ANGIOPOIETIN-1- OR VEGF-SECRETING STEM CELL AND PHARMACEUTICAL COMPOSITION FOR PREVENTION OR TREATMENT OF CARDIOVASCULAR DISEASE, COMPRISING SAME

20200368284 ยท 2020-11-26

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed are angiopoietin-1 (Ang-1)- or VEGF-secreting stem cells promotive of vascular formation, a generation method therefor, and a use thereof in preventing or treating cardiovascular disease.

    Claims

    1-6. (canceled)

    7. A method of vascular formation, comprising administering at least one mesenchymal stem cell selected from the group consisting of a VEGF-secreting mesenchymal stem cell and an Ang-1-secreting mesenchymal stem cell, or a culture of the mesenchymal stem cell, to a subject in need of vascular formation, wherein the VEGF-secreting mesenchymal stem cell contains a VEGF gene inserted thereinto and secrets VEGF, and the Ang-1-secreting mesenchymal stem cell contains an Ang-1 gene inserted thereinto and secrets Ang-1.

    8. The method of claim 7, wherein the mesenchymal stem cell is an umbilical cord-derived mesenchymal stem cell.

    9. The method of claim 7, wherein the VEGF gene and the Ang-1 gene are inserted into a safe harbor site in the genome of the mesenchymal stem cell.

    10. A method of inhibiting ischemic cell death, comprising administering at least one mesenchymal stem cell selected from the group consisting of a VEGF-secreting mesenchymal stem cell and an Ang-1-secreting mesenchymal stem cell, or a culture of the mesenchymal stem cells, to a subject in need of inhibiting ischemic cell death, wherein the VEGF-secreting mesenchymal stem cell contains a VEGF gene inserted thereinto and secrets VEGF, and the Ang-1-secreting mesenchymal stem cell contains an Ang-1 gene inserted thereinto and secrets Ang-1.

    11. The method of claim 10, wherein the mesenchymal stem cell is an umbilical cord-derived mesenchymal stem cell.

    12. The method of claim 10, wherein the VEGF gene and the Ang-1 gene are inserted into a safe harbor site in the genome of the mesenchymal stem cell.

    13. A method of preventing or treating a cardiovascular disease, comprising administering at least one mesenchymal stem cell selected from the group consisting of a VEGF-secreting mesenchymal stem cell and an Ang-1-secreting mesenchymal stem cell, or a culture of the mesenchymal stem cells, to a subject in need of preventing or treating a cardiovascular disease, wherein the VEGF-secreting mesenchymal stem cell contains a VEGF gene inserted thereinto and secrets VEGF, and the Ang-1-secreting mesenchymal stem cell contains an Ang-1 gene inserted thereinto and secrets Ang-1.

    14. The method of claim 13, wherein the cardiovascular disease is stroke, myocardial infarction, angina pectoris, lower limb ischemia, hypertension, or arrhythmia.

    15. The method of claim 13, wherein the mesenchymal stem cell is an umbilical cord-derived mesenchymal stem cell.

    16. The method of claim 13, wherein the VEGF gene and the Ang-1 gene are inserted into a safe harbor site in the genome of the mesenchymal stem cell.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0157] FIG. 1 shows a schematic diagram of a vector structure for use in generating Ang-1-secreting umbilical cord mesenchymal stem cells, and the secretion of Ang-1 from the cells generated therewith as measured by western blotting and ELISA assays.

    [0158] FIG. 2 shows a schematic diagram of a vector structure for use in VEGF-secreting umbilical cord mesenchymal stem cells, and the secretion of VEGF from the cells generated therewith as measured by western blotting and ELISA assays.

    [0159] FIGS. 3a and 3b are views illustrating the increase of indel efficiency by CRISPR/Cas9 RNP in Jurkat cells, wherein the CRISPR/Cas9 RNP is prepared to deliver a vector for generating Ang-1- or VEGF-secreting cells.

    [0160] FIG. 4 shows photographic images illustrating lower limb injury in the mouse lower limb ischemia models to which Ang-1-secreting umbilical cord mesenchymal stem cells or VEGF-secreting umbilical cord stem cells were injected.

    [0161] FIGS. 5a to 5c shows the effects of Ang-1- and VEGF-secreting umbilical cord mesenchymal stem cells in terms of the viability of cardiomyocytes (proliferation assay) (5a), the degree of vascular formation (5b), and the expression levels of main factors (5c).

