METHOD AND BIOMARKERS FOR IN VITRO DIAGNOSIS OF MENTAL DISORDERS

Abstract

The invention relates to a method for in vitro diagnosis of the presence of a mental disorder in a human individual or the predisposition of the human individual to the mental disorder, wherein the mental disorder is associated with a dysfunctional DISC1 protein pathway or disturbed dopamine homeostasis, the method comprising: a) measuring in a sample of a body tissue or fluid from the individual the expression levels of at least two marker genes, each of which coding for at least one marker protein; b) comparing the measured expression levels to predetermined threshold values representing the expression levels of said marker genes in a healthy population; and c) based on the comparison, determining whether the individual has the mental disorder or a predisposition to the mental disorder, wherein the measured expression levels are indicative to the mental disorder or disposition if the measured expression levels of said marker genes exceed, reach or fall below the predetermined threshold value. For example, the expression level (relative mRNA expression) of each of the marker genes Ifng, Ccl4, Il13ra1, Il12rb2, C3, and Slc27a2 is significantly decreased in a transgenic rat (TG, gray) in relation to non-transgenic littermates (LM, white). That is, the lower expression level of each tested marker gene in the transgenic rat relative to the expression level of the respective marker gene in the non-transgenic control is indicative of dysfunctional DISC1 protein pathway or disturbed dopamine homeostasis.

Claims

1. A method for in vitro diagnosis of a presence of a mental disorder in a human individual or a predisposition of the human individual to the mental disorder, wherein the mental disorder is associated with a dysfunctional DISC1 protein pathway or disturbed dopamine homeostasis, the method comprising: a) measuring in a sample of a body tissue or fluid from the human individual the expression levels of at least two marker genes, each of which coding for at least one marker protein, wherein said marker genes are selected from the group consisting of human NKG7, RGS1, CCL4, IFNG, IL12RB2, IL13RA1, KMO, FPR2, SLC27A2, and C3; b) comparing measured expression levels to predetermined threshold values representing the expression levels of said marker genes in a healthy population; and c) based on the comparison, determining whether the human individual has the mental disorder or a predisposition to the mental disorder, wherein the measured expression levels are indicative to the mental disorder or disposition if the measured expression levels of said marker genes exceed, reach or fall below a predetermined threshold value.

2. The method according to claim 1, wherein a first marker gene is RGS1 and at least one second marker gene is selected from the group consisting of human NKG7, CCL4, IFNG, IL12RB2, IL13RA1, KMO, FPR2, SLC27A2, and C3.

3. The method according to claim 2, wherein the first marker gene is RGS1 and the second marker gene is NKG7 and/or CCL4.

4. The method according to claim 1, wherein at least one additional marker gene is selected from the human equivalents of the genes listed in Table 1.

5. The method according to claim 1, wherein the measured expression levels are indicative to the mental disorder or disposition if each measured expression level is lower than a respective reference expression level and/or reaches or falls below the predetermined threshold value.

6. The method according to claim 1, wherein the expression levels are measured by quantitative reverse transcription Polymerase Chain Reaction or a high-affinity binding assay, and/or wherein the expression levels are measured by microarray analysis.

7. A combination of at least two marker proteins derived from marker genes, or at least two nucleic acid molecules comprising marker genes coding for marker proteins, said marker genes being selected from the group consisting of human NKG7, RGS1, CCL4, IFNG, IL12RB2, IL13RA1, KMO, FPR2, SLC27A2, and C3, for use in in vitro diagnostics.

8. The combination according to claim 7, wherein a first marker gene is RGS1 and at least one second marker gene is selected from the group consisting of human NKG7, CCL4, IFNG, IL12RB2, IL13RA1, KMO, FPR2, SLC27A2, and C3.

9. The combination according IQ claim 7, wherein at least one additional marker gene is selected from the human equivalents of the genes listed in Table 1.

10. The combination according to claim 7 configured for use in an in vitro method of diagnosing presence of a mental disorder in a human individual or a predisposition of the human individual to the mental disorder, wherein the mental disorder is associated with a dysfunctional DISC1 protein pathway or disturbed dopamine homeostasis.

11. A kit for diagnosing presence of a mental disorder in a human individual or a predisposition of the human individual to the mental disorder in vitro, wherein the mental disorder is associated with a dysfunctional DISC1 protein pathway or disturbed dopamine homeostasis, the kit comprising: a) a set of oligonucleotide primers which are suitable to initiate amplification of transcripts of at least two marker genes, each of which coding for at least one marker protein, in a Polymerase Chain Reaction and/or microarray, wherein said marker genes are selected from the group consisting of human NKG7, RGS1, CCL4, IFNG, IL12RB2, IL13RA1, KMO, FPR2, SLC27A2, and C3, and/or at least two first antibodies or molecules, each of which specifically binding to a marker protein in a body tissue or fluid from the individual, wherein the marker proteins are derived from marker genes selected from the group consisting of human NKG7, RGS1, CCL4, IFNG, IL12RB2, IL13RA1, KMO, FPR2, SLC27A2, and C3; b) at least two reporter probes capable of binding to complementary DNA (cDNA) derived from the transcripts, which are suitable to be detected in a quantitative reverse transcription Polymerase Chain Reaction, and/or at least two labelled second antibodies, each of which specifically binding to one of the first antibodies or molecules, which are designed to be detected in a high-affinity binding assay; and optionally, c) at least two reference samples.

12. A method for determining a response to at least one pharmaceutical compound able to correct a dysfunctional DISC1 protein pathway or disturbed dopamine homeostasis, wherein the expression levels of at least two marker genes are determined and compared according to a) and b) of the method according to claim 1, and wherein the measured expression levels indicate that the response to the pharmaceutical compound is positive if each aberrant expression level of said marker genes is normalized or at least improved.

13. A nonhuman transgenic animal useful for providing organs, tissues, or cells, which is able to stably express a modified gene coding for human DISC1 protein, wherein the expression level of the modified gene is higher than that of the respective wild-type gene and thus results in the formation of aggregates of the DISC1 protein within the cells, said animal representing a subset of human subjects having at least one mental disorder, for use in identification and analysis of marker proteins or genes for diagnosing mental disorders in human individuals.

14. A method for determining the therapeutic effect of a potentially curative pharmaceutical compound on a mental disorder, or a predisposition of a human individual to the mental disorder, associated with a dysfunctional DISC1 protein pathway or disturbed dopamine homeostasis, wherein said pharmaceutical compound is administered to a transgenic animal, and wherein it is indicated that a therapeutic effect is positive if aberrant expression levels of at least two marker genes selected from the group consisting of NKG7, RGS1, CCL4, IFNG, IL12RB2, IL13RA1, KMO, FPR2, SLC27A2, and C3 are normalized in said transgenic animal after administration of said pharmaceutical compound.

15. The method according to claim 14, wherein the transgenic animal is a nonhuman transgenic animal useful for providing organs, tissues, or cells, which is able to stably express a modified gene coding for human DISC1 protein, wherein the expression level of the modified gene is higher than that of a respective wild-type gene and thus results in formation of aggregates of the DISC1 protein within the cells, said animal representing a subset of human subjects having at least one mental disorder.

