Methods and compositions for plant pest control
10844398 ยท 2020-11-24
Assignee
Inventors
- Michael J. Crawford (St. Louis, MO, US)
- Xiangqian Li (St. Louis, MO, US)
- Barry J. Shortt (St. Louis, MO, US)
- Deryck Jeremy Williams (St. Louis, MO, US)
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N15/82
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention provides methods and compositions to improve fungal disease resistance and/or nematode resistance in various crop plants. The present invention also provides for combinations of compositions and methods to improve fungal disease resistance and/or nematode resistance in various crop plants.
Claims
1. A method for producing a tomato plant exhibiting an improvement in fungal disease resistance, the method comprising topically applying to a plant surface a composition that comprises: a. at least one dsRNA molecule of 24 to about 95 nucleotides in length, wherein the dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 51 or SEQ ID NO: 53, wherein the dsRNA molecule is not operably linked to a promoter or to a viral vector and wherein the dsRNA molecule does not become integrated into the plant chromosome; and b. a transfer agent comprising an organosilicone preparation that conditions the tomato plant surface to permeation by the dsRNA molecule into plant cells, wherein said tomato plant exhibits an improvement in fungal disease resistance that results from suppression of an endogenous tomato Mildew Resistance Locus 0 (MLO) gene.
2. The method of claim 1, wherein said dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 51.
3. The method of claim 1, wherein said dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 53.
4. The method of claim 1, wherein the dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 124-130 or 131.
5. The method of claim 1, wherein said composition comprises two or more of said dsRNA molecules.
6. The method of claim 1, wherein said composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof.
7. The method of claim 1, wherein said composition further comprises a non-polynucleotide herbicidal molecule and said plant is resistant to said herbicidal molecule.
8. A tomato plant obtained by the method of claim 1; wherein the plant comprises the dsRNA molecule.
9. A processed product of said plant of claim 8, wherein said processed product comprises the dsRNA and exhibits an improved attribute relative to a processed product of an untreated control plant and wherein said improved attribute results from said fungal disease resistance.
10. A composition comprising a dsRNA molecule of 24 to about 95 nucleotides in length, wherein the dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 51 or 53, wherein said dsRNA is not operably linked to a promoter or to a viral vector; and, a transfer agent comprising an organosilicone preparation that conditions a plant surface to permeation by the dsRNA molecule into plant cells.
11. The composition of claim 10, wherein said dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 51.
12. The composition of claim 10, wherein the dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 124-130 or 131.
13. The composition of claim 10, wherein said composition further comprises a non-polynucleotide herbicidal molecule, a polynucleotide herbicidal molecule, a polynucleotide that suppresses an herbicide target gene, an insecticide, a fungicide, a nematocide, or a combination thereof.
14. The composition of claim 10, wherein said dsRNA molecule is not physically bound to a biolistic particle.
15. A method of making a composition comprising the step of combining at least: a) a dsRNA molecule of 24 to about 95 nucleotides in length, wherein the dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 51 or 53, wherein said dsRNA is not operably linked to a promoter or a viral vector; and, b) a transfer agent, wherein the transfer agent is an organosilicone preparation that conditions a plant surface to permeation by the dsRNA molecule into plant cells.
16. The composition of claim 10, wherein said dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 53.
17. The method of claim 15, wherein said dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 51.
18. The method of claim 15, wherein said dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 53.
19. The method of claim 15, wherein the dsRNA molecule comprises a segment of at least 24 contiguous nucleotides that are identical or complementary to SEQ ID NO: 124-130 or 131.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION
I. Definitions
(7) The following definitions and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.
(8) Where a term is provided in the singular, the inventors also contemplate aspects of the invention described by the plural of that term.
(9) As used herein, the terms DNA, DNA molecule, and DNA polynucleotide molecule refer to a single-stranded DNA or double-stranded DNA molecule of genomic or synthetic origin, such as, a polymer of deoxyribonucleotide bases or a DNA polynucleotide molecule.
(10) As used herein, the terms DNA sequence, DNA nucleotide sequence, and DNA polynucleotide sequence refer to the nucleotide sequence of a DNA molecule.
