1. Patent Search
  2. Details

Methods for preparing RNA probes for exome sequencing and for depleting organelle DNA

20200370093 ยท 2020-11-26

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides a method for preparing RNA probes useful for exome sequencing protocols or alternatively a method for the preparation of RNA probes which can be used for the separation of circular such as organelle DNA from nuclear genome.

    Claims

    1. A method for preparing RNA probes for exome sequencing and/or exome-bisulfite sequencing, the method comprising the steps of: a) extracting and isolating total RNA from a cell or tissue sample of a eukaryote of interest or providing a ready-made total eukaryotic RNA sample; b) separating mRNA from the total RNA to obtain a portion of enriched population of mRNA molecules and a portion of non-protein coding RNA; c) preparing a first adaptor ligated cDNA library from said portion of enriched population of mRNA molecules; d) preparing a second adaptor ligated cDNA library from said portion of non-protein coding RNA; e) performing PCR enrichment of said second adaptor ligated cDNA library with a first primer pair comprising an RNA polymerase promoter sequence, wherein said first primer pair also comprises a sequence specific to the adaptor sequence present in the second adaptor ligated cDNA library; f) synthesizing a first set of RNA probes by using an RNA polymerase in the presence of the enriched cDNA library obtained from step e), wherein said RNA probes are synthesized with a selectable label; g) hybridizing said first set of RNA probes with said first adaptor ligated cDNA library, separating the hybridized and non-hybridized sample and collecting the non-hybridized sample to produce a depleted-mRNA-library; h) performing PCR enrichment of said depleted-mRNA-library with a second primer pair comprising an RNA polymerase promoter sequence, wherein said second primer pair also comprises a sequence specific to the adaptor sequence present in the first adaptor ligated cDNA library; and i) synthesizing a second set of RNA probes suitable for exome sequencing and/or exome-bisulfite sequencing by using an RNA polymerase in the presence of the enriched depleted-mRNA-library obtained from step h), wherein said second set of RNA probes are synthesized with a selectable label.

    2. The method according to claim 1, wherein an aliquot of said portion of enriched population of mRNA molecules obtained in step b) is used for normalization in step d).

    3. The method according to claim 1, wherein in step c) after adaptor ligation or in step h) after PCR enrichment, a duplex-specific nuclease (DSN) is used to normalize the cDNA library obtained.

    4. The method according to claim 1, wherein said RNA probes synthesized in step f) and i) comprise a selectable affinity label.

    5. The method according to claim 4, wherein said selectable affinity label is biotin or a derivative thereof.

    6. The method according to claim 1, further comprising capturing exome sequences from a DNA library by contacting the second set of RNA probes obtained in step i) with said library and selecting those sequences from said library which are bound to any of said RNA probes.

    7. The method according to claim 6, further comprising sequencing the sequences bound to any of said RNA probes.

    8. The method according to claim 7, wherein said sequencing is performed as bisulfite sequencing.

    9. The method according to claim 1, wherein said RNA polymerase is a SP6, T3 or T7 phage RNA polymerase.

    10. A method for preparing RNA capturing probes for the separation of circular DNA from nuclear genome, the method comprising the steps of: a) extracting and isolating total DNA from a cell or tissue sample of a eukaryote of interest or providing a ready-made total eukaryotic DNA sample; b) digesting linear nuclear DNA obtained in step a) in the presence of exonucleases or separating circular DNA from the total DNA to isolate organelle DNA and other circular DNA, or providing a ready-made sample of isolated organelle DNA; c) fragmenting the circular DNA obtained in step b); d) performing end repairing and dA-tailing to fragments obtained in step c); e) performing adaptor ligation to fragments obtained in step d) to produce a DNA library of circular DNA fragments; f) performing PCR enrichment to the DNA library obtained in step e) with a primer pair comprising an RNA polymerase promoter sequence, wherein said primer pair comprises a sequence specific to the adaptor sequence present in the DNA library; and g) synthesizing a set of RNA probes by using an RNA polymerase in the presence of the enriched DNA library obtained from step f), wherein said set of RNA probes are suitable for depletion of fragmented circular DNA from DNA libraries of said eukaryote of interest and wherein said RNA probes are synthesized with a selectable label.

    11. The method according to claim 10, wherein said RNA probes synthesized in step g) comprise a selectable affinity label.

    12. The method according to claim 11, wherein said selectable affinity label is biotin or a derivative thereof.

    13. The method according to claim 10, wherein said circular DNA is organelle DNA or transposable element DNA.

    14. The method according to claim 13, wherein said organelle is chloroplast or mitochondrion.

    15. (canceled)

    16. The method according to claim 10, further comprising capturing fragmented circular DNA from a DNA library by contacting the set of RNA probes obtained in step g) with said library and separating those sequences from said library which are bound to any of said RNA probes from those sequences which are not bound to any of said RNA probes.

    17. The method according to claim 16, further comprising a sequencing the sequences bound to the RNA probes or alternatively the sequences not bound to the RNA probes.

    18. The method according to claim 10, wherein said RNA polymerase is a SP6, T3 or T7 phage RNA polymerase.

    19-29. (canceled)

    30. A kit for exome probe preparation or organelle depletion probe preparation comprising a first and a second adaptor oligonucleotide for cDNA or DNA library preparation, wherein said adaptor oligonucleotides are at least partly complementary to each other, and a primer pair for PCR enrichment, wherein the first primer of said primer pair has a 3 end specific or complementary to the first adaptor oligonucleotide and a 5 tail comprising a RNA polymerase promoter sequence and the second primer comprises a sequence which is specific or complementary to the second adaptor oligonucleotide.

    31. The kit according to claim 30, wherein said second adaptor oligonucleotide and the second primer have identical sequences.

    32. The kit according to claim 30, wherein the length of the first and second adaptor oligonucleotides is 18-25 nt.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0009] FIG. 1. Flowchart showing the method steps of a preferred embodiment for whole exome RNA probe preparation.

    [0010] FIG. 2. Flowchart showing the method steps of a preferred embodiment for organelle genome depletion probe preparation and the method steps of a preferred embodiment for organelle genome depletion from genomic DNA sequencing libraries.

    [0011] FIG. 3. Flowchart showing a preferred detailed method in adaptor and PCR primer design to capture both sense and antisense strands of a DNA sequence.

    [0012] FIG. 4. Mapping efficiency of the whole exome sequencing data for Arabidopsis thaliana, Arabidopsis lyrata and Scots pine when mapped to the reference genome or reference transcriptome.

    DETAILED DESCRIPTION OF THE INVENTION

    [0013] The present invention is directed to a method for preparing RNA probes for exome sequencing and/or exome-bisulfite sequencing, the method comprising the steps of:

    [0014] a) extracting and isolating total RNA from a cell or tissue sample of a eukaryote of interest or providing a ready-made total eukaryotic RNA sample; said eukaryote of interest being, e.g., an animal, plant, insect or fungal species.

    [0015] b) separating mRNA from the total RNA to obtain a portion of enriched population of mRNA molecules and a portion of non-protein coding RNA; preferably an aliquot of said portion of enriched population of mRNA molecules obtained in step b) is used for normalization in step d).

    [0016] c) preparing a first adaptor ligated cDNA library from said portion of enriched population of mRNA molecules, wherein said first library is preferably prepared by ligating a double-stranded adaptor sequence on both ends of a double-stranded cDNA fragment produced by cDNA synthesis;

    [0017] d) preparing a second adaptor ligated cDNA library from said portion of non-protein coding RNA, wherein said second library is preferably prepared by ligating a double-stranded adaptor sequence on both ends of a double-stranded cDNA fragment produced by cDNA synthesis;

    [0018] e) performing PCR enrichment of said second adaptor ligated cDNA library with a first primer pair comprising an RNA polymerase promoter sequence, preferably SP6, T3 or T7 phage RNA polymerase promoter sequence, wherein said first primer pair also comprises a sequence specific to the adaptor sequence present in the second adaptor ligated cDNA library;

    [0019] f) synthesizing a first set of RNA probes by using an RNA polymerase, preferably SP6, T3 or T7 phage RNA polymerase, in the presence of the enriched cDNA library obtained from step e), wherein said RNA probes are synthesized with a selectable label, preferably with a selectable affinity label such as biotin or a derivative thereof;

    [0020] g) hybridizing said first set of RNA probes with said first adaptor ligated cDNA library, separating the hybridized and non-hybridized sample and collecting the non-hybridized sample to produce a depleted-mRNA-library;

    [0021] h) performing PCR enrichment of said depleted-mRNA-library with a second primer pair comprising the RNA polymerase promoter sequence, wherein said second primer pair also comprises a sequence specific to the adaptor sequence present in the first adaptor ligated cDNA library;

    [0022] i) synthesizing a set of RNA probes suitable for exome sequencing by using an RNA polymerase in the presence of the enriched depleted-mRNA-library obtained from step h), wherein said RNA probes are synthesized with a selectable label, preferably with a selectable affinity label such as biotin or a derivative thereof.