16. A method for measuring expression levels of at least two marker genes, the method comprising: providing a sample of a body tissue or fluid from an individual, measuring in the sample the expression levels of the at least two marker genes encoding the marker proteins according to claim 7 via quantitative reverse transcription Polymerase Chain Reaction (PCR) or a high-affinity binding assay, and/or via microarray analysis, detecting the quantitative reverse transcription PCR products or a binding to the marker proteins in the high-affinity binding assay and/or the microarray.

17. The method of claim 16, wherein the detecting comprises: a) providing a set of oligonucleotide primers which initiate amplification of transcripts of the at least two marker genes in the PCR and/or microarray, and/or at least two first antibodies or molecules, each of which specifically binding to one of the at least two marker proteins in a body tissue or fluid from the individual; b) providing at least two reporter probes that bind to complementary DNA (cDNA) derived from the transcripts, which are suitable to be detected in a quantitative reverse transcription PCR, and/or at least two labelled second antibodies, each of which specifically bind to one of the first antibodies or molecules, which are designed to be detected in a high-affinity binding assay.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0079] FIG. 1 shows two alternative, complementary and selective (incomplete) depictions of the DISC1 pathway, demonstrating that the DISC1 protein interacts with many proteins and signaling pathways that have independently been described for mental illness or other chronic brain disease conditions.

[0080] FIG. 2 shows bar diagrams representing an independent validation of a selection of markers from Table 1 in the tgDISC1 rat (TG, gray) vs. non-transgenic littermates (LM, white) using quantitative polymerase chain reaction (qPCR). Marker names abbreviated, for full name, see Table 1.

[0081] FIG. 3 shows bar diagrams representing a screening of a selection of markers from Table 1 in a population of schizophrenia patients vs. controls (n=20 for each group); cohort of patients with schizophrenia (SCZ, gray) vs. healthy controls (CTRL, white). Marker names abbreviated, for full name, see Table 1.

[0082] FIG. 4 shows graphical representations demonstrating the correlation of different markers in the tgDISC1 rat and schizophrenia patients. A. Correlation matrix of markers in the rat (left) and human (right). B. Selective depiction of single correlations appearing similar in the transgenic tgDISC1 rat (TG) vs. non-transgenic littermates (LM), and schizophrenia patients (SCZ) vs. healthy controls (CTRL).

[0083] FIGS. 5a and 5b show tables of a Spearman correlation (non-parametric) of human markers (see Table 1) demonstrating that single correlations either exist between patients and controls, or only for patients or controls demonstrating the disruption or pathological creation and stabilization of regulated networks of markers (all data analyzed without outliers).

[0084] FIG. 6 shows a bar diagram demonstrating detection specificity and sensitivity related to the clinical diagnosis of schizophrenia (SCZ, dark grey; healthy controls (HC), light grey) when a selection of single markers from Table 1 is investigated. The threshold was defined at being below 50% of the average of the healthy control group.

[0085] FIG. 7 shows a bar diagram demonstrating detection specificity and sensitivity related to the clinical diagnosis of schizophrenia (SCZ, dark grey; healthy controls (HC), light grey) when a selection of a combination of two or three markers from Table 1 is investigated. The threshold was defined at being below 50% of the average of the healthy control group.

[0086] FIG. 8 shows a graph representing normalized expression levels (brain) of RGS1 transcripts in controls (CTRL), schizophrenia (SCZ) and Bipolar Disorder (BP) samples.

DESCRIPTION OF EXEMPLARY AND PREFERRED EMBODIMENTS OF THE INVENTION

Subjects and Classifications

[0087] Control subjects and patients diagnosed with schizophrenia were part of a clinical study as described by Warbrick et al. (2011) and Trossbach et al. (2014).

Animals

[0088] Animal experiments were executed in conformity with the German Animal Protection Law and were authorized by local authorities (LANUV NRW, Recklinghausen, Germany). Experiments were performed with transgenic Sprague Dawley rats overexpressing full-length, non-mutant DISC1 carrying the polymorphisms L607F (rs6675281) and S704C (rs821616) (tgDISC1 rat; Trossbach et al., 2016) and non-transgenic littermates. Male tgDISC1 and control rats were bred at the Heinrich Heine University D0sseldorf, Animal Facility, Germany. Animals were housed three animals per cage under standard laboratory conditions with lights on from 0700 hours to 1900 hours and with water and food provided ad libitum. Blood extraction and preparation of lymphocytes was performed with adult tgDISC1 rats and littermate controls at the age of 8-9 months.

Preparation of Lymphocytes from Blood

[0089] Anaesthetized rats underwent a heart puncture to harvest a minimum of 8 mL of blood. Rat lymphocytes were prepared with the Ficoll-Paque Premium 1.084 solution (GE Healthcare, Little Chalfont, United Kingdom) according to manufacturer's instructions. Preparation of human lymphocytes was performed with Ficoll-Paque Plus (GE Healthcare, Little Chalfont, UK) as described by Trossbach et al. (2014). Lymphocyte samples were snap-frozen in liquid nitrogen and stored at 80 C. until further processing.

Preparation of RNA and cDNA

[0090] RNA of rat and human lymphocytes was prepared utilizing the RNeasy Mini Kit according to manufacturer's guidelines. Residual genomic DNA was digested on column by the RNase-free DNasel Set (both Qiagen, Hilden, Germany). RNA was diluted to a concentration of 100 ng/L and 1 g was used as input for the production of cDNA with the RevertAid First Strand Synthesis Kit in a total of 20 L utilizing the random hexamer primers provided by the kit (Thermo Fisher Scientific, Waltham, Mass., USA). The resulting cDNA was diluted 1:50, 1:25 or 1:50 dependent on PCR results as indicated in Table 1 and 5 L were used as template input.

Gene Expression Profiling

[0091] Total RNA preparations were checked for RNA integrity by Agilent 2100 Bioanalyzer quality control. All samples in this study showed high quality RNA Integrity Numbers (RIN>9). RNA was further analysed by photometric Nanodrop measurement and quantified by fluorometric Qubit RNA assays (Life Technologies). Synthesis of biotin labeled cDNA was performed on ten replicates of each experimental group (DISC1 transgenic (TG) rats and littermate (LM) controls, respectively) according to the manufacturers' protocol (WT Plus Reagent Kit; Affymetrix, Inc). Briefly, 100 ng of total RNA were converted to cDNA. After amplification by in vitro transcription and 2nd cycle synthesis, cDNA was fragmented and biotin labeled by terminal transferase. Finally, end labeled cDNA was hybridized to Affymetrix Rat Gene 2.0 ST Gene Expression Microarrays for 16h at 45 C., stained by strepatavidin/phycoerythrin conjugate and scanned as described in the manufacturers' protocol. Three samples (2TG, 1LM) did not pass hybridization quality control, two additional samples (3TG, 2LM) had to be excluded from further analyses because of abnormal ventricle volume.

