METHOD FOR DETERMINING A TISSUE INJURY AND REPAIR (TIAR) PROCESS ASSOCIATED WITH ABNORMAL FORMATION OF ENDOMETRIAL TISSUE

20200371112 ยท 2020-11-26

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to a method for determining the presence of a tissue injury and repair (TIAR) process in the uterus of a subject. The presence of TIAR is employed as a marker for the presence of a preliminary stage and/or increased risk of developing a medical disorder associated with abnormal formation of endometrial tissue. Such medical conditions are preferably an archimetrosis, such as endometriosis or adenomyosis. The method comprises determining a level of CXCL12 and/or CXCR4 in a sample from a subject.

    Claims

    1. Method for determining the presence of a tissue injury and repair (TIAR) process in the uterus of a subject as a marker for the presence of a preliminary stage or increased risk of developing a medical disorder associated with abnormal formation of endometrial tissue, comprising: a) providing a sample of said patient, b) determining a level of CXCL12 and/or CXCR4 in said sample, c) wherein the level of CXCL12 and/or CXCR4 correlates with the presence of tissue injury and repair (TIAR) processes in the uterus of a subject.

    2. Method according to claim 1, wherein the tissue injury and repair (TIAR) process comprises uterine auto-traumatization.

    3. Method according to any one of the preceding claims, wherein the recruitment of bone marrow-derived stem cells, preferably mesenchymal stem cells, is evident in the uterus of said subject.

    4. Method according to any one of the preceding claims, wherein the subject exhibits symptoms of dysmenorrhea.

    5. Method according to any one of the preceding claims, wherein the medical disorder associated with abnormal formation of endometrial tissue is endometriosis.

    6. Method according to any one of the preceding claims, wherein the medical disorder associated with abnormal formation of endometrial tissue is adenomyosis.

    7. Method according to any one of the preceding claims, wherein the level of CXCL12 and/or CXCR4 positively correlates with the presence of a preliminary stage or increased risk of developing a medical disorder associated with abnormal formation of endometrial tissue.

    8. Method according to any one of the preceding claims, wherein the sample comprises or consists of menstrual fluid.

    9. Method according to any one of the preceding claims, wherein the sample comprises a cervical test specimen or cervical test smear.

    10. Method according to any one of the preceding claims, wherein the method comprises a polymerase chain reaction (PCR) to determine a level of CXCL12 and/or CXCR4 in said sample, wherein said PCR comprises primers that hybridize with CXCL12 and/or CXCR4-encoding nucleic acid molecules according to one or more of SEQ ID NO 8-17.

    11. Method according to any one of the preceding claims, wherein the method comprises an immunoassay using one or more antibodies that bind CXCL12 and/or CXCR4 according to one or more of SEQ ID NO 1-7 to determine a level of CXCL12 and/or CXCR4 in said sample.

    12. Method according to any one of the preceding claims, wherein the sample is a menstrual fluid sample and said levels of CXCL12 and/or CXCR4 are elevated in said menstrual blood sample in comparison to a peripheral blood sample.

    13. Method according to any one of the preceding claims, wherein the determination of an increased risk of developing a medical disorder associated with abnormal formation of endometrial tissue is conducted prior to the occurrence of abnormal formation of endometrial tissue (such as in endometriosis and/or adenomyosis) in said subject.

    14. Method according to any one of the preceding claims, wherein the subject has been menstruating for a period of 3 years or less, preferably 2 years or less.

    15. Method according to any one of the preceding claims, wherein the subject is of an age of 12-20, preferably 12, 13, 14, 15, 16 or 17.

    Description

    FIGURES

    [0225] The invention is further described by the following figures. These are not intended to limit the scope of the invention, but represent preferred embodiments of aspects of the invention provided for greater illustration of the invention described herein.

    DETAILED DESCRIPTION OF THE FIGURES

    [0226] FIG. 1: a) A schematic representation of the endometrial-subendometrial unit (archimetra) within the human uterus based on immunocytochemical results as well as morphological and ontogenetic data. The endometrial-subendometrial unit is composed of the glandular (a1), the stromal part of the endometrium and the stratum subvasculare of the myometrium with predominantly circular muscular fibers (a2). Ontogenetically, the endometrial-subendometrial unit is derived from the paramesonephric ducts (a1) and their surrounding mesenchyme (a2). The bulk of the human myometrium does not originate from the paramesonephric ducts (a3). It consists of the stratum vasculare with a three dimensional meshwork of short muscular bundles and the stratum supravasculare with predominantly longitudinal muscular fibers. The stratum vasculare is the phylogenetically most recent acquisition and, in contrast to the endometrial-subendometrial unit, both, the stratum vasculare and supravasculare develop late during ontogeny. The stratum vasculare and supravasculare surround the uterine corpus and extend caudally only to the uterine isthmus. There is a transitory zone within the stratum vasculare adjacent to the stratum subvasculare where muscular fibers of the two layers blend (yellow margin of the stratum vasculare). The endocervical mucoasa is the most caudal structure derived from the paramesonephric ducts. The underlying circular muscular fibers, which are progressively diminishing in caudal direction, and the accompanying connective tissue blend with vaginal tissue elements (red) to form the vaginal portion of the cervix.

    [0227] b) a peritoneal endometriotic lesion (400) as an ectopic microarchimetra. With endometrial glands. endometrial stroma and peristromal muscular tissue the lesion is composed of all elements of the archimetra.

    [0228] c.) The primordial uterus of the 23.sup.rd week of pregnancy (50) is composed of the elements of the archimetra, such as endometrium and archimyometrium (specific actin staining) (top right). The archimetra is essentially the adult representation of the primordial uterus.

    [0229] d.) The halo in transvaginal sonography represents the archimyometrium as does e.) the junctional zone in MR imaging. Transvaginal sonography (TVS) and magnetic resonance imaging (MRI) of the uterus of a 29 years old woman unaffected with endometriosis and adenomyosis. Sagittal scans of the uterine midline are shown. The myometrial-endometrial lining is sharp and smooth; the halo in TVS and the junctional zone in MRI are unaltered; there is symmetry with respect to the anterior and posterior myometrial walls and the texture of the myometrium in TVS appears to be homogenous. Modified from Leyendecker et al. (2004, Annals of the New York Academy of Sciences 1034:338-355).

    [0230] FIG. 2: Schematic representation of the neometra and the archimetra

    [0231] FIG. 3: Immunohistochemistry of estrogen receptor (ER) expression during the late secretory phase (100) (left) and late secretory phase (50) (right) of the cycle. During the secretory phase of the cycle the positive ER staining is restricted to a small fringe representing basal endometrium.

    [0232] FIG. 4: Immunoreactive scores of estradiol receptor alpha expression in the functional (blue) and basalis (red), respectively, during the menstrual cycle. Modified from Leyendecker et al. (2002, Human Reproduction 17: 2725-2736).

    [0233] FIG. 5: Archimetral micro-unit. Left: Schematic representation of uterine arteries. After Okkels and Engle (1938). Right: Cross section of the uterine wall of a rhesus monkey on day 12 (a) and on day 17 (b) of the menstrual cycle. Bartelmez (1957)

    [0234] FIG. 6: Section of the uterus of a woman unaffected from endometriosis/adenomyosis during menstruation. Immunohistochemistry of estrogen receptor. The level of endometrial desquamation is within the lower functionalis.

    [0235] FIG. 7: Histogram demonstrating the frequency of the uterine peristaltic waves during menstruation, the early, mid- and late follicular and mid- and late luteal phases of the cycle, respectively, as obtained from video sonography of uterine peristalsis (VSUP) in healthy women. The relative distribution of cervico-fundal (type A) versus fundo-cervical (type B) and isthmical (type C) contractions is also shown. The graph clearly demonstrates the increase of the frequency of type A contractions with the progression of the follicular phase reaching a maximum during the late follicular phase and the decrease during the luteal phase of the cycles, respectively. With the progression of the menstrual cycle type B contraction waves almost disappear. Type C contractions prevail during the luteal phase. These contractions do not extend beyond the isthmical or lower corporal part of the uterus rendering the fundo-cornual part of the uterus a zone of relative peristaltic quiescence during the period of embryo implantation. Modified from Kunz et al. (2000, In Filicori, M. (ed) Endocrine Basis of Reproductive Function. Monduzzi Editore, Bologna, Italy).

    [0236] FIG. 8: The course of a peristaltic wave of the archimyometrium as shown by a sequence of MRI scans obtained from cinematographic MRI scan in a healthy woman in the late follicular phase. Initially, the archimyometrium appears to be relaxed indicated by a thin JZ with a less marked hypointensity (a). The peristaltic wave starts with tension of the archimyometrium in the lower half of the uterine corpus indicated by marked hypointensity of the JZ (b). The zone of increased tension (marked hypointensity) moves in fundal direction. A muscular package is built up indicated by the rapid increase of the JZ as the wave moves in fundal direction (c-e) followed by a rapid relaxation (f).

    [0237] FIG. 9: Representative colour prints obtained by hysterosalpingoscintigraphy in three different patients (panel 1: early follicular phase; panel 2: mid-follicular phase and panel 3: late follicular phase), respectively. In each patient, scintigrams were performed at one to two minute intervals. In this figure only the scintigrams following one minute (a), 16 minutes (b) and 32 minutes (c) after the vaginal application of the labelled macrospheres are depicted. In the patient of the mid-follicular phase, the dominant follicle was in the right ovary, while the macrospheres enter the left tube. In the patient of the late follicular phase the dominant follicle was situated in the left ovary, while the macrospheres tended to enter the right tube.

    [0238] FIG. 10: Modified original drawing from Werth and Grusdew showing the architecture of the subendometrial myometrium (archimyometrium) in a human fetal uterus. The specific orientation of the circular fibers of the archimyometrium results from the fusion of the two paramesonephric ducts forming a fundo-cornual raphe in the midline (dashed rectangle). The peristaltic pump of the uterus, which is continuously active during the menstrual cycle, is driven by coordinated contractions of these muscular fibers. Directed sperm transport into the dominant tube is made possible by differential activation of these fibers. The region of the fundo-cornual raphe is considered the predominant site of mechanical strain. Modified from Werth and Grusdew (1898, Archiv fr Gynkologie 55: 325-409).