    [0023] In a preferred embodiment, in step c) a duplex-specific nuclease (DSN) is used after adaptor ligation or in step h) after PCR enrichment to normalize the cDNA library obtained. DSN is an enzyme that selectively cleaves dsDNA and DNA in DNA-RNA hybrid duplexes. DSN is also able to discriminate between perfectly and non-perfectly matched short duplexes. DSN is inactive towards ssDNA and RNA.

    [0024] In a preferred embodiment, the above method comprises a further step of capturing exome sequences from a DNA library by contacting the set of RNA probes obtained in step i) with said library and selecting those sequences from said library which are bound to any of said RNA probes.

    [0025] In another preferred embodiment, the above method comprises a further step of sequencing the sequences bound to any of said RNA probes, preferably performed as bisulfite sequencing.

    [0026] In the PCR enrichment steps of the present method, the primer pair preferably comprises a first primer having a 3 end specific to the adaptor sequence used in the cDNA library preparation and a 5 tail comprising said RNA polymerase promoter sequence while the second primer comprises a sequence which is specific to said adaptor sequence (see FIG. 3). Preferably, the PCR enrichment step is carried out so that the first primer having said 5 tail is elongated in the first cycle(s) of the process and the second primer is elongated in the subsequent cycle(s) of the process. Finally, the said RNA polymerase promoter sequence is incorporated to both sense and antisense strands of original cDNA library sequences.

    [0027] In the embodiments of the invention, the steps c) and d) preferably comprise the steps of i) priming and fragmentation of the RNA molecules, ii) first strand cDNA synthesis, iii) second strand cDNA synthesis, iv) end preparation, v) A-tailing and vi) adaptor ligation (see also FIGS. 1 and 2). An example of the preparation of an adaptor-ligated cDNA library is disclosed in Chenchik et al., 1996.

    [0028] More preferably, the method of the present invention may comprise the following steps (see also FIG. 1: Whole-Exome RNA Probe Preparation): [0029] [01] Total RNA extraction from animal, plant, or insect tissues (basically from any eukaryotic species) with a total RNA extraction kit (e.g. QIAGEN RNeasy Plant Mini Kit). [0030] [02] DNase treatment of extracted RNA to remove genomic DNA contamination (e.g. QIAGEN RNase-Free DNase Set kit), followed by RNA cleanup and PCR confirmation of genomic DNA removal. [0031] [03] mRNA isolation, fragmentation and priming of total RNA. There are variety of kits for this purpose. For instance, NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) within NEBNext Ultra RNA Library Prep Kit for IIlumina (NEB #E7530) can be used. [0032] [04] Collection of supernatant. Preferably by following the manufacturer's instruction for the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) (except at step 16 in section 1.2 of kit producer's protocol) the supernatant is collected and kept. This collected supernatant containing non-mRNA molecules including ribosomal RNA, small RNA, and non-protein coding RNA can be called as non-mRNA-supernatant. Note: If another kit is used for mRNA enrichment, make sure that non-mRNA portion is also collected. [0033] [05] The manufacturer's instructions can be followed to dilute mRNA in 17 l of the First Strand Synthesis Reaction Buffer and Random Primer mix (2) can be prepared following the section 1.1 of NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #E7530). 1/100 of mRNA is aliquoted and named mRNA-normalization-aliquot and kept at 20 C. freezer. The following steps are performed on the rest of the mRNA using the manufacturer's instructions: mRNA fragmentation at 94 C. for 15 minutes, First Strand cDNA Synthesis (section 1.3), Second Strand cDNA Synthesis (section 1.4), Purifying the Double-stranded cDNA (section 1.5), and End Prep of cDNA Library (section 1.6). Note: ProtoScript II Reverse Transcriptase (M0368), RNase Inhibitor, Murine (M0314), Random Primer Mix (S1330), NEBNext mRNA Second Strand Synthesis Module (E6111) and NEBNext End Repair Module (E6050) could also be purchased separately and be used for these steps. [0034] [06] Adaptor Ligation can be performed according to the manufacturer's instructions with an exception of using the Custom-Adaptor-EC with primers (Adaptor1_EC_F: 5 ACA CGA CCG TCT TGC CTA CT, SEQ ID NO:1 and Apaptor4_EC_R: 5 GTA GGC AAG ACG ACA GCT C, SEQ ID NO:2) instead of using Diluted NEBNext Adaptor. Note: There is no need to use USER (Uracil-Specific Excision Reagent) Enzyme in this section. [0035] [07] The Ligation Reaction can be purified using AMPure XP Beads by Beckman Coulter (section 1.8), and named Adaptor-ligated-mRNA-library and stored at 20 C. [0036] [08] The non-mRNA-supernatant from clause [04] can be cleaned using 1.8 Agencourt AMPure XP Beads. 17 l of the First Strand Synthesis Reaction Buffer and Random Primer mix (2) can be prepared and in Section 1.1 of NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #E7530) can be added to the beads to elute non-mRNA-supernatant. The mRNA-normalization-aliquot from clause [05] can be added to the cleaned non-mRNA-supernatant and incubated at 94 C. for 15 minutes to fragment the RNA. The manufacturer's instructions can be followed to perform First Strand cDNA Synthesis (section 1.3), Second Strand cDNA Synthesis (section 1.4), purify the Double-stranded cDNA (section 1.5), End Prep of cDNA Library (section 1.6), Perform Adaptor Ligation using NEBNext adaptors (section 1.7) and purify the Ligation Reaction using AMPure XP Beads (section 1.8). [0037] [09] PCR Enrichment of Adaptor Ligated DNA can be done using Primer_T7_Fi7:

    TABLE-US-00001 (SEQIDNO:3) 5'GGATTCTAATACGACTCACTATAGGGACGTGTGCT CTTCCGATCT,
    Primer_R _i5: 5 A CAC GAC GCT CTT CCG ATC T (SEQ ID NO:4) and NEBNext Q5 Hot Start HiFi PCR Master Mix (2) by New England Biolabs (NEB #M0543). Thermocycler conditions are as follow: Initial Denaturation at 98 C. for 30 seconds, 30 cycles of Denaturation at 98 C. for 10 seconds and Annealing/Extension at 65 C. for 75 seconds, followed by 1 cycle of Final Extension at 65 C. for 5 minutes. [0038] [10] PCR product from clause is [09] purified using, e.g., AMPure XP Beads (0.9 bead to sample ratio) [0039] [11] RNA probe synthesis of purified PCR product from clause [10] can be performed using HiScribe T7 High Yield RNA Synthesis Kit (NEB # 2040) as manufacturer's instructions using modified dNTP concentration protocol including biotin-16-dUTP (Jena Bioscience #NU-803-B1016-S). After DNase I treatment, the RNA can be purified using GeneJET PCR Purification Kit (Thermo Fisher Scientific #K0701), diluted to 500 ng/l, added 1 l of SUPERase-In and stored at 80 C. The labeled RNA from this clause is called as Biotin-non-mRNA-Probe. [0040] [12] Hybridization of Adaptor-ligated-mRNA-library from clause [07] with Biotin-non-mRNA-Probe from clause [11]. In detail, 18 l of Adaptor-ligated-mRNA-library can be incubated at 95 C. for 5 min followed by 65 C. for 5 min (so called Block A). 1 l of 500 ng/l Biotin-non-mRNA-Probe from clause [11] is added to 1 l of SUPERase-In and 20 l of 2 hybridization buffer (10SSPE, 10 mM 0.5 M EDTA, pH 8.0, 10 Denhardt's Solution, 0.2% Sodium Dodecyl Sulfate (SDS)) and the sample is incubated at 65 C. for 2 min (so called Block B). Block A and Block B are mixed together (total volume of 40 l) and incubated at 65 C. overnight.

    [0041] [13] Hybridized fragments from clause [12] are depleted using, e.g., Dynabeads MyOne Streptavidin C1 beads. In detail, 20 l of the Streptavidin C1 beads are washed three times with 500 l of 1 wash buffer (5 mM Tris HCl pH 8, 0.5 mM EDTA, 1M NaCl, 0.05% tween) and after removing the wash buffer, 40 l of 2 binding buffer (10 mM Tris HCl pH 8, 1 mM EDTA, 2 M NaCl) is added to the beads. Then, 40 l of hybridized fragments from clause [12] is added to the beads and incubated for 30 min with rotation at room temperature. Beads are separated using magnetic rack and the supernatant is collected (throw away the beads). The supernatant is washed using AMPure XP Beads (1.6 bead to sample ratio) and eluted in 18 l of 10 mM Tris-CI, 0.05% TWEEN-20 solution (pH 8.0-8.5). The sample is incubated at 37 C. for 30 minutes in the presence of 1 mg/ml RNase A to remove excess RNA probes (if needed). The sample is named depleted-mRNA-library.