[0092] Data analyses on 12 Affymetrix CEL files were conducted with GeneSpring GX software (Vers. 12.5; Agilent Technologies). Probes within each probeset were summarized by GeneSprings' ExonRMA16 algorithm after quantile normalization of probe level signal intensities across all samples to reduce inter-array variability (Bolstad et al., 2003). Input data pre-processing was concluded by baseline transformation to the median of all samples. To further improve signal-to-noise ratio, a given probeset had to be expressed above background (i.e. fluorescence signal of a probeset was detected within the 20th and 100th percentiles of the raw signal distribution of a given array) in all replicates in at least one of two, or both conditions to be subsequently analysed in pairwise comparison. Differential gene expression was statistically determined by moderated T-test. The significance threshold was set to p=0.01.

Quantitative Expression Analysis

[0093] For the verification of differential expression target primers were tested by PCR using the HotStarTaq (Qiagen, Hilden, Germany). Primer sequences, dilutions and PCR supplements are depicted in Table 2. Effective primers were used for quantitative Real Time PCR (qPCR) with the StepOnePlus Real-Time PCR System (Applied Biosystems, Carlsbad, Calif., USA) and the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, Carlsbad, Calif., USA) in MicroAMP Fast Optical 96-Well Reaction Plates (Applied Biosystems, Carlsbad, Calif., USA). Depending on the target, 5% Factor Q solution (Qiagen, Hilden, Germany) was added to the mix. QPCR conditions: 10 min at 95 C., 40 cycles of 15 s at 95 C. and 60 C. for 1 min. The resulting data were processed with the corresponding StepOne Software v2.3 (Thermo Fisher Scientific, Waltham, Mass., USA). The expression of the respective target was normalized to the expression level of the housekeeping gene Actin (rat) or ARF1 (human), as well as against a rat or human control cDNA per plate to minimize variances between runs.

[0094] As shown in FIG. 2, the expression level (relative mRNA expression) of each of the marker genes Ifng, Ccl4, Il13ra1, Il12rb2, C3, and Slc27a2 from Table 1 is significantly decreased in the tgDISC1 rat (TG, gray) in relation to non-transgenic littermates (LM, white). This result indicates that the decreased expression level of these marker genes observed in the microarray analysis (Table 1) can be repeated by an independent detection method (quantitative polymerase chain reaction; qPCR). Marker genes Ifng, Ccl4, Il13ra1, Il12rb2, C3, and Slc27a2 are all downregulated, i.e. the transcript level is decreased relative to the reference (standard) level of the healthy littermates. That is, the lower expression level of each tested marker gene in the transgenic rat relative to the expression level of the respective marker gene in the non-transgenic control is indicative of dysfunctional DISC1 protein pathway or disturbed dopamine homeostasis. The altered expression level can thus be deemed to be indicative to neuropathological and biochemical features very similar to human patients with schizophrenia.

[0095] FIG. 3 shows a screening of marker genes IFNG, CCL4, IL13RA1, IL12RB2, RGS1, C3, and SLC27A2 from Table 1 in a population of schizophrenia patients (SCZ, gray) vs. healthy controls (CTRL, white), demonstrating that the decreased expression levels (relative mRNA expression) of the same markers in the tgDISC1 model are also observed in a cohort of patients with schizophrenia. Marker genes IFNG, CCL4, IL13RA1, IL12RB2, RGS1, C3, and SLC27A2 are all downregulated, i.e. the transcript level is decreased relative to the reference (standard) level of the healthy controls. Accordingly, the altered expression level can be deemed to be indicative to schizophrenia in human individuals.

[0096] FIG. 4 shows correlations of different markers in tgDISC1 rats and human individuals, demonstrating similarity between the rat system and the human system. The alterations of the expression levels of the tested markers relative to the respective reference expression levels are similar in the tgDISC1 rat and schizophrenia patients. Thus, transfer of the principles and mechanisms observed in the rat system to the human system is reasonable.

[0097] FIGS. 5a and 5b show correlation tables of human markers demonstrating that single correlations either exist between patients and controls, or only for patients or controls. The cross-correlations between single markers show that disease can either disrupt existing correlating networks or stabilize new (pathological) ones and demonstrates that the identified markers according to Table 1 are functionally interconnected.

[0098] FIGS. 6 and 7 demonstrate the detection specificity and sensitivity related to the clinical diagnosis of schizophrenia when a selection of single markers from Table 1 (RGS1, CCL4, and NKG7; FIG. 6) or a selection of a combination of two or three markers from Table 1 (RGS1+CCL4 and/or NKG7, and CCL4+NKG7; FIG. 7) is investigated. Basically it is demonstrated that specificity of the method according to the invention is very high while sensitivity is rather low. However, in the method according to the invention specificity is more important than sensitivity since the method is provided for a sub-group of patients only and thus low sensitivity relating to the all-comprising clinical diagnosis is expected and can therefore be neglected. FIG. 7 shows that the combination of two or more markers can significantly increase specificity of the method according to the invention, cf. marker gene RGS1 (alone: 88%=>+CCL4 and/or NKG7: 94%/97%).

[0099] FIG. 8 shows that, surprisingly, RGS1 expression in brain is clearly decreased in patients (Schizophrenia and Bipolar Disorder) compared to healthy controls. RGS1 is correlated to cognitive endophenotypes of patients and seems to be the best marker for diagnosing related diseases. RGS1 is significantly correlated to attention and memory in the Digital Symbol Test (DSST) indicating high clinical relevance of this marker to measurable cognitive deficiencies (data not shown). The decrease in RGS1 expression is not due to a decreased number of macrophages where it is expressed and which would correspond to the cell lineage where microglia is also derived from, the only cell type of the brain expressing RGS1 (data not shown). RGS1, preferably in conjunction with an NK cell marker, therefore seems to be advantageous to diagnose the patient subsets with credibility, plausibility and specificity.

[0100] Accordingly, RGS1 seems to crystallize as the most important marker compared to the other markers listed in Table 1. However, RGS1 expression levels seem also changed in diseases like melanoma, multiple sclerosis or others, so that at least a second marker can be beneficial. For example, the NK cell markers NKG7 or CCL4 may be of particular importance (but interchangeable). In the rat NKG7 and CCL4 indicate a decrease in expression levels, in humans it is not clear whether they are decreased due to a decrease in NK cell number, a decrease in expression per NK cell, or both. In summary, diagnostics could be prioritized to RGS1 and one or two NK cell markers such as NKG7 and CCL4, cf. FIG. 7. In patients, NK cell markers seem decreased due to a decrease in NK cell numbers, but a simultaneous decrease in expression levels cannot be excluded (data not shown).