    [0239] FIG. 11: Percentage of patients with the diagnosis of adenomyosis on the basis arbitrary limits of detection with respect to the thickness of the junctional zone ranging from 6 to 12 mm in the sagittal plane of the anterior or posterior wall of the uterus in 143 patients.

    [0240] FIG. 12: A graphical demonstration of the frequency of the subendometrial uterine peristaltic waves during menstruation, the early, mid- and late follicular and mid-luteal phases of the cycle, respectively, as determined by vaginal ultrasonography (contractions/minSEM) in women with and without endometriosis. The graph shows also the relative distribution of fundo-cervical contractions versus cervico-fundal contractions during these different phases of the cycle. During the early and midfollicular as well as the mid-luteal phase, respectively, the peristaltic activity differs significantly between the two groups of patients (P<0.05). During the late follicular phase the increased peristaltic activity in patients with endometriosis in comparison to the healthy controls (P=0.06) has attained the character of dysperistalsis.

    [0241] FIG. 13: The distribution pattern of uterine peristalsis with respect to the absence (dotted line) (n=36) or presence (solid line) (n=31) of endometriosis. Data of the mid-follicular and the mid-luteal phases, respectively, of the cycle were used. The peristaltic frequency was normalised to the mean frequency in women without endometriosis as 100%. In women with endometriosis the grade according to the revised AFS classification (American Society for Reproductive Medicine) is indicated in addition.

    [0242] FIG. 14: Representative scans obtained from hysterosalpingoscintigraphy in women without (left panel) and with endometriosis (right panel) 32 minutes following application of technetium-labelled macrospheres of sperm size in the posterior fornix of the vagina in six different women in the a) early follicular, b) mid-follicular phase and c) late follicular phases, respectively of the menstrual cycle. In normal women with normoperistalsis the particles usually remain at the site of application during the early follicular phase (left panel a). In women with endometriosis and hyperperistalsis there is in this phase already a massive transport of the particles through the uterine cavity in one of the tubes (right panel a). In the mid-follicular phase normal women show only a ascension of the particles into the uterine cavity and sometimes a trend of ascension into the tube ispsilateral to the dominant follicle (left panel b). In women with endometriosis the ascension dramatically increased and in this example the particles are transported through the tube into the peritoneal cavity. This was, however, the contralateral tube to the dominant follicle (right panel b). During the preovulatory phase of healthy women the particles are rapidly transported into the dominant tube (left panel c), while, due to dysperistalsis, there is a break down of directed sperm transport in women with endometriosis (right panel c). These scans show the enormous power of the uterine peristaltic pump during the early and mid-follicular phase of the cycle in women with hyperperistalsis and endometriosis. Continuous hyperperistalsis results in auto-traumatisation of the uterus. Modified from Kunz et al. (1996, Hum Reprod 11, 627-632) and from Leyendecker et al. (1996, Human Reproducion 11, 1542-1551).

    [0243] FIG. 15: Frequency of uterine peristaltic contractions during the follicular phase of the menstrual cycle in healthy women, in those with endometriosis, in those treated with HMG, resulting in unphysiologically high levels of oestradiol in serum and normal women treated with an iv bolus of oxytocin. The data show that high oestradiol levels and bolus injections of oxytocin, respectively, simulate the significantly increased uterine peristalsis in patients with endometriosis in comparison to healthy women. Values are meanSEM. Vaginal sonography of uterine peristalsis (VSUP). From Leyendecker et al. (1998 Human Reproduction Update 4: 752-762) with permission.

    [0244] FIG. 16: Sperm transport in women with and without endomteriosis as shown by hysterosalpingoscintigraphy. Left: Representative scintigrams of the early and mid-follicular phases: Right: Histograms of the respective data obtained in the early follicular phase in these women. It is demonstrated that, in women with endometriosis, there is a significantly increased cervico-fundal transport activity in women with endometriosis.

    [0245] FIG. 17: Recording of intrauterine pressure in an adolescent girl with extreme primary dysmenorrhea on the second day of the cycle (Courtesy L. Wildt and B. Bttcher)

    [0246] FIG. 18: The longitudinal extension of adenomyotic lesions in the upper third (a), middle third (b) and lower third (c) of the uterine corpus. Adenomyotic lesions were localized predominantly in the upper two thirds of the uterine corpus and extended also over the whole length of the uterine corpus (a+b+c). They did rarely present in the lower two thirds (b+c) and never in the lower third (c).

    [0247] FIG. 19: Showing examples of uterine adenomyosis in six patients as presented by magnetic resonance imaging (MRI). Representative sagittal and coronary scans are shown. In the infertile, non-parous women (a-e) (30-32 years of age) pelvic endometriosis of grade I-IV was demonstrated by laparoscopy. In the parous woman (f) (40 years of age) no laparoscopy was performed. In all scans preponderance of the adenomyotic lesions (expanded junctional zone) in the midline close to the fundo-cornual raphe of the archimyometrium can be demonstrated. In the first three scans (a-c) the diagnosis of adenomyosis would not meet the established radiologic criteria for MRI. In a scientific context, however, the irregularities of the junctional zone are characteristic of beginning adenomyosis. From Leyendecker et al. (2009 Archive of Gynecology and Obstetrics 280: 529-538) with permission.

    [0248] FIG. 20: MRI findings of adenomyosis in three representative patients without a relation of the lesions with the fundo-cornual raphe. Top: Uterus bicornis with extensive adenomyosis in both cornua; adenomyosis in the right uterus in a patient with uterus duplex. Bottom: Cystic cornual angle adenomyosis.

    [0249] FIG. 21: Nine examples of cystic cornual angle adenomyosis. These women suffered from extreme primary dysmenorrhea

    [0250] FIG. 22: Schematic representation of uterine auto-traumatisation by the mechanism of archimetral compression due neometral contraction at the onset of menstruation. N=neometra; E=endometrium;

    [0251] A=archimyometrium (a). Due to the high intrauterine pressure in consequence of the contraction of the neometra the archimyometrium ruptures in the cornual angles and fragments of basal endometrium are dislocated into myometrial wall, where they develop into endometriotic cysts (a and c). At the same time basal stromal cell at the fundo-cornual raphe are chronically overstretched resulting in the initiation of the TIAR mechanism and the development of an adenomyotic lesion.

    [0252] FIG. 23: Adenomyosis in a 32 years old woman without dysmenorrhea. In the sagittal scan the hypointense area could be considered to result from a episodic neometral contraction (top). The coronal scan performed after a lapse of time reveals adenomyotic lesions with signs of sprouting of the lesion in various directions (bottom).

    [0253] FIG. 24: Real-time PCR, comparison between women with endometriosis and controls. Patients with endometriosis are demonstrated with full line, whereas controls are demonstrated with dotted line. The figure demonstrates one representative sample out of 20 for women with endometriosis and one representative control sample out of 22.

    [0254] FIG. 25: The basic aspects of the molecular biology of the physiological mechanism of tissue injury and repair (TIAR) as demonstrates in mesenchymal tissue such as astrocytes, tendons and cartilage (Leyendecker et al., 2009)

    [0255] FIG. 26: This is a schematic demonstration of the sites of the development of persisting and deeply infiltrating adenomyosis.

    [0256] (1) Uterine adenomyosis; (2) obvarian endometriosis; (3) intestinal endopmetriosis; (4) intestinal-uterine adhesion due to an endometriotic lesion; (5) lesion in sacro-uterine ligament; (6) retrocervical-vaginal endometriosis and in the cul de sac; (7) lesion atserosa of the urinary bladder and the anterior wall of the uterus; (8) umbilical endometriosis; (9) endometriosis in the abdominal wall; (10) inguinal endometriosis. These sites are characterized by chronic mechanical strain. Modified from Cullen 1920

    [0257] FIG. 27: Implantation, miscarriage (left histogram) and ongoing pregnancies rates (right histogram), respectively, in patients with adenomyosis and in controls following ICSI and transfer of two embryos, respectively. Fertility Center Darmstadt. (Presented on the 2.sup.nd SEUD Congress, Barcelona, May 2016)

    [0258] FIG. 28: Morphological and functional aspects of the mechanism of disease. Uterine auto-traumatisation is caused by hyperperistalsis and increased neometral compression of the archimetra. Adenomyotic lesions develop near the upper uterine midline (MRI). Fragments of basal endometrium are detached and potentialy transmitted into the peritoneal cavity. Immunhistochemistry of estrodiol-receptor. While the fragment of the basdal endometrial layer is vital that of the functionalis is non-vital.

    [0259] FIG. 29: Trauma and Mllerian tissue proliferation are organ-specific (A and C). With TIAR and the morphogenetic complex (B) two non-organ specific systems are utilized for repair. The chronic proliferative process results in a complex morphological and functional destruction of the archimetra (MRI top right) resulting in dysperistalsis and infertility.

    [0260] FIG. 30: The principle of the test. The specificity of the test with respect to the early diagnosis of endometriosis is attained by examining an aliquot of menstrual blood.

    EXAMPLES

    [0261] The invention is further described by the following examples. These are not intended to limit the scope of the invention, but represent preferred embodiments of aspects of the invention provided for greater illustration of the invention described herein.

    [0262] In order to illustrate a practical embodiment of the invention, the following is carried out:

    [0263] ELISA Assay for CXCL12 Detection

    [0264] A sandwich ELISA assay is carried out using a menstrual blood samples obtained from female subjects of ages 12 to 20.

    [0265] (1) A standard plastic ELISA plate is coated with a capture antibody directed against CXCL12; the surface is prepared with a known quantity of capture antibody. Any nonspecific binding sites on the surface are blocked. The plate is washed.

    [0266] (2) The menstrual blood sample is added, and any CXCL12 present in the sample binds to the capture antibody immobilized on the solid surface; The plate is washed to remove unbound components.

    [0267] (3) A secondary detecting antibody is added, which also binds to CXCL12, and which is labelled with a horseradish peroxidase enzyme; This enzyme-linked secondary antibody is applied as a detection antibody and binds to the already immobilized CXCL12 from the sample. The plate is washed to remove the unbound antibody-enzyme conjugates.

