce, RHCE*cE, and RHCE*CE. The proteins are referred to as RhD and RhCE or, if designated according to the specific antigens they bear, as Rhce, RhCe, RhcE, or RhCE.

Example 1Amplification of Homologous Loci Using Consensus Sequence-Specific Primers

(42) Primers suitable for next generation sequencing (NGS) and specific for consensus sequence between RHD and RHCE genes were designed for exons 1 through 5, and tested for correct product amplifications of both genes using different primer combinations, both in uniplex and in multiplex reactions. Amplifications were tested in eight different samples, including rare Rh blood group types:

(43) TABLE-US-00003 TABLE 1 Blood type of samples Sample Blood type Sample 1 RHD+, Cw type Sample 2 RHD+, CcEe Sample 3 wDt3, Cce Sample 4 RHD*DIIIa-het Sample 5 Ce, RHD+ Sample 6 DAR-hem Sample 7 r's Sample 8 Ce, RHD+

(44) All primers consisted of a NGS tag portion in their 5 end and a sequence-specific portion. In this example, used tags were: for forward primers: ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 1) for reverse primers: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 2)

(45) Consensus Sequence-Specific Portions were:

(46) TABLE-US-00004 SEQIDNO: RHExon1 Forwardprimers RHex01F1 TCCCTCAAGCCCTCAAGTAG 3 RHex01F2 TGTTGGAGAGAGGGGTGATG 4 RHex01F3 CTGCACAGAGACGGACACAG 5 Reverseprimers RHex01R1 CCCTGCTATTTGCTCCTGTG 6 RHex01R2 AAAGGAACATCTGTGCCCCT 7 RHExon2 Forwardprimers RHex02F1 CCCTTCCAGCTGCCATTTAG 8 RHex02F2 AAATCTCGTCTGCTTCCCCC 9 Reverseprimers RHex02R1 AAGTGATCCAGCCACCATCC 10 RHex02R2 GTCCATTCCCTCTATGACCC 11 RHExon3 Forwardprimers RHex03F1 AGGTGCCCAACAGTGTTTGT 12 RHex03F2 TGAGTGAGAGGCATCCTTCC 13 Reverseprimers RHex03R1 TTTGGCCCTTTTCTCCCAGG 14 RHDex03R2 GAAACCCCACCAAATGGAGC 15 RHCEex03R3 GAAGCCCCACCAAATGGAGC 16 RHExon4 Forwardprimers RHex04F1 GGCTTCAAGTCACACCTCCT 17 RHex04F2 CAGAGGATGCCGACACTCAC 18 Reverseprimers RHex04R1 CCATTCTGCTCAGCCCAAGT 19 RHex04R2 CAGCCAGAGCCTTTTCTGAG 20 RHExon5 Forwardprimers RHex05F1 CAGCCCTAGGATTCTCATCC 21 RHex05F2 AGCAGGAGTGTGATTCTGGC 22 Reverseprimers RHex05R1 CTGTTAGACCCAAGTGCTGC 23 RHex05R2 TGGGGAGGGGCATAAATATG 24

(47) PCR were performed in 10 L reactions using the following conditions:

(48) TABLE-US-00005 Kapa HotStart ReadyMix (2X) 5.0 L template DNA (20 ng/uL) 1.4 L Fwd primer (10 ng/uL) 1.2 L Rev primer (10 ng/uL) 1.2 L dH2O 1.2 L

(49) TABLE-US-00006 95 C. 3 min 95 C. 15 sec 38 cycles 60 C. 15 sec 72 C. 30 sec 4 C. infinity

(50) PCR products were run on agarose gels in order to confirm amplifications (FIGS. 1-5). Except for one primer combination for Exon 1 (RHex01 F3 and RHex01 R1), all other primer combinations showed successful amplifications.

Example 2Identification of Amplified Products from Example 1

(51) This example shows that amplification products using different primer combinations shown in example 1 correspond indeed to both genes (RHD and RHCE). In other words, homologous regions of both genes were amplified at the same time by the consensus sequence-specific primers.

(52) Amplification products were purified and Sanger sequenced in an ABI PRISM 3730XL Genetic Analyzer according to standard procedures. Samples had been fully characterized previously for their Rh blood group phenotype and genotype. Thus, for each exon, discriminating positions between both genes were successfully identified. Table 2 shows said positions for two samples (genotypes DDCCee and ddccee). If both genes had been amplified by the same primer set, electropherograms for said samples should show double peaks (heterozygotes) at said positions (FIGS. 6-15).

(53) TABLE-US-00007 TABLE 2 Polymorphic positions Discriminating Bases to be Exon Genotype position detected 1 DD CCee 48 G, C dd ccee G 2 DD CCee 150 T, C 178 A, C 201 G, A 203 G, A 307 T, C dd ccee 150 C 178 C 201 A 203 A 307 C 3 DD CCee 361 T, A 380 T, C 383 A, G 455 A, C dd ccee 361 A 380 C 383 G 455 C 4 DD CCee 505 G, T 509 T, A 514 A, T 544 A, G 577 T, A 594 G, C 602 G, T dd ccee 505 C 509 G 514 T 544 A 577 A 594 T 602 G 5 DD CCee 667 T, G 676 G 697 G, C 712 G, A 733 G, C 744 C, T 787 G, A 800 A, T dd ccee 667 G 676 G 697 C 712 A 733 C 744 T 787 A 800 T

(54) In all cases, electropherograms showed double peaks at the corresponding discriminating positions, indicating homologous regions of both genes had been simultaneously amplified and sequenced (FIGS. 6-15).

Example 3in Silico Analysis of RHD/RHCE Sequencing Reads

(55) Simulated sequence reads from theoretical exon sequences of the RHD and RHCE genes that would be generated by the above presented primers were created using ART (art_Illumina Q version). Illumina pair-end reads were created with the following parameters: length=200 nucleotides, coverage=40 reads, mean fragment size=230 nucleotides, mean size deviation=10. Default settings were used for insertion and deletion rates: first-read insertion rate=0.00009, deletion rate=0.00011, second-read insertion rate=0.00015, second-read deletion rate=0.00023. Files were generated in the standard raw data format of NGS technologies (.fastq format) that included quality values for each pair-end read created.

(56) Sequences were aligned to the RHD gene (RefSeq Gene NG_007494.1; SEQ ID NO: 25) and RHCE (RefSeq Gene NGG_009208.2; SEQ ID NO: 26), the latter bearing mutations corresponding to a ce haplotype. Alignment was performed using Burrows-Wheeler Aligner software with seed length=45 nucleotides and two mismatches in the seed. Alignment files were generated in BAM format, which were then indexed using SAMTools software. Three different software programs were then used to extract RHD and RHCE variants: SAMTools, Shore and VarScan. Coverage and mapping quality for all exons were evaluated. IGV software was used for visualization of alignments of both genes against a reference that included both genes.

(57) Results are summarized in Table 3 below:

(58) TABLE-US-00008 TABLE 3 Summary of results, by exon Exon Alignment summary 1 Reads generated from RHD aligned with its reference exclusively. Approximately 5% of reads generated from RHCE variants aligned with RHD with mapping quality close to 0. 2 Reads generated from RHD aligned with its reference exclusively. At this exon, allele C of RHCE has an identical sequence to RHD and these reads were aligned to RHD than RHCE. Final coverage detected for RHCE in this exon was unbalanced with RHD. Reads corresponding to allele c aligned with RHCE reference exclusively. 3 Reads generated from RHD aligned with its reference exclusively. Reads generated from RHCE variants aligned with RHCE reference exclusively. 4 Reads generated from RHD aligned with its reference exclusively. Reads generated from RHCE variants aligned with RHCE reference exclusively. 5 Reads generated from RHD aligned with its reference exclusively. Reads generated from RHCE variants aligned with RHCE reference exclusively. 6 Reads generated from RHD aligned with its reference almost exclusively, except for 5% that aligned with RHCE with a mapping quality close to 0. Reads generated from RHCE aligned with RHCE reference almost exclusively, except for 6.5% of RHCE reads that aligned with RHD reference with a mapping quality close to 0. 7 Reads generated from RHD aligned with its reference exclusively. Reads generated from RHCE variants aligned with RHCE reference exclusively. 8 Reads generated from RHD and RHCE (C, c, E, and e combinations) aligned indiscriminately with both genes with a low mapping quality value. 9 Reads generated from RHD aligned with its reference exclusively. Reads generated from RHCE variants aligned with RHCE reference exclusively. 10 Reads generated from RHD and RHCE (C, c, E, and e combinations) aligned indiscriminately with both genes but with a low mapping quality value.

CONCLUSION

(59) Variants were correctly aligned and successfully assigned to the corresponding RHD or RHCE genes using standard parameters known in the art. Only a very low proportion of the reads was assigned to the incorrect gene, as in the case of exons 1 and 6. In all cases, this was detected by low mapping quality values, and bore no effect in the correct determination of sequences from both genes. Furthermore, reads with low quality values can easily be filtered out of the analysis to render them moot. Similarly, unresolved assignments were produced for reads from exons 8, 10, and some reads (those for the allele identical to RHD) from exon 2. These exons do not show enough discriminating positions between both genes, and this was again correctly detected by the analysis, showing low mapping quality values or unbalanced coverage, alerting of the situation. Again, filtering out reads with low quality values would prevent any undetected wrong assignment of sequence.

Example 4NGS of Exons 1 Through 5 of the RHD and RHCE Genes of Known-Genotype Samples Consensus Sequence-Specific Primers

(60) Libraries were generated and NGS performed, using consensus sequence-specific primers for exons 1 through 5 in a multiplex reaction, for ten reference samples of known genotype in order to evaluate the correctness of the genotyping method. These samples had been characterized previously and presented the following genotypes:

(61) TABLE-US-00009 TABLE 4 Genotypes of Samples A-J: Sample Genotype Sample A CE (exons 1-2)-DD (exons 3-9)-CE (exon 10) Sample B DDCcEe Sample C DdCCee Sample D ddCcEe Sample E DdCcee (exons 1-2)-ddCcee (exons 3-9)-DD (exon 10) Sample F ddCcee Sample G DDCcEe Sample H DdccEe Sample I Ddccee Sample J DDCCee

(62) Multiplex sequencing reactions were performed in two step PCRs (PCR1 and PCR2), following standard procedures. Conditions for PCR1 were:

(63) TABLE-US-00010 Primer Mix (1 uM) RHex01-F1-OHBCM0620-RHex01-R2-OHBCM0634 RHex02-F2-OHBCM0624-RHex02-R1-OHBCM0635 RHex03-F2-OHBCM0628-RHex03-R1-OHBCM0640 RHex04-F1-OHBCM0629-RHex04-R1-OHBCM0643 RHex05-F1-OHBCM0631-RHex05-R1-OHBCM0645 Reagent Vol per sample (ul) Multiplex Mix 7.5 Primer Mix 4 H20 0.5 DNA template (20 ng/ul) 3 Cycling 95 C. 15 min 95 C. 45 sec 23 cycles 61 C. 60 sec 72 C. 90 sec 72 C. 10 min

(64) Conditions for PCR2 were the same as for PCR1, substituting the primers for an equimolar mixture of each reverse primer (containing Agilent indexes for NGS sequencing) and OHBCM0657, and cycling 15 instead of 23 times.

(65) Libraries so created were then purified using AMPure XP beads, quantified using Qubit 2.0, and run using MiSeq v.2 reagents, all as per manufacturer instructions.

(66) Data Analysis

(67) FastQC software was used to determine basic statistics on the quality of each sample read (forward and reverse), including Per base sequence quality, Per sequence quality scores, Per base sequence content, Per base GC content, Per sequence GC content, Per base N content, Sequence Length Distribution, Sequence Duplication Levels, Overrepresented sequences and Kmer Content.

(68) Trimmomatic software was used to remove reads with less than 76 nucleotides. Reads were trimmed by 2 bp at their 3 end with Fastx-trimmer tool from FASTX-toolkit software.

(69) Sequences were aligned using Burrows-Wheeler Aligner Maximal exact match (BWA MEM) algorithm from BWA software against a reference file (multiple sequences in a fasta format) that included only the reference sequences of the five exons plus 50 bps upstream and downstream of said exons. Results are presented for an alignment against a reference of gene RHD (NG007494.1; SEQ ID NO: 25) (exons 1-5; SEQ ID NOS: 27, 33, 39, 45 and 51, respectively) and a consensus sequence for 4 alleles (RHCE*ce, RHCE*Ce, RHCE*cE, and RHCE*CE) of gene RHCE (NG009208.2) (exons 1-5; SEQ ID NOS: 32, 38, 44, 50 and 56, respectively). Alignment files were generated in BAM format including information such as bitwise flag, alignment position, mapping quality, extended CIGAR string and query quality. In this example of analysis, the alignment results were sorted using Picard Tools software and indexed using SAMTools software. The sorted-indexed bam file was parsed to generate an alignment summary for each position including alignment and base-pair information at each chromosomal position such as bitwise flag, mapping quality, query quality, chromosome name, coordinate, reference base, alternate base, number of reads covering the site, read bases, base qualities and mapping qualities, forming a pileup formatted file using SAMTools software.

(70) VarScan software was used to parse the pileup formatted file, obtain genotypes at each sequence position and extract RHD and RHCE variants. In this step, SNPs and INDELs are detected using available parameters in the software. In this case, minimum coverage was set at 15, minimum variant frequency to call an alternative genotype above 5%, and genotype average quality call of 30 Phred Score units.

