PRIMERS, KIT AND METHOD FOR DETECTING EHP PATHOGENS OF LITOPENAEUS VANNAMEI

20200370094 ยท 2020-11-26

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention discloses primers, probes, a kit and a method for detecting Enterocytozoon hepatopenaei (EHP) pathogens of Litopenaeus vannamei. A PCR reaction system adopted in the method includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2, a forward primer having a nucleotide sequence as shown in SEQ ID NO: 4, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 5, a probe having a nucleotide sequence as shown in SEQ ID NO: 3, and a probe having a nucleotide sequence as shown in SEQ ID NO: 6. The method can perform duplex quantitative fluorescence PCR, an internal reference and a sample to be detected are put in the same reaction, thereby eliminating unstable factors of two reactions and improving the reliability of the result.

    Claims

    1. A primer for amplifying an 18S rRNA gene of Litopenaeus vannamei, comprising a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2.

    2. A fluorescent probe, which is used against the primer for amplifying an 18S rRNA gene of Litopenaeus vannamei according to claim 1 and has a nucleotide sequence as shown in SEQ ID NO: 3.

    3. The fluorescent probe according to claim 2, wherein the probe is labeled with a VIC fluorophore and a BHQ1 quencher group.

    4. A primer for amplifying a gene of Enterocytozoon hepatopenaei (EHP) pathogens of Litopenaeus vannamei, which comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO: 4 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 5.

    5. A fluorescent probe, which is used against the primer for amplifying a gene of EHP pathogens of Litopenaeus vannamei according to claim 4 and has a nucleotide sequence as shown in SEQ ID NO: 6.

    6. The fluorescent probe according to claim 5, wherein the probe is labeled with a FAM fluorophore and a BHQ1 quencher group.

    7. A kit for quantitatively detecting EHP pathogens of Litopenaeus vannamei, which comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2, a forward primer having a nucleotide sequence as shown in SEQ ID NO: 4, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 5, a probe having a nucleotide sequence as shown in SEQ ID NO: 3, and a probe having a nucleotide sequence as shown in SEQ ID NO: 6.

    8. The kit for quantitatively detecting EHP pathogens of Litopenaeus vannamei according to claim 7, further comprising Premix Ex Taq (Probe qPCR) (2) and ROX Reference Dye (50).

    9. A method for quantitatively detecting EHP pathogens of Litopenaeus vannamei, comprising: taking the extracted tissue DNA of Litopenaeus vannamei as a sample to be detected; and placing a PCR reaction system into a PCR reaction tube, placing the PCR reaction tube into a quantitative fluorescence PCR instrument, setting a reaction time, and carrying out a duplex PCR reaction; wherein the PCR reaction system comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 2, a forward primer having a nucleotide sequence as shown in SEQ ID NO: 4, a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 5, a probe having a nucleotide sequence as shown in SEQ ID NO: 3, a probe having a nucleotide sequence as shown in SEQ ID NO: 6, Premix Ex Taq (Probe qPCR) (2), ROX Reference Dye (50), and a sample; the sample is a sample to be detected, a standard, a negative control or a blank control; the standard comprises plasmids containing an 18S rRNA gene of Litopenaeus vannamei at a known concentration and plasmids containing a EHP SWP gene at a known concentration, and meanwhile the standard is used as a positive control; the negative control comprises DNAs extracted from tissues of healthy Litopenaeus vannamei; and the blank control comprises H.sub.2O; wherein the 18S rRNA gene of Litopenaeus vannamei is used as an internal reference; when both the positive control and the internal reference have amplification product, the blank control has no amplification product, and the negative control only has amplification of the 18S rRNA gene product of Litopenaeus vannamei and has no amplification of the EHP SWP gene product, it indicates that the PCR reaction is normal; if the sample to be detected has amplification of the EHP SWP gene product, it indicates that the detection result is positive; and if the sample to be detected has no amplification of the EHP SWP gene product, it indicates that the detection result is negative; and linear regression is conducted according to a standard curve and Ct values corresponding to the product to obtain the EHP pathogen content in the sample to be detected.

    10. The method for quantitatively detecting EHP pathogens of Litopenaeus vannamei according to claim 9, wherein the extraction of the tissue DNAs of Litopenaeus vannamei comprises: taking the Litopenaeus vannamei to be detected, taking out hepatopancreas tissues, adding a lysis buffer, fully grinding the hepatopancreas tissues, adding a proteinase K, mixing evenly, then placing in a water bath, and adding phenol to obtain the tissue DNAs of Litopenaeus vannamei.

