METHOD OF TREATING TYPE II DIABETES AND OBESITY AND METHOD OF SCREENING A MEDICAMENT FOR THE SAME
20200370045 ยท 2020-11-26
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
A61K49/0008
HUMAN NECESSITIES
A61K38/465
HUMAN NECESSITIES
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
G01N33/50
PHYSICS
A61K31/7088
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
Abstract
The present invention provides a use of an agent for preparing a medicament for inhibiting microRNA-708. The medicament is used for at least one of the following: reducing intracellular triglyceride content, inhibiting differentiation of fat cells, resisting obesity, promoting insulin sensitivity, increasing respiratory metabolic rates, increasing energy consumption, increasing the number of mitochondria, up-regulating oxidative phosphorylation or heat-producing genes, relieving insulin resistance, resisting fatty liver and treating or preventing Type 2 diabetes.
Claims
1.-13. (canceled)
14. A method of treating type II diabetes or obesity, comprising introducing to a subject in need thereof a therapeutically effective amount of a reagent for microRNA-708 inhibition.
15. The method according to claim 14, wherein the inhibition is achieved by at least one of short hairpin RNA (shRNA), an antisense nucleic acid, ribozyme, dominant negative mutation, CRISPR-Cas9, CRISPR-Cpfl and zinc finger nuclease.
16. The method according to claim 14, wherein the inhibition is achieved by knocking down or knocking out a first nucleic acid comprising a nucleotide sequence set forth in SEQ ID NO: 1.
17. The method according to claim 14, wherein the inhibition is achieved by introducing a second nucleic acid comprising a nucleotide sequence set forth in SEQ ID NO: 2, wherein the second nucleic acid is reverse complementary to the first nucleic acid.
18. The method according to claim 14, wherein the obesity is induced by high fat diets.
19. The method according to claim 14, wherein the reagent for microRNA-708 inhibition is capable of decreasing an intracellular triglyceride level.
20. The method according to claim 14, wherein the reagent for microRNA-708 inhibition is capable of enhancing insulin sensitivity.
21. The method according to claim 20, wherein the reagent for microRNA-708 inhibition is capable of improving insulin tolerance.
22. The method according to claim 20, wherein the reagent for microRNA-708 inhibition is capable of improving glucose tolerance.
23. The method according to claim 14, wherein the reagent for microRNA-708 inhibition is capable of increasing an energy expenditure rate for microRNA-708 inhibition.
24. The method according to claim 23, wherein the reagent for microRNA-708 inhibition is capable of increasing a respiratory-metabolic rate for microRNA-708 inhibition.
25. The method according to claim 23, wherein the reagent for microRNA-708 inhibition is capable of increasing the number of mitochondria.
26. The method according to claim 23, wherein the reagent for microRNA-708 inhibition is capable of up-regulating an oxidative phosphorylation- or thermogenesis-related gene.
27. The method according to claim 26, wherein the oxidative phosphorylation- or thermogenesis-related gene comprises at least one of ucpl, cidea, pgcla, ppara and Dio2.
28. The method according to claim 14, wherein the reagent for microRNA-708 inhibition is capable of alleviating fatty liver.
29. The method according to claim 14, wherein the reagent for microRNA-708 inhibition is introduced to the subject sequentially or simultaneously in combination with an additional reagent for type II diabetes and obesity.
30. The method according to claim 29, wherein the additional reagent comprises at least one selected from orlistat and thiazolidinedione.
31. A method of screening a medicament for type II diabetes and obesity, comprising contacting a candidate medicament with a disease model, wherein microRNA-708 inhibition in the disease model after the contact is an indicator of the candidate medicament being a target medicament.
32. The method according to claim 31, wherein the disease model is adipocytes or a mouse obesity model.
33. The method according to claim 31, wherein the microRNA-708 inhibition comprises down-regulation of microRNA-708 expression or inhibition of microRNA-708 function.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION
[0047] Reference will be made in detail to embodiments of the present disclosure, and examples of the embodiments are shown in the drawings. The embodiments described herein with reference to drawings are explanatory, illustrative, and used to generally understand the present disclosure. The embodiments shall not be construed to limit the present disclosure.
EXAMPLE 1
[0048] Significantly Increased Intracellular Triglyceride Caused by microRNA-708
[0049] Mouse primary fat cells were cultured for 48 hours in the presence of mirRNA-708 transfection (a well-established sequence synthesized in Shanghai GenePharma Co., Ltd) or scramble transfection (negative control) with lipofectamine 2000. After washed with PBS 2-3 times and transferred in 2 ml PBS to a 15 ml falcon tube, the cells were added with 8 ml (Hexanelsoproponal=3:2) for vigorous vibration on a shaker overnight. After about 10 min still standing, when white precipitation in the middle layer disappeared, the organic phase at the upper layer was transferred to a glass tube, which was heated at 70 C. at the bottom and blow-dried with nitrogen at the top, and then dissolved in 100 l toluene. The resulting protein-containing aqueous solution at the bottom was centrifuged at 4000 rpm for 20 min, with the aqueous solution discarded and pellets dried at 60 C. to be powders (by placed on a heat block in an ultra-clean bench), which was then dissolved in 1 ml 0.2M KOH overnight. In the next day, the protein concentrations were assayed and used as internal reference. The collected test sample and the standard lipid solution were subjected to TLC (Hexane:Ether:Acetic acid=70:30:1), followed by immersing in copper sulfate for about 20 seconds, and then slightly blow-drying till no obvious droplets existed. After dried at 100 to 120 C. for 5 to 10 min, gel imaging system was applied for quantitative analysis.