(71) The pileup file resulting from alignment was also parsed to evaluate base calling, coverage and mapping quality at each nucleotide position in the reference sequence. Standard alignment values such as coverage in forward strand, coverage in reverse strand, total coverage and mapping quality were recorded and interpreted.

(72) A selection method was designed where cutoff criteria were set, as follows. To define homozygous calls, a minimum of 70% of reads must have supported the called allele. To define heterozygous calls, between 30 and 70% of total reads must have supported the alternative allele. In addition to this, the mapping quality and calling quality should have been above 20 Phred Score units. When coverage is evaluated independently for forward or reverse strand alignment, reads supporting the call also had to convey to defined criteria, such as having a forward-to-reverse coverage ratio of between 0.7 and 1.35.

(73) Expected and observed results can be seen in Tables 5-8 (see below).

Example 5Amplification of Homologous Loci Using Consensus Sequence-Specific Primers

(74) Primers suitable for next generation sequencing (NGS) and specific for consensus sequence between RHD and RHCE genes were designed for exons 6 through 10 and intron 2, and tested for correct product amplifications of both genes using different primer combinations in uniplex reactions.

(75) Amplifications were tested with one sample:

(76) TABLE-US-00011 TABLE 9 Blood type of samples Sample Genotype Sample 1 D/cc

(77) Consensus sequence-specific portions were:

(78) TABLE-US-00012 RHex06F1 GGTCACTTGCAGCAAGATGG (SEQIDNO:59) RHex06F2 ACCTTGCTTCCTTTACCCAC (SEQIDNO:60) RHex06R1 TGGCCTTCAGCCAAAGCAGA (SEQIDNO:61) RHex06R2 CTAATGCAGCTGTGCACTGC (SEQIDNO:62) RHex07F1 TGTGTGAAAGGGGTGGGTAG (SEQIDNO:63) RHex07F2 GTCTCACCTGCCAATCTGCT (SEQIDNO:64) RHex07R1 GTTGGAGGGGAGTGTTAAGG (SEQIDNO:65) RHex07R2 CCAGCTAAGGACTCTGCACA (SEQIDNO:66) RHex08F1 ATGGCACTACTGACACCGAC (SEQIDNO:67) RHex08F2 TTGTCCCTGATGACCTCTGC (SEQIDNO:68) RHex08R1 TGTCCTGGCAATGGTGGAAG (SEQIDNO:69) RHex08R2 GCACATAGACATCCAGCCAC (SEQIDNO:70) RHex09F1 AGCTGGTCCAGGAATGACAG (SEQIDNO:71) RHex09F2 GTGGGAGAAAAAGGATTTCTGTTGAGA (SEQIDNO:72) RHex09F3 TCTTGAGATTAAAAATCCTGTGCTCCA (SEQIDNO:73) RHex09R1 AGTTCATGCACTCAAAATCTATCACGT (SEQIDNO:74) RHex09R2 CCTGCAATGCTCCTTACTCC (SEQIDNO:75) RHex10F1 GGCTGTTTCAAGAGATCAAGCC (SEQIDNO:76) RHex10F2 TCAGTATGTGGGTTCATCTGCA (SEQIDNO:77) RHex10R1 AGGCAACAGTGAGAGGAAGTTG (SEQIDNO:78) RHex10R2 TGCTGTCATGAGCGTTTCTCAC (SEQIDNO:79) RHin2F1 CTTGTGCCACTTGACTTGGGACTG (SEQIDNO:80) RHin2F2 CTGTTTTGAGTCCCTTCAGGGGAG (SEQIDNO:81) RHin2F3 CTCACATACTGATAACTTAGCAAATGGC (SEQIDNO:82) RHin2R1 GATCACTTGAGCCCAGGAGGC (SEQIDNO:83) RHin2R2 TTAACTCAGGAGGCTGAGGTGG (SEQIDNO:84) RHin2R3 CTGAGGTGGGAGGATCACTTGAG (SEQIDNO:85) RHCEin2R4 AAATTAGCCGGGCATGGTAGCAG (SEQIDNO:86)

(79) PCR were performed in 15 L reactions using the following conditions:

(80) TABLE-US-00013 Qiagen Multiplex kit (2X) 7.5 L Template DNA (20 ng/uL) 3.5 L Primer mix 1.0 L dH2O 3.0 L

(81) TABLE-US-00014 95 C. 15 min 95 C. 45 sec 23 cycles 60 C. 64 sec 72 C. 90 sec 72 C. 10 min 4 C. infinity

(82) PCR products for Sample 1 were run on agarose gels in order to confirm amplifications (FIG. 27-28).

Example 6NGS of Exons 1 Through 10 of the RHD and RHCE Genes of Known-Genotype Samples Consensus Sequence-Specific Primers

(83) Libraries were generated and NGS performed, using consensus sequence-specific primers for exons 1 through 10 and intron 2 in two multiplex reactions, for seven reference samples of known genotype in order to evaluate the correctness of the genotyping method. These samples had been characterized previously and presented the following genotypes:

(84) TABLE-US-00015 TABLE 10 Blood type of samples Sample Genotype Sample 1 ddccee Sample 2 DDCCee Sample 3 DdCcee Sample 4 ddCCee Sample 5 DDccEE Sample 6 ddccee Sample 7 DccEe

(85) TABLE-US-00016 TABLE 11 Polymorphic positions Expected bases by genotype Exon Position D Ce cE ce 1 i01+18 A C C C 2 c.150 T T C C c.178 A A C C c.201 G G A A c.203 G G A A c.307 T T C C 3 i0213 C T T T i028 T A A A c.361 T A A A c.380 T C C C c.383 A G G G c.455 A C C C 4 i0348 deletion T T T c.505 A C C C c.509 T G G G c.513 A T T T c.544 T A A A c.577 G A A A c.594 A T T T c.602 C G G G 5 c.667 T G G G c.676 G G C G c.697 G C C C c.712 G A A A c.733 G C C C c.744 C T T T c.787 G A A A c.800 A T T T 6 c.916 G A A A c.932 A G G G i06+21 C T T T i06+22 C G G G i06+23 T C C C i06+24 C T T T 7 c.941 G T T T c.968 C A A A c.974 G T T T c.979 A G G G c.985 G C C C c.986 G A A A c.989 A C C C c.992 A T T T c.1025 T C C C c.1048 G C C C c.1053 C T T T c.1057 G T T T c.1059 A G G G c.1060 G A A A c.1061 C A A A 9 i0875 deletion C C C i0874 deletion A A A i0867 C T T T c.1170 T C C C c.1193 A T T T i09+62 A G G G Intron 2 Absent Present Absent Absent

(86) Multiplexes were prepared with the following combinations of primers:

(87) TABLE-US-00017 Multiplex mix A Multiplex mix B Region FW RV FW RV Exon 1 F3 R1 F2 R2 Exon 2 F2 R2 F1 R1 Exon 3 F3 R1 F2 R3 Exon 4 F1 R1 F2 R2 Exon 5 F2 R1 F1 R2 Exon 6 F2 R2 F1 R1 Exon 7 F1 R1 F2 R2 Exon 8 F1 R1 F2 R2 Exon 9 F3 R2 F1 R1 Exon 10 F1 R1 F2 R2 Intron 2 F3 R8 F2 R3

(88) Multiplex sequencing reactions were performed in two step PCRs (PCR1 and PCR2), following standard procedures. Conditions for PCR1 were:

(89) TABLE-US-00018 Reagent Vol per sample (ul) Qiagen Multiplex Mix 7.5 Primer Mix 1 H20 3 DNA template (20 ng/ul) 3.5

(90) TABLE-US-00019 Cycling 95 C. 15 min 95 C. 45 sec 23 cycles 61 C. 60 sec 72 C. 90 sec 72 C. 10 min

(91) Conditions for PCR2 were the same as for PCR1, substituting the primers for an equimolar mixture of each reverse primer (containing Agilent indexes for NGS sequencing) and a forward primer, and cycling 10 instead of 23 times.

(92) Libraries so created were then purified using SequalPrep normalization plate, quantified using Qubit 2.0, and run using MiSeq v.3 reagents, all as per manufacturer instructions.

(93) Data Analysis

(94) FastQC software was used to determine basic statistics on the quality of each sample read (forward and reverse), including Per base sequence quality, Per sequence quality scores, Per base sequence content, Per base GC content, Per sequence GC content, Per base N content, Sequence Length Distribution, Sequence Duplication Levels, Overrepresented sequences and Kmer Content.

(95) Trimmomatic software was used to remove reads with less than 76 nucleotides. Reads were trimmed by 2 bp at their 3 end with Fastx-trimmer tool from FASTX-toolkit software.

(96) Sequences were aligned using Burrows-Wheeler Aligner Maximal exact match (BWA MEM) algorithm from BWA software against a reference file (multiple sequences in a fasta format) that included only the reference sequences of the five exons plus 50 bps upstream and downstream of said exons. Results are presented for an alignment against a reference of gene RHD (NG007494.1; SEQ ID NO: 25) (exons 1-10 and intron 2; SEQ ID NOS: 27, 33, 39, 45, 51, 87, 93, 99, 105, 111, and 117, respectively) and sequence of gene RHCE (NG009208.2) (exons 1-10 and intron 2; SEQ ID NOS: 28, 34, 40, 46,52, 88, 94, 100, 106, 112, and 120, respectively). Alignment files were generated in BAM format including information such as bitwise flag, alignment position, mapping quality, extended CIGAR string and query quality. In this example of analysis, the alignment results were sorted using Picard Tools software and indexed using SAMTools software. The sorted-indexed bam file was parsed to generate an alignment summary for each position including alignment and base-pair information at each chromosomal position such as bitwise flag, mapping quality, query quality, chromosome name, coordinate, reference base, alternate base, number of reads covering the site, read bases, base qualities and mapping qualities, forming a pileup formatted file using SAMTools software.

(97) VarScan software was used to parse the pileup formatted file, obtain genotypes at each sequence position and extract RHD and RHCE variants. In this step, SNPs and INDELs are detected using available parameters in the software. In this case, minimum coverage was set at 15, minimum variant frequency to call an alternative genotype above 5%, and genotype average quality call of 30 Phred Score units.

(98) The pileup file resulting from alignment was also parsed to evaluate base calling, coverage and mapping quality at each nucleotide position in the reference sequence. Standard alignment values such as coverage in forward strand, coverage in reverse strand, total coverage and mapping quality were recorded and interpreted.

(99) A selection method was designed where cutoff criteria were set, as follows. To define homozygous calls, a minimum of 70% of reads must have supported the called allele. To define heterozygous calls, between 30 and 70% of total reads must have supported the alternative allele. In addition to this, the mapping quality and calling quality should have been above 20 Phred Score units. When coverage is evaluated independently for forward or reverse strand alignment, reads supporting the call also had to convey to defined criteria, such as having a forward-to-reverse coverage ratio of between 0.7 and 1.35. Expected and observed results can be seen in Tables 14-21 and 31.

Example 7NGS of Exons 1 Through 10 of the RHD and RHCE Genes of Known-Genotype Samples Consensus Sequence-Specific Primers

(100) Libraries were generated and NGS performed, using consensus sequence-specific primers for exons 1 through 10 and intron 2 in two multiplex reactions, for six reference samples of known genotype in order to evaluate the correctness of the genotyping method. These samples had been characterized previously and presented the following genotypes:

(101) TABLE-US-00020 TABLE 12 Blood type of samples Sample Genotype Sample 1 DDCCee Sample 2 ddccee Sample 3 ddCcee Sample 4 ddCcEe Sample 5 DCcee Sample 6 ddccee

(102) TABLE-US-00021 TABLE 13 Polymorphic positions Expected bases by genotype Exon Position D Ce cE ce 1 i01+18 A C C C 2 c.150 T T C C c.178 A A C C c.201 G G A A c.203 G G A A c.307 T T C C 3 i0213 C T T T i028 T A A A c.361 T A A A c.380 T C C C c.383 A G G G c.455 A C C C 4 i0348 deletion T T T c.505 A C C C c.509 T G G G c.513 A T T T c.544 T A A A c.577 G A A A c.594 A T T T c.602 C G G G 5 c.667 T G G G c.676 G G C G c.697 G C C C c.712 G A A A c.733 G C C C c.744 C T T T c.787 G A A A c.800 A T T T 6 c.916 G A A A c.932 A G G G i06+21 C T T T i06+22 C G G G i06+23 T C C C i06+24 C T T T 7 c.941 G T T T c.968 C A A A c.974 G T T T c.979 A G G G c.985 G C C C c.986 G A A A c.989 A C C C c.992 A T T T c.1025 T C C C c.1048 G C C C c.1053 C T T T c.1057 G T T T c.1059 A G G G c.1060 G A A A c.1061 C A A A 9 i0875 deletion C C C i0874 deletion A A A i0867 C T T T c.1170 T C C C c.1193 A T T T i09+62 A G G G Intron 2 Absent Present Absent Absent

(103) Multiplexes were prepared with the following combinations of primers:

(104) TABLE-US-00022 Multiplex mix A Multiplex mix B Region FW RV FW RV Exon 1 F3 R1 F2 R2 Exon 2 F2 R2 F1 R1 Exon 3 F3 R1 F2 R3 Exon 4 F1 R1 F2 R2 Exon 5 F2 R1 F1 R2 Exon 6 F2 R2 F1 R1 Exon 7 F1 R1 F2 R2 Exon 8 F1 R1 F2 R2 Exon 9 F3 R2 F1 R1 Exon 10 F1 R1 F2 R2 Intron 2 F3 R8 F2 R3

(105) Multiplex sequencing reactions were performed in two step PCRs (PCR1 and PCR2), following standard procedures. Conditions for PCR1 were:

(106) TABLE-US-00023 Reagent Vol per sample (ul) Qiagen Multiplex Mix 7.5 Primer Mix 1 H20 3 DNA template (20 ng/ul) 3.5

(107) TABLE-US-00024 Cycling 95 C. 15 min 95 C. 45 sec 23 cycles 61 C. 60 sec 72 C. 90 sec 72 C. 10 min

(108) Conditions for PCR2 were the same as for PCR1, substituting the primers for an equimolar mixture of each reverse primer (containing Agilent indexes for NGS sequencing) and a forward primer, and cycling 10 instead of 23 times.