    [0042] [14] PCR Enrichment of depleted-mRNA-library from clause [13]. PCR is performed using, e.g., NEBNext Q5 Hot Start HiFi PCR Master Mix 2 with Primer EC1 T7 F:

    TABLE-US-00002 (SEQIDNO:5) 5GGATTCTAATACGACTCACTATAGGGAGCTGTCGT CTTGCCTACT
    and Adaptorl_EC_F: A CAC GAC CGT CTT GCC TAC T (SEQ ID NO:1) with the following thermocycler condition: Initial Denaturation at 98 C. for 30 seconds, 30 cycles of Denaturation at 98 C. for 10 seconds, Annealing/Extension at 65 C. for 75 seconds, followed by 1 cycle of Final Extension at 65 C. for 5 minutes. [0043] [15] Purification. The PCR product from clause can be [14] purified using, e.g., AMPure XP Beads (0.9 bead to sample ratio) [0044] [16] RNA probe synthesis for cleaned PCR product from clause [15] can be performed using HiScribe T7 High Yield RNA Synthesis Kit (NEB #2040) as manufacturer's instructions. Modified dNTP concentration protocol including biotin-16-dUTP (Jena Bioscience #NU-803-B1016-S) can be used. After DNase I treatment, the RNA can be purified using GeneJET PCR Purification Kit (Thermo Fisher Scientific #K0701), diluted to 500 ng/l, added 1 l of SUPERase-In and stored at 80 C. The labeled RNA from this clause is called Whole-Exome-Probe. [0045] [17] Whole-Exome-Probe from clause [16] can be used as capturing probes for exome library preparation and targeted-bisulfite (exome-bisulfite) library preparation.

    [0046] The present invention is also directed to a method for preparing RNA capturing probes for the separation of circular DNA such as organelle DNA from nuclear genome, preferably said organelle DNA being from chloroplast or mitochondrion, the method comprising the steps of:

    [0047] a) extracting and isolating total DNA from a cell or tissue sample of a eukaryote of interest or providing a ready-made total eukaryotic DNA sample;

    [0048] b) digesting linear nuclear DNA obtained in step a) in the presence of exonucleases, preferably Lambda Exonuclease and Exonuclease I, or separating circular DNA from the total DNA to isolate organelle DNA and other circular DNA, or providing a ready-made sample of isolated organelle DNA;

    [0049] c) fragmenting the circular DNA obtained in step b);

    [0050] d) performing end repairing and dA-tailing to fragments obtained in step c);

    [0051] e) performing adaptor ligation to fragments obtained in step d) to produce a DNA library of circular DNA fragments (i.e. linear or non-circular fragments originating from said circular DNA) , wherein said library is preferably prepared by ligating a double-stranded adaptor sequence on both ends of an A-tailed DNA fragment;

    [0052] f) performing PCR enrichment to the DNA library obtained in step e) with a primer pair comprising an RNA polymerase promoter sequence, preferably SP6, T3 or T7 phage RNA polymerase promoter sequence, wherein said primer pair is specific to the adaptor sequence present in the DNA library;

    [0053] g) synthesizing a set of RNA probes by using an RNA polymerase, preferably SP6, T3 or T7 phage RNA polymerase, in the presence of the enriched DNA library obtained from step f), wherein said set of RNA probes are suitable for depletion of fragmented circular DNA from total DNA samples of said eukaryote of interest, wherein said RNA probes are synthesized with a selectable label such as biotin or a derivative thereof.

    [0054] In a preferred embodiment, the method comprises a further step of capturing circular DNA from a DNA library by contacting the set of RNA probes obtained in step g) with said library and separating those sequences from said library which are bound to any of said RNA probes from those sequences which are not bound to any of said RNA probes.

    [0055] In a preferred embodiment, the method comprises a further step of sequencing the sequences bound to the RNA probes or alternatively the sequences not bound to the RNA probes. In a more preferred embodiment, the adaptor ligated DNA library of organelle DNA fragments obtained in step e) could be directly sequenced after PCR enrichment with NGS compatible indexed primers.

    [0056] In a preferred embodiment, in step e) a duplex-specific nuclease (DSN) is used after adaptor ligation to normalize the circular DNA library obtained.

    [0057] In another preferred embodiment, in step b) the first exonuclease digests one strand of linear dsDNA (making ssDNA) while the second exonuclease digests the remaining single stranded DNA.

    [0058] Preferably, the circular DNA is organelle DNA from chloroplast and/or mitochondrion or circular transposable DNA. Transposable elements (TEs) may be active in a eukaryotic cell and may produce circular DNA (and sometimes may be present even as many copies as organelle DNA).

    [0059] More preferably, the method of the present invention may comprise the following steps (see also FIG. 2: Organelle Genome Depletion Probe Preparation): [0060] [18] Isolation of organelle genome(s) including mitochondria and/or chloroplast (in plants). 500 ng of total extracted DNA is treated with Lambda Exonuclease (NEB #M0262) at 37 C. for 2 hours followed by Exonuclease I (NEB #M0293) digestion at 37 C. for 2 hours. These enzymes digest linear nuclear DNA while they are not able to digest supercoiled and circular mitochondria and/or chloroplast DNA. There are also other methods available for isolation of organelle genomes, which could be used if needed. [0061] [19] Cleaning up digested DNA using, e.g., PCR purification kit such as GeneJET PCR Purification Kit (Thermo Fisher Scientific # K0701). [0062] [20] Organelle- and nuclear-DNA specific primers are used to confirm successful removal of nuclear DNA using PCR and for enrichment of organelle DNA. If necessary, the above two clause [18] and [19] can be repeated to make sure the nuclear DNA specific primers do not amplify any fragments. [0063] [21] Shredding cleaned organelle DNA from clause [19]. Bioruptor can be used for shredding DNA for 200-300 bp fragments using 30/90 (On/Off cycle time) for 30 minutes. [0064] [22] Optional application: If the purpose of project is to sequence organelle genome(s), DNA library can be prepared from shredded DNA from clause [21] using, e.g., commercially available DNA library preparation kits (e.g. NEBNext DNA Library Prep Master Mix Set for Illumina for library prep kit #E7370). [0065] [23] Performing end repair of fragmented DNA from clause [21] followed by product cleanup using AMPure XP beads (1.6 beads to sample ratio). The chemicals in NEBNext DNA Library Prep Master Mix Set for Illumina for library prep kit (NEB #E7370) can be used to perform this step.

    [0066] [24] Performing dA-Tailing of End Repaired DNA from clause [23] followed by product cleanup using AMPure XP beads (1.6 beads to sample ratio). The chemicals in NEBNext DNA Library Prep Master Mix Set for Illumina for library prep kit (NEB #E7370) can be used to perform this step. [0067] [25] Performing Adaptor Ligation of dA-Tailed DNA from clause [24] using Adaptor1_EC_F: 5 ACA CGA CCG TCT TGC CTA CT (SEQ ID NO:1) and Apaptor4_EC_R: 5 GTA GGC AAG ACG ACA GCT C (SEQ ID NO:2) instead of using Diluted NEBNext Adaptor. The chemicals in NEBNext DNA Library Prep Master Mix Set for Illumina for library prep kit (NEB #E7370) can be used to perform this step, followed by product cleanup using, e.g. AMPure XP beads (1.6 beads to sample ratio). [0068] [26] PCR Enrichment of adaptor ligated DNA from clause [25]. PCR can be performed using NEBNext Q5 Hot Start HiFi PCR Master Mix (2) with Primer_EC1_T7_F:

    TABLE-US-00003 (SEQIDNO:5) 5GGATTCTAATACGACTCACTATAGGGAGCTGTCGT CTTGCCTACT
    and Adaptor1_EC_F: A CAC GAC CGT CTT GCC TAC T (SEQ ID NO:1) with the following thermocycler condition; Initial Denaturation at 98 C. for 30 seconds, 30 cycles of Denaturation at 98 C. for 10 seconds and Annealing/Extension at 65 C. for 75 seconds, followed by 1 cycle of Final Extension at 65 C. for 5 minutes.

    [0069] [27] The PCR product from clause [26] is purified using, e.g. AMPure XP Beads (0.9 bead to sample ratio) [0070] [28] RNA probe for cleaned PCR product from clause [27] can be synthesized using HiScribe T7 High Yield RNA Synthesis Kit (NEB #2040) as manufacturer's instructions using modified dNTP concentration protocol including biotin-16-dUTP (Jena Bioscience #NU-803-B1016-S). After DNase I treatment, the RNA can be purified using GeneJET PCR Purification Kit (Thermo Fisher Scientific #K0701), diluted to 500 ng/pl, added 1 l of SUPERase-In and stored at 80 C. The biotin labeled RNA from this clause is called Organelle-depletion-Probe. [0071] [29] Organelle-depletion-Probe from clause [28] can be used as capturing probes for depletion of organelle genome from whole genome sequencing (re-sequencing), whole genome de novo sequencing, exome sequencing, targeted sequencing, targeted-bisulfite (exome-bisulfite) sequencing, whole genome bisulfite sequencing, reduced representation bisulfite sequencing, directional or non-directional RNA sequencing, RAD sequencing, ddRAD sequencing, genotyping by sequencing library preparations or any other available sequencing approaches.

    [0072] In another preferred embodiment, the present invention also provides the following method for the depletion of organelle DNA from DNA libraries (see FIG. 2, Organelle Genome Depletion from Genomic DNA sequencing Libraries):

    [0073] [30] Preparing the next generation sequencing libraries using. e.g., commercial kits according to manufacturer's instructions until cleaned Adapter-ligated-library for any sequencing platform including whole genome sequencing (re-sequencing), whole genome de novo sequencing, exome sequencing, targeted sequencing, directional or non-directional RNA sequencing, RAD sequencing, ddRAD sequencing, genotyping by sequencing library preparations or any other available sequencing approaches is ready. For targeted-bisulfite (exome-bisulfite) sequencing, whole genome bisulfite sequencing and reduced representation bisulfite sequencing, prepare the libraries until cleaned adaptor ligated DNA is ready without performing bisulfite treatment.