[0050] It is found by the present inventors that the intracellular triglyceride is significantly increased by microRNA-708 as shown in
EXAMPLE 2
[0051] Role of microRNA-708 in Adipose Metabolism
[0052] Total RNA was extracted from various tissues of mice respectively for detection of microRNA-708 distribution by Realtime PCR, from which it is found by the present inventors that microRNA-708 is specifically and highly expressed in adipose tissue. Further, the mouse primary preadipocyte isolated by centrifugation were induced to differentiate to mature adipocytes in vitro, during which increasing microRNA-708 expression levels were observed as adipocytes differentiated, proving that microRNA-708 is closely related to the function of adipose tissue or adipocytes. The results are shown in
[0053] After 10 weeks' accommodation, healthy and microRNA-708 knockout mice (purchased from Nanjing Institute of Model Biology and achieved by cas9 engineering technology) were fed with normal diets (ND) and the high fat diets (HFD) respectively for another 10 weeks, with body weight measured weekly. As shown in
[0054] As obesity is closely related to type II diabetes, the present inventors also examined the role of microRNA-708 in insulin sensitivity, where insulin tolerance test (ITT) and glucose tolerance test (GTT) were adopted. ITTs of the microRNA-708 knockout mice were assayed 0, 15, 30, 60, and 90 min after an intraperitoneal injection of insulin (diluted as 0.5 U/ml in saline and dosed at 0.5-1.2 U insulin per kg body mass, e.g., 0.5 U insulin per kg body mass, 0.027 U/10 g=2.7 U/kg) following a 4 h fast. GTTs of the microRNA-708 knockout mice were assayed 0, 15, 30, 60, and 90 min after an intraperitoneal injection of glucose (diluted as 20% glucose solution in saline and dosed at 0.5-2 g glucose per kg body mass, e.g., 1 g glucose per kg body mass) following overnight fast. As shown in
[0055] Furthermore, oxygen expenditure and carbon dioxide emissions per minute per body mass of healthy and microRNA-708 knockout mice were monitored individually in the metabolic chamber. As shown in
[0056] The subcutaneous adipose tissue from healthy and microRNA-708 knockout mice were fixed in 10% paraformaldehyde and stained with haematoxylin-eosin for electron microscope analysis. As shown in
[0057] After extracted from healthy and microRNA-708 knockout mice, respective RNA was subjected to reverse transcription to obtain cDNA for gene detection by Realtime-PCR.
[0058] Next, the lipid contents were investigated between healthy and microRNA-708 knockout mice. By means of TLC detection, the significantly reduced hepatic triglyceride content was observed in the mirRNA-708 knockout mice fed with high fat diets relative to that of healthy mice, as shown in
[0059] A designed RNA sequence (CCCAGCUAGACUUGUAAGUCCUU (SEQ ID NO: 2)), reverse complementary to microRNA-708, was subcutaneously injected at 10 D/g to 2-month old obese mice (fed with HFD for two months) weekly for four weeks. By such treatment, the obesity levels in the obese mice were declined distinctly and insulin tolerance symptoms were also significantly alleviated, shown in
EXAMPLE 3
[0060] microRNA-708 Profile in the Human Obesity Model
[0061] The present inventors collected fat tissues from different regions of healthy and obese patients (including abdominal adipose tissue, abdominal subcutaneous adipose tissue and inguinal subcutaneous adipose tissue) from the Department of Endocrinology, Shanghai Sixth Hospital. These tissues were homogenized for extraction of total RNA by TRIZOL. The steps are as follows:
[0062] 1. adding Trizol to cells or tissues, still standing at room temperature for 5 min for sufficient lysis;
[0063] 2. centrifuging at 12,000 rpm for 5 min with pellet discarded;
[0064] 3. adding 200 l chloroform per 1 ml Trizol, vortex for mixing and placing at room temperature for 15 min;
[0065] 4. centrifuging at 12,000 g for 15 min at 4 C.;
[0066] 5. pipetting the upper aqueous phase into another centrifuge tube;
[0067] 6. adding 0.5 ml isopropanol per 1 ml Trizol, vortex for mixing, placing at room temperature for 5 to 10 min;
[0068] 7. centrifuging at 12,000 g for 10 min at 4 C. with supernatant discarded and thus RNA pellet obtained;
[0069] 8. adding 1 ml 75% ethanol per 1 ml Trizol, gently shaking to re-suspend the pellet;
[0070] 9. centrifuging at 8,000 g for 5 min at 4 C. with supernatant discarded;
[0071] 10. air-drying at room temperature or vacuum drying for 5 to 10 min.
[0072] After reverse transcription was performed using miRNA reverse transcription kit from TransGen Biotech, the expression level of mirRNA-708 in these tissues were detected by Real-Time PCT. It is found that microRNA was expressed significantly higher in adipose tissues of obese human relative to that of healthy human, as shown in
[0073] Reference throughout this specification to an embodiment, some embodiments, one embodiment, another example, an example, a specific example or some examples means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present disclosure. Thus, the appearances of the phrases such as in some embodiments, in one embodiment, in an embodiment, in another example, in an example, in a specific example or in some examples in various places throughout this specification are not necessarily referring to the same embodiment or example of the present disclosure. Furthermore, the particular features, structures, materials, or characteristics may be combined in any suitable manner in one or more embodiments or examples.
[0074] Although explanatory embodiments have been shown and described, it would be appreciated by those ordinarily skilled in the art that the above embodiments cannot be construed to limit the present disclosure, and changes, alternatives, and modifications can be made in the embodiments in the scope of the present disclosure.