Non-Patent Literature

[0101] 1. Bolstad et al. (2003): A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics, 19, 2, 185-193, 2003. [0102] 2. Chan et al. (2015): Development of a blood-based molecular biomarker test for identification of schizophrenia before disease onset. Translational Psychiatry (2015) 5, e601; doi:10.1038/tp.2015.91; published online 14 Jul. 2015. [0103] 3. Dean (2011): Dissecting the Syndrome of Schizophrenia: Progress toward Clinically Useful Biomarkers. Schizophrenia Research and Treatment Volume 2011, Article ID 614730, 10 pages, doi:10.1155/2011/614730. [0104] 4. Hamburg et al. (2016): Simultaneous effects on parvalbumin-interneuron and dopaminergic system development in a transgenic rat model for sporadic schizophrenia. Scientific Reports 6:34946 DOI: 10.1038/srep34946. [0105] 5. Hennah & Porteous (2009): The DISC1 pathway modulates expression of neurodevelopmental, synaptogenic and sensory perception genes. PLoS ONE 2009; 4(3):e4906 [0106] 6. Howes & Kapur (2009): The dopamine hypothesis of schizophrenia: version IIIthe final common pathway. Schizophr Bull. 2009 May; 35(3):549-62. doi: 10.1093/schbul/sbp006. Epub 2009 Mar. 26. [0107] 7. Korth (2009): DISCopathies: brain disorders related to DISC1 dysfunction. Rev Neurosci 2009; 20(5-6):321-30 [0108] 8. Korth (2012): Aggregated proteins in schizophrenia and other chronic mental diseases: DISC1opathies. Prion 6(2):134-41. [0109] 9. Korth (2012): Aggregated proteins in schizophrenia and other chronic mental diseases. Prion 6:2, 1-8. April/May/June 2012. [0110] 10. Soares et al. (2011): DISC1: Structure, Function, and Therapeutic Potential for Major Mental Illness. ACS Chem Neurosci. 2011 Nov. 16; 2(11):609-632. Epub 2011 Aug. 5. [0111] 11. Trossbach et al. (2014): Peripheral DISC1 protein levels as a trait marker for schizophrenia and modulating effects of nicotine. Behav Brain Res 275C: 176-182. [0112] 12. Trossbach et al. (2016): Misassembly of full-length Disrupted-in-Schizophrenia 1 protein is linked to altered dopamine homeostasis and behavioral deficits. Molecular Psychiatry (2016), 1-12. [0113] 13. Warbrick et al. (2011): Direction and magnitude of nicotine effects on the fMRI BOLD response are related to nicotine effects on behavioral performance. Psychopharmacology (Berl) 215(2): 333-344.