    [0074] [31] Hybridization of Adaptor-ligated-library from clause [07] [30] with Organelle-depletion-Probe from clause [28]. In detail, 18 l of Adaptor-ligated-library from clause [30] is incubated at 95 C. for 5 min followed by 65 C. for 5 min (so called Block A). 1 l of 500 ng/l Organelle-depletion-Probe from clause [28] is added to 1 l of SUPERase-In and 20 l of 2 hybridization buffer (10SSPE, 10 mM 0.5 M EDTA, pH 8.0, 10 Denhardt's Solution, 0.2% Sodium Dodecyl Sulfate (SDS)) and incubated at 65 C. for 2 min (so called Block B). Block A and Block B are mixed together (total volume of 40 l, so called Block H) and incubated at 65 C. overnight.

    [0075] [32] Depletion of hybridized fragments from clause [31] using, e.g., Dynabeads MyOne Streptavidin C1 beads. In detail, 20 l of the Streptavidin C1 beads are washed with 500 l of 1 wash buffer (5 mM Tris HCl pH 8, 0.5 mM EDTA, 1M NaCl, 0.05% tween), after removing the wash buffer, 40 l of 2 binding buffer (10 mM Tris HCl pH 8, 1 mM EDTA, 2 M NaCl) is added to the beads. 40 l of hybridized fragments (Block H) from clause [31] is added to the beads and incubated for 30 min with rotation at room temperature. Separate the beads in a magnetic rack and collect the supernatant (beads containing captured organelle genome fragments were thrown away). The supernatant is washed using AMPure XP Beads (1.6 bead to sample ratio) and eluted in 18 l of 10 mM Tris-Cl, 0.05% TWEEN-20 solution (pH 8.0-8.5). The sample is incubated at 37 C. for 30 minutes in the presence of 1 mg/ml RNase A to remove excess RNA probes (if needed). The sample is then named depleted-library. [0076] [33] The rest of original library preparation protocol (left over from clause [30] can be performed on the depleted-library from clause [32] according to the kit's specific manufacturer's instructions and then sent for sequencing.

    [0077] The present invention is also directed to a set of RNA probes obtained by the first mentioned method above, wherein said set of RNA probes is suitable for selecting exome sequences of a eukaryotic species from a cDNA library. Each of the RNA probes comprises copies of cDNA library adaptor sequences flanking a eukaryotic genomic strand and the first nucleotide at the 5 end of the probe is G as the probe is produced by a RNA polymerase as defined above. The set of RNA probes target both sense and antisense strands of the exome sequences. Preferably, the 5 adaptor sequence and the 3 adaptor sequence flanking a eukaryotic genomic strand in each of the RNA probes comprise at least 8-12 contiguous complementary nucleotides (see e.g. FIG. 3).

    [0078] The present invention also provides a set of RNA probes obtained by the latter method mentioned above, wherein said set is suitable for selecting circular organelle sequences of a eukaryotic species from a DNA library. Each of the RNA probes comprises copies of DNA library adaptor sequences flanking a eukaryotic organelle strand and the first nucleotide at the 5 end of the probe is G. The set of RNA probes target both sense and antisense strands of the organelle sequences. Preferably, the 5 adaptor sequence and the 3 adaptor sequence flanking a eukaryotic organelle strand in each of the RNA probes comprise at least 8-12 contiguous complementary nucleotides (see e.g. FIG. 3).

    [0079] The total length of each RNA probe in said sets is preferably 100-400 nt, more preferably 100-300 nt or 150-250 nt, most preferably about 200 nt. The length of said adaptor sequences in said probes is preferably 18-25 nt, more preferably 20-22 nt. Even more preferably, said adaptor sequences are not complementary to NGS adaptor sequences to prevent capturing non-specific fragments from DNA libraries comprising common NGS adaptors. Preferably, the probes comprise labelled U nucleotides and the preferred label is biotin.

    [0080] In its further embodiment, the invention also provides a kit for exome probe preparation or organelle depletion probe preparation, wherein said kit comprises a first and a second adaptor oligonucleotide for cDNA or DNA library preparation, wherein said adaptor oligonucleotides are at least partly complementary to each other, and a primer pair for PCR enrichment, wherein the first primer of said primer pair has a 3 end specific or complementary to the first adaptor oligonucleotide and a 5 tail comprising a RNA polymerase promoter sequence and the second primer comprises a sequence which is specific or complementary to the second adaptor oligonucleotide. Preferably, said second adaptor oligonucleotide and the second primer have identical sequences. The length of the said adaptor oligonucleotides is preferably 18-25 nt, more preferably 19-20 nt or 20-22 nt. As above, said adaptor sequences should preferably not be complementary to NGS adaptor sequences. Said adaptor oligonucleotides are preferably suitable for ligation to A-tailed cDNA/DNA fragments. The adaptor oligonucleotides and PCR enrichment primers are designed so that they target both sense and antisense strands of the target cDNA or DNA library.

    [0081] The present invention is further described in the following Experimental Section, which is not intended to limit the scope of the invention.

    EXPERIMENTAL SECTION

    [0082] Example 1Whole Exome Sequencing of Arabidopsis thaliana, Arabidopsis lyrata and Scots Pine

    [0083] This invention has been tested in whole-exome sequencing of three different species including A. thaliana (small genome size of around 139 MB with a good quality reference genome), A. lyrata (small genome size of around 207 MB with a draft reference genome) and Scots pine (huge genome of around 20 GB with no reference genome). One sample of A. thaliana from Col ecotype, 2 samples of A. lyrata from Spiterstulen population and two samples from Scots pine (one from needle and one from megagametophyte tissues) were selected for this experiment.

    [0084] Total RNA was extracted from tissues using either RNeasy Mini Kit (QIAGEN) for A. thaliana, A. lyrata or Scots pine megagametophyte tissues and Spectrum Plant Total RNA Kit (Sigma) with protocol B for Scots pine Needles. Genomic DNA was removed from the samples using RNase-Free DNase Set kit (QIAGEN) according to manufacturer's instructions followed by ethanol precipitation of RNA. The quality of RNA (RIN; RNA Integrity Number) was measured with Bioanalyzer using Agilent RNA 6000 Pico Kit. In this invention, NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) which is part of NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #E7530) was used with the manufacturer's instructions with some modifications as follow. Note: NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) enriches majority of mRNA however around 1% of rRNA and non-mRNA molecules remains in the enriched mRNA. Therefore, the following protocol is designed to even remove the remaining 1% rRNA/non-mRNA molecules in the library and to normalize the probes.

    [0085] In section 1.2, step 16 of NEB #E7530 manual, the supernatant was not thrown away and instead it was collected, labeled as non-mRNA-supernatant and stored at 20 C. for later use. The protocol was followed on the beads in the section 1.2, step 16 of NEB #E7530 manual. Before RNA fragmentation, an aliquot of mRNA (1/100) was collected and labeled as mRNA-normalization-aliquot and stored at 20 C. for later use. RNA fragmentation was performed on the main aliquot of mRNA at 94 C. for 10 minutes instead of 15 minutes to yield bigger fragments (around 300 bp). In the First strand cDNA synthesis step, the incubation time was increased from 15 minutes to 50 minutes as recommended for bigger fragments. The Second Strand cDNA Synthesis was performed according to manufacturer's instructions followed by bead purification of the double-stranded cDNA using 1.8 Agencourt AMPure XP beads and End Prep of cDNA library. Adaptor ligation was performed using Adaptorl_EC_F: 5 ACA CGA CCG TCT TGC CTA CT (SEQ ID NO:1) and Apaptor4_EC_R: 5 GTA GGC AAG ACG ACA GCT C (SEQ ID NO:2) instead of using Diluted NEBNext Adaptor without performing USER Enzyme treatment step. The adaptor-ligated libraries were purified using AMPure XP Beads and labeled as

    [0086] Adaptor-ligated-mRNA-library and stored at 20 C.

    [0087] Non-mRNA-supernatant was cleaned using 1.8 Agencourt AMPure XP Beads and eluted in 17 l of the First Strand Synthesis Reaction Buffer and Random Primer mix (2) prepared in Section 1.1 of NEBNext Ultra RNA Library Prep Kit for IIlumina (NEB #E7530). mRNA-normalization-aliquot was added to the cleaned non-mRNA-supernatant and incubated at 94 C. for 10 minutes to fragment the RNA. The manufacturer's instructions was followed to perform First Strand cDNA Synthesis (section 1.3), Second Strand cDNA Synthesis (section 1.4), Purifying the Double-stranded cDNA (section 1.5), End Prep of cDNA Library (section 1.6), Adaptor Ligation using NEBNext adaptors (section 1.7) and Purify the Ligation Reaction Using AMPure XP Beads (section 1.8).