    [0162] FIG. 6 shows degrees of fibrosis in the heart tissues of the myocardial infarction models treated with Ang-1-secreting umbilical cord mesenchymal stem cells and VEGF-secreting umbilical cord mesenchymal stem cells alone or in combination in terms of scar area (% of LV (left ventricular) area), infarcted wall thickness (mm), and LV expansion index.

    [0163] FIG. 7a shows in vivo CINE-f-MRI images accounting for ejection fractions of the rat hearts in myocardial infarction models co-treated with Ang-1-MSC and VEGF-MSC and FIG. 7b is a graph showing infarction sizes in the models.

    [0164] FIG. 8 shows fluorescence images illustrating degrees of vascular formation in myocardial infarction models treated with either or both of Ang-1-secreting umbilical cord mesenchymal stem cells and VEGF-secreting umbilical cord mesenchymal stem cells.

    MODE FOR CARRYING OUT THE INVENTION

    [0165] Hereinafter, the present disclosure will be described in more detail with reference to Examples, which are merely illustrative and are not intended to limit the scope of the present disclosure. It is apparent to those skilled in the art that the Examples described below may be modified without departing from the essential gist of the disclosure.

    Example 1: Generation of Ang-1- and VEGF-Secreting Cell by Using CRISPR/Cas9 RNP

    [0166] 1.1. Generation of Ang-1-Secreting Cell

    [0167] An Ang-1 gene (GenBank Accession No. NM_001146.4) was inserted into a pZDonor vector (Sigma Aldrich) to construct a recombinant vector for Ang-1 expression (see FIG. 1). In addition, AAVS1-targeting CRISPR/Cas9 RNP (ToolGen, Inc) was prepared (Cas9: Streptococcus pyogenes-derived Cas9 protein; the targeting sequence of sgRNA for AAVS1: gucaccaauccugucccuag; refers to General Formula 3 supra, with respect to the entire sequence).

    [0168] The AAVS1-targeting CRISPR/Cas9 RNP and the pZDonor carrying the Ang-1 gene were co-transfected into umbilical cord mesenchymal stem cells. The umbilical cord mesenchymal stem cells were prepared as follows: human umbilical cord was treated and centrifuged. After removal of the supernatant, the cells were placed in a T25 flask and cultured in a 37 C. incubator provided with 5% CO.sub.2. After 7 days, cells adherent to the flask were subjected to chromosomal assay while the non-adhering umbilical cord cells were transferred into a T25 flask containing a modified minimum essential medium supplemented with 20% fetal bovine serum (FBS) and 4 ng/mL basic fibroblast growth factor. After 5-7 days of culturing, whether the cells adhered to the bottom and were growing was identified. When the cells stably proliferated, the medium was changed. Then, the cells were cultured to 80% confluency, with the exchange of the medium with a fresh one twice per week.

    [0169] The CRISPR/Cas9 RNP cleaves an AAVS site on cell genomic genes to insert a desired gene (e.g., Ang-1 gene) into the cleaved site, thereby generating Ang-1-secreting umbilical cord mesenchymal stem cells (Ang-1-MSC). The Ang-1 secretion of the generated Ang-1-MSC was assayed by western blotting, ELISA, PCR, and fluorescent immunostaining (Flag), and the results are depicted in FIG. 1.

    [0170] 1.2. Generation of VEGF-Secreting Cel

    [0171] A VEGF gene (GenBank Accession No. NM_001171623.1) was inserted into a pZDonor vector (Sigma-Aldrich) to construct a recombinant vector for VEGF expression (FIG. 2). In addition, AAVS1-targeting CRISPR/Cas9 RNP (ToolGene Inc.) was prepared (Cas9: Streptococcus pyogenes-derived Cas9 protein; the targeting sequence of sgRNA for AAVS1: gucaccaauccugucccuag; refers to General Formula 3 supra, with respect to the entire sequence).

    [0172] The above-prepared AAVS1-targeting CRISPR/Cas9 RNP and the pZDonor carrying the VEGF gene were co-transfected into human umbilical cord mesenchymal stem cells (see Example 1.1).

    [0173] The CRISPR/Cas9 RNP cleaves an AAVS site on cell genomic genes to insert a desired gene (e.g., VEGF gene) into the cleaved site, thereby generating VEGF-secreting umbilical cord mesenchymal stem cells (VEGF-MSC). The VEGF secretion of the generated VEGF-MSC was assayed by western blotting, ELISA, PCR, and fluorescent immunostaining (Flag), and the results are depicted in FIG. 2.