(109) Libraries so created were then purified using SequalPrep normalization plate, quantified using Qubit 2.0, and run using MiSeq v.3 reagents, all as per manufacturer instructions.

(110) Data Analysis

(111) FastQC software was used to determine basic statistics on the quality of each sample read (forward and reverse), including Per base sequence quality, Per sequence quality scores, Per base sequence content, Per base GC content, Per sequence GC content, Per base N content, Sequence Length Distribution, Sequence Duplication Levels, Overrepresented sequences and Kmer Content.

(112) Trimmomatic software was used to remove reads with less than 76 nucleotides. Reads were trimmed by 2 bp at their 3 end with Fastx-trimmer tool from FASTX-toolkit software.

(113) Sequences were aligned using Burrows-Wheeler Aligner Maximal exact match (BWA MEM) algorithm from BWA software against a reference file (multiple sequences in a fasta format) that included only the reference sequences of the five exons plus 50 bps upstream and downstream of said exons. Results are presented for an alignment against a reference of gene RHD (NG007494.1; SEQ ID NO: 25) (exons 1-10 and intron 2; SEQ ID NOS: 27, 33, 39, 45, 51, 87, 93, 99, 105, 111, and 117, respectively) and sequence of gene RHCE (NG009208.2) (exons 1-10 and intron 2; SEQ ID NOS: 28, 34, 40, 46, 52, 88, 94, 100, 106, 112, and 120, respectively). Alignment files were generated in BAM format including information such as bitwise flag, alignment position, mapping quality, extended CIGAR string and query quality. In this example of analysis, the alignment results were sorted using Picard Tools software and indexed using SAMTools software. The sorted-indexed bam file was parsed to generate an alignment summary for each position including alignment and base-pair information at each chromosomal position such as bitwise flag, mapping quality, query quality, chromosome name, coordinate, reference base, alternate base, number of reads covering the site, read bases, base qualities and mapping qualities, forming a pileup formatted file using SAMTools software.

(114) VarScan software was used to parse the pileup formatted file, obtain genotypes at each sequence position and extract RHD and RHCE variants. In this step, SNPs and INDELs are detected using available parameters in the software. In this case, minimum coverage was set at 15, minimum variant frequency to call an alternative genotype above 5%, and genotype average quality call of 30 Phred Score units.

(115) The pileup file resulting from alignment was also parsed to evaluate base calling, coverage and mapping quality at each nucleotide position in the reference sequence. Standard alignment values such as coverage in forward strand, coverage in reverse strand, total coverage and mapping quality were recorded and interpreted.

(116) A selection method was designed where cutoff criteria were set, as follows. To define homozygous calls, a minimum of 70% of reads must have supported the called allele. To define heterozygous calls, between 30 and 70% of total reads must have supported the alternative allele. In addition to this, the mapping quality and calling quality should have been above 20 Phred Score units. When coverage is evaluated independently for forward or reverse strand alignment, reads supporting the call also had to convey to defined criteria, such as having a forward-to-reverse coverage ratio of between 0.7 and 1.35.

(117) Expected and observed results can be seen in Tables 22-29 and 31.

(118) In three examples (4, 6 and 7), several combinations of SEQ ID NOs: 3-24 and 59-86 were evaluated to test the accuracy of the detection of alleles in the highly homologous genes RHD and RHCE through next-generation sequencing. The regions amplified by the method bear discriminating nucleotide positions between RHD, RHCE*Ce, RHCE*CE, RHCE*ce and RHCE*cE. These positions were then analyzed to determine whether they permit a calculation of the proportion of alleles present in each gene, and, thus, the determination of the correct genotype of a sample. Discriminating positions occur in exons 1, 2, 3, 4, 5, 6, 7, and 9. Additionally, a region in intron 2 that presents a 109 base pair insert was also evaluated in the determination of the RHCE Big C genotyping. In the examples, the method was also tested to see if it is capable of rendering all the bases contained in the coding regions, as well as the insert in intron 2 which is useful for blood typing.

(119) In Tables 14 to 31, the reference base and detected base appear in the column Mutation in reference to coding region. For example, in Table 14, for which the reference sequence is the RHD gene, the reference sequence has a T at position c.150 in exon 2, while the detected variant (the mutation in reference to coding region) is a C (noted by the > symbol). The values reported for every position are calculated by dividing the number of reads supporting the variant within the total number of reads. In Tables 5 to 8, the format changes slightly to report the aforementioned calculation as a percentage. Mutations for each RHCE allele and RHD are summarized under the column Polymorphic sites only for coding region positions. These positions are considered stable to discriminate between the RHD, RHCE*Ce, RHCE*CE, RHCE*ce and RHCE*cE.

(120) The expected allele ratio is calculated on the basis of the existence of none, one or two RHD alleles and none, one or two RHCE alleles. For example, on Table 14, the sample with the genotype ddccee has no RHD gene and two alleles of genotype little c and little e for RHCE. When the NGS sequences of this sample are mapped to the reference RHD, the positions with a different variant than the reference will be detected. For this sample, all expected variants (Table 15) when aligning to RHD are 100% from the RHCE gene because RHD is deleted. On the other hand, when aligning to the RHCE reference (Tables 18 and 19), there are no expected variants because the sample's sequence is identical to the reference sequence. In the case of intron 2, the ratios are calculated based on the number of reads that aligned to the reference sequence within the sum of reads that aligned to RHCE and RHD.

(121) In Example 4, a total of 24 discriminating nucleotide positions between RHD and RHCE were evaluated for exons 1 through 5 of the RH genes for each sample and reference sequence. In said example, the sum of the nucleotide positions (24 per sample) for all samples evaluated (7) using two reference sequences amounts to 336. The concordance between observed and expected allele ratios for the total of nucleotide positions evaluated for the combination of primers used in Example 4 is 100%.

(122) In Examples 6 and 7, a total of 50 discriminating nucleotide positions between RHD and RHCE were evaluated for exons 1 through 10 of the RH genes for primer mix A and 52 for primer mix B. In said examples, the sum of the nucleotide positions (50 for primer mix A and 52 for primer mix B per sample) for all samples evaluated (13) using two reference sequences amounts to 1300 for primer mix A and 1352 for primer mix B. The concordance between observed and expected allele ratios for the combination of primers used in Examples 6 and 7 is 96% for primer mix A and 90% for primer mix B.

(123) The conclusion, thus, is that, through the data analysis of three examples, it was confirmed that the regions sequenced by the method cover the entire coding regions of the ten exons and the 109 base pair insert in intron 2 of the RH genes (RHD and RHCE), allowing blood typing of the group. The application of consensus sequence-specific primers permits the homogeneous amplification of the two genes and, in this regard, makes it a quantitative method which allows the genotype prediction.

(124) Accuracy of this genotype prediction may be reduced in samples with large sequence rearrangements, but even then, the lowest expected accuracy of the invention is 90%. These examples show that through the use of combinations of SEQ ID NO: 3-24 and 59-86, homologous genes can be simultaneously genotyped.

(125) The examples demonstrate that the method allows the simultaneous sequencing of genes RHD and RHCE and the correct genotyping of variant positions to assign the proportion or allele ratio of each gene. In this regard, the method overcomes limitations of serological testing and Sanger sequencing in blood typing. Additionally, the method is high-throughput which is advantageous in the clinical setting for blood typing massive amounts of samples.

(126) TABLE-US-00025 TABLE 5 RHCE Obtained results based on analysis DdCcee (exons 1-2)- CE (exon 1)-DD ddCcee Polymorphic sites Exonic (exons 2-9)-CE (exons 3-9)- ce cE Ce CE D Ex position (exon 10) ddCcEe DD (exon 10) ddCcee DDCcEe ddccee DDCCee C C T T T 2 150 T 99% C 51% T 48% C 34% T 65% C 52% T 47% C 25% T 74% C 99% T 99% C C A A A 178 A 99% A 48% C 51% C 34% A 65% A 47% C 52% C 25% A 74% C 99% A 99% A A G G G 201 G 99% A 50% G 49% A 35% G 66% A 51% G 49% A 25% G 74% A 99% G 99% A A G G G 203 G 99% A 50% G 49% A 33% G 65% A 50% G 49% A 25% G 74% A 99% G 99% C C T T T 307 T 99% C 51% T 49% C 34% T 65% C 50% T 49% C 25% T 74% C 99% T 99% A A A A T 3 361 T 99% No calls for No calls for No calls for T 48% No calls for T 49% C C C C T 380 T 99% variants (no variants (no variants (no T 48% variants (no T 49% G G G G A 383 A 99% variant variant variant A 48% variant A 49% C C C C A 455 A 99% detected) detected) detected) A 48% detected) A 49% C C C C A 4 505 A 99% A 52% A 52% G G G G T 509 T 99% T 52% T 52% T T T T A 514 A 99% A 53% A 52% A A A A T 544 T 99% T 53% T 52% A A A A G 577 G 99% G 53% G 52% T T T T A 594 A 99% A 52% A 51% G G G G C 602 C 99% C 53% C 52% G G G G T 5 667 T 99% T 50% T 51% G C G C G 676 G 100% C 50% G 50% G 99% G 99% C 25% G 74% G 99% G 99% C C C C G 697 G 99% No calls for No calls for No calls for G 50% No calls for G 51% A A A A G 712 G 99% variants (no variants (no variants (no G 50% variants (no G 52% C C C C G 733 G 99% variant variant variant G 50% variant G 51% T T T T C 744 C 99% detected) detected) detected) C 50% detected) C 51% A A A A G 787 G 99% G 52% G 53% T T T T A 800 A 99% A 50% A 51%

(127) TABLE-US-00026 TABLE 6 RHCE Expected results based on known genotypes DdCcee (exons 1-2)- CE (exon 1)-DD ddCcee Polymorphic sites Exonic (exons 2-9)-CE (exons 3-9)- ce cE Ce CE D Ex position (exon 10) ddCcEe DD (exon 10) ddCcee DDCcEe ddccee DDCCee C C T T T 2 150 T 100% C 50% T 50% C 33.3% C 50% T 50% C 25% T 75% C 100% T 100% T 66.6% C C A A A 178 A 100% C 50% A 50% C 33.3% A 50% C 50% C 25% A 75% C 100% A 100% A 66.6% A A G G G 201 G 100% A 50% G 50% A 33.3% A 50% G 50% A 25% G 75% A 100% G 100% G 66.6% A A G G G 203 G 100% A 50% G 50% A 33.3% A 50% G 50% A 25% G 75% A 100% G 100% G 66.6% C C T T T 307 T 100% C 50% T 50% C 33.3% C 50% T 50% C 25% T 75% C 100% T 100% T 66.6% A A A A T 3 361 T 100% RHD RHD RHD T 50% RHD T 50% C C C C T 380 T 100% deleted, deleted, deleted, T 50% deleted, T 50% G G G G A 383 A 100% no calls no calls no calls A 50% no calls A 50% C C C C A 455 A 100% expected expected expected A 50% expected A 50% C C C C A 4 505 A 100% A 50% A 50% G G G G T 509 T 100% T 50% T 50% T T T T A 514 A 100% A 50% A 50% A A A A T 544 T 100% T 50% T 50% A A A A G 577 G 100% G 50% G 50% T T T T A 594 A 100% A 50% A 50% G G G G C 602 C 100% C 50% C 50% G G G G T 5 667 T 100% T 50% T 50% G C G C G 676 G 100% C 50% G 50% G 100% G 100% C 25% G 75% G 100% G 100% C C C C G 697 G 100% RHD RHD RHD G 50% RHD G 50% A A A A G 712 G 100% deleted, deleted, deleted, G 50% deleted, G 50% C C C C G 733 G 100% no calls no calls no calls G 50% no calls G 50% T T T T C 744 C 100% expected expected expected C 50% expected C 50% A A A A G 787 G 100% G 50% G 50% T T T T A 800 A 100% A 50% A 50%