    [0088] PCR Enrichment of Adaptor Ligated DNA was performed with Primer_T7_Fi7:

    TABLE-US-00004 (SEQIDNO:3) 5GGATTCTAATACGACTCACTATAGGGACGTGTGCT CTTCCGATCT
    and Primer_R _i5: 5 A CAC GAC GCT CTT CCG ATC T (SEQ ID NO:4) using NEBNext Q5 Hot Start HiFi PCR Master Mix, 2. Thermocycler condition was as follow: Initial Denaturation at 98 C. for 30 seconds, 30 cycles of Denaturation at 98 C. for 10 seconds and Annealing/Extension at 65 C. for 75 seconds, followed by 1 cycle of Final Extension at 65 C. for 5 minutes. PCR products were cleaned using AMPure XP Beads (0.9 bead to sample ratio)

    [0089] RNA probes were synthesis from cleaned PCR product using HiScribe T7 High Yield RNA Synthesis Kit (NEB #2040) as manufacturer's instructions using modified dNTP concentration protocol in the presence of biotin-16-dUTP (Jena Bioscience #NU-803-B1016-S). After DNase I treatment, the RNA was purified using GeneJET PCR Purification Kit (Thermo Fisher Scientific #K0701), the concentration was adjusted to 500 ng/l and 1 l of SUPERase-In was added to the sample and stored at 80 C. The biotin labeled RNA was named as Biotin-non-mRNA-Probe.

    [0090] The Adaptor-ligated-mRNA-library was hybridized with Biotin-non-mRNA-Probe. In detail, 18 l of Adaptor-ligated-mRNA-library was incubated at 95 C. for 5 min, then 65 C. for 5 min (so called Block A). 1 l of 500 ng/pl Biotin-non-mRNA-Probe was added to 1 l of SUPERase-In and 20 l of 2 hybridization buffer (10SSPE, 10 mM 0.5 M EDTA, pH 8.0, 10 Denhardt's Solution, 0.2% Sodium Dodecyl Sulfate (SDS)) and incubated at 65 C. for 2 min (so called Block B). Block A and Block B were mixed together (total volume of 40 l, so called Block H) and incubated at 65 C. overnight. The hybridized samples were washed using Dynabeads MyOne Streptavidin C1 beads as follow. 20 l of the Streptavidin C1 beads washed with 500 l of pre-heated (65 C.) 1 wash buffer (5 mM Tris HCl pH 8, 0.5 mM EDTA, 1M NaCl, 0.05% tween), after removing the wash buffer, 40 l of pre-heated (65 C.) 2 binding buffer (10 mM Tris HCl pH 8, 1 mM EDTA, 2M NaCl) was added to the beads. 40 l of hybridized fragments (Block H) was added to the beads and incubated for 30 min with rotation at 65 C. The samples were placed in a magnetic rack and the supernatant was collect. The beads containing captured non-mRNA fragments was thrown away. The supernatant was washed using AMPure XP Beads (1.6 bead to sample ratio) and eluted in 18 l of 10 mM Tris-Cl, 0.05% TWEEN-20 solution (pH 8.0-8.5). The sample was incubated at 37 C. for 30 minutes in the presence of 1 mg/ml RNase A to remove excess RNA probes (if needed). The sample named as depleted-mRNA-library.

    [0091] PCR Enrichment of depleted-mRNA-library was performed using NEBNext Q5 Hot Start HiFi PCR Master Mix 2 with Primer_EC1_F:

    TABLE-US-00005 (SEQIDNO:5) 5GGATTCTAATACGACTCACTATAGGGAGCTGTCGT CTTGCCTACT
    and Adaptor1_EC_F: A CAC GAC CGT CTT GCC TAC T (SEQ ID NO:1) with the following thermocycler condition: Initial Denaturation at 98 C. for 30 seconds, 30 cycles of Denaturation at 98 C. for 10 seconds and Annealing/Extension at 65 C. for 75 seconds, followed by 1 cycle of Final Extension at 65 C. for 5 minutes. PCR product was cleaned using AMPure XP Beads (0.9 bead to sample ratio). RNA probe synthesis was perform using 1 pg of PCR product as template using HiScribe T7 High Yield RNA Synthesis Kit (NEB # 2040) as manufacturer's instructions using modified dNTP concentration protocol in the presence of biotin-16-dUTP (Jena Bioscience #NU-803-B1016-S). After DNase I treatment, the RNA was purified using GeneJET PCR Purification Kit (Thermo Fisher Scientific # K0701), diluted to 500 ng/l, 1 l of SUPERase-In was added to RNA and stored at 80 C. The labeled RNA named as Whole-Exome-Probe was used as capturing baits for exome library preparation and targeted-bisulfite (exome-bisulfite) library preparation as follow.

    [0092] High molecular weight DNA was extracted from A. thaliana, A. lyrata and scots pine and RNA was removed by RNase A (incubation at 37 C. for 30 minutes). 1 g of DNA was shredded to around 300 bp fragments using Bioruptor (30 sec/90 sec On/Off cycle time for 30 minutes). NEBNext Ultra DNA Library Prep Kit for Illumina (E7370) was used for library prep of as manufacturer's instruction until Size Selection of Adaptor Ligated DNA step. The size selected product named as adaptor-ligated-DNA

    [0093] The adaptor-ligated-DNA was hybridized with Whole-Exome-Probe. In detail, 2.5 g of salmon sperm DNA (ThermoFisher Scientific #15632011) was added to 15.5 l of adaptor-ligated-DNA and incubated at 95 C. for 5 min, then 65 C. for 5 min (so called Block A). 1 l of 500 ng/l Whole-Exome-Probe was added to 1 l of SUPERase-In and 20 l of 2 hybridization buffer (10 SSPE, 10 mM 0.5 M EDTA, pH 8.0, 10 Denhardt's Solution, 0.2% Sodium Dodecyl Sulfate (SDS)) and incubated at 65 C. for 2 min (so called Block B). Block A and Block B were mixed together (total volume of 40 l) and incubated at 65 C. for 66 hours (Gnirke et al. 2009). The hybridized samples were washed using Dynabeads MyOne Streptavidin C1 beads as follow. 20 l of the Streptavidin C1 beads washed three times with 200 l of binding buffer, then the beads were re-suspended in 70 l of binding buffer and warmed to hybridization temperature (65 C.). 40 l of hybridized fragments was added to the beads and incubated for 30 min with occasional agitation at hybridization temperature (65 C.). The samples were placed in a magnetic rack until the solution is cleared, then the supernatant was removed and the beads were washed three times with 500 l of pre-warmed (65 C.) wash buffer. The beads were re-suspended in 40 l of 10 mM Tris-Cl, 0.05% TWEEN (pH 8.0-8.5) and incubated at 95 C. for 5 minutes. The beads were pelleted in a magnetic rack and supernatant which contained enriched library were collected in a new tube.

    [0094] The library were PCR amplified using 2X KAPA HiFi HotStart ReadyMix (KAPA Biosystems #KK2600) and indexed using forward and reverse library primers (NEBNext #E7600). The amplified library was washed 2 times with AMPure XP Beads (0.9 bead to sample ratio) to remove primers dimers.

    [0095] The quality and size of libraries were analysed by Bioanalyzer using Agilent High Sensitivity DNA Analysis Kits. The libraries were quantified using KAPA Library Quantification Kit Illumina Platforms (KAPA Biosystems #KK4824), pooled and sequenced using Illumina platform, NextSeq500.

    [0096] Results

    [0097] The procedure outlined in this invention was used to produce whole exome capturing probes and test the efficiency of the probes in exome sequencing of three different species including A. thaliana, A. lyrata and Scots pine. Mapping efficiency of the reads was calculated for both reference genomes (for A. thaliana and A. lyrata) and reference transcriptomes (all three species). In A. thaliana, 99.7% of the reads were mapped to the reference genome and 64% of the reads were mapped to the reference transcriptome (FIG. 4). Annotation file of A. thaliana (tair10) has 217,183 exomes and 65,255 UTRs with an exome-wide average of around 297 bp and average UTR-wide average of around 163 bp. Considering that the average fragment length for exome sequencing libraries was around 300 bp, it suggests that around 35% of the reads captured adjunct regions of the exomes and UTRs (around 150 bp of either introns or promoters). This information is very valuable when using this invention as a tool for exome sequencing and annotation of a transcriptome reference for species with no reference genome or a species with fragmented genome.

    [0098] In A. lyrata, 95.8% of the reads were mapped to the A. lyrata's reference genome and 76.3% of the reads were mapped to the A. lyrata's reference transcriptome (FIG. 4). The current annotation file of A. lyrata has 170,346 exomes and 55,383 UTRs with an exome-wide average of around 222 bp and UTR-wide average of around 61 bp. Around 20% of A. lyrata's reads captured adjunct regions of the exomes and UTRs (around 150 bp of either introns or promoters).

    [0099] In A. thaliana, 68.7% of exons (149,317) are larger than 100 bp which is comparable to A. lyrata with 63.2% of exons (107,734) having a minimum of 100 bp. However, the number of UTRs bigger than 100 bp was 63% and 19.8% for A. thaliana and A. lyrata, respectively. Therefore, it is expected to capture more promoter regions in A. thaliana than that in A. lyrata because the majority of UTRs in A. lyrata are smaller than 100 bp and these regions are unlikely to be pulled down in whole exome sequencing. This was due to higher mapping efficiency of A. lyrata compared to A. thaliana when they mapped to transcriptome reference.