    [0174] The assays were conducted as follows:

    [0175] RT-PCR Analysis

    [0176] After RNA isolation using Trizol, cDNA was synthesized using an olig-dT primer and a reverse transcriptase. cDNA synthesis started with reverse transcription at 42_ C. for one hour, followed by thermal treatment at 95 C. for 10 min to stop the enzymatic activity. Primers for a gene of interest were designed and used for PCR (primers: Fwd: 5-cggaactctgccctctaacg-3; Rev: 5-tgaggaagagttcttgcagct-3).

    [0177] Western Blot

    [0178] The protein concentration in an isolated protein solution was measured by BCA assay and a predetermined amount of the protein solution was run on a 10% SDS-PAGE gel by electrophoresis before transfer onto a PVDF membrane. This membrane was incubated with a primary antibody (Sigma Aldrich) at 4 C. for 12 hours and then washed to remove the unbound antibody. Subsequently, incubation with an HRP-conjugated secondary antibody (Vector Laboratories) was done at room temperature for one hour. After completion of the reaction, protein expression was analyzed with ECL (Amersham).

    [0179] Immunocytochemistry-Fluorescent Staining

    [0180] Fixed cells were reacted with a primary antibody at 4 C. for 12 hours and washed, followed by incubation with fluorescein-conjugated goat anti-rabbit IgG at room temperature for one hour. The cells thus stained were mounted on a glass slide and observed under a Zeiss confocal microscope.

    [0181] In addition, gene editing (Indel: insertion and/or deletion) efficiency of the above prepared CRISPR/Cas9 RNP was tested in Jurkat cells (ATCC) and the results are depicted in FIGS. 3a and 3b.

    [0182] (In FIGS. 3 and 3b, [0183] none: mock transfection; [0184] sgRNA #1: transfected with 5-GTCACCAATCCTGTCCCTAG(TGG)-3 (hAAVS1 #1; PAM sequence in the parentheses)-targeting guide RNA (sgRNA) alone; [0185] sgRNA #2: transfected with 5-ACCCCACAGTGGGGCCACTA(GGG)-3 (hAAVS1 #2; PAM sequence in the parentheses)-targeting sgRNA alone; [0186] Sp.cas9 only: transfected with cas9 protein alone; [0187] aRGEN1: transfected with hAAVS1 #1-targeting sgRNA #1 plus cas9; [0188] aRGEN2: transfected with hAAVS1 #2-targeting sgRNA #2 plus cas9; [0189] dRGEN1: transfected with hAAVS1 #1-targeting sgRNA #1 plus cas9-carrying plasmid; and [0190] dRGEN2: transfected with hAAVS1 #2-targeting sgRNA #2 plus cas9-carrying plasmid)

    [0191] As shown in FIGS. 3a and 3b, the RNP form was observed to have higher efficiency in intracellular delivery and gene editing than plasmid form.

    Example 2: Protective Effect on Cardiomyocyte

    [0192] 2.1. Human Cardiomyocyte Culturing

    [0193] Cardiomyocytes were suspended in DMEM (culture medium) containing 5% (v/v) FBS, 5% (v/v) HS (horse serum), 20 g/ml gentamicin and 2.5 g/ml amphotericin B, plated at a density of 110.sup.6 cells/ml (10 ml) into 10-cm culture dishes, and maintained at 37 C. in a 5% CO.sub.2/95% atmosphere in an incubator. After 2-3 weeks of in vitro culture, the cells were treated with AGE-albumin and used in analyzing apoptosis-related properties.

    [0194] 2.2. Cell Viability (MTT Assay)

    [0195] Human cardiomyocytes prepared in Example 2.1 were seeded at a density of 210.sup.3 cells/well into 96-well plates. When reaching 80% confluence, the human cardiomyocytes were treated with 50 nM AGE-albumin for 24 hours and then with Ang-1-MSC (Ang-1-secreting umbilical cord mesenchymal stem cells) or VEGF-MSC (VEGF-secreting umbilical cord mesenchymal stem cells) (see Example 1) for 24 hours. Thereafter, the cells were rinsed with PBS and examined for viability using an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] assay. Living cells reduce the yellow MTT compound into purple formazan, which is soluble in dimethyl sulfoxide (Me.sub.2SO). In each well, the cells were incubated for 2 hours with the MTT compound at 0.5 mg/ml and then added with DMSO (Sigma-Aldrich). The intensity of blue staining in the culture medium was measured at 540 nm using a spectrophotometer and was expressed as proportional amounts of living cells.