(128) TABLE-US-00027 TABLE 7 RHD Obtained results based on analysis DdCcee (exons 1-2)- CE (exon 1)-DD ddCcee Polymorphic sites Exonic (exons 2-9)-CE (exons 3-9)- ce cE Ce CE D Exon position (exon 10) ddCcEe DD (exon 10) ddCcee DDCcEe ddccee DDCCee C C T T T 2 150 No calls for C 51% C 34% C 52% C 25% C 99% No calls for C C A A A 178 variants (no C 51% C 34% C 51% C 24% C 99% variants (no A A G G G 201 variant A 50% A 33% A 50% A 24% A 99% variant A A G G G 203 detected) A 50% A 33% A 50% A 24% A 99% detected) C C T T T 307 C 50% C 34% C 50% C 24% C 99% A A A A T 3 361 A 99% A 99% A 99% A 51% A 99% A 49% C C C C T 380 C 99% C 99% C 99% C 51% C 99% C 50% G G G G A 383 G 99% G 99% G 99% G 51% G 99% G 50% C C C C A 455 C 99% C 99% C 99% C 51% C 99% C 49% C C C C A 4 505 C 99% C 99% C 99% C 46% C 99% C 47% G G G G T 509 G 99% G 99% G 99% G 46% G 99% G 47% T T T T A 514 T 99% T 99% T 99% T 46% T 99% T 47% A A A A T 544 A 99% A 99% A 99% A 46% A 99% A 47% A A A A G 577 A 99% A 99% A 99% A 46% A 99% A 47% T T T T A 594 T 99% T 99% T 99% T 46% T 99% T 47% G G G G C 602 G 99% G 99% G 99% G 46% G 99% G 47% T T T T G 5 667 G 99% G 99% G 99% G 49% G 99% G 48% G C G C G 676 C 49% No call No call C 25% No call No call C C C C G 697 C 99% C 99% C 99% C 49% C 99% C 48% A A A A G 712 A 99% A 99% A 99% A 49% A 99% A 47% C C C C G 733 C 99% C 99% C 99% C 49% C 99% C 48% T T T T C 744 T 99% T 99% T 99% T 49% T 99% T 48% A A A A G 787 A 99% A 99% A 99% A 47% A 99% A 46% T T T T A 800 T 99% T 99% T 99% T 48% T 99% T 47%

(129) TABLE-US-00028 TABLE 8 RHD Expected results based on known genotype CE (exon 1)-DD DdCcee (exons 1-2)- Polymorphic sites Exonic (exons 2-9)-CE ddCcee (exons 3-9)- ce cE Ce CE D Exon position (exon 10) ddCcEe DD (exon 10) ddCcee DDCcEe ddccee DDCCee C C T T T 2 150 RHCE deleted, C 50% C 33.3% C 50% C 25% C 100% No calls C C A A A 178 no calls C 50% C 33.3% C 50% C 25% C 100% expected A A G G G 201 expected A 50% A 33.3% A 50% A 25% A 100% A A G G G 203 A 50% A 33.3% A 50% A 25% A 100% C C T T T 307 C 50% C 33.3% C 50% C 25% C 100% A A A A T 3 361 A 100% A 100% A 100% A 50% A 100% A 50% C C C C T 380 C 100% C 100% C 100% C 50% C 100% C 50% G G G G A 383 G 100% G 100% G 100% G 50% G 100% G 50% C C C C A 455 C 100% C 100% C 100% C 50% C 100% C 50% C C C C A 4 505 C 100% C 100% C 100% C 50% C 100% C 50% G G G G T 509 G 100% G 100% G 100% G 50% G 100% G 50% T T T T A 514 T 100% T 100% T 100% T 50% T 100% T 50% A A A A T 544 A 100% A 100% A 100% A 50% A 100% A 50% A A A A G 577 A 100% A 100% A 100% A 50% A 100% A 50% T T T T A 594 T 100% T 100% T 100% T 50% T 100% T 50% G G G G C 602 G 100% G 100% G 100% G 50% G 100% G 50% T T T T G 5 667 T 100% T 100% T 100% T 50% T 100% T 50% G C G C G 676 C 50% No calls No calls C 25% No calls No calls expected expected expected expected C C C C G 697 C 100% C 100% C 100% C 50% C 100% C 50% A A A A G 712 A 100% A 100% A 100% A 50% A 100% A 50% C C C C G 733 C 100% C 100% C 100% C 50% C 100% C 50% T T T T C 744 T 100% T 100% T 100% T 50% T 100% T 50% A A A A G 787 A 100% A 100% A 100% A 50% A 100% A 50% T T T T A 800 T 100% T 100% T 100% T 50% T 100% T 50%

(130) TABLE-US-00029 TABLE 14 Observed genotypes against reference sequence RHD (SEQ NO: 25) using the combination of primers of mix A. Mutation in reference Genotypes Exon to coding region ddccee DDCCee DdCcee ddCCee DDccEE ddccee D?ccEe 1 c.148 + 18A > C 1.00 0.48 0.64 1.00 0.48 0.65 0.66 2 c.150T > C 1.00 0.00 0.35 0.00 0.57 0.75 0.70 c.178A > C 1.00 0.00 0.35 0.00 0.56 0.73 0.69 c.201G > A 1.00 0.00 0.32 0.00 0.54 0.72 0.68 c.203G > A 1.00 0.00 0.32 0.00 0.53 0.72 0.67 c.307T > C 1.00 0.00 0.32 0.00 0.54 0.73 0.68 3 c.335 13C > T 1.00 0.45 0.55 1.00 0.43 0.61 0.60 c.336 8T > A 1.00 0.44 0.54 1.00 0.43 0.61 0.59 c.361T > A 1.00 0.46 0.57 1.00 0.46 0.63 0.61 c.380T > C 1.00 0.47 0.56 1.00 0.46 0.63 0.61 c.383A > G 1.00 0.47 0.57 1.00 0.46 0.64 0.62 c.455A > C 1.00 0.47 0.57 1.00 0.46 0.63 0.62 4 c.487 48insT 1.00 0.50 0.65 1.00 0.51 0.73 1.00 c.505A > C 1.00 0.51 0.66 1.00 0.52 0.74 1.00 c.509T > G 1.00 0.50 0.65 1.00 0.51 0.73 1.00 c.514A > T 1.00 0.51 0.66 1.00 0.51 0.74 1.00 c.544T > A 1.00 0.51 0.66 1.00 0.52 0.74 1.00 c.577G > A 1.00 0.50 0.65 1.00 0.52 0.73 1.00 c.594A > T 1.00 0.51 0.65 1.00 0.52 0.74 1.00 c.602C > G 1.00 0.51 0.65 1.00 0.52 0.74 1.00 5 c.667T > G 1.00 0.50 0.67 1.00 0.49 1.00 1.00 c.676G > C 0.00 0.00 0.00 0.00 0.49 0.00 0.65 c.697G > C 1.00 0.50 0.67 1.00 0.49 0.65 1.00 c.712G > A 1.00 0.50 0.67 1.00 0.49 0.65 1.00 c.733G > C 1.00 0.50 0.67 1.00 0.49 0.65 1.00 c.744C > T 1.00 0.50 0.67 1.00 0.49 0.65 1.00 c.787G > A 1.00 0.49 0.67 1.00 0.49 0.65 1.00 c.800A > T 1.00 0.50 0.67 1.00 0.49 0.65 1.00 6 c.916G > A 1.00 0.50 0.67 1.00 0.50 0.67 0.66 c.932A > G 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.939 + 21C > T 1.00 0.50 0.67 1.00 0.49 0.67 0.66 c.939 + 22C > G 1.00 0.50 0.67 1.00 0.49 0.67 0.66 c.939 + 23T > C 0.99 0.51 0.67 0.99 0.50 0.67 0.66 c.939 + 24C > T 1.00 0.50 0.67 0.99 0.49 0.67 0.66 7 c.941G > T 1.00 0.50 0.62 1.00 0.50 0.64 0.65 c.968C > A 1.00 0.50 0.61 1.00 0.49 0.63 0.64 c.974G > T 1.00 0.50 0.62 1.00 0.49 0.63 0.64 c.979A > G 1.00 0.50 0.62 1.00 0.50 0.64 0.64 c.985G > C 1.00 0.50 0.62 1.00 0.50 0.64 0.65 c.985G > A 1.00 0.50 0.62 1.00 0.50 0.63 0.64 c.989A > C 1.00 0.50 0.62 1.00 0.49 0.63 0.64 c.992A > T 1.00 0.50 0.62 1.00 0.49 0.63 0.64 c.1025T > C 1.00 0.50 0.62 1.00 0.50 0.64 0.65 c.1048G > C 1.00 0.50 0.62 1.00 0.50 0.64 0.64 c.1053C > T 1.00 0.50 0.62 1.00 0.50 0.63 0.64 c.1057G > T 0.99 0.49 0.61 0.99 0.49 0.63 0.64 c.1059A > G 0.99 0.50 0.62 1.00 0.50 0.63 0.64 c.1060G > A 1.00 0.50 0.62 1.00 0.49 0.63 0.64 9 c.1061C > A 1.00 0.50 0.62 1.00 0.50 0.64 0.65 c.1170T > C 1.00 0.51 0.65 1.00 0.46 0.36 0.67 c.1193A > T 1.00 0.52 0.66 1.00 0.47 0.37 0.68 c.1227 + 62A > G 1.00 0.50 0.65 1.00 0.46 0.36 0.67

(131) TABLE-US-00030 TABLE 15 Expected genotypes based on genotype, reference sequence RHD (SEQ NO: 25) using the combination of primers of mix A. Mutation in reference Genotypes Exon to coding region ddccee DDCCee DdCcee ddCCee DDccEE ddccee D?ccEe 1 c.148 + 18A > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 2 c.150T > C 1.00 0.00 0.33 0.00 0.50 0.67 0.67 c.178A > C 1.00 0.00 0.33 0.00 0.50 0.67 0.67 c.201G > A 1.00 0.00 0.33 0.00 0.50 0.67 0.67 c.203G > A 1.00 0.00 0.33 0.00 0.50 0.67 0.67 c.307T > C 1.00 0.00 0.33 0.00 0.50 0.67 0.67 3 c.336 13C > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.336 8T > A 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.361T > A 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.380T > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.383A > G 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.455A > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 4 c.487 48insT 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.505A > C 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.509T > G 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.514A > T 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.544T > A 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.577G > A 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.594A > T 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.602C > G 1.00 0.50 0.67 1.00 0.50 0.67 1.00 5 c.667T > G 1.00 0.50 0.67 1.00 0.50 1.00 1.00 c.676G > C 0.00 0.00 0.00 0.00 0.50 0.00 0.67 c.697G > C 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.712G > A 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.733G > C 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.744C > T 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.787G > A 1.00 0.50 0.67 1.00 0.50 0.67 1.00 c.800A > T 1.00 0.50 0.67 1.00 0.50 0.67 1.00 6 c.916G > A 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.932A > G 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.939 + 21C > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.939 + 22C > G 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.939 + 23T > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.939 + 24C > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 7 c.941G > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.968C > A 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.974G > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.979A > G 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.985G > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.986G > A 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.989A > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.992A > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1025T > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1048G > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1053C > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1057G > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1059A > G 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1060G > A 1.00 0.50 0.67 1.00 0.50 0.67 0.67 9 c.1061C > A 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1170T > C 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1193A > T 1.00 0.50 0.67 1.00 0.50 0.67 0.67 c.1227 + 62A > G 1.00 0.50 0.67 1.00 0.50 0.67 0.67

(132) TABLE-US-00031 TABLE 16 Observed genotypes against reference sequence RHD (SEQ NO: 25) using the combination of primers of mix B. Mutation in reference Genotypes Exon to coding region ddccee DDCCee DdCcee ddCCee DDccEE ddccee D?ccEe 1 c.148 + 18A > C 1 0.48 0.65 1 0.52 0.64 0.65 2 c.150T > C 1 0 0.33 0 0.53 0.68 0.71 c.178A > C 1 0 0.33 0 0.53 0.69 0.71 c.201G > A 1 0 0.33 0 0.53 0.68 0.7 c.203G > A 1 0 0.32 0 0.53 0.68 0.7 c.307T > C 1 0 0.33 0 0.53 0.68 0.7 3 c.336 13C > T 1 0.51 0.64 1 0.56 0.67 0.66 c.336 8T > A 1 0.51 0.64 1 0.56 0.67 0.66 c.361T > A 1 0.51 0.64 1 0.56 0.67 0.66 c.380T > C 1 0.51 0.64 1 0.56 0.68 0.66 c.383A > G 1 0.51 0.64 1 0.56 0.68 0.66 c.455A > C 1 0.51 0.65 1 0.56 0.67 0.66 4 c.505A > C 1 0.5 0.65 1 0.49 0.71 1 c.509T > G 1 0.5 0.65 1 0.49 0.71 1 c.514A > T 1 0.5 0.65 1 0.49 0.71 1 c.544T > A 1 0.5 0.65 1 0.49 0.71 1 c.577G > A 1 0.5 0.65 1 0.49 0.71 1 c.594A > T 1 0.51 0.65 1 0.49 0.72 1 c.602C > G 1 0.5 0.66 1 0.49 0.71 1 5 c.667T > G 1 0.55 0.76 1 0.68 1 1 c.676G > C 0 0 0 0 0.67 0 0.66 c.697G > C 1 0.55 0.76 1 0.67 0.75 1 c.712G > A 1 0.55 0.76 1 0.67 0.75 1 c.733G > C 1 0.55 0.76 1 0.68 0.76 1 c.744C > T 1 0.55 0.76 1 0.68 0.75 1 c.787G > A 1 0.51 0.73 1 0.65 0.72 1 c.800A > T 1 0.54 0.76 1 0.68 0.75 1 6 c.916G > A 1 0.52 0.64 1 0.5 0.64 0.67 c.932A > G 1 0.51 0.64 1 0.5 0.64 0.67 c.939 + 21C > T 0.99 0.5 0.63 1 0.49 0.63 0.66 c.939 + 22C > G 0.99 0.49 0.62 1 0.48 0.63 0.65 c.939 + 23T > C 0.97 0.5 0.62 0.98 0.49 0.63 0.66 c.939 + 24C > T 0.99 0.49 0.62 0.99 0.48 0.62 0.65 7 c.941G > T 1 0.48 0.63 1 0.49 0.62 0.66 c.968C > A 1 0.48 0.63 1 0.49 0.62 0.66 c.974G > T 1 0.48 0.63 1 0.48 0.62 0.66 c.979A > G 1 0.48 0.63 1 0.49 0.62 0.66 c.985G > C 1 0.48 0.63 1 0.49 0.62 0.66 c.986G > A 1 0.48 0.63 1 0.48 0.62 0.66 c.989A > C 1 0.48 0.63 1 0.49 0.62 0.66 c.992A > T 1 0.48 0.63 1 0.48 0.62 0.66 c.1025T > C 1 0.48 0.63 1 0.49 0.62 0.66 c.1048G > C 1 0.48 0.63 1 0.48 0.62 0.66 c.1053C > T 1 0.48 0.63 1 0.49 0.62 0.66 c.1057G > T 0.99 0.48 0.62 1 0.48 0.62 0.65 c.1059A > G 1 0.48 0.63 1 0.49 0.62 0.66 c.1060G > A 1 0.48 0.62 1 0.48 0.61 0.65 9 c.1061C > A 1 0.48 0.63 1 0.48 0.62 0.65 c.1154 81_1154 0.98 0.50 0.64 0.98 0.49 0.34 0.67 80insAC c.1154 67C > T 1 0.51 0.66 1 0.5 0.35 0.68 c.1170T > C 1 0.51 0.65 1 0.5 0.35 0.67 c.1193A > T 1 0.51 0.66 1 0.51 0.35 0.68