    [0100] There is no genome reference for Scots pine, however, there is a draft transcriptome reference for this genome with 36,106 coding genes (http://bioinformatics.psb.ugent.be). Whole exome sequencing was performed for Scots pine using both needle and megagametophyte tissues. For both tissues, around 48% of the reads were mapped to the transcriptome reference (FIG. 4). When compared to Arabidopsis species, current transcriptome reference for Scots pine is missing around 16-28% of the genes in the genome. Furthermore, the current transcriptome reference for Scots pine lacking information about exon-intron boundaries, making it very inefficient if traditional exome capturing probes designed for this species. This invention not only captures majority of exomes but also gives an opportunity to correct the current transcriptome reference of Scots pine for exon-intron boundaries.

    [0101] In A. thaliana, this invention was able to capture exomes of around 35,340 genes (99.9%) out of total 35,386 genes with a minimum read depth of 10. The captured portion of the exomes was 32,808,497 bp (51.1%) out of the total 64,249,826 bp with a minimum of 10 read depth.

    [0102] In A. lyrata, 29,289 genes (89.7%) of total 32,667 genes were captured with this invention accounting for 60% of the exomes (23,598,131 bp out of 38,929,289 bp) a minimum read depth of 10. The commonly captured genes between two biological samples in A. lyrata was 85.3%, demonstrating the reproducibility of whole exome capturing probes used in this invention.

    [0103] In Scots pine, exome capture were performed in both needles and megagametophytes. 22,442 genes (62%) in needles and 22,676 (62%) in megagametophytes were captured out of total of 36,106 genes in known Pinus sylvestris transcriptome. This invention captured around 7,914,639 bp (26.5%) and 9,110,635 bp (30.5%) out of total 29,877,965 bp of Scots pine transcriptome in needles and megagametophytes, respectively, sharing 71 A of the captured genes using different RNA probes from different tissues.

    [0104] Discussion

    [0105] Exome sequencing is powerful next generation sequencing technique specially when the genome size is too large or high depth reads is essential for downstream bioinformatics. There are three platforms for exome sequencing in human including NimbleGen, Agilent and Illumina which capture between 40% and 70% of the targets (around 50-60 Mb target in human) depending the platform. Although all platforms are targeting the human exome, there is surprisingly little overlap (26.2 Mb) between the three platforms. Illumina targets more untranslated regions (UTRs) compared to NimbleGen's and Agilent's. Illumina has 22.5 Mb of unique targets (21.8 Mb of these are UTRs) while NimbleGen and Agilent have 16.1 Mb and 7 Mb of unique targets, respectively (Warr et al. 2015). These differences in target coverage makes data comparisons difficult as some targets are missing in some platforms.

    [0106] If a reference genome exists for species, NimbleGen and Agilent companies support designing and providing probes. However, the process is very costly and has been offered for only limited species with efficiency being much lower than human exome capture rate. If a reference genome does not exist for species, exome library kit has not been offered at all. In some cases, close relative species has been used as a reference genome to design probes but shows high level of no-specific capture.

    [0107] This invention requires no reference genome with annotation for designing the probes or downstream bioinformatics and it allowed creating a biotinylated probe from the RNA of the same species. Therefore, the probes from this invention were highly specific to the species. In species without a reference genome, some researchers use relative species to design probes and perform exome sequencing which could lower the efficiency even further down because of probe non-specificity.

    [0108] Therefore, this innovation is an ideal solution for providing an opportunity for academic institutions or companies to head start with exome sequencing without waiting years for a reference genome to be published.

    [0109] Targeted bisulfite sequencing can be performed either by bisulfite conversion of hybrid-selected native DNA (Lee et al. 2011) or by hybrid selection of bisulfite converted DNA (Allum et al. 2015; Li et al. 2015). Current commercially available exome capture kits only target one strand of the DNA (either sense or antisense). For targeted bisulfite sequencing, it is required to sequence both strands of DNA to investigate the methylation profile of species under certain conditions. Recently, targeted bisulfite sequencing has been offered for human (Ziller et al. 2016) which uses SeqCap Epi technology (Roche). In this technology, the probes designed to capture the regions of interest after bisulfite treatment. This procedure requires multiple copies of probe for a single target which makes probe-designing process costly.

    [0110] The probes with current invention, targets both strands of a target DNA, therefore, the probes could be used for whole exome sequencing as well as whole exome bisulfite sequencing. In case of whole exome bisulfite sequencing, bisulfite conversion needs to be performed on hybrid-selected native DNA using probes from this invention. Currently, there is limited reports of targeted bisulfite sequencing for non-human species with a reference genome. As mentioned above, there are some kits available for targeted bisulfite sequencing (e.g. Roche's SeqCap Epi Choice Enrichment Kit) but native DNA capture happens after bisulfite treatment and requires multiple probes for a single target. Unless they include all possible probe combinations, the outcome might be biased towards some probes. This invention will make it feasible to work in parallel on exome sequencing and exome bisulfite sequencing of any species with or without a reference genome. Currently, there is no possibility for exome sequencing in species without a reference genome. Double digest RAD sequencing (ddRAD-Seq) is the most widely used technique for studying polymorphism in non-human species without a reference genome. The ddRAD-Seq does not target the exomes; therefore, it has less significance in term of biological meaning.

    [0111] The applications in biological sciences are moving towards RNA sequencing coupled with exome sequencing and methylation profiling of genic regions to answer a biological question. This invention makes it possible to combine these three approaches in all species with or without a reference genome. This invention will revolutionize the quality and quantity of meaningful science produced worldwide and will help even in improving the existing reference genomes for human or non-human species. The followings are the list of advantages over the current applications. [0112] Enabling exome sequencing of non-human species with or without a reference genome. [0113] Enabling exome-bisulfite sequencing for non-human species. [0114] Non-biased exome-bisulfite (or targeted bisulfite) sequencing for human compared to current methodology (e.g. SeqCap Epi Choice Enrichment Kit). [0115] More focused of exomes that they are biologically important (shows gene expression) and mostly related to a biological question/cues. [0116] There is a possibility to discover new genes which are not discovered before and which might express under rare or certain conditions. It is worth highlighting that these new genes will not be picked up with RNA sequencing as well because the sequence alignment (Tophat or Star packages) is done based on the reference genome with their known annotation. [0117] It is very cost effective comparing the cost of designing traditional probes for human or non-human species.

    [0118] Example 2Organelle genome sequencing in Arabidopsis thaliana and Arabidopsis lyrata

    [0119] Organelle genome sequencing was performed using this invention on one individual of A. thaliana ecotype Col and two individuals of A. lyrata from Spiterstulen population. Organelle genomes (both mitochondria and chloroplast) were isolated as follow: 500 ng of freshly extracted DNA was digested with Lambda Exonuclease (NEB #M0262) at 37 C. for 2 hours followed by product cleanup using GeneJET PCR Purification Kit (Thermo Fisher Scientific # K0701). The cleaned digested product was digested again with Exonuclease I (NEB #M0293) at 37 C. for 2 hours followed by second cleanup using GeneJET PCR Purification Kit (Thermo Fisher Scientific # K0701). PCR was performed using chloroplast DNA specific primers, mitochondria DNA specific primers and Nuclear DNA specific primers to confirm removal of nuclear DNA and enrichment of organelle DNA. Organelle DNA was shredded to 300 bp fragments using Bioruptor (30/90 On/Off cycle time for 30 minutes). This product names as shredded_organelle_genome.

    [0120] NEBNext DNA Library Prep Master Mix Set for Illumina for library prep kit (NEB #E7370) was used to prepare libraries for shredded_organelle_genome as manufacturer's instructions. The quality and size of libraries were analysed by Bioanalyzer using Agilent High Sensitivity DNA Analysis Kits. The libraries were quantified using KAPA Library Quantification Kit Illumina Platforms (KAPA Biosystems #KK4824), pooled and sequenced using Illumina platform NextSeq500.

    [0121] Results

    [0122] In order to demonstrate the efficiency of enzyme based isolation and enrichment of organelle genomes for next generation sequencing projects, organelle genomes was isolated from A. thaliana and A. lyrata as described in this invention. Whole genome sequencing libraries were prepared from the isolated organelle DNA and sequenced using Illumina platform.

    [0123] The average read depth for chloroplast and mitochondria of A. thaliana were around 126 and 35, respectively. The average read depth for chloroplast and mitochondria of A. lyrata were around 603 and 86, respectively. In A. thaliana, 68% of the nuclear genome had no reads at all while 100% chloroplast genome had reads (Table 1). Almost all (99.7%) of chloroplast genome (154,452 bp out of 154,478 bp) had minimum read depth of 50 while, for nuclear genome, it was only 0.20% for 50 read depth (Table 1). A similar pattern was observed for A. lyrata with slightly higher nuclear genome contamination. On average, 0.62% of nuclear genome had a minimum read depth of 50 compared to A. thaliana with 0.20% (Table 2). The reason for slight overestimation could be because A. lyrata genome is not a complete genome and there is chloroplast genome contamination in the reference genome.