    [0268] (4) A substrate is added, and is converted by the enzyme of the secondary antibody to a detectable form. Essentially, a chemical is added to be converted by the enzyme into a color or fluorescent or electrochemical signal. The absorbance or fluorescence or electrochemical signal of the plate wells is measured in a standardized plate reader to determine the presence and quantity of CXCL12.

    [0269] The above analysis is conducted using samples from multiple subjects who are diagnosed as healthy subjects after internal physical examination, or show symptoms of dysmenorrhea but prior to pathological indications of endometriosis. All subjects are monitored for further disease symptoms and are eventually categorized into patient groups with or without abnormal formation of endometrial tissue. Comparisons between the CXCL12 levels determined in the two subject groups indicate an elevated level of CXCL12 in subjects who went on to develop a medical condition of abnormal formation of endometrial tissue. Similar analysis on the basis of CXCR4 reveals a similar correlation.

    [0270] Pilot Study: RT-PCR Analysis of CXCL12 in Menstrual Blood Samples in Patients with Archimetrosis:

    [0271] Introduction

    [0272] The test is based on the inventive concept of the pathogenesis and pathophysiology of uterine adenomyosis and endometriosis (archimetrosis). Adenomyosis and endometriosis (archimetrosis) are caused by auto-traumatisation or iatrogenic traumatization of the uterus (Leyendecker et al. 1998; Leyendecker et al. 2015). The auto-traumatisation results from genuine biomechanical functions of the non-pregnant uterus during the menstrual cycle. These functions consist of the uterine peristalsis of the archimyometrium (subvascular layer of the myometrium) for directed sperm transport into the tube ipsilateral to the dominant follicle and high fundal implantation of the blastocyst as well as of rhythmic contractions of the stratum vasculare of the myometrium for the externalization of the menstrual debris at the end of menstrual cycle.

    [0273] The adult uterus is composed of two phylogenetically and ontogenetically different structures: The archimetra and the neometra. The archimetra is the adult representation of the primordial uterus and derived from the Mllerian duct. It develops early in phylogeny and ontogeny. The neometra, composed of the the supravascular and the vascular layers of the myometrium, respectively, is of non-Mllerian origin develops late during phylogeny and in the human late in pregnancy and even after birth (Werth and Grusdew, 1898; Leyendecker et al. 1998; Leyendecker et al. 1999; Noe et al. 1999).

    [0274] During the first ten postmenarcheal years following the establishment of regular ovulatory cycles (13-23 years of age) 5 to 6 million peristaltic contraction waves occur. This estimation is based on the observation that, in healthy women, about 2 contraction waves per minute occur during the early follicular phase of the cycle (Leyendecker et al. 1996).

    [0275] In addition, during this period of reproductive life at least 110 to 140 thousand neometral contractions occur (Leyendecker et al. 2015). This estimation is based on the observation that, during the menstrual period, these contractions occur with a frequency of about 24-36 contractions per hour for a duration of about 36 hours.

    [0276] These contractile activities of the non-pregnant uterus during and at the end of the menstrual cycle are dramatically increased in women that are suffering from endometriosis/adenomyosis. The increased peristaltic activity (hyperperistalsis) in women suffering from endometriosis could be demonstrated by hystero-salpingo-scintigraphy (HSSG) and video-sonography of uterine peristalsis (VSUP) (Kunz et al. 1996; Leyendecker et al. 1996). In women with endometriosis, the frequency of the peristaltic waves is doubled during the early, mid-follicular and mid-luteal phases of the cycle as compared to controls.

    [0277] Primary dysmenorrhea constitutes the clinical symptom of neometral hypercontractility. The intrauterine pressure in these women during menstruation might exceed the blood pressure in arterioles not only on the height of the contractions but also between the contractions (Leyendecker et al. 2015). Thus, the menstrual pain may be caused by both the power of the contractions and a concomitant contractions-induced ischemia.

    [0278] In this study the symptoms primary and secondary dysmenorrhea are defined and used in a temporal and not in a causal context.

    [0279] Accordingly, for the purpose of this study, primary dysmenorrhea is defined as menstrual pain that develops early in the period of reproductive life, shortly after menarche with the onset of regular ovulatory cycles.

    [0280] Accordingly, for the purpose of this study, secondary dysmenorrhea is defined as the menstrual pain that develops after a somewhat longer period of regular menstruations without pelvic pain.

    [0281] Intensity of Primary Dysmenorrhea

    [0282] There is circumstantial evidence that the auto-traumatization and the development of archimetrosis depends upon on strength and duration of the myometrial contractile activity. The prevalence of archimetrosis in 60-80% of premenopausal women (Emge, 1962) and the increasing prevalence of archimetrosis in symptom-free women attempting tubal sterilization with increasing time lapse after the last pregnancy support this view (Moen and Muus 1991; Muus 1991). It is further supported by the observation that the morphological destruction of the uterus due to adenomyosis was more pronounced in women with extreme primary dysmenorrhea than in women with less serious grades of dysmenorrhea (Leyendecker et al. 2015). This strength-duration characteristic allows the conclusion that the likelihood of developing archimetrosis at a young age increases with the severity of the uterine hypercontractility and, clinically and historically, with the severity of primary dysmenorrhea.

    [0283] It is, therefore, necessary to apply in this study a grading system of the intensity of primary dysmenorrhea when taking the history of the patient. Instead of using a pain score based on subjective sensation historical data that easily can be remembered, such as the use of analgesics, are preferred (Leyendecker et al. 2015):

    [0284] Mild Primary Dysmenorrhea:

    [0285] The menstrual pain could be tolerated without the use of analgesics.

    [0286] Moderate Primary Dysmenorrhea:

    [0287] To control menstrual pain analgesics were used more or less occasionally.

    [0288] Severe Primary Dysmenorrhea:

    [0289] The menstrual pain could only be tolerated each month by the use of analgesics

    [0290] Extreme Primary Dysmenorrhea:

    [0291] Absenteism from school and work during menstruation

    [0292] Change of Character of Dysmenorrhea (Quality and Intensity)

    [0293] During many years of the early reproductive period of life the character of pelvic menstrual pain may not change. Some women, however, report that, despite of continuing regular cycles, the menstrual pain decreased about two to four years after menarche. This might be due to the continuous loss of follicles and the continuing slight decrease in estradiol levels with increasing age. Also, during a phase of anovulatory cycles, the pain might be reduced or might have even disappeared.

    [0294] Alternatively, the pain might change in character in that it is more localized and may be also intensified. This could indicate that the disease is growing and spreading, in that larger adenomyoma and/or pelvic endometriosis is developing. In such circumstances the patient might be convinced that the genuine disease has begun with the onset of this particular pain and considers the menstrual pain and discomfort before as normal. This is probably the reason why secondary dysmenorrhea was regarded as the principal symptom of endometriosis

    [0295] This indicates that the menstrual history has to be taken with scrutiny. Special questions might help the patients to remember the history of their menstrual pain, such as, whether the use of oral contraceptives was started solely in order to obtain relief from pain or solely for, primarily for or together with attempting contraception.

    [0296] The prevalence of primary dysmenorrhea is about 50% (Burnett 2005). In a recent study of women affected by archimetrosis (uterine adenomyosis and/or peritoneal endometriosis) of 116 women 109 reported and 7 denied dysmenorrhea. Of the 109 women with dysmenorrhea 17 had secondary and 92 primary dysmenorrhea. With more than 70% the occasional and constant use of analgesics prevailed in women with primary dysmenorrhea. Conversely, such women are at increased risk to acquire uterine adenomyosis and peritoneal endometriosis (archimetrosis).

    [0297] Examination of the Menstrual Effluent in Women with and without Archimetrosis

    [0298] Tissue Culture:

    [0299] In a large review Philipp and Huber (1939) reported that in healthy women the tissue culture of menstrual debris was not possible while cyclic endometrium easily grew in culture. Commenting on Sampson theory (1927) that peritoneal endometriosis would result from retrograde menstruation they argued that the endometrial tissue, disseminated within the peritoneal cavity and growing on peritoneal surfaces must be derived from tissue of deaper layers of the endometrium shed during menstruation.

    [0300] Immunhistochemistry of the Menstrual Effluent:

    [0301] Histological examination of menstrual effluent showed cellular death of the endometrial fragments shed in women without endometriosis, while in women with endometriosis the shed tissue fragments showed the characteristics of vital cells. Moreover, immunohistochemistry of the menstrual effluent showed the expression of estradiol and progesterone receptors in women with endometriosis and not in women without the disease. Because estradiol and progesterone receptors are, at the end of the cycle and during the early menstrual cycle only expressed in the basal and not in the functional layer of the endometrium, it was concluded that in women with endometriosis fragments of basal endometrium are shed, which is not the case in disease free controls. Therefore, it was suggested that peritoneal endometriosis would result from the menstrual desquamation and transtubal dissemination of fragments of basal endometrium (Leyendecker et al. 2002).

    [0302] Molecular Biology of the Menstrual Effluent: Estradiol:

    [0303] In women with archimetrosis the levels of estradiol in menstrual blood are higher than in peripheral blood taken at the same time. In healthy control the respective estradiol levels do not differ from each other.

    [0304] TIAR:

    [0305] This is the acronym of Tissue Injury And Repair. It describes the capacity of mesenchymal tissue to express of enzymes that catalize the synthesis of estradiol from cholesterol. In various tissues tissue cultures and experiments with isolated stromal cells it had been demonstrated that this synthetic pathway and parts of it are stimulated by strain that may be mechanical (overstretching of cells, mechanical tissue injury) or inflammatory in character. This results, at the site of traumatization, in the local production of estradiol. Several investigations have shown that this cascade of synthesis of estradiol is also activated in endometriotic tissue and in the endometrium of affected women and not in controls.

    [0306] Circumstantial evidence indicates that, on the level of the non-pregnant uterus, this mechanical strain and traumatization result from the genuine mechanical functions of the uterus, such as the peristaltic activity of the archimyometrium for directed sperm transport and the menstrual neometral contractions for the externalization of menstrual debris.