(133) TABLE-US-00032 TABLE 17 Expected genotypes based on genotypes, reference sequence RHD (SEQ NO: 25) using the combination of primers of mix B. Mutation in reference Genotypes Exon to coding region ddccee DDCCee DdCcee ddCCee DDccEE ddccee D?ccEe 1 c.148 + 18A > C 1 0.5 0.67 1 0.5 0.67 0.67 2 c.150T > C 1 0 0.33 0 0.5 0.67 0.67 c.178A > C 1 0 0.33 0 0.5 0.67 0.67 c.201G > A 1 0 0.33 0 0.5 0.67 0.67 c.203G > A 1 0 0.33 0 0.5 0.67 0.67 c.307T > C 1 0 0.33 0 0.5 0.67 0.67 3 c.336 13C > T 1 0.5 0.67 1 0.5 0.67 0.67 c.336 8T > A 1 0.5 0.67 1 0.5 0.67 0.67 c.361T > A 1 0.5 0.67 1 0.5 0.67 0.67 c.380T > C 1 0.5 0.67 1 0.5 0.67 0.67 c.383A > G 1 0.5 0.67 1 0.5 0.67 0.67 c.455A > C 1 0.5 0.67 1 0.5 0.67 0.67 4 c.505A > C 1 0.5 0.67 1 0.5 0.67 1.00 c.509T > G 1 0.5 0.67 1 0.5 0.67 1.00 c.514A > T 1 0.5 0.67 1 0.5 0.67 1.00 c.544T > A 1 0.5 0.67 1 0.5 0.67 1.00 c.577G > A 1 0.5 0.67 1 0.5 0.67 1.00 c.594A > T 1 0.5 0.67 1 0.5 0.67 1.00 c.602C > G 1 0.5 0.67 1 0.5 0.67 1.00 5 c.667T > G 1 0.5 0.67 1 0.5 1 1.00 c.676G > C 0 0 0 0 0.5 0 0.67 c.697G > C 1 0.5 0.67 1 0.5 0.67 1.00 c.712G > A 1 0.5 0.67 1 0.5 0.67 1.00 c.733G > C 1 0.5 0.67 1 0.5 0.67 1.00 c.744C > T 1 0.5 0.67 1 0.5 0.67 1.00 c.787G > A 1 0.5 0.67 1 0.5 0.67 1.00 c.800A > T 1 0.5 0.67 1 0.5 0.67 1.00 6 c.916G > A 1 0.5 0.67 1 0.5 0.67 0.67 c.932A > G 1 0.5 0.67 1 0.5 0.67 0.67 c.939 + 21C > T 1 0.5 0.67 1 0.5 0.67 0.67 c.939 + 22C > G 1 0.5 0.67 1 0.5 0.67 0.67 c.939 + 23T > C 1 0.5 0.67 1 0.5 0.67 0.67 c.939 + 24C > T 1 0.5 0.67 1 0.5 0.67 0.67 7 c.941G > T 1 0.5 0.67 1 0.5 0.67 0.67 c.968C > A 1 0.5 0.67 1 0.5 0.67 0.67 c.974G > T 1 0.5 0.67 1 0.5 0.67 0.67 c.979A > G 1 0.5 0.67 1 0.5 0.67 0.67 c.985G > C 1 0.5 0.67 1 0.5 0.67 0.67 c.986G > A 1 0.5 0.67 1 0.5 0.67 0.67 c.989A > C 1 0.5 0.67 1 0.5 0.67 0.67 c.992A > T 1 0.5 0.67 1 0.5 0.67 0.67 c.1025T > C 1 0.5 0.67 1 0.5 0.67 0.67 c.1048G > C 1 0.5 0.67 1 0.5 0.67 0.67 c.1053C > T 1 0.5 0.67 1 0.5 0.67 0.67 c.1057G > T 1 0.5 0.67 1 0.5 0.67 0.67 c.1059A > G 1 0.5 0.67 1 0.5 0.67 0.67 c.1060G > A 1 0.5 0.67 1 0.5 0.67 0.67 9 c.1061C > A 1 0.5 0.67 1 0.5 0.67 0.67 c.1154 81_1154 1 0.5 0.67 1 0.5 0.67 0.67 80insAC c.1154 67C > T 1 0.5 0.67 1 0.5 0.67 0.67 c.1170T > C 1 0.5 0.67 1 0.5 0.67 0.67 c.1193A > T 1 0.5 0.67 1 0.5 0.67 0.67

(134) TABLE-US-00033 TABLE 18 Observed genotypes against reference sequence RHCE (SEQ NO: 26) using the combination of primers of mix A. Mutation in reference Genotypes Exon to coding region ddccee DDCCee DdCcee ddCCee DDccEE ddccee D?ccEe 1 c.148 + 18C > A 0.00 0.53 0.36 0.00 0.52 0.35 0.34 2 c.150C > T 0.00 1.00 0.67 1.00 0.45 0.27 0.32 c.178C > A 0.00 1.00 0.67 1.00 0.45 0.28 0.32 c.201A > G 0.00 1.00 0.68 1.00 0.46 0.28 0.32 c.203A > G 0.00 1.00 0.68 1.00 0.46 0.28 0.32 c.307C > T 0.00 1.00 0.68 1.00 0.46 0.27 0.32 3 c.336 13T > C 0.00 0.54 0.44 0.00 0.55 0.37 0.39 c.336 8A > T 0.00 0.53 0.44 0.00 0.55 0.37 0.39 c.361A > T 0.00 0.53 0.44 0.00 0.54 0.37 0.39 c.380C > T 0.00 0.53 0.43 0.00 0.54 0.36 0.39 c.383G > A 0.00 0.53 0.43 0.00 0.54 0.36 0.38 c.455C > A 0.00 0.53 0.43 0.00 0.54 0.36 0.38 4 c.487 48delT 0.00 0.49 0.34 0.00 0.49 0.27 0.00 c.505C > A 0.00 0.49 0.34 0.00 0.48 0.25 0.00 c.509G > T 0.00 0.50 0.35 0.00 0.49 0.27 0.00 c.514T > A 0.00 0.49 0.34 0.00 0.48 0.26 0.00 c.544A > T 0.00 0.49 0.35 0.00 0.48 0.26 0.00 c.577A > G 0.00 0.50 0.35 0.00 0.48 0.26 0.00 c.594T > A 0.00 0.48 0.34 0.00 0.47 0.23 0.00 c.602G > C 0.00 0.49 0.34 0.00 0.48 0.24 0.00 5 c.667G > T 0.00 0.50 0.33 0.00 0.51 0.00 0.00 c.676G > C 0.00 0.00 0.00 0.00 0.49 0.00 0.65 c.697C > G 0.00 0.50 0.33 0.00 0.51 0.35 0.00 c.712A > G 0.00 0.50 0.33 0.00 0.51 0.35 0.00 c.733C > G 0.00 0.50 0.33 0.00 0.51 0.35 0.00 c.744T > C 0.00 0.50 0.33 0.00 0.51 0.35 0.00 c.787A > G 0.00 0.52 0.34 0.00 0.52 0.36 0.00 c.800T > A 0.00 0.51 0.33 0.00 0.51 0.35 0.00 6 c.916A > G 0.00 0.50 0.33 0.00 0.51 0.33 0.34 c.932G > A 0.00 0.50 0.33 0.00 0.51 0.33 0.34 c.939 + 21T > C 0.00 0.49 0.33 0.00 0.50 0.33 0.33 c.939 + 22G > C 0.00 0.49 0.33 0.00 0.50 0.33 0.33 c.939 + 23C > T 0.00 0.48 0.32 0.00 0.50 0.32 0.33 c.939 + 24T > C 0.00 0.50 0.33 0.00 0.51 0.33 0.34 7 c.941T > G 0.00 0.50 0.38 0.00 0.50 0.36 0.35 c.968A > C 0.00 0.50 0.38 0.00 0.50 0.36 0.36 c.974T > G 0.00 0.50 0.38 0.00 0.50 0.37 0.36 c.979G > A 0.00 0.50 0.38 0.00 0.50 0.36 0.36 c.985C > G 0.00 0.50 0.38 0.00 0.50 0.36 0.36 c.986A > G 0.00 0.50 0.38 0.00 0.50 0.36 0.36 c.989C > A 0.00 0.50 0.38 0.00 0.50 0.36 0.36 c.992T > A 0.00 0.50 0.38 0.00 0.50 0.36 0.36 c.1025C > T 0.00 0.50 0.38 0.00 0.50 0.36 0.35 c.1048C > G 0.00 0.50 0.38 0.00 0.50 0.36 0.36 c.1053T > C 0.00 0.50 0.38 0.00 0.50 0.36 0.36 c.1057T > G 0.00 0.50 0.38 0.00 0.50 0.36 0.35 c.1059G > A 0.00 0.49 0.37 0.00 0.49 0.36 0.35 c.1060A > G 0.00 0.51 0.38 0.00 0.51 0.37 0.36 9 c.1061A > C 0.00 0.50 0.38 0.00 0.51 0.37 0.36 c.1170C > T 0.00 0.49 0.35 0.00 0.54 0.64 0.33 c.1193T > A 0.00 0.49 0.35 0.00 0.54 0.64 0.33 c.1227 + 62G > A 0.00 0.49 0.35 0.00 0.54 0.64 0.33

(135) TABLE-US-00034 TABLE 19 Expected genotypes based on genotype, reference sequence RHCE (SEQ NO: 26) using the combination of primers of mix A. Mutation in reference Genotypes Exon to coding region ddccee DDCCee DdCcee ddCCee DDccEE ddccee D?ccEe 1 c.148 + 18C > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 2 c.150C > T 0.00 1.00 0.67 1.00 0.50 0.33 0.33 c.178C > A 0.00 1.00 0.67 1.00 0.50 0.33 0.33 c.201A > G 0.00 1.00 0.67 1.00 0.50 0.33 0.33 c.203A > G 0.00 1.00 0.67 1.00 0.50 0.33 0.33 c.307C > T 0.00 1.00 0.67 1.00 0.50 0.33 0.33 3 c.336 13T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.336 8A > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.361A > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.380C > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.383G > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.455C > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 4 c.487 48delT 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.505C > A 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.509G > T 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.514T > A 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.544A > T 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.577A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.594T > A 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.602G > C 0.00 0.50 0.33 0.00 0.50 0.33 0.00 5 c.667G > T 0.00 0.50 0.33 0.00 0.50 0.00 0.00 c.676G > C 0.00 0.00 0.00 0.00 0.50 0.00 0.67 c.697C > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.712A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.733C > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.744T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.787A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.800T > A 0.00 0.50 0.33 0.00 0.50 0.33 0.00 6 c.916A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.932G > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.939 + 21T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.939 + 22G > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.939 + 23C > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.939 + 24T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 7 c.941T > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.968A > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.974T > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.979G > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.985C > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.986A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.989C > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.992T > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1025C > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1048C > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1053T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1057T > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1059G > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1060A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 9 c.1061A > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1170C > T 0.00 0.50 0.33 0.00 0.50 0.67 0.33 c.1193T > A 0.00 0.50 0.33 0.00 0.50 0.67 0.33 c.1227 + 62G > A 0.00 0.50 0.33 0.00 0.50 0.67 0.33