    [0196] The results are shown in FIGS. 5a (proliferation assay result; cell viability) and 5b (views of stereoscopic optical microscope; angiogenesis rate) (GFP: GFP-MSC, VEGF: VEGF-MSC, ANG1: ANG1-MSC, VEGF+ANG1: mixture of VEGF-MSC and ANG1-MSC, and rhVEGF: recombinant human VEGF (RND system)).

    [0197] As shown in FIGS. 5a and 5b, human cardiomyocytes, when treated with AGE-albumin, underwent cell death and thus decreased in cell viability. In contrast, treatment with ANG-1- and/or VEGF-secreting umbilical cord mesenchymal stem cells increased cell viability and angiogenesis rate in primary human cardiomyocyte. In addition, a remarkably higher effect was brought about in angiogenesis rate by VEGF-MSC than the recombinant protein rhVEGF, which is attributed to the fact that VEGF-MSC contributes to secrete VEGF.

    [0198] These data indicate that ANG-1- or VEGF-secreting umbilical cord mesenchymal stem cells have a protective effect on cardiac muscle cell death (inhibitory effect on cardiomyocyte death) at higher efficiency than protein forms of ANG-1 or VEGF.

    [0199] 2.3. Measurement of Angiogenic and Vasculogenic Factor (Western Blotting)

    [0200] The cardiomyocytes treated with each of the stem cells in Example 2.2 were powdered with liquid nitrogen and lysed in RIPA buffer (Abcam). After centrifugation, the supernatant was taken as a solution of proteins from the stem cell-treated cardiomyocytes. The protein concentration in an isolated protein solution was measured using BCA (Life technologies) according to the manufacturer's instructions and a predetermined amount of the protein solution (total protein amount: 30 g) was run on a 10% SDS-PAGE gel by electrophoresis before transfer onto a PVDF membrane. This membrane was incubated with a primary antibody (Sigma Aldrich) at 4 C. for 12 hours and then washed to remove the unbound antibody. Subsequently, incubation with an HRP-conjugated secondary antibody (Vector Laboratories) was done at room temperature for one hour. After completion of the reaction, protein expression was analyzed with ECL (Amersham). The results are given in FIG. 5c. As shown in FIG. 5c, the most prominent increase in the expression of Akt and p-ERK1/2, which are essential for angiogenesis and vasculogenesis was observed upon treatment with ANG-1- and/or VEGF-secreting umbilical cord mesenchymal stem cells.

    Example 3: Protective Effect of Ang-1-MSC or VEGF-MSC on Cardiac Muscle Cell Death in Myocardial Infarction Model (In Vivo Assay)

    [0201] 3.1. Establishment of Myocardial Infarction Animal Model

    [0202] Sprague-Dawley rats, each weighing 250-300 g, were prepared, and anaesthetized with a combination of ketamine (50 mg/kg) and xylazine (4 mg/kg). A 16-gauge catheter was inserted into the bronchus and connected with an artificial respirator. After the animal was fixed with a tape against a flat plate to secure the limbs and the tail, a 1-1.5 cm vertical incision was made left from the sternum, and the pectoralis major muscle was separated from the pectoralis minor muscle to ascertain the space between the 5.sup.th and 6.sup.th ribs. Then, the muscle therebetween was carefully incised at 1 cm in a widthwise direction. A retractor was pushed in between the 5.sup.th and 6.sup.th ribs which were then separated further from each other. Since the upper part of the heart is typically covered with the thymus in rats, the thymus was pulled to the head using an angle hook to clearly view the heart. The figure of the left coronary artery was scrutinized to determine the range of artery branches to be tied. The LAD (left anterior descending artery) located 2-3 mm below the junction of the pulmonary conus and the left atrial appendage was ligated with 6-0 silk. Subsequently, the 5.sup.th and 6.sup.th ribs were positioned to their original places, and the incised muscle was sutured with MAXON 4-0 filament, followed by withdrawing air from the thoracic cavity through a 23-gauge needle syringe to spread the lungs fully. The skin was sutured with MAXON 4-0 filament. The catheter was withdrawn, and viscous materials were removed from the pharynx. After operation, a pain-relieving agent (Buprenorphine 0.025 mg/kg) was subcutaneously injected every 12 hours.

    [0203] 3.2. Protective Effect of Ang-1-MSC or VEGF-MSC

    [0204] To the myocardial infarction animal model prepared above, the Ang-1-secreting umbilical cord mesenchymal stem cells (Ang-1-MSC) and/or VEGF-secreting umbilical cord mesenchymal stem cells (VEGF-MSC) were injected (injection dose: a total of 30 l, 110.sup.6 cells in 30 l). The cardiomyocytes were stained with cresyl violet and counted under a microscope.