    [0307] There is also clinical and experimental evidence for a strain-duration characteristics of these contractile activities to cause trauma because nearly all women develop, with time, uterine adenomyosis (and endometriosis) and women with hypercontractility, such as hyper- and dysperistalsis and increased neometral contractions as indicated by primary dysmenorrhea develop this disease (archimetrosis) early in their reproductive life.

    [0308] In 2009, for the first time, the theory was developed and published that the local production of estradiol within uterine tissue serves healing of the uterine wounds induced by auto-traumatization and also iatrogenic trauma (Leyendecker et al. 2009) and subsequently further elaborated (Leyendecker et al. 2015)

    [0309] Following the finding that estrogen-receptor positive endometrial tissue is detached during menstruation and found in the menstrual effluent of women with endometriosis, which is not the case in disease free women (Leyendecker et al. 2002), real time PCR of ER-alpha, ER-beta, PR and COX2 was performed in the menstrual effluent of women with endometriosis and controls. Particularly the concentration of ER-beta in the menstrual effluent of women with endometriosis was dramatically and significantly increased in comparison to controls. In this study, however, the PCR of the P450 arom was invalid because of the application of a wrong primer (Kissler et al. 2002; 2007). Nevertheless, available experimental data suggest that the P450arom may be also significantly increased in the menstrual effluent of women with adenomyosis/endometriosis because it catalizes, within the TIAR process the final step, the aromatization of testosterone to estradiol.

    [0310] CXCL12, CXCR4:

    [0311] In various tissues wound healing is attained by the attraction of mesenchymal stem cells (MSC) into the site of trauma. This is achieved by the dramatically increased expression of the chemokine CXCL12 by estradiol and mediated by the ER-beta. This results in the local proliferation of endometrial or archimetral stem cells (ESC or ASC), in stroma-epithelial transformation and in stromal metaplasia giving in turn rise to the formation of uterine adenomyoma. From these local sites of proliferation vascular dissemination, and most importanly, transtubal dissemination of vital endometrial cells (basal epithelium and stroma; eventually only ASC) may occur resulting in peripheral and peritoneal endometriosis, respectively.

    [0312] Archimetrosis Constitutes a Potential Sequel of Auto-Traumatisation Due to Myometrial Hypercontractility [0313] The presence or absence of a Mllerian tissue proliferative process on the level of the archimetra in women with the suspected diagnosis of archimetrosis (non-invasive diagnosis of archimetrosis). [0314] The presence or absence of a Mllerian tissue proliferative process in young women at high risk to develop archimetrosis because of uterine hypercontractility as indicated by primary dysmenorrhea (Screening in order to take adequate measures to prevent further proliferation and dissemination; eventually to preserve fertility). [0315] Test as a tool to obtain further insights into the dynamics of the early disease process such as the strength-duration characteristics (latency phase of onset of mechanical strain until the onset of proliferation and dissemination of basal endometrial tissue that is expressing CXCL17 and until the attraction MSC that express CXCR4). [0316] Test for the efficacy of treatment modalities to stop Mllerian tissue proliferation and dissemination

    Specificity of the Test

    [0317] The expression of the basal morphogentic complex (ER-Beta, CXCL12, CXCR4) is not organ and disease specific. The relative but nevertheless high specificity of the test results from the test to be performed in the menstrual effluent of a defined group of women in their early or middle reproductive period of life that display a characteristic symptomatology such as a history of primary dysmenorrhea, pelvic pain, unexplained infertility and eventually bleeding disorders (pre- and postmenstrual spotting).

    [0318] Adenocarcinoma of the endometrium constitutes a malign Mllerian proliferation. Abnormal uterine bleeding constitutes the characteristic symptom of this disease. However, the prevalence of this malign process is in the climacteric period of life.

    [0319] Expected Results of the Test

    [0320] Previous studies performed with the menstrual effluent using real-time PCR showed a significant increase of ER-eta expression in the menstrual effluent of women with endometriosis as compared to healthy controls. ER-eta is a constituent of what is defined as the basal morphogenetic complex constisting of ER-eta, CXCL 12 and CXCR4. This basal morphogenetic complex requires estradiol for stimulation which is provided, in a prakrine fashion, by the TIAR process that is induced by mechanical strain and enables the normal endometrial stromal cells to convert into cells that are capable to synthezise estradiol from cholesterol. Both ER-eta and the chemokine CXCL12 are expressed in the same tissue compartment of the endometrium, of which fragments are shed with the menstrual blood in women with endometriosis.

    [0321] In consequence, it can be expected that the MSCs expressing CXCL4 on their surface and that are, via the endometrial capillary system (terminal vessels), attracted by CXCL12 to this endometrial compartment are significantly increased in the menstrual effluent as well. The detection of increased levels of CXCL12 and CXCR4, therefore, is indicative of a wound healing process and, in a defined population of young women, indicative of the beginning or the presence of archimetrosis.

    [0322] Subjects and Methods

    [0323] Subjects: The tests will be performed in women (17 to 35 yrs of age) with and without archimetrosis (uterine adenomyosis and pelvic endometriosis). The presence or absence of archimetrosis has to be demonstrated by laparoscopy. and/or high resolution vaginal sonography.

    [0324] A careful menstrual history (menarche; regularity of cycles), history of pelvic pain (primary and secondary dysmenorrhea; dyspareunia; dysuria; dyschezia, first onset and aggravation of pelvic pain) and bleeding disorders has to be taken. The presence or absence of cyclic pelvic pain prior to menarche and peri-menstrual pain at distal (extragenital) parts of the body have to be documented.

    [0325] A careful gynecological examination has to be performed with special emphasis being laid upon finding special sites of pain, such as the sacro-uterine ligaments, the recto-vaginal septum, bowel and ovarian adhesions to the uterus.

    [0326] Exclusion Criteria:

    [0327] Previous pregnancy; previous intrauterine surgery (hysteroscopy; curettage); irregular cycles; anovulatory cycles; hormonal therapy such as oral contraception, if not terminated 6 month ago; use of intrauterine device; use of COX2 inhibitors during the test phase; fibroids of the uterus.

    [0328] High Resolution Transvaginal Sonography of the Uterus (TVS):

    [0329] All relevant sonographic data of the uterus have to be documented (size; position; anterior, posterior and fundal walls, junctional zone myometrium (halo; archimyometrium). The presence or absence of signs of uterine adenomyosis has to be documented. TVS is performed during the mid-luteal phase of the cycle (day 20-24 of the cycle) prior to sample collection in order to demonstrate a luteal phase appearance of the endometrium.

    [0330] Sample Collection:

    [0331] Venous blood is drawn in the mid-luteal phase for measurement of serum progesterone levels in order to document a normal luteal phase.

    [0332] Menstrual blood is collected on the morning after onset of menstruation (Leyendecker et al. 2002). This could be the 1.sup.st or 2.sup.nd day of menstruation. During the previous night, just a sanitary pad is used.

    [0333] Processing of the Menstrual Blood Specimen:

    [0334] The menstrual blood sample is centrifuged (600g for 5 minutes) and the supernatant is decanted. RNAlater RNA Stabilization Reagent (Quiagen, Order No. 76104) is added to the pellet. RNA stays stable for 7 days at room temperature (15-25 C.).

    [0335] On the day of sample collection or one day later the specimen is transferred to the Institut fr experimentelle Chirurgie der Universitt des Saarlandes, Homburg/Saar, Germany for cryopreservation and for the later implementation of the RT-PCR.

    TABLE-US-00006 Primersequences(5to3): GAPDHS: (SEQIDNO18) TGGTATCGTGGAAGGACTCATGAC GAPDHAS: (SEQIDNO19) TTGTAGACGGCAGGTCAGGT ERbetaS: (SEQIDNO20) GCTTTGTGGAGCTCAGCCTG ERbetaAS: (SEQIDNO21) ACCCAGTGAAGGAGCTGATG CXCL12/SDF1alphaS: (SEQIDNO22) CGTGTCACCTGTGCTTCG CXCL12/SDF1alphaAS: (SEQIDNO23) CAGCTCTATCGACTGCCCTC CXCR4S: (SEQIDNO24) CCAGTAGCCACCGCATCT CXCR4AS: (SEQIDNO25) ATAGTCCCCTGAGCCCATTT p450AromataseS: (SEQIDNO26) GACTCTAAATTGCCCCCTCTG p450AromataseAS: (SEQIDNO27) GTGCCCTCATAATTCCACAC