(136) TABLE-US-00035 TABLE 20 Observed genotypes against reference sequence RHCE (SEQ NO: 26) using the combination of primers of mix B. Mutation in reference Genotypes Exon to coding region ddccee DDCCee DdCcee ddCCee DDccEE ddccee D?ccEe 1 c.148 + 18C > A 0.00 0.52 0.34 0.00 0.48 0.36 0.35 2 c.150C > T 0.00 1.00 0.67 1.00 0.47 0.32 0.29 c.178C > A 0.00 1.00 0.67 1.00 0.47 0.31 0.29 c.201A > G 0.00 1.00 0.67 1.00 0.47 0.32 0.30 c.203A > G 0.00 1.00 0.68 1.00 0.47 0.32 0.30 c.307C > T 0.00 1.00 0.67 1.00 0.47 0.32 0.30 3 c.336 13T > C 0.00 0.50 0.36 0.00 0.45 0.33 0.35 c.336 8A > T 0.00 0.50 0.36 0.00 0.45 0.33 0.34 c.361A > T 0.00 0.50 0.36 0.00 0.44 0.33 0.35 c.380C > T 0.00 0.50 0.36 0.00 0.44 0.33 0.34 c.383G > A 0.00 0.50 0.36 0.00 0.44 0.32 0.34 c.455C > A 0.00 0.50 0.36 0.00 0.44 0.33 0.34 4 c.505C > A 0.00 0.50 0.35 0.00 0.51 0.28 0.00 c.509G > T 0.00 0.50 0.35 0.00 0.51 0.29 0.00 c.514T > A 0.00 0.50 0.35 0.00 0.51 0.29 0.00 c.544A > T 0.00 0.50 0.35 0.00 0.51 0.29 0.00 c.577A > G 0.00 0.50 0.35 0.00 0.51 0.29 0.00 c.594T > A 0.00 0.49 0.35 0.00 0.51 0.28 0.00 c.602G > C 0.00 0.49 0.34 0.00 0.51 0.29 0.00 5 c.667G > T 0.00 0.45 0.24 0.00 0.32 0.00 0.00 c.675G > C 0.00 0.00 0.00 0.00 0.67 0.00 0.66 c.697C > G 0.00 0.45 0.24 0.00 0.33 0.25 0.00 c.712A > G 0.00 0.45 0.24 0.00 0.33 0.25 0.00 c.733C > G 0.00 0.45 0.24 0.00 0.32 0.24 0.00 c.744T > C 0.00 0.45 0.24 0.00 0.32 0.25 0.00 c.787A > G 0.00 0.49 0.27 0.00 0.35 0.28 0.00 c.800T > A 0.00 0.46 0.24 0.00 0.32 0.24 0.00 6 c.916A > G 0.00 0.48 0.36 0.00 0.50 0.36 0.33 c.932G > A 0.00 0.49 0.36 0.00 0.50 0.36 0.33 c.939 + 21T > C 0.00 0.46 0.34 0.00 0.48 0.34 0.31 c.939 + 22G > C 0.00 0.47 0.35 0.00 0.49 0.35 0.32 c.939 + 23C > T 0.00 0.46 0.34 0.00 0.47 0.34 0.31 c.939 + 24T > C 0.00 0.47 0.35 0.00 0.49 0.35 0.32 7 c.941T > G 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.968A > C 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.974T > G 0.00 0.52 0.37 0.00 0.52 0.38 0.34 c.979G > A 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.985C > G 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.986A > G 0.00 0.52 0.37 0.00 0.52 0.38 0.34 c.989C > A 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.992T > A 0.00 0.52 0.37 0.00 0.52 0.38 0.34 c.1025C > T 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.1048C > G 0.00 0.52 0.37 0.00 0.52 0.38 0.34 c.1053T > C 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.1057T > G 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.1059G > A 0.00 0.51 0.37 0.00 0.51 0.37 0.34 c.1060A > G 0.00 0.52 0.37 0.00 0.51 0.38 0.35 9 c.1061A > C 0.00 0.52 0.37 0.00 0.51 0.38 0.34 c.1154 82_1154 0.00 0.49 0.34 0.00 0.50 0.65 0.32 81delAC c.1154 67T > C 0.00 0.49 0.34 0.00 0.50 0.65 0.32 c.1170C > T 0.00 0.49 0.35 0.00 0.50 0.65 0.33 c.1193T > A 0.00 0.49 0.34 0.00 0.49 0.65 0.32

(137) TABLE-US-00036 TABLE 21 Expected genotypes based on genotypes, reference sequence RHCE (SEQ NO: 26) using the combination of primers of mix B. Mutation in reference Genotypes Exon to coding region ddccee DDCCee DdCcee ddCCee DDccEE ddccee D?ccEe 1 c.148 + 18C > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 2 c.150C > T 0.00 1.00 0.67 1.00 0.50 0.33 0.33 c.178C > A 0.00 1.00 0.67 1.00 0.50 0.33 0.33 c.201A > G 0.00 1.00 0.67 1.00 0.50 0.33 0.33 c.203A > G 0.00 1.00 0.67 1.00 0.50 0.33 0.33 c.307C > T 0.00 1.00 0.67 1.00 0.50 0.33 0.33 3 c.336 13T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.336 8A > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.361A > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.380C > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.383G > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.455C > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 4 c.505C > A 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.509G > T 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.514T > A 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.544A > T 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.577A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.594T > A 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.602G > C 0.00 0.50 0.33 0.00 0.50 0.33 0.00 5 c.667G > T 0.00 0.50 0.33 0.00 0.50 0.00 0.00 c.676G > C 0.00 0.00 0.00 0.00 0.50 0.00 0.67 c.697C > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.712A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.733C > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.744T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.787A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.00 c.800T > A 0.00 0.50 0.33 0.00 0.50 0.33 0.00 6 c.916A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.932G > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.939 + 21T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.939 + 22G > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.939 + 23C > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.939 + 24T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 7 c.941T > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.968A > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.974T > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.979G > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.985C > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.986A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.989C > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.992T > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1025C > T 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1048C > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1053T > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1057T > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1059G > A 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1060A > G 0.00 0.50 0.33 0.00 0.50 0.33 0.33 9 c.1061A > C 0.00 0.50 0.33 0.00 0.50 0.33 0.33 c.1154 82_1154 0.00 0.50 0.33 0.00 0.50 0.67 0.33 81delAC c.1154 67T > C 0.00 0.50 0.33 0.00 0.50 0.67 0.33 c.1170C > T 0.00 0.50 0.33 0.00 0.50 0.67 0.33 c.1193T > A 0.00 0.50 0.33 0.00 0.50 0.67 0.33

(138) TABLE-US-00037 TABLE 22 Observed genotypes against reference sequence RHD (SEQ NO: 25) using the combination of primers of mix A. Mutation in reference Genotypes Exon to coding region DDCCee ddCcEe ddCcee ddccee ddccee Dccee 1 c.148 + 18A > C 0.49 1.00 1.00 1.00 1.00 0.46 2 c.150T > C 0.00 0.51 0.51 1.00 1.00 0.28 c.178A > C 0.00 0.51 0.52 1.00 1.00 0.28 c.201G > A 0.00 0.51 0.51 1.00 1.00 0.28 c.203G > A 0.00 0.50 0.50 1.00 1.00 0.27 c.307T > C 0.00 0.51 0.51 1.00 1.00 0.28 3 c.336 13C > T 0.55 1.00 1.00 1.00 1.00 0.52 c.336 8T > A 0.55 1.00 1.00 1.00 1.00 0.52 c.361T > A 0.54 1.00 1.00 1.00 1.00 0.52 c.380T > C 0.55 1.00 1.00 1.00 1.00 0.52 c.383A > G 0.56 1.00 1.00 1.00 1.00 0.53 c.455A > C 0.55 1.00 1.00 1.00 1.00 0.52 4 c.487 48_487 0.51 1.00 1.00 1.00 1.00 0.49 47insT c.505A > C 0.51 1.00 1.00 1.00 1.00 0.50 c.509T > G 0.50 1.00 1.00 1.00 1.00 0.48 c.514A > T 0.51 1.00 1.00 1.00 1.00 0.49 c.544T > A 0.51 1.00 1.00 1.00 1.00 0.49 c.577G > A 0.49 1.00 1.00 1.00 1.00 0.48 c.594A > T 0.53 1.00 1.00 1.00 1.00 0.51 c.602C > G 0.50 1.00 1.00 1.00 1.00 0.49 5 c.667T > G 0.45 1.00 1.00 1.00 1.00 0.47 c.676G > C 0.00 0.50 0.00 0.00 0.00 0.00 c.697G > C 0.45 1.00 1.00 1.00 1.00 0.47 c.712G > A 0.45 1.00 1.00 1.00 1.00 0.46 c.733G > C 0.45 1.00 1.00 1.00 1.00 0.47 c.744C > T 0.45 1.00 1.00 1.00 1.00 0.47 c.787G > A 0.42 1.00 1.00 1.00 1.00 0.43 c.800A > T 0.44 1.00 1.00 1.00 1.00 0.46 6 c.916G > A 0.48 1.00 1.00 1.00 1.00 0.49 c.932A > G 0.48 1.00 1.00 1.00 1.00 0.49 c.939 + 21C > T 0.47 0.99 0.99 0.99 0.99 0.48 c.939 + 22C > G 0.45 0.98 0.97 0.98 0.98 0.47 c.939 + 23T > C 0.47 0.94 0.94 0.95 0.94 0.49 c.939 + 24C > T 0.45 0.97 0.97 0.97 0.98 0.45 7 c.941G > T 0.44 1.00 1.00 1.00 1.00 0.43 c.968C > A 0.45 1.00 1.00 1.00 1.00 0.43 c.974G > T 0.44 1.00 1.00 1.00 1.00 0.43 c.979A > G 0.45 1.00 1.00 1.00 1.00 0.43 c.985G > C 0.44 1.00 1.00 1.00 1.00 0.43 c.986G > A 0.44 1.00 1.00 1.00 1.00 0.43 c.989A > C 0.44 1.00 1.00 1.00 1.00 0.43 c.992A > T 0.45 1.00 1.00 1.00 1.00 0.43 c.1025T > C 0.45 1.00 1.00 1.00 1.00 0.43 c.1048G > C 0.44 1.00 1.00 1.00 1.00 0.43 c.1053C > T 0.44 1.00 1.00 1.00 1.00 0.43 c.1057G > T 0.44 0.99 0.99 0.99 0.99 0.42 c.1059A > G 0.46 0.99 0.99 0.99 0.99 0.45 c.1060G > A 0.42 1.00 1.00 1.00 1.00 0.41 9 c.1061C > A 0.43 0.99 1.00 1.00 1.00 0.42 c.1170T > C 0.50 1.00 1.00 1.00 1.00 0.50 c.1193A > T 0.51 1.00 1.00 1.00 1.00 0.51 c.1227 + 62A > G 0.51 1.00 1.00 1.00 1.00 0.50

(139) TABLE-US-00038 TABLE 23 Expected genotypes based on genotype, reference sequence RHD (SEQ NO: 25) using the combination of primers of mix A. Mutation in reference Genotypes Exon to coding region DDCCee ddCcEe ddCcee ddccee ddccee Dccee 1 c.148 + 18A > C 0.50 1.00 1.00 1.00 1.00 0.67 2 c.150T > C 0.00 0.50 0.50 1.00 1.00 0.33 c.178A > C 0.00 0.50 0.50 1.00 1.00 0.33 c.201G > A 0.00 0.50 0.50 1.00 1.00 0.33 c.203G > A 0.00 0.50 0.50 1.00 1.00 0.33 c.307T > C 0.00 0.50 0.50 1.00 1.00 0.33 3 c.336 13C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.336 8T > A 0.50 1.00 1.00 1.00 1.00 0.67 c.361T > A 0.50 1.00 1.00 1.00 1.00 0.67 c.380T > C 0.50 1.00 1.00 1.00 1.00 0.67 c.383A > G 0.50 1.00 1.00 1.00 1.00 0.67 c.455A > C 0.50 1.00 1.00 1.00 1.00 0.67 4 c.487 48_487 0.50 1.00 1.00 1.00 1.00 0.67 47insT c.505A > C 0.50 1.00 1.00 1.00 1.00 0.67 c.509T > G 0.50 1.00 1.00 1.00 1.00 0.67 c.514A > T 0.50 1.00 1.00 1.00 1.00 0.67 c.544T > A 0.50 1.00 1.00 1.00 1.00 0.67 c.577G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.594A > T 0.50 1.00 1.00 1.00 1.00 0.67 c.602C > G 0.50 1.00 1.00 1.00 1.00 0.67 5 c.667T > G 0.50 1.00 1.00 1.00 1.00 0.67 c.676G > C 0.00 0.50 0.00 0.00 0.00 0.00 c.697G > C 0.50 1.00 1.00 1.00 1.00 0.67 c.712G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.733G > C 0.50 1.00 1.00 1.00 1.00 0.67 c.744C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.787G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.800A > T 0.50 1.00 1.00 1.00 1.00 0.67 6 c.916G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.932A > G 0.50 1.00 1.00 1.00 1.00 0.67 c.939 + 21C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.939 + 22C > G 0.50 1.00 1.00 1.00 1.00 0.67 c.939 + 23T > C 0.50 1.00 1.00 1.00 1.00 0.67 c.939 + 24C > T 0.50 1.00 1.00 1.00 1.00 0.67 7 c.941G > T 0.50 1.00 1.00 1.00 1.00 0.67 c.968C > A 0.50 1.00 1.00 1.00 1.00 0.67 c.974G > T 0.50 1.00 1.00 1.00 1.00 0.67 c.979A > G 0.50 1.00 1.00 1.00 1.00 0.67 c.985G > C 0.50 1.00 1.00 1.00 1.00 0.67 c.986G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.989A > C 0.50 1.00 1.00 1.00 1.00 0.67 c.992A > T 0.50 1.00 1.00 1.00 1.00 0.67 c.1025T > C 0.50 1.00 1.00 1.00 1.00 0.67 c.1048G > C 0.50 1.00 1.00 1.00 1.00 0.67 c.1053C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.1057G > T 0.50 1.00 1.00 1.00 1.00 0.67 c.1059A > G 0.50 1.00 1.00 1.00 1.00 0.67 c.1060G > A 0.50 1.00 1.00 1.00 1.00 0.67 9 c.1061C > A 0.50 1.00 1.00 1.00 1.00 0.67 c.1170T > C 0.50 1.00 1.00 1.00 1.00 0.67 c.1193A > T 0.50 1.00 1.00 1.00 1.00 0.67 c.1227 + 62A > G 0.50 1.00 1.00 1.00 1.00 0.67