    Description

    BRIEF DESCRIPTION OF THE DRAWING

    [0026] FIG. 1 is a standard curve prepared according to the PCR amplification result of the standard;

    [0027] FIG. 2 is a duplex PCR amplification graph; and

    [0028] FIG. 3 shows amplification curves corresponding to a standard (positive control), a negative control, a blank control, a positive sample and a negative sample.

    DETAILED DESCRIPTION

    [0029] The following clearly and completely describes the technical solutions in the embodiments of the present invention. Apparently, the described embodiments are merely some embodiments of the present invention rather than all of the embodiments. All other embodiments obtained by a person of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

    [0030] Embodiment 1 Experiment for EHP detection of Litopenaeus vannamei

    [0031] (1) DNA Extraction

    [0032] A lysis buffer was prepared and its components were: 100 mM of Tris-HCl (pH 8.0), 50 mM of EDTA, and 0.5% of SDS (sodium dodecyl sulfate).

    [0033] The hepatopancreas of Litopenaeus vannamei to be detected was taken, grinded, weighed at 100 mg, added with 400 L of the aforementioned lysis buffer to fully grind the hepatopancreas tissues, added with 80 g of a proteinase K, mixed fully, then placed in a water bath at 55 C. for 1 h, added with 400 L of phenol, gently shaken for 10 min, and centrifuged at 12000 r/min for 10 min. The supernatant was taken, added with 400 L of phenol-chloroform (1:1) and mixed uniformly, and centrifuged at 12000 r/min for 10 min. The supernatant was taken, added with 400 L of chloroform and mixed uniformly, and centrifuged at 12000 r/min for 10 min. The supernatant was taken, added with absolute ethanol precooled at 20 C. which was twice the volume of the supernatant, and mixed uniformly, and centrifuged at 12000 r/min for 10 min. The sediment was retained, washed twice with 400 L of ethanol that had a concentration of 75% and precooled at 20 C., air-dried at room temperature, and then added with 50 L of ultrapure water to obtain extracted DNAs.

    [0034] (2) Duplex Quantitative Fluorescence PCR

    [0035] Plasmids containing part of the 18S rRNA gene of Litopenaeus vannamei and plasmids containing part of the Enterocytozoon hepatopenaei (EHP) SWP gene were uniformly diluted to a concentration of 110.sup.8 copies/L. The two plasmids were mixed and diluted with gradients to concentrations of 110.sup.7 copies/L, 110.sup.6 copies/L, and 110.sup.5 copies/L, so as to serve as standards, and also positive controls.

    [0036] A quantitative fluorescence PCR reaction system was formulated, which included: 10 L of Premix Ex Taq (Probe qPCR) (2), 0.4 L of primer 18S rRNA-F (10 M), 0.4 L of primer 18S rRNA-R (10 M), 0.4 L of primer EHP-F (10 M), 0.4 L of primer EHP-R (10 M), 0.4 L of probe 18S rRNA-probe (10 M), 0.4 L of probe EHP-probe (10 M), 0.2 L of ROX Reference Dye (50), 1 L of DNAs of the sample to be detected (200 ng/L), or 1 L of the aforementioned mixed plasmids (as standards and positive controls) or 1 L of the DNAs extracted from tissues of healthy Litopenaeus vannamei (200 ng/L) (as negative controls) or 1 L of H.sub.2O (as blank controls), with the ultrapure water making up to 20 pt. Premix Ex Taq (Probe qPCR) (2) and ROX Reference Dye (50) were purchased from Takara.

    [0037] The nucleotide sequences of respective primers and probes were as follows.

    [0038] The nucleotide sequence of the primer 18S rRNA-F (forward primer I) was:

    TABLE-US-00001 (SEQIDNO:1) AGCAGGCTGGTTTTTGCTTA;

    [0039] The nucleotide sequence of the primer 18S rRNA-R (reverse primer I) was:

    TABLE-US-00002 (SEQIDNO:2) GTTCCGAAAAACCGACAAAA;

    [0040] The nucleotide sequence of the probe 18S rRNA-probe (probe I) was:

    TABLE-US-00003 (SEQIDNO:3) CCCGAATGGTCGTGCATGGA;

    [0041] The nucleotide sequence of the primer EHP-F (forward primer II) was:

    TABLE-US-00004 (SEQIDNO:4) GCGGCACAATTCTCAAACAT;

    [0042] The nucleotide sequence of the primer EHP-R (reverse primer II) was:

    TABLE-US-00005 (SEQIDNO:5) TCCTACAAATGCTGTGTCTGTG;

    [0043] The nucleotide sequence of the probe EHP-probe (probe II) was:

    TABLE-US-00006 (SEQIDNO:6) TCACCATTGGTCAAATACAATTTCAAACA.