TABLE-US-00001 TABLE 1 TG versus LM P- Gene symbol [rat] Gene description Genbank Refseq Change FC value 1 Rgs1 regulatorofG-proteinsignaling1 BC098681 NM_019336 2.03 0.006 2 Ccl4 chemokine(C-Cmotif)ligand4 U06434 NM_053858 1.67 0.000 3 Fpr2|Fpr2| formylpeptidereceptor2|formylpeptide- XM_001073508/ 1.65 0.005 receptor2-like 4 C3 complementcomponent3 NM_016994 1.63 0.004 5 Nkg7 naturalkillercellgroup7sequence AF082535 NM_133540 1.60 0.000 6 Il12rb2 interleukin12receptor, beta2 NM_001191750 1.59 0.009 7 Serpinb1a serine(orcysteine)proteinaseinhibitor, BC098686 NM_001031642 1.52 0.007 cladeB, member1a 8 Ly49si3 AY653730 NM_001009919 1.51 0.006 9 Pla2g7 phospholipaseA2, groupVII(platelet- BC088457 NM_001009353 1.48 0.006 activatingfactoracetylhydrolase, plasma 10 Hist2h2aa3 similartoH2Ahistonefamily, memberO| XM_002726027 1.47 0.000 histonecluster2, H2aa3 11 Slc27a2 solutecarrierfamily27(fattyacid- D85100 NM_031736 1.46 0.009 transporter), member2 12 RGD1559149 simto60SribosomalproteinL7a 1.46 0.003 13 Il13ra1 interleukin13receptor, alpha1 BC093615 NM_145789 1.45 0.007 14 Cyp4f18 cytochromeP450, family4, subfamilyf, BC101918 NM_001033686 1.44 0.004 polypeptide18 15 Rpl10 ribosomalproteinL10 BC058467 1.41 0.006 16 Olr428 olfactoryreceptor428 NM_001000394 1.41 0.009 17 Tmem62 Rattus norvegicus TL0ABA35YN06 1.39 0.002 mRNA sequence. 18 Acer3 PREDICTED: Rattus norvegicus alkaline 1.38 0.003 ceramidase 3 (Acer3), mRNA 19 Ifng interferongamma AF010466 NM_138880 1.38 0.001 20 RGD1561778 similartodendriticcell-derived- NM_001168284 1.38 0.006 immunoglobulin(Ig)-like- receptor1, DlgR1-mouse 21 Scimp SLPadaptorandCSKinteracting XM_003752341 1.37 0.002 membraneprotein 22 Tspan31 tetraspanin31 BC086452 NM_001008378 1.36 0.004 23 Tmem223 transmembraneprotein223 NM_001191104 1.35 0.005 24 Klrb1b|Klrb1a killercelllectin-like- U56936|DQ157010 NM_173292///N 1.35 0.007 receptorsubfamilyBmember1B|1A 25 Cst7 cystatinF(leukocystatin) NM_001106523 1.35 0.002 26 Krtap3-3|Krtap3-3|1 keratinassociatedprotein3- XM_002724543 1.35 0.002 3|keratinassociatedprotein3-3-like1 27 Retnlg resistin-likegamma NM_181625 1.35 0.002 28 Cd24 CD24molecule BC064439 NM_012752 1.34 0.008 29 Prdm1 PRdomaincontaining1, withZNFdomain NM_001107639 1.34 0.001 30 Pak1 p21protein(Cdc42/Rac)- U49953 NM_017198 1.34 0.007 activatedkinase1 31 Ptms parathymosin BC167753 NM_031975 1.34 0.007 32 RGD1563145 similarto60SribosomalproteinL13 XM_001068099 1.34 0.002 33 Kmo kynurenine3- AF056031 NM_021593 1.34 0.004 monooxygenase(kynurenine3- hydroxylase) 34 Tob1 transducerofErbB-2.1 AF349723 NM_133317 1.33 0.002 35 Il36b interleukin36, beta NM_001108570 1.33 0.007 36 Clic5 chlorideintracellularchannel5 AF323174 NM_053603 1.33 0.008 37 Chi3l1 chitinase3-like1(cartilageglycoprotein- BC091365 NM_053560 1.32 0.006 39) 38 Ptp4a1 proteintyrosinephosphatasetypeIVA, BC097307 NM_031579 1.32 0.000 member1 39 Elovl1 ELOVLfattyacidelongase1 1.31 0.008 40 Tyrobp Tyroproteintyrosinekinasebinding- AY247021 NM_212525 1.31 0.001 protein 41 Itm2a integralmembraneprotein2A BC099174 NM_001025712 1.30 0.002 42 Klrg1 killercelllectin- X79812 NM_031649 1.30 0.005 likereceptorsubfamilyG, member1 43 Srgap3 SLIT- NM_001191975 1.30 0.004 ROBORhoGTPaseactivatingprotein3 44 Tlr5 toll-likereceptor5 FJ750588 NM_001145828 1.30 0.007 45 Slamf8 SLAMfamilymember8 NM_001105973 1.30 0.002 46 Olr1531 olfactoryreceptor1531 NM_001001102 1.30 0.004 47 Clec4a2 C-typelectindomainfamily4, memberA2 AY494061 NM_001005880 1.30 0.009 48 Stard3 StAR-relatedlipidtransfer 1.30 0.000 (START)domaincontaining3 49 Hist1h2ac histonecluster1, H2ac|H2ae- XM_003751712 1.29 0.001 like|H2ai|H2an|H4m 50 Eno3 enolase3, beta, muscle BC083566 NM_012949 1.29 0.004 51 Kif15 kinesinfamilymember15 AY291581 NM_181635 1.29 0.007 52 Pmaip1 phorbol-12-myristate-13-acetate- AY788892 NM_001008385 1.29 0.002 inducedprotein1 53 Ptp4a1 proteintyrosinephosphatasetypeIVA, NM_031579 1.29 0.001 member1 54 Sod1 superoxidedismutase1, soluble FQ220715 NM_017050 1.29 0.004 55 Cd55 BC061869 NM_022269 1.29 0.002 56 Ly6c Ly6-Cantigen NM_020103 1.29 0.009 57 Tuba3a|Tuba3b tubulin, alpha3A|tubulin, alpha3B BC079395 NM_001040008 1.28 0.001 58 LOC252890 Z39smallnucleolarRNA NR_002705 1.28 0.004 59 Sytl3 synaptotagmin-like3 BC166706 NM_001127560 1.28 0.007 60 Ltbr lymphotoxinbetareceptor BC085880 NM_001008315 1.28 0.003 (TNFRsuperfamily, member3) 61 Zfp580 zincfingerprotein580 XM_218196///X 1.28 0.000 62 Try10|Prss2 trypsin10|similartoAnionictrypsinII NM_001004097 1.28 0.007 precursor(PretrypsinogenII)|protease, serine, 2 63 Osgin2 oxidativestressinducedgrowthinhibitor XM_232798 1.28 0.003 familymember2 64 H2afx H2Ahistonefamily, memberX NM_001109291 1.28 0.007 65 Cwc15 CWC15spliceosome-associatedprotein BC091396 NM_001024987 1.28 0.003 homolog(S. cerevisiae) 66 LOC690097|RGD156130 similartoimmunoreceptorLy49si3 1.27 0.002 67 Kdelr1 KDEL(Lys-Asp-Glu- BC092600 NM_001017385 1.27 0.008 Leu)endoplasmicreticulum proteinretentionreceptor1 68 Ifngr1 interferongammareceptor1 AF201901 NM_053783 1.27 0.003 69 Abcg3l1 ATP-bindingcassette, BC098896 NM_001004076 1.27 0.005 subfamilyG(WHITE), member3-like1 70 Cyba cytochromeb-245, alphapolypeptide 1.27 0.005 71 Nampt nicotinamidephosphoribosyltransferase BC085681 NM_177928 1.27 0.003 72 Nqo1 NAD(P)Hdehydrogenase, quinone1 BC083542 NM_017000 1.27 0.008 73 Tmem50b transmembraneprotein50B BC091349 NM_001025014 1.27 0.006 74 Cblb Cas-Br-M(murine)ecotropicretroviral AB071283 NM_133601 1.27 0.007 transformingsequenceb 75 Hopx HOPhomeobox AF492685 NM_133621 1.26 0.006 76 Sh2d2a SH2domaincontaining2A BC088087 NM_207605 1.26 0.005 77 RGD1566373 similartolargesubunitribosomal XM_001080446 1.26 0.003 proteinL36a 78 Pdha1 pyruvatedehydrogenase(lipoamide) BC098897 NM_001004072 1.26 0.007 alpha1 79 Napsa napsinAasparticpeptidase BC078790 NM_031670 1.26 0.006 80 Lcmt2 leucinecarboxylmethyltransferase2 BC083783 NM_001011956 1.26 0.000 81 Phgdh