    REFERENCES

    [0336] Abramovicz J. S., Archer D. F. (1990) Uterine endometrial peristalsisa transvaginal ultrasound study. Fertil Steril 54:451-454 [0337] Absenger Y, Hess-Stumpp H, Kreft B, Kratzschmar J, Haendler B, Schutze N, Regidor P A, Winterhager E (2004) Cyr61, a deregulated gene in endometriosis. Mol Hum Reprod. 10, 399-407 [0338] Adamson G D and Pasta D J (1994) Surgical treatment of endometriosis-associated infertility: analysis compared with survival analysis. Am J Obstet Gynecol 171, 1488-1505 [0339] Aghajanova L, Hamilton A, Kwintkiewicz J, Vo K C, Giudice L C. (2009) Steroidogenic enzyme and key decidualization marker dysregulation in endometrial stromal cells from women with versus without endometriosis. Biol Reprod Jan; 80 (1):105-14. Epub 2008 Sep. 24. [0340] Alabiso et al, Endometriosis Treatment Italian Club. (2015) Adenomyosis: What the Patient Needs. J Minim Invasive Gynecol. 2016 May-June; 23 (4):476-88. doi: 10.1016/j.jmig . . . 12.017. Epub 2016 Jan. 6 [0341] American Fertility Society (1985) Revised American Fertility Society classification of endometriosis. Fertil Steril 43, 351-352 [0342] Anaf V1, Simon P, El Nakadi I, Fayt I, Simonart T, Buxant F, Noel J C. (2002) Hyperalgesia, nerve infiltration and nerve growth factor expression in deep adenomyotic nodules, peritoneal and ovarian endometriosis. Hum Reprod 17(7):1895-900. [0343] Attar E, Tokunaga H, Imir G, Yilmaz M B, Redwine D, Putman M, Gurates B, Attar R, Yaegashi N, Hales D B, Bulun S E. (2009) Prostaglandin E2 via steroidogenic factor-1 coordinately regulates transcription of steroidogenic genes necessary for estrogen synthesis in endometriosis. J Clin Endocrinol Metab 94: 623-631 [0344] Barcena de Arellano M L, Gericke J, Reichelt U, Ebert A D, Chiantera V, Schneider A, Mechsner S (2011) Immunohistochemical characterization of endometriosis-associated smooth muscle cells in human peritoneal endometriotic lesions. [0345] Hum Reprod 26:2721-2730 [0346] Barrier B F1, Malinowski M J, Dick E J Jr, Hubbard G B, Bates G W. (2004) Adenomyosis in the baboon is associated with primary infertility. Fertil Steril. October; 82 Suppl 3: 1091-1094 [0347] Bartelmez G W (1957) The form and the functions of the uterine blood vessels in the rhesus monkey. Carnegie Contrib Embryol 36: 153-182 [0348] Bartosik, D, Viscarello R R, Damjanov 1 (1984) Endometriosis as an autoimmune disease. Fertil Steril 41/2:21S [0349] Batt R E (2011) A history of endometriosis, Springer New York [0350] 24. Benagiano G, Brosens I. (2006) History of adenomyosis. Best Pract Res Clin Obstet Gynaecol. 20:449-463 [0351] Birnholz J. (1984) Ultrasonic visualization of endometrial movements. Fertil Steril 41:157-158 [0352] Blumenkrantz, M. J., Gallagher, N., Bashore, R. A., Tenckhoh, H. (1981) Retrograde menstruation in women undergoing chronic peritoneal dialysis. Obstet. Gynecol. 57: 667-672 [0353] Bombail V1, MacPherson S, Critchley H O, Saunders P T. (2008) [0354] Estrogen receptor related beta is expressed in human endometrium throughout the normal menstrual cycle. Hum Reprod. December; 23 (12):2782-90. Doi: 10.1093/humrep/den298. Epub 2008 Sep. 4 [0355] Boudot A1, Kerdivel G, Habauzit D, Eeckhoute J, Le Dily F, Flouriot G, Samson M, Pakdel F. (2011) Differential estrogen-regulation of CXCL12 chemokine receptors, CXCR4 and CXCR7, contributes to the growth effect of estrogens in breast cancer cells. PLoS One.; 6 (6):e20898. doi: 10.1371/journal.pone.0020898. Epub 2011 Jun. 10. [0356] Bouzaffour M, Dufoursq P, Lecaudey V, Haas P, Vriz, S (2009) Fgf and Sdf-1 pathways interact during zebrafish fin regeneration Plos One 4: e5824 [0357] Brenner R M Slayden O D (1994) Cyclic changes in the primate oviduct and endometrium. In: E. Knobil, J. D. Neill (eds) The Physiology of Reproduction. Raven Press New York. P. 541-549 [0358] Brosens I A, Brosens J J. (2000) Redefining endometriosis: is deep endometriosis a progressive disease? Hum Reprod. January; 15(1):1-3. Review. [0359] Bulletti C, De Ziegler D, Polli V, Del Ferro E, Palini S and Flamigni C. (2002) Characteristics of uterine contractility during menses in women with mild to moderate endometriosis. Fertil Steril 77: 156-1161. [0360] Bulun S E. Endometriosis. (2009) N Engl J Med. January 15; 360 (3):268-79. [0361] Burnett M A1, Antao V, Black A, Feldman K, Grenville A, Lea R, Lefebvre G, Pinsonneault O, Robert M. (2005) Prevalence of primary dysmenorrhea in Canada. J Obstet Gynaecol Can. August; 27 (8):765-70 [0362] Cahil D. J., Wardle P. G., Maile, L. A., Harlow, C. R., Hull, M. G. R. (1995) Pituitary ovarian dysfunction as a cause for endometriosis-associated and unexplained infertility. Hum Reprod 10: 3142-3146 [0363] Ceradini D J1, Kulkarni A R, Callaghan M J, Tepper O M, Bastidas N, Kleinman M E, Capla J M, Galiano R D, Levine J P, Gurtner G C. (2004) Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1. Nat Med. August; 10 (8):858-64. Epub 2004 Jul. 4 [0364] Chapron C, Souza C, Borghese B, Lafay-Pillet M C, Santulli P, Bijaoui G, Goffinet F, de Ziegler, D (2011) Oral contraceptives and endometriosis: the past use of oral contraceptives for treating severe primary dysmenorrhea is associated with endometriosis, especially deep infiltrating endometriosis. Hum Reprod 26:2028-2035 [0365] Counseller V S (1938) Endometriosis. A clinical and surgical review. Am J Obstet Gynecol 36:877-886 [0366] Cullen T S (1896) Adenomyoma uteri diffusum benignum. Johns Hopkins Hosp. Rep 6:133-157 [0367] Cullen T S (1903) Adeno-Myome des Uterus. (Festschrift Johannes Orth) Verlag von August Hirschwald, Berlin [0368] Cullen T S (1908) Adenomyoma of the uterus. W.B. Saunders Company. Philadelphia and London Cullen T S (1920) The distribution of adenomyoma containing uterine mucosa. Arch Surgery 1:215-283 [0369] Dawood M Y (2006) Primary dysmenorrhea. Advances in pathogenesis and management. Obstet. Gynecol 108: 428-440, [0370] DeVries K, Lyons E A, Ballard G, Levi C S, Lindsay D (1990) Contractions of the inner third of the myometrium. Am J Obstet Gynecol 162:679-682. [0371] Dotan I, Werner L, Vigodman S, Weiss S, Brazowski E, Maharshak N, Chen O, Tulchinsky H, Halpem Z, Guzner-Gur H (2010) CXCL12 is a constitutive and inflammatory chemokine in the intestinal immune system. Inflamm Bowel Dis 16: 583-592 [0372] Du H1, Taylor H S. (2007) Contribution of bone marrow-derived stem cells to endometrium and endometriosis. Stem Cells August; 25(8):2082-6. Epub 2007 Apr. 26 [0373] Ebert A D, Fuhr N, David M, Schneppel L, Papadopoulos T. (2009) Histological confirmation of endometriosis in a 9-year-old girl suffering from unexplained cyclic pelvic pain since her eighth year of life. Gynecol Obstet Invest 67:158-161 [0374] Einer-Jensen N (1988) Countercurrent transfer in the ovarian pedicle and its physiological implications. Oxford Rev Reprod Biol 10, 348-381 [0375] 20. Emge L A (1962) The elusive adenomyosis of the uterus. It's historical past and it's present state of recognition. Am J Obstet Gynecol 83:1541-1563 [0376] ESHRE Capri Workshop Group (2008). Genetic aspects of female reproduction Hum Reprod Update. July-August; 14(4):293-307. [0377] Fazleabas A T, Brudney A, Chai D, Langoi D, Bulun S E (2003). Steroid receptor and aromatase expression in baboon endometriotic lesions. Fertil Steril. September; 80 Suppl 2:820-7. [0378] Franceschini I1, Lomet D, Cateau M, Delsol G, Tillet Y, Caraty A. (2006) [0379] Kisspeptin immunoreactive cells of the ovine preoptic area and arcuate nucleus co-express estrogen receptor alpha. Neurosci Lett. July 3; 401(3):225-230. Epub 2006 Apr. 18. [0380] Freund W A (1896) Klinische Notizen zu den voluminsen Adenomyomen des Uterus. In: Recklinghausen von, F. Die Adenomyomata und Cystadenomyomata des Uterus und der Tubenwandung: ihre Abkunft von Resten des Wolff'schen Krpers. [0381] August Hirschwald Verlag, Berlin [0382] Fuchs A R, Behrens O, Maschek H, Kupsch E, Einspanier A (1998) Oxytocin and vasopressin receptors in human nonpregnant endometrium, myometrium and uterine myomas during menstrual cycle and early pregnancy: characterisation, cellular localisation and comparison with rhesus monkey. Hum. Reprod. Update 4:594-604, [0383] Fujii S, Konishi, I, Mori T (1989) Smooth muscle differentiation at endometrio-myometrial junction. An ultrastructural study. Virch Archiv A Pathal. Anat. 414: 105-112 [0384] Garcia-Segura L M, Wozniak A, Azcoitia I, Rodriguez J R, Hutchison R E, Hutchison A B (1999) Aromatase expression by astrocytes after brain injury: Implications for local estrogen formation in brain repair. Neuroscience 89: 567-578 [0385] Garcia-Segura L M (2008) Aromatase in the brain: not just for reproduction anymore. J Neuroendocrinol. June; 20(6):705-12. Links [0386] Gargett C E, Schwab K E, Deane J A (2016) Endometrial stem/progenitor cells: the first 10 years. Hum Reprod Update March-April; 22(2):137-63. doi: 10.1093/humupd/dmv051. Epub 2015 November 9. [0387] Garbern J C1, Mummery C L, Lee R T. (2013) Model systems for cardiovascular regenerative biology. Cold Spring Harb Perspect Med. April 1; 3(4):a014019. [0388] Gashaw I, Hastings J M, Jackson K S, Winterhager E, Fazleabas A T. (2006) Induced endometriosis in the baboon (Papio anubis) increases the expression of the proangiogenic factor CYR61 (CCN1) in eutopic and ectopic endometria. [0389] Biol Reprod. June; 74(6):1060-6. Epub 2006 February 15. [0390] Gilliver S C, Ashworth J J, Ashcroft G S. (2007) The hormonal regulation of cutaneous wound healing. Clin Dermatol. January-February; 25(1):56-62. Review. [0391] Godwin J W, Pinto A R, Rosenthal N A (2013) Macrophages are required for adult salamander limb regeneration, PNAS 110: 9415-9420 [0392] Goodall J. R (1944) A study of endometriosis, endosalpingiosis, endocervicosis and peritoneo-ovarian sclerosis. A clinical and pathologic study (2.sup.nd edition). JB Lippincott Company, Philadelphia, [0393] Gui Y, Zhang J, Yuan L, Lessey B A. (1999) Regulation of HOXA-10 and its expression in normal and abnormal Endometrium Mol Hum Reprod 5:866-873 [0394] Guo C, Zhu H, Huang W, Li S, Qu W, Liu Y, Tan A. (2010) Side population cells in the human decidua of early pregnancy exhibit stem/progenitor cell-like characteristics. Reprod Biomed Online. December; 21(6):783-93. doi: 10.1016/j.rbmo.2010.07.010. Epub 2010 Aug. 1. [0395] Guo S.-W, Mao X, Ma Q, Liu X. (2013). Dysmenorrhea and its severity are associated with increased contractility and over-expression of oxytocin receptor (OTR) in women with symptomatic adenomyosis. Fertil Steril 99:231-240 [0396] Gurates B, Bulun S E. (2003) Endometriosis: the ultimate hormonal disease. [0397] Semin Reprod Med. May; 21(2):125-34. Review. [0398] Hadfield R M, Yudkin P L, Coe C L, Scheffler, J., Uno, H., Barlow, D. H., Kemnitz, J. W. Kennedy S H (1997). Risk factors for endometriosis in the rhesus monkey (Macaca mulatta): a case-control study. Hum Reprod Update 3:109-15. [0399] Hadjiargyrou M, Ahrens W, Rubin C T. Temporal expression of the chondrogenic and angiogenic growth factor CYR61 during fracture repair (2000). [0400] J Bone Miner Res. Jun; 15(6):1014-23. [0401] Halme J, Hammond M G, Hulka J F, Raj S G, Talbert L M. (1984) Retrograde menstruation in healthy women and in patients with endometriosis. Obstet Gynecol. August; 64(2):151-4. [0402] Halme J, Becker S, Wing R. Accentuated cyclic activation of peritoneal macrophages in patients with endometriosis (1984). Am J Obstet Gynecol. January 1; 148(1):85-90 [0403] Han S J, Jung S Y, Wu S-P, Hawkins S M, Park M J, K Y O S, Qin J, Lydon J P, Tsai S Y, Tsai M-J, DeMayop F J, O'Malley B W (2015) Estrogen receptor modulates apoptosis complexes and the inflammasome to drive pathogenesis of endometriosis Cell 163: 960-974 [0404] Hansen T, Vulgaris S, Siggelkow W, Kirkpatrick C J (2006) Massive adenomyosis in a patient with uterus septus completus. Zentralbl Gynkol 128:153-156 [0405] Hapangama D K, Kamal A M, Bulmer J N (2015) Estrogen receptor : the guardian of the endometrium Hum Reprod. Update 21: 174-193 [0406] Hauksson A, Akerlund M, Melin P (1988) Uterine blood flow and myometrial activity at menstruation, and the action of vasopressin and a synthetic antagonist. [0407] Br. J. Obstet. Gynaecol. 95:898-904 [0408] Hocking A M (2015) The role od chemokines in mesenchymal stem cell homing to wounds. Adv Wound Care (New Rochelle). 4:623-630. Review. [0409] Hricak H, Alpers C, Crooks L E and Sheldon P E (1983) Magnetic resonance imaging of the female pelvis: Initial experience. Am J Rad 141, 119-1128 [0410] Huang C C1, Orvis G D, Wang Y, Behringer R R. (2012) Stromal-to-epithelial transition during postpartum endometrial regeneration. PLoS One; 7(8):e44285. doi: 10.1371/journal.pone.0044285. Epub 2012 Aug. 27. [0411] Hudelist G, Czerwenka K, Keckstein J, Haas C, Fink-Retter A, Gschwantler-Kaulich D, Kubista E, Singer C F. (2007) Expression of Aromatase and Estrogen Sulfotransferase in Eutopic and Ectopic Endometrium: Evidence for Unbalanced Estradiol Production in Endometriosis. Reproductive Sc, Vol. 14, No. 8, 798-805 [0412] Hufnagel D, Li F, Cosar E, Krikun G, Taylor H S. (2015) The Role of Stem Cells in the Etiology and Pathophysiology of Endometriosis. Semin Reprod Med. 33:333-340. [0413] Hull M E, Moghissi K S, Magyar D F, Hayes M F (1986) Comparison of different treatment modalities of endometriosis in infertile women. Fertil. Steril. 47:40 [0414] Ibrahim M G, Chiantera V, Frangini S, Younes S, Khler C, Taube E T, Plendl J, Mechsner S (2015) Ultramicro-trauma in the endometrial-myometrial junctional zone and pale cell migration in adenomyosis Fertil Steril 104: 1475-1483 [0415] Janssen E B1, Rijkers A C, Hoppenbrouwers K, Meuleman C, D'Hooghe T M. (2013) Prevalence of endometriosis diagnosed by laparoscopy in adolescents with dysmenorrhea or chronic pelvic pain: a systematic review. Hum Reprod Update. 19(5):570-82. doi: 10.1093/humupd/dmt016. Epub 2013 May 31 [0416] Jeffrey J E, Aspden R M (2007). Cyclooxygenase inhibition lowers prostaglandin E2 release from articular cartilage and reduces apoptosis but not proteoglycan degradation following an impact load in vitro. [0417] Arthritis Res Ther.(6):R129. [0418] Kaiserman-Abramof, I. R. and Padykula, H. A. (1989) Ultrastructural epithelial zonation of the primate endometrium (rhesus monkey). Am. J. Anat., 184, 13-30. [0419] Kennedy S, Bergqvist A, Chapron C, D'Hooghe T, Dunselman G, Greb R, Hummelshoj L, Prentice A, Saridogan E. ESHRE Special Interest Group for Endometriosis and Endometrium Guideline Development Group (2005) ESHRE guideline for the diagnosis and treatment of endometriosis Hum Reprod 20:2698-704 [0420] Kindermann G (1988) Endometriose: Wesen ubd Entstehung. In: Kser O, Friedber V, Ober K G, Thomsen K, Zander J (Hsg.) Gynkologie und Geburtshilfe Band III. Teil 2 13.1-13.27 Thieme, Stuttgart [0421] Kissler S, Schmidt M, Keller N, Wiegratz T, Tonn, T, Roth K W, Seifried E, Baumann R, Siebzehnruebl E, Leyendecker G, Kaufmann M. (2005) Real-time PCR analysis for estrogen receptor beta and progesterone receptor in menstrual blood samplesa new approach to a non-invasive diagnosis for endometriosis. Hum Reprod. 20 (suppl.): i179 (P-496) [0422] Kissler S, Schmidt M, Keller N, Wiegratz I, Kohl J, Baumann R, Kunz G, Kaufmann M, Leyendecker G (2007) Real-Time PCR-Analyse fr strogen-Rezeptor beta, Progesteronrezeptor und P-450-Aromatase im Menstrualbluteine Pilotstudie ber die Bedeutung des basalen Endometriums in der Pathogenese der Endometriose [0423] Geburtshilfe Frauenheilkd 67A24 DOI: 10.1055/s-2007-989163 [0424] Kitawaki J, Noguchi T, Amatsu T, Maeda K, Tsukamoto K, Yamamoto T, Fushiki S, Osawa Y, Honjo H (1997) Expression of aromatase cytochrome P450 protein and messenger ribonucleic acid in human endometriotic and adenomyotic tissues but not in normal endometrium. Biol. Reprod. 57: 514-519 [0425] Konstantzinopoulos P A, Kominea A, Vandoros G, Sykiotis G P, Andricopoulos P, Varakis I, Sotiropoulos-Bonikou G, Papavassiliou A G (2003) Oestrogen receptor beta (ERbeta) is abundantly expressed in normal colonic mucosa, but declines in colon adenocarcinoma pralleling the tumour's differentiation. Eur J Cancer 39: 1251-1258 [0426] Kossmann, R. (1897) Die Abstammung der Drsenschlauche in dem Uterus und in den Tuben. Arch Gynk 54:359-381 [0427] Kunz G, Beil D, Deininger H, Wildt L, Leyendecker G (1996) The dynamics of rapid sperm transport through the female genital tract. Evidence from vaginal sonography of uterine peristalsis (VSUP) and hysterosalpingoscintigraphy (HSSG). Hum. Reprod. 11:627-632 [0428] Kunz G, Noe M, Herbertz M and Leyendecker G. (1998a) Uterine peristalsis during the follicular phase of the menstrual cycle. Effects of oestrogen, antioestrogen and oxytocin. Hum Reprod. Update 4: 647-654 [0429] Kunz G, Herbertz M, Noe M and Leyendecker G. (1998b) Sonographic evidence of a direct impact of the ovarian dominant structure on uterine function during the menstrual cycle. Hum Reprod. Update 4: 667-672 [0430] Kunz G, Beil D, Huppert P and Leyendecker G. (2000) Structural abnormalities of the uterine wall in women with endometriosis and infertility visualized by vaginal sonography and magnetic resonance imaging. Hum Reprod 15: 76-82 [0431] Kunz G, Beil D, Huppert P, Noe M, Kissler S, & Leyendecker G. (2005) Adenomyosis in endometriosisprevalence and impact on fertility. Evidence from magnetic resonance imaging. Hum Reprod 20: 2309-2316 [0432] Kunz G, Herbertz M, Beil D, Huppert P, Leyendecker G. (2007) Adenomyosis as a disorder of the early and late human reproductive period. Reprod Biomed. Online [0433] December; 15: 681-685 [0434] Laird S M, Widowson R, E I-Sheilkhi M, Hall A J, Li T C (2011) Expression of CXCL12 and CXCR4 in human endometrium; effects of CXCL12 on MMP production by human endometrial cells. Hum Reprod 26: 1144-1152 [0435] Lander A D, Kimble J, Clevers H, Fuchs E, Montarras D, Buckingham M, Calof A L, Trumpp A, Oskarsson T (2012). What does the concept of the stem cell niche really mean today? BMC Biol. March 9; 10:19. doi: 10.1186/1741-7007-10-19 [0436] Larsen S B, Lundorf E, Forman A, Dueholm M. (2011) Adenomyosis and junctional zone changes in patients with endometriosis. Eur J Obstet Gynecol Reprod Biol.157:206-11 [0437] Lavaque E, Sierra A, Azcoitia I, Garcia-Segura L M (2006). Steroidogenic acute regulatory protein in the brain. Neuroscience. 