    [0044] The aforementioned probe 18S rRNA-probe was labeled with a VIC fluorophore and a BHQ1 quencher group, and the labeled probe was:

    TABLE-US-00007 (SEQIDNO:3) VIC-CCCGAATGGTCGTGCATGGA-BHQ1.

    [0045] The aforementioned probe EHP-probe was labeled with a FAM fluorophore and a BHQ1 quencher group, and the labeled probe was:

    TABLE-US-00008 (SEQIDNO:6) FAM-TCACCATTGGTCAAATACAATTTCAAACA-BHQ1.

    [0046] The quantitative fluorescence PCR instrument of ABI 7500 was used, and the reaction program was set as follows: pre-denaturation at 95 C. for 30 s, one cycle; 95 C. for 5 s, 60 C. for 34 s, 40 cycles.

    [0047] After the quantitative fluorescence PCR reaction was completed, both the positive controls (mixed plasmids) and the internal reference (the 18S rRNA gene of Litopenaeus vannamei from the sample to be detected) had PCR amplification products, the blank controls (H.sub.2O) had no PCR amplification product, and the negative controls (DNAs extracted from the tissues of healthy Litopenaeus vannamei) only had PCR amplification products of the 18S rRNA gene of Litopenaeus vannamei and had no PCR amplification products of the EHP SWP gene, which could prove that the experimental operation was correct.

    [0048] The 18S rRNA gene fragment sequence of the amplified standards and positive controls (SEQ ID NO: 7) was:

    TABLE-US-00009 AGCAGGCTGGTTTTTGCTTACAGCCCGAATGGTCGTGCATGGAATGATGG AACAGGACCTCGGTTCTATTTTGTCGGTTTTTCGGAAC.

    [0049] The EHP SWP gene fragment sequence of the amplified standards and positive controls (SEQ ID NO: 8) was:

    TABLE-US-00010 GCGGCACAATTCTCAAACATTTTCACCATTGGTCAAATACAATTTCAAAC ACTGTAAACCTTAAAGCATTAAAAAGAGACGATATTTACACAGACACAGC ATTTGTAGGA.

    [0050] The sample to be detected had amplification products of the EHP SWP gene, indicating that the detection result was positive. The content of EHP pathogens in the sample to be detected could be obtained by conducting linear regression according to the standard curve and the Ct values corresponding to the products (the number of cycles as experienced when the fluorescence signal in each reaction tube reached a set threshold value).

    [0051] There were no amplification products of the EHP SWP gene for the sample to be detected, which indicated that the detection result was negative.

    [0052] As shown in FIG. 1, it was a standard curve prepared according to the PCR amplification result of the standards (the upper curve was the standard curve corresponding to the 18S rRNA gene of Litopenaeus vannamei, the lower curve was the standard curve corresponding to the EHP SWP gene, and CO was the concentration of the standards).

    [0053] As shown in FIG. 2, it was a duplex PCR amplification graph of the same sample (in the figure, the upper peak was the amplification curve of the 18S rRNA gene of Litopenaeus vannamei (as the internal reference); the lower peak was the amplification curve (positive) of the EHP SWP gene, and Rn was the intensity of fluorescence signal).

    [0054] As shown in FIG. 3, it showed the amplification curves corresponding to the standards (i.e., positive controls), negative controls, blank controls, positive samples and negative samples, where the detection result of the positive samples was positive and the detection result of the negative samples was negative.

    [0055] The method of the present invention has higher sensitivity, can detect the positive samples at a minimum concentration of 110.sup.2 copies/L, and shortens the original experiment period by half.

    [0056] Although the content of the present invention has been described in detail through the aforementioned preferred embodiments, it should be recognized that the above description should not be considered as limiting the present invention. Upon reading the aforementioned content, it will be apparent to those skilled in the art that various modifications and alternations to the present invention can be made. Therefore, the claimed scope of the present invention shall be defined by the appended claims.