phosphoglyceratedehydrogenase BC086327 NM_031620 1.26 0.009 82 Lamtor2 lateendosomal/lysosomaladaptor, MAP NM_001106441 1.25 0.004 KandMTORactivator2 83 LOC681290 T-cellreceptorgammachainCregion5/10- S75437 1.25 0.005 13-like 84 Pppde2 PPPDEpeptidasedomaincontaining2 BC098857 NM_001025703 1.25 0.009 85 Pik3r5 phosphoinositide-3-kinase, NM_001191923 1.24 0.004 regulatorysubunit5 86 Dse dermatansulfateepimerase BC168891 NM_001108933 1.24 0.009 87 Csf1 colonystimulatingfactor1(macrophage) BC074007 NM_023981 1.24 0.009 88 St3gal4 ST3beta-galactosidealpha-2,3- BC089057 NM_203337 1.24 0.007 sialyltransferase4 89 Gyg1 glycogenin1 BC070944 NM_031043 1.24 0.010 90 Ager advancedglycosylationendproduct- L33413 NM_053336 1.24 0.001 specificreceptor 91 Cadm3 celladhesionmolecule3 BC161811 NM_001047103 1.24 0.007 92 Tect2|Atp6v0a2 tectonic2|ATPase, H+transporting, 1.24 0.001 lysosomalV0subunitA2 93 Syt15 synaptotagminXV BC084685 NM_181632 1.23 0.004 94 Bcat1 branchedchainaminoacid BC087710 NM_017253 1.23 0.008 transaminase1, cytosolic 95 Hcst hematopoieticcellsignaltransducer AY247020 NM_001005900 1.23 0.003 96 Slc35f5 solutecarrierfamily35, memberF5 NM_001105950 1.22 0.006 97 Olr1071|Olr1070 olfactoryreceptor1071|olfactory NM_001000063 1.22 0.005 receptor1070 98 Tm7sf4 transmembrane7superfamilymember4 1.22 0.006 99 Lst1 leukocytespecifictranscript1 AF208230 NM_022634 1.22 0.004 100 Ankrd57 ankyrinrepeatdomain57 NM_001109364 1.21 0.002 101 Rora RAR-relatedorphanreceptorA NM_001106834 1.21 0.008 102 Pnpla2 patatin-likephospholipasedomain NM_001108509 1.21 0.001 containing2 103 Tmem14c transmembraneprotein14C NM_001135169 1.21 0.007 104 Pspn persephin AF040961 NM_013014 1.21 0.005 105 Tlr2 toll-likereceptor2 AY151255 NM_198769 1.20 0.006 106 Zfp418 zincfingerprotein418|similarto FQ212491 NM_001191620 1.20 0.008 zincfingerprotein418 107 Atp6v1g3 ATPase, H+transporting, lysosomalV1 NM_001105991 1.20 0.003 subunitG3 108 LOC680549 similartoPbx/knotted1homeobox2 FQ221048 1.20 0.010 109 LOC100363043 chromosome14openreadingframe119- XM_002725161 1.20 0.006 like 110 LOC100364650 rCG38872-like 1.20 0.009 111 Pgm2 phosphoglucomutase2 BC160893 NM_001106007 1.19 0.005 112 Mospd3 motilespermdomaincontaining3 BC099230 NM_001025629 1.19 0.004 113 Tmcc1 transmembraneandcoiled- 1.19 0.008 coildomainfamily1 114 Manf mesencephalicastrocyte-derived BC166980 NM_001108183 1.19 0.000 neurotrophicfactor 115 Tubgcp6 tubulin, gammacomplexassociated NM_001108748 1.19 0.001 protein6 116 Cldn24 claudin24 NM_001110144 1.19 0.007 117 Ccdc90b coiled-coildomaincontaining90B BC097480 NM_001024885 1.19 0.001 118 Chic2 cysteine-richhydrophobicdomain2 NM_001105736 1.19 0.010 119 Ndufs5 NADHdehydrogenase(ubiquinone) BC168721 NM_001030052 1.18 0.002 Fe-Sprotein5 120 Etv6 etsvariant6 BC105773 NM_001037353 1.18 0.004 121 Banp Btg3associatednuclearprotein BC160844 NM_001106191 1.18 0.007 122 RGD1560608 similarnovelprotein NM_001109280 1.18 0.008 123 Npm3 nucleophosmin/nucleoplasmin, 3 XM_577868 1.18 0.005 124 Olr240 olfactoryreceptor240 XM_001076482 1.18 0.000 125 Ptgdr2 prostaglandinD2receptor2 AY228550 NM_001012070 1.18 0.003 126 Nkd2 nakedcuticlehomolog2(Drosophila) NM_001107454 1.18 0.008 127 LOC500959 triosephosphateisomerase AY461585 NM_001033072 1.18 0.001 128 Edem2 ERdegradationenhancer, mannosidase BC079029 NM_001004230 1.18 0.005 alpha-like2 129 Fgf4 fibroblastgrowthfactor4 AB079673|AF260830 NM_053809 1.18 0.003 130 Polk polymerase(DNAdirected)kappa BC166778 NM_138516 1.18 0.001 131 Hus1b HUS1checkpointhomologb(S. pombe) NM_001134846 1.18 0.005 132 Ndufb4 NADHdehydrogenase(ubiquinone)1beta FQ217067 NM_001037338 1.18 0.006 subcomplex4 133 Arhgap9 RhoGTPaseactivatingprotein9 BC107938 NM_001080789/ 1.17 0.002 134 Crhr1 corticotropinreleasinghormone L25438|EU012438|E NM_030999 1.17 0.001 receptor1 135 LOC100366245 rCG30616-like 1.17 0.004 136 RGD1565819|Zfp831 similartoC20orf174|zincfingerprotein831 NM_001171096 1.17 0.004 137 Defa10 defensinalpha10 AY623754 NM_001033074 1.17 0.003 138 RGD1565819|Zfp831 similartoC20orf174|zincfingerprotein831 NM_001171096 1.17 0.005 139 Pvrl4 poliovirusreceptor-related4 FQ228642 NM_001109076 1.17 0.007 140 Rapsn receptor- NM_001108584 1.17 0.001 associatedproteinofthesynapse 141 Opa3 opticatrophy3(human) BC168945 1.17 0.007 142 Pnma1 paraneoplasticantigenMA1 AF335505 NM_130820 1.17 0.008 143 Olr1471|LOC100360028 olfactoryreceptor1471|olfactory NM_001000722 1.17 0.009 receptorOlr1471-like 144 Arrdc1 arrestindomaincontaining1 BC158871 NM_001100770 1.17 0.002 145 Erp29 endoplasmicreticulumprotein29 BC091129 NM_053961 1.16 0.006 146 Zcrb1 zincfingerCCHC- BC099747 NM_001034940 1.16 0.009 typeandRNAbindingmotif1 147 LOC100364342|Chchd4 coiled-coil-helix-coiled-coil- 1.16 0.002 helixdomain containing4-like 148 RGD1559979 similartoAPH1Bhomolog(C. elegans) XM_003754686/ 1.16 0.004 149 Mir3558 microRNAmir-3558 NR_037340 1.16 0.003 150 Tulp1 tubbylikeprotein1 NM_001107642 1.16 0.005 151 LOC100360334 forminhomology2domaincontaining3- BC090338 1.16 0.003 like 152 Fam158a familywithsequencesimiarity158, BC086432 1.16 0.004 memberA 153 Arl6ip6 ADP-ribosylation-likefactor6interacting BC079329 NM_001024310 1.16 0.008 protein6 154 Sdhb succinatedehydrogenasecomplex, BC158620 NM_001100539 1.16 0.008 subunitB, ironsulfur(Ip) 155 Srms src-relatedkinaselackingC-terminal BC090006 NM_001011961 1.16 0.009 regulatorytyrosineandN-terminal myristylationsites 156 Aldh16a1 aldehydedehydrogenase16family, BC101860 NM_001033706 1.16 0.007 memberA1 157 Id2 inhibitorofDNAbinding2 BC086391 NM_013060 1.16 0.001 158 LOC688495 NM_001135252 1.15 0.006 159 Prrx2 pairedrelatedhomeobox2 NM_001105739 1.15 0.007 160 Tomm20| translocaseofoutermitochondrial XM_001072851 1.15 0.002 membrane20 homolog(yeast)-like 161 Vtn vitronectin BC105821 NM_019156 1.15 0.006 162 Lipg lipase, endothelial AY916123 NM_001012741 1.15 0.009 163 Dpf2 D4, zincanddoublePHDfingersfamily2 NM_001108516 1.14 0.000 164 Adcy2 