(11) As used herein, the term gene refers to any portion of a nucleic acid that provides for expression of a transcript or encodes a transcript. A gene thus includes, but is not limited to, a promoter region, 5 untranslated regions, transcript encoding regions that can include intronic regions, and 3 untranslated regions.
(12) As used herein, the terms RNA, RNA molecule, and RNA polynucleotide molecule refer to a single-stranded RNA or double-stranded RNA molecule of genomic or synthetic origin, such as, a polymer of ribonucleotide bases that comprise single or double stranded regions.
(13) Unless otherwise stated, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5 to 3 direction. The nomenclature used herein is that required by Title 37 of the United States Code of Federal Regulations 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1 and 3.
(14) As used herein, a plant surface refers to any exterior portion of a plant. Plant surfaces thus include, but are not limited to, the surfaces of flowers, stems, tubers, fruit, anthers, pollen, leaves, roots, or seeds. A plant surface can be on a portion of a plant that is attached to other portions of a plant or on a portion of a plant that is detached from the plant.
(15) As used herein, the phrase polynucleotide is not operably linked to a promoter refers to a polynucleotide that is not covalently linked to a polynucleotide promoter sequence that is specifically recognized by either a DNA dependent RNA polymerase II protein or by a viral RNA dependent RNA polymerase in such a manner that the polynucleotide will be transcribed by the DNA dependent RNA polymerase II protein or viral RNA dependent RNA polymerase. A polynucleotide that is not operably linked to a promoter can be transcribed by a plant RNA dependent RNA polymerase.
(16) As used herein, any polynucleotide sequences of SEQ ID NO: 80-195, though displayed in the sequence listing in the form of ssDNA, encompass all other polynucleotide forms such as dsDNA equivalents, ssDNA equivalents, ssRNA equivalents, ssRNA complements, dsRNA, and ssDNA complements.
(17) As used herein, any polynucleotide sequences of SEQ ID NO: 197-213, though displayed in the sequence listing in the form of one strand of a dsRNA molecule, encompass all other polynucleotide forms such as dsDNA equivalents, ssDNA equivalents, ssRNA equivalents, ssRNA complements, dsRNA, and ssDNA complements.
(18) As used herein, a first nucleic-acid sequence is operably connected or linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to an RNA and/or protein-coding sequence if the promoter provides for transcription or expression of the RNA or coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, are in the same reading frame.
(19) As used herein, the phrase organosilicone preparation refers to a liquid comprising one or more organosilicone compounds, wherein the liquid or components contained therein, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enable the polynucleotide to enter a plant cell. Examples of organosilicone preparations include, but are not limited to, preparations marketed under the trade names Silwet or BREAK-THRU and preparations provided in Table 1. In certain embodiments, an organosilicone preparation can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide suppression of target gene expression in the plant cell.
(20) As used herein, the phrase provides for an improvement in fungal disease resistance and/or nematode resistance refers to any measurable increase in a plant's resistance to fungal- and/or nematode-induced damage. In certain embodiments, an improvement in fungal disease resistance and/or nematode resistance in a plant or plant part can be determined in a comparison to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant is a plant that has not undergone treatment with polynucleotide and a transfer agent. Such control plants would include, but are not limited to, untreated plants or mock treated plants.
(21) As used herein, the phrase provides for a reduction, when used in the context of a transcript or a protein in a plant or plant part, refers to any measurable decrease in the level of transcript or protein in a plant or plant part. In certain embodiments, a reduction of the level of a transcript or protein in a plant or plant part can be determined in comparison to a control plant or plant part that has not been treated with a composition comprising a polynucleotide and a transfer agent. When used in this context, a control plant or plant part is a plant or plant part that has not undergone treatment with polynucleotide and a transfer agent. Such control plants or plant parts would include, but are not limited to, untreated or mock treated plants and plant parts.
(22) As used herein, the phrase wherein said plant does not comprise a transgene refers to a plant that lacks either a DNA molecule comprising a promoter that is operably linked to an exogenous polynucleotide or a recombinant viral vector.