(140) TABLE-US-00039 TABLE 24 Observed genotypes against reference sequence RHD (SEQ NO: 25) using the combination of primers of mix B. Mutation in reference Genotypes Exon to coding region DDCCee ddCcEe ddCcee ddccee ddccee Dccee 1 c.148 + 18A > C 0.51 1.00 1.00 0.99 0.99 0.49 2 c.150T > C 0.00 0.51 0.52 1.00 1.00 0.28 c.178A > C 0.00 0.52 0.53 1.00 1.00 0.29 c.201G > A 0.00 0.50 0.51 1.00 1.00 0.27 c.203G > A 0.00 0.49 0.50 1.00 1.00 0.26 c.307T > C 0.00 0.48 0.47 0.99 1.00 0.25 3 c.336 13C > T 0.63 1.00 1.00 1.00 1.00 0.66 c.336 8T > A 0.64 1.00 1.00 1.00 1.00 0.67 c.361T > A 0.62 1.00 1.00 1.00 1.00 0.66 c.380T > C 0.64 1.00 1.00 1.00 1.00 0.67 c.383A > G 0.64 1.00 1.00 1.00 1.00 0.67 c.455A > C 0.62 1.00 1.00 1.00 1.00 0.66 4 c.505A > C 0.50 1.00 1.00 1.00 1.00 0.50 c.509T > G 0.50 1.00 1.00 1.00 1.00 0.49 c.514A > T 0.50 1.00 1.00 1.00 1.00 0.50 c.544T > A 0.50 1.00 1.00 1.00 1.00 0.50 c.577G > A 0.49 1.00 1.00 1.00 1.00 0.49 c.594A > T 0.51 1.00 1.00 1.00 1.00 0.50 c.602C > G 0.50 1.00 1.00 1.00 1.00 0.50 5 c.667T > G 0.48 1.00 1.00 1.00 1.00 0.59 c.676G > C 0.00 0.49 0.00 0.00 0.00 0.00 c.697G > C 0.49 1.00 1.00 1.00 1.00 0.60 c.712G > A 0.49 1.00 1.00 1.00 1.00 0.59 c.733G > C 0.50 1.00 1.00 1.00 1.00 0.61 c.744C > T 0.50 1.00 1.00 1.00 1.00 0.61 c.787G > A 0.41 1.00 1.00 1.00 1.00 0.52 c.800A > T 0.48 1.00 1.00 1.00 1.00 0.59 6 c.916G > A 0.49 1.00 1.00 1.00 1.00 0.50 c.932A > G 0.51 1.00 1.00 1.00 1.00 0.51 c.939 + 21C > T 0.41 0.99 0.98 0.99 0.99 0.42 c.939 + 22C > G 0.38 0.98 0.97 0.97 0.97 0.39 c.939 + 23T > C 0.43 0.94 0.93 0.91 0.92 0.44 c.939 + 24C > T 0.38 0.98 0.98 0.97 0.97 0.41 7 c.941G > T 0.45 1.00 1.00 1.00 1.00 0.45 c.968C > A 0.45 1.00 1.00 1.00 1.00 0.45 c.974G > T 0.45 1.00 1.00 1.00 1.00 0.44 c.979A > G 0.45 1.00 1.00 1.00 1.00 0.45 c.985G > C 0.45 1.00 1.00 1.00 1.00 0.45 c.986G > A 0.46 1.00 1.00 1.00 1.00 0.45 c.989A > C 0.45 1.00 1.00 1.00 1.00 0.44 c.992A > T 0.45 1.00 1.00 1.00 1.00 0.44 c.1025T > C 0.45 1.00 1.00 1.00 1.00 0.45 c.1048G > C 0.45 1.00 1.00 1.00 1.00 0.45 c.1053C > T 0.45 1.00 1.00 1.00 1.00 0.46 c.1057G > T 0.44 0.99 0.99 0.99 0.99 0.44 c.1059A > G 0.46 0.99 0.99 0.99 1.00 0.45 c.1060G > A 0.44 1.00 1.00 1.00 1.00 0.44 9 c.1061C > A 0.45 1.00 1.00 1.00 1.00 0.45 c.1154 81_1154 0.47 0.98 0.98 0.98 0.98 0.48 80insAC c.1154 67C > T 0.48 1.00 1.00 1.00 1.00 0.49 c.1170T > C 0.47 1.00 1.00 1.00 1.00 0.47 c.1193A > T 0.50 1.00 1.00 1.00 1.00 0.51

(141) TABLE-US-00040 TABLE 25 Expected genotypes based on genotypes, reference sequence RHD (SEQ NO: 25) using the combination of primers of mix B. Mutation in reference Genotypes Exon to coding region DDCCee ddCcEe ddCcee ddccee ddccee Dccee 1 c.148 + 18A > C 0.50 1.00 1.00 1.00 1.00 0.67 2 c.150T > C 0.00 0.50 0.50 1.00 1.00 0.33 c.178A > C 0.00 0.50 0.50 1.00 1.00 0.33 c.201G > A 0.00 0.50 0.50 1.00 1.00 0.33 c.203G > A 0.00 0.50 0.50 1.00 1.00 0.33 c.307T > C 0.00 0.50 0.50 1.00 1.00 0.33 3 c.336 13C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.336 8T > A 0.50 1.00 1.00 1.00 1.00 0.67 c.361T > A 0.50 1.00 1.00 1.00 1.00 0.67 c.380T > C 0.50 1.00 1.00 1.00 1.00 0.67 c.383A > G 0.50 1.00 1.00 1.00 1.00 0.67 c.455A > C 0.50 1.00 1.00 1.00 1.00 0.67 4 c.505A > C 0.50 1.00 1.00 1.00 1.00 0.67 c.509T > G 0.50 1.00 1.00 1.00 1.00 0.67 c.514A > T 0.50 1.00 1.00 1.00 1.00 0.67 c.544T > A 0.50 1.00 1.00 1.00 1.00 0.67 c.577G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.594A > T 0.50 1.00 1.00 1.00 1.00 0.67 c.602C > G 0.50 1.00 1.00 1.00 1.00 0.67 5 c.667T > G 0.50 1.00 1.00 1.00 1.00 0.67 c.676G > C 0.00 0.50 0.00 0.00 0.00 0.00 c.697G > C 0.50 1.00 1.00 1.00 1.00 0.67 c.712G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.733G > C 0.50 1.00 1.00 1.00 1.00 0.67 c.744C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.787G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.800A > T 0.50 1.00 1.00 1.00 1.00 0.67 6 c.916G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.932A > G 0.50 1.00 1.00 1.00 1.00 0.67 c.939 + 21C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.939 + 22C > G 0.50 1.00 1.00 1.00 1.00 0.67 c.939 + 23T > C 0.50 1.00 1.00 1.00 1.00 0.67 c.939 + 24C > T 0.50 1.00 1.00 1.00 1.00 0.67 7 c.941G > T 0.50 1.00 1.00 1.00 1.00 0.67 c.968C > A 0.50 1.00 1.00 1.00 1.00 0.67 c.974G > T 0.50 1.00 1.00 1.00 1.00 0.67 c.979A > G 0.50 1.00 1.00 1.00 1.00 0.67 c.985G > C 0.50 1.00 1.00 1.00 1.00 0.67 c.986G > A 0.50 1.00 1.00 1.00 1.00 0.67 c.989A > C 0.50 1.00 1.00 1.00 1.00 0.67 c.992A > T 0.50 1.00 1.00 1.00 1.00 0.67 c.1025T > C 0.50 1.00 1.00 1.00 1.00 0.67 c.1048G > C 0.50 1.00 1.00 1.00 1.00 0.67 c.1053C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.1057G > T 0.50 1.00 1.00 1.00 1.00 0.67 c.1059A > G 0.50 1.00 1.00 1.00 1.00 0.67 c.1060G > A 0.50 1.00 1.00 1.00 1.00 0.67 9 c.1061C > A 0.50 1.00 1.00 1.00 1.00 0.67 c.1154 81_1154 0.50 1.00 1.00 1.00 1.00 0.67 80insAC c.1154 67C > T 0.50 1.00 1.00 1.00 1.00 0.67 c.1170T > C 0.50 1.00 1.00 1.00 1.00 0.67 c.1193A > T 0.50 1.00 1.00 1.00 1.00 0.67

(142) TABLE-US-00041 TABLE 26 Observed genotypes against reference sequence RHCE (SEQ NO: 26) using the combination of primers of mix A. Mutation in reference Genotypes Exon to coding region DDCCee ddCcEe ddCcee ddccee ddccee Dccee 1 c.148 + 18C > A 0.51 0.00 0.00 0.00 0.00 0.54 2 c.150C > T 1.00 0.49 0.49 0.00 0.00 0.72 c.178C > A 1.00 0.49 0.48 0.00 0.00 0.72 c.201A > G 1.00 0.49 0.49 0.00 0.00 0.72 c.203A > G 1.00 0.50 0.50 0.00 0.00 0.73 c.307C > T 1.00 0.48 0.48 0.00 0.00 0.71 3 c.336 13T > C 0.45 0.00 0.00 0.00 0.00 0.48 c.336 8A > T 0.45 0.00 0.00 0.00 0.00 0.48 c.361A > T 0.46 0.00 0.00 0.00 0.00 0.48 c.380C > T 0.45 0.00 0.00 0.00 0.00 0.48 c.383G > A 0.43 0.00 0.00 0.00 0.00 0.47 c.455C > A 0.44 0.00 0.00 0.00 0.00 0.48 4 c.487 48delT 0.49 0.00 0.00 0.00 0.00 0.51 c.505C > A 0.49 0.00 0.00 0.00 0.00 0.50 c.509G > T 0.50 0.00 0.00 0.00 0.00 0.52 c.514T > A 0.49 0.00 0.00 0.00 0.00 0.51 c.544A > T 0.49 0.00 0.00 0.00 0.00 0.51 c.577A > G 0.51 0.00 0.00 0.00 0.00 0.51 c.594T > A 0.47 0.00 0.00 0.00 0.00 0.48 c.602G > C 0.50 0.00 0.00 0.00 0.00 0.51 5 c.667G > T 0.55 0.00 0.00 0.00 0.00 0.53 c.676G > C 0.00 0.50 0.00 0.00 0.00 0.00 c.697C > G 0.55 0.00 0.00 0.00 0.00 0.53 c.712A > G 0.55 0.00 0.00 0.00 0.00 0.54 c.733C > G 0.55 0.00 0.00 0.00 0.00 0.53 c.744T > C 0.55 0.00 0.00 0.00 0.00 0.53 c.787A > G 0.58 0.00 0.00 0.00 0.00 0.57 c.800T > A 0.56 0.00 0.00 0.00 0.00 0.54 6 c.916A > G 0.52 0.00 0.00 0.00 0.00 0.51 c.932G > A 0.51 0.00 0.00 0.00 0.00 0.51 c.939 + 21T > C 0.49 0.00 0.00 0.00 0.00 0.48 c.939 + 22G > C 0.51 0.00 0.00 0.00 0.00 0.49 c.939 + 23C > T 0.47 0.00 0.00 0.00 0.00 0.46 c.939 + 24T > C 0.52 0.00 0.00 0.00 0.00 0.51 7 c.941T > G 0.55 0.00 0.00 0.00 0.00 0.57 c.968A > C 0.55 0.00 0.00 0.00 0.00 0.57 c.974T > G 0.56 0.00 0.00 0.00 0.00 0.57 c.979G > A 0.55 0.00 0.00 0.00 0.00 0.57 c.985C > G 0.56 0.00 0.00 0.00 0.00 0.57 c.986A > G 0.56 0.00 0.00 0.00 0.00 0.57 c.989C > A 0.56 0.00 0.00 0.00 0.00 0.57 c.992T > A 0.55 0.00 0.00 0.00 0.00 0.57 c.1025C > T 0.55 0.00 0.00 0.00 0.00 0.57 c.1048C > G 0.55 0.00 0.00 0.00 0.00 0.57 c.1053T > C 0.55 0.00 0.00 0.00 0.00 0.57 c.1057T > G 0.55 0.00 0.00 0.00 0.00 0.56 c.1059G > A 0.52 0.00 0.00 0.00 0.00 0.54 c.1060A > G 0.56 0.00 0.00 0.00 0.00 0.58 9 c.1061A > C 0.56 0.00 0.00 0.00 0.00 0.57 c.1170C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.1193T > A 0.49 0.00 0.00 0.00 0.00 0.49 c.1227 + 62G > A 0.49 0.00 0.00 0.00 0.00 0.50