adenylatecyclase2(brain) M80550 NM_031007 1.14 0.007 165 Dclre1a DNAcross-linkrepair1A NM_001106201 1.14 0.005 166 Amigo3 adhesionmoleculewithIglikedomain3 AY237731 NM_178144 1.14 0.001 167 Hsd17b11 hydroxysteroid(17- BC078929 NM_001004209 1.14 0.006 beta)dehydrogenase11 168 Agfg2 ArfGAPwithFGrepeats2 NM_001107131 1.14 0.009 169 Lcor liganddependentnuclearreceptor- 1.14 0.002 corepressor 170 Pak6 p21protein(Cdc42/Rac)- NM_001106498 1.14 0.010 activatedkinase6 171 Ywhab tyrosine3- BC076502 NM_019377 1.14 0.009 monooxygenase/tryptophan5- monooxygenaseactivationprotein, betapolypeptide 172 Gabrd gamma-aminobutyricacid(GABA)A M35162 NM_017289 1.14 0.009 receptor, delta 173 Polg polymerase(DNAdirected), gamma NM_053528 1.13 0.003 174 Card10 caspaserecruitmentdomainfamily, NM_001130554 1.13 0.006 member10 175 Zic5 Zicfamilymember5 NM_001108391 1.13 0.007 176 Prelp proline/arginine-richendleucine- AF163569 NM_053385 1.13 0.003 richrepeatprotein 177 Cldn18 claudin18 1.13 0.001 178 Ppp1r36 proteinphosphatase1, BC079166 NM_001013944 1.13 0.005 regulatorysubunit36 179 MGC125002 similartoRIKENcDNA5830433M19 BC105829 1.13 0.001 180 Limch1 LIMandcalponinhomologydomains1 FQ226534 NM_001191678 1.13 0.009 181 Prr19 prolinerich19 BC168703 NM_001173428 1.13 0.004 182 Mir615 microRNAmir-615 NR_032748 1.13 0.002 183 Chmp1b chargedmultivesicularbodyprotein1B BC168175 NM_001109533 1.13 0.008 184 Odf4 outerdensefiberofspermtails4 BC079319 NM_001007670 1.13 0.009 185 Ldoc1| leucinezipper, down-regulatedin XM_001078075 1.12 0.005 cancer1-like 186 Olr6 olfactoryreceptor6 NM_001000539 1.12 0.008 187 Gpr68 Gprotein-coupledreceptor68 NM_001108049 1.12 0.004 188 Opa3 opticatrophy3(human) BC168945 NM_001107486 1.12 0.005 189 Tmprss2 transmembraneprotease, serine2 BC061712 NM_130424 1.12 0.003 190 Wfdc3 WAPfour-disuifidecoredomain3 NM_001106541 1.12 0.010 191 Adam1a adisintegrinandmetallopeptidase BC081807 NM_020078 1.12 0.005 domain1a 192 Fat3 FATtumorsuppressorhomolog3 AB076401 NM_138544 1.12 0.010 (Drosophila) 193 Mmp11 matrixmetallopeptidase11 BC099781 NM_012980 1.12 0.005 194 Lcat lecithincholesterolacyltransferase BC091155 NM_017024 1.12 0.007 195 Akap5 Akinase(PRKA)anchorprotein5 U67136 NM_133515 1.12 0.002 196 Fkbp4 FK506bindingprotein4 NM_001191863 1.11 0.006 197 Jrk jerkyhomolog(mouse) BC152551 NM_001104612 1.11 0.008 198 RGD1311517 similartoRIKENcDNA9430015G10 BC083613 1.11 0.006 199 Vps28 vacuolarproteinsorting28homolog BC168742 NM_001130492 1.11 0.009 (S. cerevisiae) 200 Trmu tRNA5-methylaminomethyl-2- BC161991 NM_001135876 1.11 0.004 thiouridylatemethyltransferase 201 Dtx3 deltexhomolog3(Drosophila) NM_001191989 1.11 0.004 202 Mir3588 microRNAmir-3588 NR_037386 1.10 0.004 203 Calhm1 calciumhomeostasismodulator1 NM_001109168 1.10 0.006 204 Fscn2 fascinhomolog2, actin- NM_001107072 1.10 0.006 bundlingprotein, retinal (Strongylocentrotuspurpuratus) 205 Robo1 roundabouthomolog1(Drosophila) AF041082 NM_022188 1.10 0.004 206 RGD1310212 similartoKIAA1111-likeprotein NM_001106765 1.10 0.002 207 Homer3 homerhomolog3(Drosophila) AB020879 NM_053310 1.10 0.004 208 Neu2 sialidase2(cytosolicsialidase) D16300 NM_017130 1.10 0.007 209 Wisp1 WNT1induciblesignalingpathwayprotein1 AF228049 NM_031716 1.10 0.010 210 Tdrd5 tudordomaincontaining5 BC168218 NM_001134739/ 1.10 0.009 211 Asgr2 asialoglycoproteinreceptor2 AF230645 NM_017189 1.10 0.007 212 Speg SPEGcomplexlocus U57097 NM_001108802/ 1.10 0.009 213 RGD1306782 similartoRIKENcDNA1700029P11 XM_001077385 1.10 0.009 214 Mecom MDS1andEVI1complexlocus 1.10 0.002 215 Col20a1 collagen, typeXX, alpha1 XM_001058131 1.10 0.006 216 Ywhae tyrosine3- M84416 NM_031603 1.09 0.003 monooxygenase/tryptophan5- monooxygenaseactivationprotein, 217 Acot12 acyl-CoAthioesterase12 AB040609 NM_130747 1.09 0.004 218 LOC100363401 celldivisioncycle26-like XM_002729269 1.08 0.007 219 Cldn11 claudin11 BC070927 NM_053457 1.08 0.008 220 DSTN Destrin CAG46754.1 CR541956.1 1.23 0.040 221 ENO3 Beta-Enolase 3 P13929.5 1.12 0.040 222 RNF165/Ark2C E3 ubiquitin protein ligase Arkadia NP_001317260.1 1.18 0.040 223 RNFT2 Ring-finger and transmembranedomain Q96EX2.2 1.33 0.040 containingprotein 2 224 S100A12 S100 calcium binding protein in P80511.2 1.46 0.040 amniotic fluid 225 ANKRD34C ankyrin repeat domain containing NP_001139813.1 1.20 0.040 protein 34C 226 C9 Complement 9 AAB51328.1 1.15 0.040 227 C1S Complement C1s subcomponent P09871.1 1.22 0.040 228 CD34 Hematopoietic progenitor cell antigen P28906.2 1.19 0.040 34 229 CD40 Tumor necrosis factor receptor P25942.1 1.32 0.040 superfamily member 5 230 CFB Complement factor B P00751.2 1.16 0.040 231 CRP cAMP-activated global trnascriptional P0ACJ8.1 1.21 0.040 regulator 232 CXCL1 CXC motif chemokine 1 P09341.1 1.45 0.040 233 HIF1A Hypoxia-inducible factor 1-alpha Q16665.1 1.23 0.040 234 IL10 Interleukin 10 CAG46790.1 1.17 0.040 235 IL6 Interleukin 6 P05231.1 1.22 0.040 236 KCNA2 Potassium voltage-gated channel P16389.2 1.20 0.040 subfamily A member 2 237 LYPD1 Ly6/PLAUR domain-containing protein 1 Q8N2G4.2 1.23 0.040 238 OMG Oligodendrocyte-myelin glycoprotein P23515.2 1.15 0.040 239 RBFOX1 RNA-binding protein fox-1 homolog 1 Q9JJ43.3 1.24 0.040 240 RBFOX2 RNA-binding protein fox-1 homolog 2 O43251.3 1.32 0.040 241 TARDBP/TDP-43 TAR-DNA binding protein 43 Q13148.1 1.36 0.040 242 CAPN1 Calpain 1 catalytic subunit P07384.1 1.26 0.040 243 TNIK TRAF2 and NCK-interacting protein Q9UKE5.1 1.34 0.008 kinase 244 CNP 2,3-cyclic-nucleotide 3- P09543.2 1.24 0.040 phosphodiesterase 245 CRHR1 corticotropn relasing factor 1 P34998.1 1.19 0.040 246 MPPED1 Metallophosphoesterase domain- O15442.3 1.42 0.040 containing protein 1 247 ITGAM Integrin alpha M P11215.2 1.29 0.040 248 GSG1L Germ cell-specific gene 1-like protein Q6UXU4.2 1.19 0.040 249 CUX2 Homeobox protein cut-like 2 O14529.4 1.23 0.040 250 SLC45A1 proton-associated sugar transproter Q9Y2W3.4 1.41 0.040 indicates data missing or illegible when filed