138(3):741-7. [0438] Leiva M C, Hasty L A and Lyttle C R (1994) Inflammatory changes of the endometrium in patients with minimal-to-moderate endometriosis. Fertil. Steril. 62:967-972 [0439] Leyendecker G, Wildt L. (1983) Induction of ovulation with chronic intermittent (pulsatile) administration of Gn-R H in women with hypothalamic amenorrhoea. J Reprod Fertil. September; 69(1):397-409. [0440] Leyendecker, G. Kunz G, Wildt, L, Beil D, Deininger H (1996) Uterine hyperperistalsis and dysperistalsis as dysfunctions of the mechanism of rapid sperm transport in patients with endometriosis and infertility. Hum. Reprod. 11:1542-1551. [0441] Leyendecker G, Kunz G, Noe M, Herbertz M and Mall G. (1998) Endometriosis: A dysfunction and disease of the archimetra. Hum Reprod Update 4: 752-762 [0442] Leyendecker G, Kunz G, Noe M, Herbertz M, Beil, D, Huppert P, Mall G. (1999) [0443] Die Archimetra als neues morphologisch-funktionelles Konzept des Uterus sowie als Ort der Primrerkrankung bei Endometriose Reproduktionsmedizin 15: 356-371 [0444] Leyendecker G. Endometriosis is an entity with extreme pleiomorphism. (2000) Hum Reprod 15: 4-7 [0445] Leyendecker G, Herbertz M, Kunz G and Mall G (2002) Endometriosis results from the dislocation of basal endometrium. Hum Reprod 17:2725-2736 [0446] Leyendecker G, Kunz G, Kissler S, Wildt L. (2006) Adenomyosis and reproduction. Best Pract Res Clin Obstet Gynaecol. 20:523-46. [0447] Leyendecker G, Wildt L, Mall G. (2009) The pathophysiology of endometriosis and adenomyosis: tissue injury and repair Arch Gynecol Obstet 280:529-538 [0448] Leyendecker G, Wildt L (2011) A new concept of endometriosis and adenomyosis: Tissue injury and repair (TIAR). Hum Mol Biol Clin Invest 5:125-142 [0449] Leyendecker G, Wildt L. (2012) Neue Erkenntnisse zur Pathophysiologie von Endometriose and Adenomyose: Tissue Injury and Repair (TIAR). Fortschritte in der Endometrioseforschung. forMed. Exzellenzforschung in der Medizin. 3:12-23. ISSN 2191-9003. [0450] Leyendecker G1, Bilgicyildirim A, Inacker M, Stalf T, Huppert P, Mall G, Bttcher B, Wildt L. (2015) Adenomyosis and endometriosis. Re-visiting their association and further insights into the mechanisms of auto-traumatisation. An MRI study. Arch Gynecol Obstet. April; 291(4):917-32. doi: 10.1007/s00404-014-3437-8. Epub 2014 Sep. 21 [0451] Li X, Guo S W (2014) Clinical profiles of 710 premenopausal women with adenomyosis who underwent hysterectomy. J. Ocstet Gynaecol Res:40:485-494 [0452] Liu Y, Tal R, Pluchino N, Mamillapalli R, Taylor H S (2017) Systemic administration of bone marrow-derived cells leads to better uterine engraftment than use of uterine-derived cells or local injection. J Cell Mol Med. August 7. doi: 10.1111/jcmm.13294. [Epub ahead of print] [0453] Lyons E A, Taylor P J, Zheng, X H, Ballard G, Levi C S, Kredentser J V (1991) Characterization of subendometrial myometrial contractions throughout the menstrual cycle in normal fertile women. Fertil Steril 55:771-775 [0454] Mkrinen L, (1988) Uterine contractions in endometriosis: effects of operative and danazol treatment. J. Obstet Gynecol 9, 134-138 [0455] Maggi M, Magini A, Fiscella A, Giannini S, Fantoni G, Toffoletti F, Massi G, Serio M (1992) Sexsteroid modulation of neurohypophysial hormone receptors in human nonpregnant myometrium. J clin Endocrinol Metab 74: 385-392 [0456] Mahmood T A, Templeton A. (1990) Pathophysiology of mild endometriosis: review of literature. Hum Reprod. October; 5(7):765-84. Review. [0457] Malinak L R, Buttram V C, Elias S, Simpson J L (1980) Heritable aspects of endometriosis I I. Clinical characteristics of familial endometriosis. Am J Obstet Gynecol 127:332 Marsh E E & Laufer M R (2005). Endometriosis in premenarcheal girls who do not have an obstructive anomaly. Fertil Steril 83: 758-760 [0458] Marcoux S, Maheux R and Berube S (1997) Laparoscopic surgery in infertile women with minimal or mild endometriosis. Canadian Collaborative Group on Endometriosis. N Engl J Med 337, 217-22. [0459] Martinez-Conjero J A, Morgan M, Montesinos M, Fortuno S, Meseguer M, Simon C, Horcajados J A, Pellicer A (2011) Adenomyosis does not affect implantation, but is associated with miscarriage in patients undergoing oocyte donation Fertil Steril 96: 943-950 [0460] Matsuzaki S, Murakami t, Uehara S, Canis M, Sasano H, (2001) Expression of estrogen receptor alpha and beta in peritoneal and ovarian endometriosis. Fertil Steril. June; 75(6):1198-205. [0461] Mechsner S1, Weichbrodt M, Riedlinger W F, Bartley J, Kaufmann A M, Schneider A, Khler (2008) Estrogen and progestogen receptor positive endometriotic lesions and disseminated cells in pelvic sentinel lymph nodes of patients with deep infiltrating rectovaginal endometriosis: a pilot study. Hum Reprod. October; 23(10):2202-9. doi: 10.1093/humrep/den259. Epub 2008 Jul. 16 [0462] Meyer R (1919) ber den Stand der Frage der Adenomyositis und Adenome im allgemeinen und insbesondere ber Adenomyositis seroepithelialis und Adenomyometritis sarcomatosa. Zbl Gynkol 43, 745-750 [0463] Meyer, R, (1930) Adenomyosis, Adenofibrosis und Adenomyom. In: W. Stoeckel (ed) Handbuch der Gynkologie. Sechster Band/Erste Hlfte; p 356-669, J. F. Bergmann, Mnchen [0464] Moen M H, Muus K M (1991) Endometriosis in pregnant and non-pregnant women at tubal sterilisation. Hum. Reprod. 6:699 [0465] Moen M H. (1991) Is a long period without childbirth a risk factor for developing endometriosis? Hum Reprod. 6:1404-1407 [0466] Montgomery G W, Nyholt D R, Zhao Z Z, Treloar S A, Painter J N, Missmer S A, Kennedy S H, Zondervan K T (2008). The search for genes contributing to endometriosis risk. [0467] Hum Reprod Update. September-October; 14(5):447-57. Epub 2008 Jun. 5. Review. [0468] Moridi I, Mamillapalli R, Cosar E, Ersoy G S, Taylor H S (2017) Bone marrow stem cell chemotactic activity is induce by elevated CXCL12 in endometriosis. Reprod Sc 24:526-533 [0469] Mowa C N, Hoch R, Montavon C L, Jesmin S, Hindman G, Hou G (2008). Estrogen enhances wound healing in the penis of rats. Biomed Res. October; 29(5):267-70. [0470] Nisolle M, Donnez J. (1997) Peritoneal endometriosis, ovarian endometriosis, and adenomyotic nodules of the rectovaginal septum are three different entities. Fertil Steril. October; 68(4):585-96 [0471] Noe M, Kunz G, Herbertz M, Mall G and Leyendecker G (1999). The cyclic pattern of the immunocytochemical expression of oestrogen and progesterone receptors in human myometrial and endometrial layers: Characterisation of the endometrial-subendometrial unit. Hum Reprod 14: 101-110 [0472] Oike K., Obata S., Tagaki K., Matsuo K., Ishihara K., and Kikuchi S. (1988) Observation of endometrial movement with transvaginal sonography. J Ultrasound Med. 7: 99 [0473] Okkels H, Engle E T (1938) Studies on the finer structure of the uterine blood vessels of the macacus monkey. Acta Patho Microbiol Scand 15: 150-168 [0474] Osteen K G, Rogers W H, Gaire M, Hargrove J T, Gorstein F, Matrisian L M (1994) Stromal epithelial interaction mediates steroidal regulation of metalloproteinase expression in human endometrium. Proc Natl Accd Sci USA 91, 10129-10133 [0475] Otto K (1957) ber Vorkommen und tiologie der Adenomyosis uteri mit Berichten ber zwei atypische Flle. Zentralbl Gynk 79, 471-480 [0476] Padykula, H. A., Coles, L. G., Okulicz, W. C., Rapaport, S. I., Mc Cracken, J. A., King, N. W. jr, Longcope, C. and Kaiserman-Abramof, I. R. (1989) The basalis of the primate endometrium: a bifunctional germinal compartment. Biol. Reprod., 40, 681-690. [0477] Parazzini F, Vercellini P, Panazza S, Chatenoud L, Oldani S, Crosignani P G (1997) Risk factors for adenomyosis. Hum Reprod 12, 1275-1279 [0478] Peters H. (1977) The human ovary in childhood and early maturity. Eur J Obstet Gynec Reprod Biol 9:137-144 [0479] Philipp E, Huber H. (1939) Die Entstehung der Endometriose, gleichzeitig ein Beitrag zur Pathologie des interstitiellen Tuben Abschnittes Zbl Gyn 63: 7-40 [0480] Ramsey E M (1989) Vascular anatomy In: Wynn R M and Jollie W P. Biology of the Uterus (second edition) Plenum Medical Book Company, New York [0481] Recklinghausen von F. (1896) Die Adenomyomata und Cystadenomyomata des Uterus und der Tubenwandung: ihre Abkunft von Resten des Wolff'schen Krpers. [0482] August Hirschwald Verlag, Berlin [0483] Reinhold C, Tafazoli F and Wang L (1998) Imaging features of adenomyosis. Hum Reprod Update 4, 337-349 [0484] Ridley J H (1968) The histogenesis of endometriosis. Obstet Gynec Surv 23, 1-35 [0485] Revised American Fertility Society classification of endometriosis. (1985) Fertil Steril 43:351-352 [0486] Rokitansky von K (1960) ber Uterusdrsen-Neubildung. Z. Gesellschaft rzte 16:577-581 [0487] Rogers P A W (1996) Structure and function od endometrial blood vessels Hum Reprod Update 2: 57-62 [0488] Rudolph-Owen L A, Slayden O V D, Matrisian L M, Brenner R M (1998) Matrix metalloproteinase expression in macaca mulatta endometrium: Evidence for zone-specific regulatory tissue gradients. Biol Reprod 59, 1349-1368 [0489] Ruiz Al, Salvo V A, Ruiz L A, Bez P, Garca M, Flores I. (2010) [0490] Basal and steroid hormone-regulated expression of CXCR4 in human endometrium and endometriosis. Reprod Sci. October; 17(10):894-903. doi: 10.1177/1933719110379920. Epub 2010 Aug. 18 [0491] Sakr S, Naqvi H, Komm B, Taylor H S (2014) Endometriosis impairs bone marrow-derived stem cell recruitment to the uterus Whereas Bazedoxifene treatment leads to endometriosis regression and improved stem cell engraftment Endocrinology 155: 1489-1497 [0492] Salamanca A, Beltran E (1995). Subendometrial contractility in menstrual phase visualised by transvaginal sonography in patients with endometriosis. Fertl. Steril. 64: 193-195 [0493] Sampson, J. A. (1922) The life history of ovarian hematomas (hemorrhagic cysts) of endometrial (Mllerian) type. Am J Obstet Gynecol 4: 451-512 [0494] Sampson, J. A., (1927) Peritoneal endometriosis due to the menstrual dissemination of endometrial tissue into the peritoneal cavity. Am. J. Obstet. Gynecol. 14: 422-429 [0495] Schwalm H, Dubrauszky V (1966) The structure of the musculature of the human uterusmuscles and connective tissue. Am. J. Obstet. Gynecol. 94:391-404 [0496] Shioyama R, Aoki Y, Ito H, Matsuta Y, Nagase K, Oyama N, Miwa Y, Akino H, Imamura Y, Yokoyama O (2008). Long-lasting breaches in the bladder epithelium lead to storage dysfunction with increase in bladder PGE2 levels in the rat. [0497] Am J Physiol Regul Integr Comp Physiol. August; 295(2):R714-8 [0498] Sierra A, Lavaque E, Perez-Martin M, Azcoitia I, Hales D B, Garcia-Segura L M (2003). Steroidogenic acute regulatory protein in the rat brain: cellular distribution, developmental regulation and overexpression after injury. Eur J Neurosci. September; 18(6):1458-67. [0499] Simpson J L, Elias S, Melinak L R, Buttram V C (1980) Heritable aspects of endometriosis: I genetic studies. Am J Obstet Gynecol 137:327 [0500] Su H Y, Chen C H, Gao H W, Liu J Y. (2005) A bicornuate uterus with a unilateral cornual adenomyosis. Obstet Gynecol. 105:1191-3. [0501] Stappenbeck T S1, Miyoshi H. (2009) The role of stromal stem cells in tissue regeneration and wound repair. Science. June 26; 324(5935):1666-9. doi: 10.1126/science.1172687 [0502] Takahashi K, Nagata H and Kitao M (1989). Clinical usefulness of determination of estradiol levels in the menstrual blood for patients with endometriosis. Acta Obstet Gynecol Jpn 41, 1849-1850. [0503] Takebayashi A1, Kimura F, Kishi Y, Ishida M, Takahashi A, Yamanaka A, Wu D, Zheng L, Takahashi K, Suginami H, Murakami T (2014). Subpopulations of macrophages within eutopic endometrium of endometriosis patients. Am J Reprod Immunol. 2015 March; 73(3):221-31. doi: 10.1111/aji.12331. Epub October 25 [0504] Takemura M, Nomura S, Kimura T, Inoue T, Onoue H, Azuma C, Saji F, Kitamura Y, Tanzawa O (1993) Expression and localization of oxytocin receptor gene in human uterine endometrium in relation to the menstrual cycle. Endocrinology 132: 1830-1835 [0505] Taylor A H, Al-Azzawi F. (2000) Immunolocalisation of oestrogen receptor beta in human tissues. J Mol Endocrinol. 24:145-55. [0506] Taylor H S, Vanden Heuvel G B, Igarashi P. (1997) A conserved HOX axis in the mouse and human female reproductive system: Late establishment and persistent adult expression of the HOXA cluster genes. Biol Reprod. 57:1338-1345 [0507] Teicher B A, Fricker S P (2010) CXCL12 (SDF-1)/CXCR4 pathway in cancer. Clin Cancer Res. 16:2927-2931 [0508] Tummon I S, Maclin V M, Rachwanska E, Binor Z, Dmowski P W (1988) Occult ovulatory dysfunction in women with minimal endometriosis or unexplained infertility. Fertil Steril 50:716 [0509] Van den Bosch T1, Dueholm M2, Leone F P3, Valentin L4, Rasmussen C K2, Votino A5, Van Schoubroeck D1, Landolfo C6, Install AJ7,8, Guerriero S9, Exacoustos C10, Gordts S11, Benacerraf B12, D'Hooghe T13, De Moor B7,8, Brlmann H14, Goldstein S15, Epstein E16, Bourne T1,17, Timmerman D1. (2015) Terms, definitions and measurements to describe sonographic features of myometrium and uterine masses: a consensus opinion from the Morphological Uterus Sonographic Assessment (MUSA) group. Ultrasound Obstet Gynecol. September; 46(3):284-98. doi: 10.1002/uog.14806. Epub 2015 Aug. 10 [0510] Wada-Hiraike O1, Imamov O, Hiraike H, Hultenby K, Schwend T, Omoto Y, Warner M, Gustafsson J A (2006) Role of estrogen receptor beta in colonic epithelium Proc Natl Acad Sci USA. 103:2959-2964. Epub 2006 Feb. 13 [0511] Wang X, Mamillapalli R, Mutlu L, Du H, Taylor H S (2015) Chemoattraction of bone arrow-derived stem cells towards human endometrial stromal cells is mediated by estradiol regulated CXCL12 and CXCR4 expression. Stem Cell Res 15: 14-22 [0512] Werth R, Grusdew W (1898) Untersuchungen ber die Entwicklung and Morphologie der menschlichen Uterusmuskulatur. Arch. Gynkol. 55:325-409. [0513] Wetzstein R (1965) Der Uterusmuskel: Morphologie. Arch Gynecol 202, 1-13 [0514] Wierman M E, Kisiljak-Vassiliades K, D O, Tobert S, (2011) Gonadotropin releasing hormone (GnRH) neurn migration: initiation, maintenance and cessation a critical steps to ensure normal reproductive function Front Neuroendocrinol 32: 43-52 [0515] Wildt L, Kissler S, Licht P, Becker W (1998) Sperm transport in the human female genital tract and its modulation by oxytocin assessed by hysterosalpingography, hysterotonography, electrohysterography and Doppler sonography. Hum Reprod Update 4, 655-666 [0516] Wu Y1, Wang J, Scott P G, Tredget E E (2007) Bone marrow-derived stem cells in wound healing: a review. Wound Repair Regen. September-October; 15 Suppl 1:S18-26. [0517] Xu Y1, Zhu H1, Zhao D1, Tan J1. (2015) Endometrial stem cells: clinical application and pathological roles. Int J Clin Exp Med. December 15; 8(12):22039-44. eCollection 2015 [0518] Yamamoto T, Noguchi T, Tamura T, Kitiwaki J, Okada H (1993) Evidence for oestrogen synthesis in adenomyotic tissues. Am. J. Obstet. Gynecol. 169: 734-738 [0519] Yang G, Im H J, Wang J H (2005). Repetitive mechanical stretching modulates IL-1beta induced COX-2, MMP-1 expression, and PGE2 production in human patellar tendon fibroblasts. [0520] Gene. December 19; 363:166-72. Epub 2005 Oct. 13. Links [0521] Zervomanolakis I, Ott H W, Mller J, Seeber B E, Friess S C, Mattle V, Virgolini I, Heute D, Wildt L (2009). Uterine mechanisms of ipsilateral directed spermatozoa transport: Evidence for a contribution of the utero-ovarian countercurrent system. [0522] Eur J Obstet Gynecol Reprod Biol May; 144 Suppl 1:S45-9. [0523] Zhang L X1, Shen L L2, Ge S H3, Wang L M3, Yu X J4, Xu Q C5, Yang P S3, Yang C Z6. (2015) Systemic BMSC homing in the regeneration of pulp-like tissue and the enhancing effect of stromal cell-derived factor-1 on BMSC homing. Int J Clin Exp Pathol. September 1; 8(9):10261-71. eCollection [0524] Zhou W H, Wu X, Hu W D, Du M R (2015) Co-expression of CXCR4 and CXCR7 in human endometrial stromal cells is modulated by steroid hormones. Int J Clin Exp Pathol. March 1; 8(3):2449-60. eCollection 2015 [0525] Zhu W1, Pao G M, Satoh A, Cummings G, Monaghan J R, Harkins T T, Bryant S V, Randal Voss S, Gardiner D M, Hunter (2012). Activation of germline-specific genes is required for limb regeneration in the Mexican axolotl. Dev Biol. October 1; 370(1):42-51. doi: 10.1016/j.ydbio.2012.07.021. Epub 2012 Jul. 27 [0526] Zingg H H, Rosen F, Chu K, Larcher A, Arslan A M, Richard S, Lefebvre D (1995) Oxytocin and oxytocin receptor gene expression in the uterus. Recent Progr. Hormone Res. 50:255-273 [0527] Zgraggen S, Huggenberger R, Kerl K, Detmar M (2014) An important role of the SDF-1/CXCR4 axis in chronic skin inflammation. PLoS One. April 2; 9(4):e93665. doi: 10.1371/journal.pone.0093665. eCollection 2014