(143) TABLE-US-00042 TABLE 27 Expected genotypes based on genotype, reference sequence RHCE (SEQ NO: 26) using the combination of primers of mix A. Mutation in reference Genotypes Exon to coding region DDCCee ddCcEe ddCcee ddccee ddccee Dccee 1 c.148 + 18C > A 0.50 0.00 0.00 0.00 0.00 0.50 2 c.150C > T 1.00 0.50 0.50 0.00 0.00 0.50 c.178C > A 1.00 0.50 0.50 0.00 0.00 0.50 c.201A > G 1.00 0.50 0.50 0.00 0.00 0.50 c.203A > G 1.00 0.50 0.50 0.00 0.00 0.50 c.307C > T 1.00 0.50 0.50 0.00 0.00 0.50 3 c.336 13T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.336 8A > T 0.50 0.00 0.00 0.00 0.00 0.50 c.361A > T 0.50 0.00 0.00 0.00 0.00 0.50 c.380C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.383G > A 0.50 0.00 0.00 0.00 0.00 0.50 c.455C > A 0.50 0.00 0.00 0.00 0.00 0.50 4 c.487 48delT 0.50 0.00 0.00 0.00 0.00 0.50 c.505C > A 0.50 0.00 0.00 0.00 0.00 0.50 c.509G > T 0.50 0.00 0.00 0.00 0.00 0.50 c.514T > A 0.50 0.00 0.00 0.00 0.00 0.50 c.544A > T 0.50 0.00 0.00 0.00 0.00 0.50 c.577A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.594T > A 0.50 0.00 0.00 0.00 0.00 0.50 c.602G > C 0.50 0.00 0.00 0.00 0.00 0.50 5 c.667G > T 0.50 0.00 0.00 0.00 0.00 0.50 c.676G > C 0.00 0.50 0.00 0.00 0.00 0.00 c.697C > G 0.50 0.00 0.00 0.00 0.00 0.50 c.712A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.733C > G 0.50 0.00 0.00 0.00 0.00 0.50 c.744T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.787A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.800T > A 0.50 0.00 0.00 0.00 0.00 0.50 6 c.916A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.932G > A 0.50 0.00 0.00 0.00 0.00 0.50 c.939 + 21T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.939 + 22G > C 0.50 0.00 0.00 0.00 0.00 0.50 c.939 + 23C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.939 + 24T > C 0.50 0.00 0.00 0.00 0.00 0.50 7 c.941T > G 0.50 0.00 0.00 0.00 0.00 0.50 c.968A > C 0.50 0.00 0.00 0.00 0.00 0.50 c.974T > G 0.50 0.00 0.00 0.00 0.00 0.50 c.979G > A 0.50 0.00 0.00 0.00 0.00 0.50 c.985C > G 0.50 0.00 0.00 0.00 0.00 0.50 c.986A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.989C > A 0.50 0.00 0.00 0.00 0.00 0.50 c.992T > A 0.50 0.00 0.00 0.00 0.00 0.50 c.1025C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.1048C > G 0.50 0.00 0.00 0.00 0.00 0.50 c.1053T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.1057T > G 0.50 0.00 0.00 0.00 0.00 0.50 c.1059G > A 0.50 0.00 0.00 0.00 0.00 0.50 c.1060A > G 0.50 0.00 0.00 0.00 0.00 0.50 9 c.1061A > C 0.50 0.00 0.00 0.00 0.00 0.50 c.1170C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.1193T > A 0.50 0.00 0.00 0.00 0.00 0.50 c.1227 + 62G > A 0.50 0.00 0.00 0.00 0.00 0.50

(144) TABLE-US-00043 TABLE 28 Observed genotypes against reference sequence RHCE (SEQ NO: 26) using the combination of primers of mix B. Mutation in reference Genotypes Exon to coding region DDCCee ddCcEe ddCcee ddccee ddccee Dccee 1 c.148 + 18C > A 0.49 0.00 0.00 0.00 0.00 0.50 2 c.150C > T 1.00 0.49 0.48 0.00 0.00 0.72 c.178C > A 1.00 0.48 0.47 0.00 0.00 0.71 c.201A > G 1.00 0.50 0.48 0.00 0.00 0.73 c.203A > G 1.00 0.51 0.50 0.00 0.00 0.74 c.307C > T 0.99 0.50 0.50 0.00 0.00 0.72 3 c.336 13T > C 0.37 0 0 0.00 0.00 0.34 c.336 8A > T 0.36 0 0 0.00 0.00 0.33 c.361A > T 0.37 0 0 0.00 0.00 0.34 c.380C > T 0.36 0 0 0.00 0.00 0.33 c.383G > A 0.36 0 0 0.00 0.00 0.33 c.455C > A 0.38 0 0 0.00 0.00 0.34 4 c.505C > A 0.50 0 0 0.00 0.00 0.50 c.509G > T 0.50 0 0 0.00 0.00 0.51 c.514T > A 0.50 0 0 0.00 0.00 0.50 c.544A > T 0.50 0 0 0.00 0.00 0.50 c.577A > G 0.51 0 0 0.00 0.00 0.51 c.594T > A 0.49 0 0 0.00 0.00 0.50 c.602G > C 0.50 0 0 0.00 0.00 0.50 5 c.667G > T 0.52 0 0 0.00 0.00 0.41 c.676G > C 0.00 0.49 0 0.00 0.00 0.00 c.697C > G 0.51 0 0 0 0 0.40 c.712A > G 0.51 0 0 0 0 0.41 c.733C > G 0.50 0 0 0 0 0.39 c.744T > C 0.50 0 0 0 0 0.39 c.787A > G 0.57 0 0 0 0 0.47 c.800T > A 0.51 0 0 0 0 0.39 6 c.916A > G 0.51 0 0 0 0 0.50 c.932G > A 0.49 0 0 0 0 0.49 c.939 + 21T > C 0.39 0 0 0 0 0.40 c.939 + 22G > C 0.43 0 0 0 0 0.44 c.939 + 23C > T 0.36 0 0 0 0 0.37 c.939 + 24T > C 0.42 0 0 0 0 0.42 7 c.941T > G 0.54 0 0 0 0 0.55 c.968A > C 0.55 0 0 0 0 0.55 c.974T > G 0.55 0 0 0 0 0.56 c.979G > A 0.54 0 0 0 0 0.55 c.985C > G 0.55 0 0 0 0 0.55 c.986A > G 0.54 0 0 0 0 0.55 c.989C > A 0.55 0 0 0 0 0.56 c.992T > A 0.55 0 0 0 0 0.56 c.1025C > T 0.55 0 0 0 0 0.55 c.1048C > G 0.55 0 0 0 0 0.55 c.1053T > C 0.55 0 0 0 0 0.54 c.1057T > G 0.55 0 0 0 0 0.55 c.1059G > A 0.53 0 0 0 0 0.53 c.1060A > G 0.55 0 0 0 0 0.55 9 c.1061A > C 0.55 0 0 0 0 0.55 c.1154 82_1154 0.52 0 0 0 0 0.51 81delAC c.1154 67T > C 0.52 0 0 0 0 0.51 c.1170C > T 0.53 0 0 0 0 0.53 c.1193T > A 0.50 0 0 0 0 0.50

(145) TABLE-US-00044 TABLE 29 Expected genotypes based on genotypes, reference sequence RHCE (SEQ NO: 26) using the combination of primers of mix B. Mutation in reference Genotypes Exon to coding region DDCCee ddCcEe ddCcee ddccee ddccee Dccee 1 c.148 + 18C > A 0.50 0.00 0.00 0.00 0.00 0.50 2 c.150C > T 1.00 0.50 0.50 0.00 0.00 0.50 c.178C > A 1.00 0.50 0.50 0.00 0.00 0.50 c.201A > G 1.00 0.50 0.50 0.00 0.00 0.50 c.203A > G 1.00 0.50 0.50 0.00 0.00 0.50 c.307C > T 1.00 0.50 0.50 0.00 0.00 0.50 3 c.336 13T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.336 8A > T 0.50 0.00 0.00 0.00 0.00 0.50 c.361A > T 0.50 0.00 0.00 0.00 0.00 0.50 c.380C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.383G > A 0.50 0.00 0.00 0.00 0.00 0.50 c.455C > A 0.50 0.00 0.00 0.00 0.00 0.50 4 c.505C > A 0.50 0.00 0.00 0.00 0.00 0.50 c.509G > T 0.50 0.00 0.00 0.00 0.00 0.50 c.514T > A 0.50 0.00 0.00 0.00 0.00 0.50 c.544A > T 0.50 0.00 0.00 0.00 0.00 0.50 c.577A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.594T > A 0.50 0.00 0.00 0.00 0.00 0.50 c.602G > C 0.50 0.00 0.00 0.00 0.00 0.50 5 c.667G > T 0.50 0.00 0.00 0.00 0.00 0.50 c.676G > C 0.00 0.50 0.00 0.00 0.00 0.00 c.697C > G 0.50 0.00 0.00 0.00 0.00 0.50 c.712A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.733C > G 0.50 0.00 0.00 0.00 0.00 0.50 c.744T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.787A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.800T > A 0.50 0.00 0.00 0.00 0.00 0.50 6 c.916A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.932G > A 0.50 0.00 0.00 0.00 0.00 0.50 c.939 + 21T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.939 + 22G > C 0.50 0.00 0.00 0.00 0.00 0.50 c.939 + 23C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.939 + 24T > C 0.50 0.00 0.00 0.00 0.00 0.50 7 c.941T > G 0.50 0.00 0.00 0.00 0.00 0.50 c.968A > C 0.50 0.00 0.00 0.00 0.00 0.50 c.974T > G 0.50 0.00 0.00 0.00 0.00 0.50 c.979G > A 0.50 0.00 0.00 0.00 0.00 0.50 c.985C > G 0.50 0.00 0.00 0.00 0.00 0.50 c.986A > G 0.50 0.00 0.00 0.00 0.00 0.50 c.989C > A 0.50 0.00 0.00 0.00 0.00 0.50 c.992T > A 0.50 0.00 0.00 0.00 0.00 0.50 c.1025C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.1048C > G 0.50 0.00 0.00 0.00 0.00 0.50 c.1053T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.1057T > G 0.50 0.00 0.00 0.00 0.00 0.50 c.1059G > A 0.50 0.00 0.00 0.00 0.00 0.50 c.1060A > G 0.50 0.00 0.00 0.00 0.00 0.50 9 c.1061A > C 0.50 0.00 0.00 0.00 0.00 0.50 c.1154 82_1154 0.50 0.00 0.00 0.00 0.00 0.50 81delAC c.1154 67T > C 0.50 0.00 0.00 0.00 0.00 0.50 c.1170C > T 0.50 0.00 0.00 0.00 0.00 0.50 c.1193T > A 0.50 0.00 0.00 0.00 0.00 0.50

(146) TABLE-US-00045 TABLE 30 Observed and expected genotypes for intron 2 against reference sequences RHD (SEQ ID NO: 117) and RHCE (SEQ ID NO: 120) Observed Expected Primer mix Genotype RHCEin2 RHDin2 RHCEin2 RHDin2 A ddccee 0.00 1.00 0.00 1.00 DDCCee 0.44 0.56 0.50 0.50 DdCcee 0.29 0.71 0.33 0.67 ddCCee 1.00 0.00 1.00 0.00 DDccEE 0.00 1.00 0.00 1.00 ddccee 0.00 1.00 0.00 1.00 D?ccEe 0.00 1.00 0.00 1.00 B ddccee 0.00 1.00 0.00 1.00 DDCCee 0.29 0.71 0.50 0.50 DdCcee 0.23 0.77 0.33 0.67 ddCCee 1.00 0.00 1.00 0.00 DDccEE 0.00 1.00 0.00 1.00 ddccee 0.00 1.00 0.00 1.00 D?ccEe 0.00 1.00 0.00 1.00

(147) TABLE-US-00046 TABLE 31 Observed and expected genotypes for intron 2 against reference sequences RHD (SEQ ID NO: 117) and RHCE (SEQ ID NO: 120) Observed Expected Primer mix Genotype RHCEin2 RHDin2 RHCEin2 RHDin2 A DDCCee 0.42 0.58 0.5 0.5 ddccee 0.00 1.00 0 1 DdCcee 0.19 0.81 0.33 0.67 ddCcee 0.31 0.69 0.25 0.75 ddCcEe 0.29 0.71 0.25 0.75 ddccee 0.00 1.00 0 1 B DDCCee 0.25 0.75 0.5 0.5 ddccee 0.00 1.00 0 1 DdCcee 0.12 0.88 0.33 0.67 ddCcee 0.31 0.69 0.25 0.75 ddCcEe 0.32 0.68 0.25 0.75 ddccee 0.00 1.00 0 1

EQUIVALENTS

(148) The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.

(149) All references, including patent documents, disclosed herein are incorporated by reference in their entirety for all purposes, particularly for the disclosure referenced herein.