TABLE-US-00002 TABLE 2 cDNA add- target (rat) primer forward 5-3 primer reverse 5-3 dilutior ons M TG Ifng GCCCTCTCTGGCTGTTACTG CTGATGGCCTGGTTGTCTTT 1:25 5% n = 7 n = 3 (SEQ ID NO: 31) concentration: (SEQ ID NO: 32) concentration: 300 nM Factor 50 nM Q Ccl4 CTCTCTCCTCCTGCTTGTGG CACAGATTTGCCTGCCTTTT 1:25 5% n = 8 n = 6 (SEQ ID NO: 33) concentration: (SEQ ID NO: 34) concentration: 50 nM Factor 900 nM Q Il13ra1 GAAACATGGAGGGTGCAAGT CACTGCGACAAAGACTGGAA 1:25 5% n = 7 n = 5 (SEQ ID NO: 35) concentration: (SEQ ID NO: 36) concentration: 300 nM Factor 300 nM Q Il12rb2 AGCCTCTTAACAGCACATCCT TGAAATTCATATTCTGTGAATGGTCT 1:25 no n = 8 n = 5 (SEQ ID NO: 37) concentration: (SEQ ID NO: 38) concentration: 300 nM 300 nM C3 GAGAGCTGGTTGTGGACCAT CAGTCGCAGGTCAATGAAGA 1:25 5% n = 7 n = 5 (SEQ ID NO: 39) concentration: (SEQ ID NO: 40) concentration: 300 nM Factor 50 nM Q Slc27a2 GCAGGAAATACAACGCCACT TCTTCCAACAGCTCCGATTT 1:25 5% n = 8 n = 5 (SEQ ID NO: 41) concentration: (SEQ ID NO: 42) concentration: 300 nM Factor 50 nM Q Actin GAGAGGGAAATCGTGCGTG CATGGATGCCACAGGATTCC depen- no (SEQ ID NO: 43) concentration: (SEQ ID NO: 44) concentration: 300 nM dent on 300 nM target batch target cDNA add- batch 2 | LMU 1 | Grafenberg (human) primer forward 5-3 primer reverse 5-3 dilutior ons HC SP UR CTRL SCZ IFNG GGCTGTAGATTCTCGAGTGCGG CGCTACATCTGAATGACCTGC 1:50 no n = 43 n = 57 n = 9 n = 51 n = 15 (SEQ ID NO: 1) concentration: (SEQ ID NO: 2) concentration: 300 nM 300 nM CCL4 CTGAGTTCTGCAGCCTCACC CTGGGATCAGCACAGACTTGC 1:10 no n = 41 n = 54 n = 9 n = 50 n = 17 (SEQ ID NO: 3) concentration: (SEQ ID NO: 4) concentration: 300 nM 300 nM IL13RA1 CCACCCGAGGGAGCCAGCTC CTTCTGGGGGTGAGATGC 1:10 no n = 44 n = 55 n = 8 n = 51 n = 18 (SEQ ID NO: 5) concentration: (SEQ ID NO: 6) concentration: 50 nM 50 nM IL12RB2 GACTGTGGCCTGCACCTG GACAGCAGTAACCTTGGCTGTG 1:10 no n = 42 n = 54 n = 9 n = 48 n = 16 (SEQ ID NO: 7) concentration: (SEQ ID NO: 8) concentration: 300 nM 300 nM C3 GCTCCAGACACAGATGACCTG GCGTAGACCTTGACTGCTCCAG 1:10 no n = 45 n = 17 (SEQ ID NO: 9) concentration: (SEQ ID NO: 10) concentration: 300 nM 50 nM C3 CCCTCACGGCCTTTGTTCTC GCCAGAGCATAGCCAGCAATG 1:10 no n = 38 n = 53 n = 7 (SEQ ID NO: 11) (SEQ ID NO: 12) concentration: 300 nM SLC27A2 CCACGACAGAGTTGGAGATAC GGCCTTGCATAACTAGGTAGG 1:25 no n = 43 n = 57 n = 8 n = 49 n = 18 (SEQ ID NO: 13) concentration: (SEQ ID NO: 14) concentration: 300 nM 300 nM RGS1 GAGTTCTGGCTGGCTTGTGAAG GGCTGTAGATTCTCGAGTGCGG 1:10 no n = 43 n = 57 n = 8 n = 50 n = 18 (SEQ ID NO: 15) concentration: (SEQ ID NO: 16) concentraticn: 300 nM 300 nM JAK2 GAATGTCTTGGGATGGCAGTG CAGTGGCTTTGCATTGGCTG 1:10 no n = 38 n = 50 n = 8 (SEQ ID NO: 17) concentration: (SEQ ID NO: 18) concentration: 300 nM 300 nM CCR5 GAGACATCCGTTCCCCTACAAG GTGAGTAGAGCGGAGGCAGG 1:10 no n = 38 n = 51 n = 8 n = 31 n = 13 (SEQ ID NO: 19) concentration: (SEQ ID NO: 20) concentration: 300 nM 300 nM FPR2 GTGTCCTATGAGTCTGCTGG CCATGGCCATGGAGACAATG 1:10 no n = 45 n = 53 n = 9 (SEQ ID NO: 21) concentration: (SEQ ID NO: 22) concentration: 300 nM 300 nM NKG7 CCCGCTTGTCTCAACCACC CACAGTGAGCACCCAGGC 1:10 no n = 40 n = 54 n = 9 (SEQ ID NO: 23) concentration: (SEQ ID NO: 24) concentration: 300 nM 300 nM KMO GAATGCGGGCTTTGAAGACTG CGCGTGATCATCTGGGATTC 1:10 no n = 44 n = 53 n = 9 (SEQ ID NO: 25) concentration: (SEQ ID NO: 26) concentration: 300 nM 300 nM SERPINB1 GACCAGAGGTAACACGGCAG CACTGGCCAGGTCAGCAC 1:10 no n = 39 n = 51 n = 8 (SEQ ID NO: 27) concentration: (SEQ ID NO: 28) concentration: 300 nM 300 nM ARF1 GACCACGATCCTCTACAAGC TCCCACACAGTGAAGCTGATG depen- no (SEQ ID NO: 29) concentration: (SEQ ID NO: 30) concentration: 300 nM dent on 300 nM target