    [0205] The results are given in FIG. 6. FIG. 6 shows images of stained heart tissues (upper panels) and graphs pertaining to infarction (lower panels). Depicted in the graphs are quantitated scar areas (% of LV (left ventricular) area), with lower numerical values accounting for lower levels of fibrosis in the heart (left), infarcted wall thicknesses (mm), with higher numerical values accounting for better rehabilitation from myocardial infarction (middle), and left ventricular (LV) expansion indices, with lower numerical values accounting for better rehabilitation from myocardial infarction. As shown in FIG. 6, the injection of the Ang-1- and/or VEGF-secreting mesenchymal stem cells reduced fibrosis areas (blue) and myocardial infarction areas (red) in the heart cells of the rats before or after myocardial infarction, with the observation of increasing therapeutic effects on myocardial infarction in the following order MSC<ANG1-MSC<VEGF-MSC<ANG1-MSC+VEGF-MSC (A+V MSC).

    [0206] In addition, ejection fractions of the rat heart in the myocardial infarction models co-treated with Ang-1-MSC and VEGF-MSC are shown in FIG. 7a, as imaged in vivo by the CINE-f-MRI while infarction sizes are graphed in FIG. 7b. As can be seen in FIGS. 7a and 7b, the ejection fraction of the co-treated heart was prominently increased, compared to that of general MSC-treated heart.

    Example 4: Protective Effect of Ang-1-MSC or VEGF-MSC on Cardiac Muscle Cell Death in Lower Limb Ischemia Model (In Vivo Assay)

    [0207] 4.1. Establishment of Rat Lower Limb Ischemia Model

    [0208] As experimental animals, male Balb/c-nu mice were used. Animal model establishment was conducted in a clean and sterile environment under the anesthesia by N20:02=1:1 (v:v), isoflurane inhalation.

    [0209] After anesthesia, incision of about 2 cm was made on the skin. Then, 3-0 surgical silk was applied to an accurate site (5-6 mm below iliac arteries or superficial femoral arteries and inguinal ligament) for ligation, followed by closing the skin with a skin clip.

    [0210] 4.2. Protective Effect on Lower Limb Muscle Cell Death

    [0211] To examine the protective effect of Ang-1-MSC or VEGF-MSC on lower limb muscle cell death in lower limb ischemia model, a total of 10.sup.6 cells of Ang-1-MSC was injected into the tissue of the rat lower limb ischemia model established above. After one and two weeks, the lower limbs of the mice were observed and are shown in FIG. 4.

    [0212] FIG. 4 shows photographic images of lower limbs of the mouse lower limb ischemia models to which Ang-1-MSC, MSC (positive control), and PBS (negative control) were injected (Sham: normal mouse with no lower limb ischemia induced therein). As shown in FIG. 4, lower limb muscle cell death was reduced in the Ang-1-MSC-injected mouse, compared to the MSC- or PBS-injected mouse.

    Example 5: Immunohistochemistry (IHC)

    [0213] Immunohistochemistry was conducted on heart tissues from normal or myocardial infarction rats. Normal or myocardial infarction heart tissues were fixed with 4% paraformaldehyde in a 0.1 M neutral phosphate buffer, cryopreserved overnight in a 30% sucrose solution, and then sectioned on a cryostat (Leica CM 1900) at a 10 m thickness. Paraffin-embedded tissues were cut into 10 m-thick sections, deparaffinized with xylene, and rehydrated with a series of graded ethanol. Normal goat serum (10%) was used to block non-specific protein binding. The tissue sections were incubated overnight at 4 C. with the following primary antibodies: rabbit anti-alpha-SMA antibody (Abcam), mouse anti-human albumin antibody (1:200, R&D System), and goat anti-Iba1 antibody (1:500, Abcam). Then, the tissue sections were washed three times with PBS before incubation for 1 hour at room temperature with Alexa Fluor 633 anti-mouse IgG (1:500, Invitrogen). After washing the secondary antibodies three times with PBS, coverslips were mounted onto glass slides using the Vectashield mounting medium (Vector Laboratories), and observed under a laser confocal fluorescence microscope (LSM-710, Carl Zeiss).

    [0214] The results are depicted in FIG. 8. As shown in FIG. 8, the alpha-SMA factor, which is responsible for angiogenesis, was most intensively stained upon treatment with either or both of Ang-1-MSC and VEGF-MSC in the rat heart tissues.