(23) As used herein, the phrase suppressing expression or suppression, when used in the context of a gene, refers any measurable decrease in the amount and/or activity of a product encoded by the gene. Thus, expression of a gene can be suppressed when there is a reduction in levels of a transcript from the gene, a reduction in levels of a protein encoded by the gene, a reduction in the activity of the transcript from the gene, a reduction in the activity of a protein encoded by the gene, any one of the preceding conditions, or any combination of the preceding conditions. In this context, the activity of a transcript includes, but is not limited to, its ability to be translated into a protein and/or to exert any RNA-mediated biologic or biochemical effect. In this context, the activity of a protein includes, but is not limited to, its ability to exert any protein-mediated biologic or biochemical effect. In certain embodiments, a suppression of gene expression in a plant or plant part can be determined in a comparison of gene product levels or activities in a treated plant to a control plant or plant part. When used in this context, a control plant or plant part is a plant or plant part that has not undergone treatment with a composition comprising a polynucleotide and a transfer agent. Such control plants or plant parts would include, but are not limited to, untreated or mock treated plants and plant parts.
(24) As used herein, the term transcript corresponds to any RNA that is produced from a gene by the process of transcription. A transcript of a gene can thus comprise a primary transcription product which can contain introns or can comprise a mature RNA that lacks introns.
(25) As used herein, the term liquid refers to both homogeneous mixtures such as solutions and non-homogeneous mixtures such as suspensions, colloids, micelles, and emulsions.
II. Overview
(26) Provided herein are certain methods and polynucleotide compositions that can be applied to living plant cells/tissues to suppress expression of target genes and that provide improved fungal disease resistance and/or nematode resistance to a crop plant. Also provided herein are plants and plant parts exhibiting fungal disease resistance and/or nematode resistance as well as processed products of such plants or plant parts. The compositions may be topically applied to the surface of a plant, such as to the surface of a leaf, and include a transfer agent. Aspects of the method can be applied to various crops, for example, including but not limited to: i) row crop plants including, but are not limited to, corn, barley, sorghum, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, potato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e.g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i.e., a plant not grown from a seed) that include fruit trees and plants. Fruit trees produced by such processes include, but are not limited to, citrus and apple trees. Plants produced by such processes include, but are not limited to, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants.
(27) Without being bound by a particular theory, the compositions and methods of the present invention are believed to operate through one or more of the several natural cellular pathways involved in RNA-mediated gene suppression as generally described in Brodersen and Voinnet (2006), Trends Genetics, 22:268-280; Tomari and Zamore (2005) Genes & Dev., 19:517-529; Vaucheret (2006) Genes Dev., 20:759-771; Meins et al. (2005) Annu. Rev. Cell Dev. Biol., 21:297-318; and Jones-Rhoades et al. (2006) Annu. Rev. Plant Biol., 57:19-53. RNA-mediated gene suppression generally involves a double-stranded RNA (dsRNA) intermediate that is formed intra-molecularly within a single RNA molecule or inter-molecularly between two RNA molecules. This longer dsRNA intermediate is processed by a ribonuclease of the RNAase III family (Dicer or Dicer-like ribonuclease) to one or more shorter double-stranded RNAs, one strand of which is incorporated into the RNA-induced silencing complex (RISC). For example, the siRNA pathway involves the cleavage of a longer double-stranded RNA intermediate to small interfering RNAs (siRNAs). The size of siRNAs is believed to range from about 19 to about 25 base pairs, but the most common classes of siRNAs in plants include those containing 21 to 24 base pairs (See, Hamilton et al. (2002) EMBO J., 21:4671-4679).