    [0124] In contrast, A. lyrata control sample (not digested with enzymes), were also sequenced. On average, 76% nuclear genome had minimum read depth of 10 in non-digested sample while it was only 10.3% in digested sample (Table 3). These experiments clearly demonstrated that organelle genome could be enriched using the enzyme digestion method described in this invention.

    [0125] Discussion

    [0126] There are few methodologies for organelle genome isolation which includes i) isolation of organelle tissues from cell crude followed by DNA extraction and ii) isolation of total DNA followed by CsCl density gradient centrifugation to separate nuclear DNA from organelle DNA. In both cases, time-consuming CsCl density gradient centrifugation has been adapted as part of extraction protocol. For species with small mitochondria genomes (e.g. human or mouse), plasmid miniprep kit (Quispe-Tintaya et al. 2013) or specialized kits such as mtDNA Isolation Kit (BioVision) or Mitochondria Isolation Kit (MACS) has been used. However, there is no easy way for plant/animal species with large chloroplast (above 150,000 bp) or mitochondria (above 400,000 bp) genome sizes. In this invention, combination of Lambda Exonuclease and Exonuclease I were used to eliminate linear nuclear DNA. These enzymes has been used for purification of small plasmids but never have been tried for isolation of mitochondria or chloroplast. This methodology is very fast, cheap and it could be used for any species with varying organelle genome size. Normal DNA library preparation can be performed on the purified organelle DNA for direct sequencing of these organelles. Using this invention, a high read depth were obtained for chloroplast and mitochondria in A. thaliana and A. lyrata. The average read depth for chloroplast and mitochondria of A. thaliana were around 126 and 35, respectively. The average read depth for chloroplast and mitochondria of A. lyrata were around 603 and 86, respectively. Since Chloroplast genome in Arabidopsis is smaller than mitochondria genome; the efficiency of this invention was much higher for chloroplast genome.

    [0127] Example 3Whole Genome Sequencing of Arabidopsis lyrata with Organelle Genome Depletion

    [0128] The shredded_organelle_genome from A. lyrata (one individual from Spiterstulen population) was prepared as procedure outlined in Example 2. The chemicals from NEBNext DNA Library Prep Master Mix Set for Illumina for library prep kit (NEB #E7370) was used to prepare libraries for shredded_organelle_genome as manufacturer's instructions with the following modifications.

    [0129] End Repair of Fragmented DNA was performed on shredded_organelle_genome followed by product cleanup using AMPure XP beads (1.6 beads to sample ratio). The dA-Tailing of End Repaired DNA was performed following product cleanup using AMPure XP beads (1.6 beads to sample ratio). Then, the Adaptor Ligation of dA-Tailed DNA step was performed using Adaptor1_EC_F: 5 ACA CGA CCG TCT TGC CTA CT (SEQ ID NO:1) and Apaptor4_EC_R: 5 GTA GGC AAG ACG ACA GCT C (SEQ ID NO:2) instead of using NEBNext Adaptor (note: there was no need to use USER Enzyme Mix). The adaptor-ligated product was cleaned and size selected (300 bp) using AMPure XP beads. PCR Enrichment of adaptor ligated DNA was performed using NEBNext Q5 Hot Start HiFi PCR Master Mix 2 with Primer_EC1_T7_F:

    TABLE-US-00006 (SEQIDNO:5) 5GGATTCTAATACGACTCACTATAGGGAGCTGTCGT CTTGCCTACT
    and Adaptor1_EC_F: A CAC GAC CGT CTT GCC TAC T (SEQ ID NO:1) with the following thermocycler condition: Initial Denaturation at 98 C. for 30 seconds, 30 cycles of Denaturation at 98 C. for 10 seconds and Annealing/Extension at 65 C. for 75 seconds, followed by 1 cycle of Final Extension at 65 C. for 5 minutes. The PCR product was purified using AMPure XP Beads (0.9 bead to sample ratio). The product named as T7-ligated-PCR-product.

    [0130] RNA probe synthesis was performed using 1 l of T7-ligated-PCR-product using HiScribe T7 High Yield RNA Synthesis Kit (NEB #2040) as manufacturer's instructions using modified dNTP concentration protocol in the presence of biotin-16-dUTP (Jena Bioscience #NU-803-B1016-S). After DNase I treatment, the RNA was purified using GeneJET PCR Purification Kit (Thermo Fisher Scientific #K0701), diluted to 500 ng/l, added 1 l of SUPERase-In and stored at 80 C. The biotin labeled RNA was named as Organelle-depletion-Probe.

    [0131] To prepare DNA library for whole genome resequencing of A. lyrata, the procedure as above was performed to obtain adaptor-ligated-DNA. 18 l of adaptor-ligated-DNA was incubated at 95 C. for 5 min, then 65 C. for 5 min (so called Block A). 1 l of 500 ng/l Organelle-depletion-Probe was added to 1 l of SUPERase-In and 20 l of 2 hybridization buffer (10SSPE, 10 mM 0.5 M EDTA, pH 8.0, 10 Denhardt's Solution, 0.2% Sodium Dodecyl Sulfate (SDS)) and incubated at 65 C. for 2 min (so called Block B). Block A and Block B were mixed together (total volume of 40 l; so called Block H) and incubated at 65 C. overnight. 20 l of the Streptavidin C1 beads washed with 500 l of pre-heated (65 C.) 1 wash buffer (5 mM Tris HCl pH 8, 0.5 mM EDTA, 1 M NaCl, 0.05% tween), after removing the wash buffer, 40 l of pre-heated (65 C.) 2 binding buffer (10 mM Tris HCl pH 8, 1 mM EDTA, 2M NaCl) was added to the beads. 40 l of hybridized fragments (Block C) was added to the beads and incubated for 30 min with occasional agitation at 65 C. The beads were pelleted in a magnetic rack and the supernatant was collected (beads were throw away). The supernatant was washed using AMPure XP Beads (1.6 bead to sample ratio) and eluted in 18 l of 10 mM Tris-Cl, 0.05% TWEEN-20 solution (pH 8.0-8.5). The sample was incubated at 37 C. for 30 minutes in the presence of 1 mg/ml RNase A to remove excess RNA probes (optional). The sample named as organelle-depleted-library. PCR enrichment was performed with indexed i7 and i5 primers on the organelle-depleted-library using manufacturer's instructions in NEBNext DNA Library Prep Master Mix Set for Illumina for library prep kit (NEB #E7370). The amplified library was washed 2 times with AMPure XP Beads (0.9 bead to sample ratio).

    [0132] The quality and size of libraries were analysed by Bioanalyzer using Agilent High Sensitivity DNA Analysis Kits. The libraries were quantified using KAPA Library Quantification Kit Illumina Platforms (KAPA Biosystems #KK4824), pooled and sequenced using Illumina platform NextSeq500.

    [0133] Results

    [0134] As shown in Table 3, in whole genome sequencing of A. lyrata, majority of reads were belonged to organelle genomes with more than 1000 read depth. Around 8% of chloroplast genome had even higher than 10,000 read depth. In order to calculate the percentage of reads wasted by organelle genomes, two whole genome sequencing A. lyrata data (both single ended reads and paired ended reads) were analyzed (Table 4). Organelle genomes accounts for only around 0.27% of the genome in A. lyrata (521 kb out of total 207 Mb) however, there are multiple copies of organelle genomes within a cell compared to two copies of nuclear genome. Therefore, in whole genome sequencing projects it is expected to obtain more reads for organelle genomes compared to nuclear genome. In this invention, we crude extracted organelle genomes and produced capturing probes. Using these capturing probes, organelle genomes were depleted from whole genome sequencing libraries. The amount of reads for organelle genomes was significantly reduced using this invention. In normal whole genome DNA libraries, organelle genomes comprised more than 30% of the total reads while it was reduced to around 5% in organelle genome depleted libraries (this invention). This invention could be further improved by using highly pure organelle genome probes and extension of hybridization time to capture and deplete more organelle genomes.

    [0135] Discussion

    [0136] In order to reduce the amount of organelle genomes in genome sequencing project, some time consuming custom-made DNA extraction methods have been developed which are highly specific for the species. The efficiency of reducing organelle genomes were mostly low, ranging from 14% to 76% (Lutz et al. 2011). As an example, Lutz et al. (2011) reported that 30% of whole genome sequencing reads in Genlisea aurea were belonged to organelle genomes and it reduced to 11% using modified DNA extraction method.

    [0137] To date, there is no methodology or kit available to deplete the whole organelle genome from whole genome sequencing projects. There is only kits available to deplete ribosomal RNA from RNA sequencing projects such as NEBNext rRNA Depletion Kit (Human/Mouse/Rat) and Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat).

    [0138] Using this invention, organelle genome specific capturing probes were produced and used to deplete organelle genome fragments from whole genome library preparations for either whole genome sequencing or whole genome bisulfite sequencing projects. Organelle genome purification could be achieved by the methodology mentioned in this invention or by any previously reported extraction methods (CsCl gradient separation method or specialized kits). The purified organelle genomes could be converted to capturing probes and used to deplete the organelle genome from nuclear genome library preparations with the methodology stated in this invention. Using this invention, the organelle genome contamination was reduced from over 30% to 5% using crude organelle genome capturing probes; however, it is possible to achieve below 1% organelle genome contamination with some optimizations (e.g. producing probes from more pure organelle genomes or elongating the hybridization time).

    TABLE-US-00007 TABLE 1 Depletion of linear nuclear genome and enrichment of organelle genome using enzyme digestion in Arabidopsis thaliana. Total 1x 1x 20x 20x 50x 50x Chromosome length (bp) (bp) (%) (bp) (%) (bp) (%) Chr1 30,427,671 12,983,805 42.7 146,347 0.5 40,083 0.1 Chr2 19,698,289 8,427,777 42.8 67,144 0.3 50,943 0.3 Chr3 23,459,830 9,972,983 42.5 86,299 0.4 46,174 0.2 Chr4 18,585,056 7,876,518 42.4 89,080 0.5 52,149 0.3 Chr5 26,975,502 11,589,027 43.0 75,403 0.3 46,072 0.2 Chloroplast 154,478 154,478 100.0 154,452 99.9 154,081 99.8

    TABLE-US-00008 TABLE 2 Depletion of linear nuclear genome and enrichment of organelle genome using enzyme digestion in Arabidopsis lyrata. Total 1x 1x 20x 20x 50x 50x Chromosome length (bp) (bp) (%) (bp) (%) (bp) (%) Chr1 33,132,539 24,777,392 74.8 774,632 2.3 173,121 0.5 Chr2 19,320,864 13,836,239 71.6 571,959 3.0 257,858 1.3 Chr3 24,464,547 18,856,237 77.1 711,917 2.9 277,436 1.1 Chr4 23,328,337 17,573,620 75.3 697,339 3.0 179,037 0.8 Chr5 21,221,946 15,717,485 74.1 575,334 2.7 158,615 0.7 Chr6 25,113,588 18,918,072 75.3 534,074 2.1 129,722 0.5 Chr7 24,649,197 18,519,637 75.1 574,057 2.3 147,975 0.6 Chr8 22,951,293 16,199,729 70.6 501,876 2.2 111,577 0.5 Mitochondria 366,924 258,016 70.3 219,772 59.9 183,250 49.9 Chloroplast 154,478 132,694 85.9 114,884 74.4 105,036 68.0

    TABLE-US-00009 TABLE 3 Genome alignment statistics for in Arabidopsis lyrata without enzyme digestion (control). Total 1x 1x 20x 20x 50x 50x 1000x 10,000x Chromosome length (bp) (bp) (%) (bp) (%) (bp) (%) (%) (%) Chr1 33,132,539 28,124,766 84.9 22,746,157 68.7 4,986,257 15.0 0.1 0.0 Chr2 19,320,864 15,583,447 80.7 12,491,730 64.7 2,757,938 14.3 0.9 0.0 Chr3 24,464,547 21,074,488 86.1 17,289,705 70.7 3,958,863 16.2 0.5 0.0 Chr4 23,328,337 19,315,590 82.8 15,574,175 66.8 3,377,781 14.5 0.2 0.0 Chr5 21,221,946 17,710,017 83.5 14,283,704 67.3 3,187,690 15.0 0.1 0.0 Chr6 25,113,588 21,147,110 84.2 17,213,110 68.5 3,541,422 14.1 0.1 0.0 Chr7 24,649,197 20,856,295 84.6 16,944,007 68.7 3,497,664 14.2 0.1 0.0 Chr8 22,951,293 18,276,074 79.6 14,348,243 62.5 3,149,084 13.7 0.1 0.0 Mitochondria 366,924 261,869 71.4 240,190 65.5 231,177 63.0 22.5 0.0 Chloroplast 154,478 138,839 89.9 117,414 76.0 113,021 73.2 50.3 7.8

    TABLE-US-00010 TABLE 4 The percentage of waste reads because of organelle genome contamination in non-depleted libraries and organelle genome depleted libraries. Total Mapped to Mapped to Percentage Sample Reads reads Chloroplast Mitochondria organelle genome Non-depleted libraries (normal whole genome DNA libraries) A. lyrata-S1 100 bp Single-End 50,834,934 13,227,688 1,285,640 28.55% A. lyrata-S2 100 bp Paired-End 45,245,323 12,604,441 2,771,797 33.98% Organelle genome depleted libraries (this invention) A. lyrata-S1 150 bp Paired-End 84,040,304 2,926,884 1,285,540 5.01% A. lyrata-S2 150 bp Paired-End 138,203,286 5,217,794 2,160,791 5.34%

    REFERENCES

    [0139] Allum, F, Shao, X, Gunard, F, Simon, M-M, Busche, S, Caron, M, Lambourne, J, Lessard, J, Tandre, K, Hedman, K, Kwan, T, Ge, B, Rnnblom, L, McCarthy, M I, Deloukas, P, Richmond, T, Burgess, D, Spector, T D, Tchernof, A, Marceau, S, Lathrop, M, Vohl, M-C, Pastinen, T, Grundberg, E (2015) Characterization of functional methylomes by next-generation capture sequencing identifies novel disease-associated variants. Nature Communications 6, 7211. [0140] Chenchik, A, Diachenko, L, Moqadam, F, Tarabykin, V, Lukyanov, S, and Siebert, P. D., (1996) Full-length cDNA Cloning and Determination of mRNA 5 and 3 Ends by Amplification of Adaptor-Ligated cDNA, BioTechniques 21:526-534. [0141] Gnirke, A, Melnikov, A, Maguire, J, Rogov, P, LeProust, E M, Brockman, W, Fennell, T, Giannoukos, G, Fisher, S, Russ, C, Gabriel, S, Jaffe, D B, Lander, E S, Nusbaum, C (2009) Solution Hybrid Selection with Ultra-long Oligonucleotides for Massively Parallel Targeted Sequencing. Nature biotechnology 27, 182-189. [0142] Kato, N, Reynolds, D, Brown, M L, Boisdore, M, Fujikawa, Y, Morales, A, Meisel, L A (2008) Multidimensional fluorescence microscopy of multiple organelles in Arabidopsis seedlings. Plant Methods 4, 9. [0143] Lee, E-J, Pei, L, Srivastava, G, Joshi, T, Kushwaha, G, Choi, J-H, Robertson, K D, Wang, X, Colbourne, J K, Zhang, L, Schroth, G P, Xu, D, Zhang, K, Shi, H (2011) Targeted bisulfite sequencing by solution hybrid selection and massively parallel sequencing. Nucleic Acids Research 39, e127-e127. [0144] Li, Q, Suzuki, M, Wendt, J, Patterson, N, Eichten, S R, Hermanson, P J, Green, D, Jeddeloh, J, Richmond, T, Rosenbaum, H, Burgess, D, Springer, N M, Greally, J M (2015) Post-conversion targeted capture of modified cytosines in mammalian and plant genomes. Nucleic Acids Research 43, e81-e81. [0145] Lister, R, O'Malley, R C, Tonti-Filippini, J, Gregory, B D, Berry, C C, Millar, A H, Ecker, J R (2008) Highly Integrated Single-Base Resolution Maps of the Epigenome in Arabidopsis. Cell 133, 523-536. [0146] Lutz, K A, Wang, W, Zdepski, A, Michael, T P (2011) Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing. BMC Biotechnology 11, 54. [0147] Ossowski, S, Schneeberger, K, Clark, R M, Lanz, C, Warthmann, N, Weigel, D (2008) Sequencing of natural strains of Arabidopsis thaliana with short reads. Genome Research 18, 2024-2033. [0148] Quispe-Tintaya, W, White, R R, Popov, V N, Vijg, J, Maslov, A Y (2013) Fast mitochondrial DNA isolation from mammalian cells for next-generation sequencing. Bio Techniques 55, 133-136. [0149] Rauwolf, U, Golczyk, H, Greiner, S, Herrmann, RG (2010) Variable amounts of DNA related to the size of chloroplasts III. Biochemical determinations of DNA amounts per organelle. Molecular Genetics and Genomics 283, 35-47. [0150] Shaver, J M, Oldenburg, D J, Bendich, A J (2006) Changes in chloroplast DNA during development in tobacco, Medicago truncatula, pea, and maize. Planta 224, 72-82. [0151] Urich, M A, Nery, J R, Lister, R, Schmitz, R J, Ecker, J R (2015) MethylC-seq library preparation for base-resolution whole-genome bisulfite sequencing. Nat. Protocols 10, 475-483. [0152] Warr, A, Robert, C, Hume, D, Archibald, A, Deeb, N, Watson, M (2015) Exome Sequencing: Current and Future Perspectives. G3: Genes/Genomes/Genetics 5, 1543-1550. [0153] Ziller, M J, Stamenova, E K, Gu, H, Gnirke, A, Meissner, A (2016) Targeted bisulfite sequencing of the dynamic DNA methylome. Epigenetics & Chromatin 9, 55. [0154] Zoschke, R, Liere, K, Brner, T (2007) From seedling to mature plant: Arabidopsis plastidial genome copy number, RNA accumulation and transcription are differentially regulated during leaf development. The Plant Journal 50, 710-722.