(28) Polynucleotides
(29) As used herein, polynucleotide refers to a DNA or RNA molecule containing multiple nucleotides and generally refers both to oligonucleotides (a polynucleotide molecule of 18-25 nucleotides in length) and longer polynucleotides of 26 or more nucleotides. Embodiments of this invention include compositions including polynucleotides having a length of 18-25 nucleotides (18-mers, 19-mers, 20-mers, 21-mers, 22-mers, 23-mers, 24-mers, or 25-mers), or medium-length polynucleotides having a length of 26 or more nucleotides (polynucleotides of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 nucleotides), or long polynucleotides having a length greater than about 300 nucleotides (e.g., polynucleotides of between about 300 to about 400 nucleotides, between about 400 to about 500 nucleotides, between about 500 to about 600 nucleotides, between about 600 to about 700 nucleotides, between about 700 to about 800 nucleotides, between about 800 to about 900 nucleotides, between about 900 to about 1000 nucleotides, between about 300 to about 500 nucleotides, between about 300 to about 600 nucleotides, between about 300 to about 700 nucleotides, between about 300 to about 800 nucleotides, between about 300 to about 900 nucleotides, or about 1000 nucleotides in length, or even greater than about 1000 nucleotides in length, for example up to the entire length of a target gene including coding or non-coding or both coding and non-coding portions of the target gene). Where a polynucleotide is double-stranded, its length can be similarly described in terms of base pairs.
(30) Polynucleotide compositions used in the various embodiments of this invention include compositions including: RNA or DNA or RNA/DNA hybrids or chemically modified polynucleotides or a mixture thereof. In certain embodiments, the polynucleotide may be a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In certain embodiments, the polynucleotide includes non-canonical nucleotides such as inosine, thiouridine, or pseudouridine. In certain embodiments, the polynucleotide includes chemically modified nucleotides. Examples of chemically modified polynucleotides are well known in the art; see, for example, U.S. Patent Publication 2011/0171287, U.S. Patent Publication 2011/0171176, U.S. Patent Publication 2011/0152353, U.S. Patent Publication 2011/0152346, and U.S. Patent Publication 2011/0160082, which are herein incorporated by reference. Illustrative examples include, but are not limited to, the naturally occurring phosphodiester backbone of a polynucleotide which can be partially or completely modified with phosphorothioate, phosphorodithioate, or methylphosphonate internucleotide linkage modifications, modified nucleoside bases or modified sugars can be used in polynucleotide synthesis, and polynucleotides can be labeled with a fluorescent moiety (e.g., fluorescein or rhodamine) or other label (e.g., biotin).
(31) Polynucleotides can be single- or double-stranded RNA, single- or double-stranded DNA, double-stranded DNA/RNA hybrids, and modified analogues thereof. In certain embodiments of the invention, the polynucleotides that provide single-stranded RNA in the plant cell may be: (a) a single-stranded RNA molecule (ssRNA), (b) a single-stranded RNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA molecule (dsRNA), (d) a single-stranded DNA molecule (ssDNA), (e) a single-stranded DNA molecule that self-hybridizes to form a double-stranded DNA molecule, (f) a single-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, and (i) a double-stranded, hybridized RNA/DNA molecule, or combinations thereof. In certain embodiments, these polynucleotides can comprise both ribonucleic acid residues and deoxyribonucleic acid residues. In certain embodiments, these polynucleotides include chemically modified nucleotides or non-canonical nucleotides. In certain embodiments of the methods, the polynucleotides include double-stranded DNA formed by intramolecular hybridization, double-stranded DNA formed by intermolecular hybridization, double-stranded RNA formed by intramolecular hybridization, or double-stranded RNA formed by intermolecular hybridization. In certain embodiments where the polynucleotide is a dsRNA, the anti-sense strand will comprise at least 18 nucleotides that are essentially complementary to the target gene. In certain embodiments the polynucleotides include single-stranded DNA or single-stranded RNA that self-hybridizes to form a hairpin structure having an at least partially double-stranded structure including at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. Not intending to be bound by any mechanism, it is believed that such polynucleotides are or will produce single-stranded RNA with at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. In certain embodiments, the polynucleotides can be operably linked to a promotergenerally a promoter functional in a plant, for example, a pol II promoter, a pol III promoter, a pol IV promoter, or a pol V promoter.
(32) The polynucleotide molecules of the present invention are designed to modulate expression by inducing regulation or suppression of an endogenous gene in a plant and are designed to have a nucleotide sequence essentially identical or essentially complementary to the nucleotide sequence of an endogenous gene of a plant or to the sequence of RNA transcribed from an endogenous gene of a plant, which can be coding sequence or non-coding sequence. These effective polynucleotide molecules that modulate expression are referred to herein as a trigger, or triggers. By essentially identical or essentially complementary it is meant that the trigger polynucleotides (or at least one strand of a double-stranded polynucleotide) have sufficient identity or complementarity to the endogenous gene or to the RNA transcribed from the endogenous gene (e.g. the transcript) to suppress expression of the endogenous gene (e.g., to effect a reduction in levels or activity of the gene transcript and/or encoded protein). Polynucleotides of the methods and compositions provided herein need not have 100 percent identity or complementarity to the endogenous gene or to the RNA transcribed from the endogenous gene (i.e. the transcript) to suppress expression of the endogenous gene (i.e. to effect a reduction in levels or activity of the gene transcript or encoded protein). Thus, in certain embodiments, the polynucleotide or a portion thereof is designed to be essentially identical to, or essentially complementary to, a sequence of at least 18 or 19 contiguous nucleotides in either the target gene or messenger RNA transcribed from the target gene (e.g. the transcript). In certain embodiments, an essentially identical polynucleotide has 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to the sequence of 18 or more contiguous nucleotides in either the endogenous target gene or to an RNA transcribed from the target gene (e.g. the transcript). In certain embodiments, an essentially complementary polynucleotide has 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to the sequence of 18 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene.
(33) In certain embodiments, polynucleotides used in the methods and compositions provided herein can be essentially identical or essentially complementary to any of: i) conserved regions of Mildew Resistance Locus O (MLO) genes of both monocot and dicot plants; ii) conserved regions of Mildew Resistance Locus O (MLO) genes of monocot plants; or iii) conserved regions of Mildew Resistance Locus O (MLO) genes of dicot plants. Such polynucleotides that are essentially identical or essentially complementary to such conserved regions can be used to improve fungal disease resistance and/or nematode disease resistance by suppressing expression of Mildew Resistance Locus O (MLO) genes in any of: i) both dicot and monocot plants, including, but not limited to, corn, barley, wheat, sorghum, rice, cucumber, pea, Medicago sp., soybean, pepper, tomato, and grape; ii) monocot plants, including, but not limited to, corn, barley, wheat, sorghum, and rice, and; or iii) dicot plants, including, but not limited to, cucumber, pea, Medicago sp., soybean, pepper, tomato, and grape.
(34) Polynucleotides containing mismatches to the target gene or transcript can thus be used in certain embodiments of the compositions and methods provided herein. In certain embodiments, a polynucleotide can comprise at least 19 contiguous nucleotides that are essentially identical or essentially complementary to said gene or said transcript or comprises at least 19 contiguous nucleotides that are essentially identical or essentially complementary to the target gene or target gene transcript. In certain embodiments, a polynucleotide of 19 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to RNA transcribed from the target gene (e.g. the transcript) can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 20 or more nucleotides that contains a contiguous 19 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 21 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to RNA transcribed from the target gene (e.g. the transcript) can have 1, 2, or 3 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 22 or more nucleotides that contains a contiguous 21 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1, 2, or 3 mismatches to the target gene or transcript. In designing polynucleotides with mismatches to an endogenous target gene or to an RNA transcribed from the target gene, mismatches of certain types and at certain positions that are more likely to be tolerated can be used. In certain embodiments, mismatches formed between adenine and cytosine or guanosine and uracil residues are used as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. In certain embodiments, mismatches in 19 base pair overlap regions can be at the low tolerance positions 5, 7, 8 or 11 (from the 5 end of a 19 nucleotide target) with well tolerated nucleotide mismatch residues, at medium tolerance positions 3, 4, and 12-17, and/or at the high tolerance nucleotide positions at either end of the region of complementarity (i.e. positions 1, 2, 18, and 19) as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. It is further anticipated that tolerated mismatches can be empirically determined in assays where the polynucleotide is applied to the plants via the methods provided herein and the treated plants assayed for suppression of Mildew Resistance Locus O (MLO) expression or appearance of fungal disease resistance and/or nematode resistance.
(35) In certain embodiments, polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to one allele or one family member of a given target gene coding or non-coding sequence of a MLO target gene. In other embodiments, the polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to multiple alleles or family members of a given Mildew Resistance Locus O (MLO) target gene. In certain embodiments, the polynucleotide can thus comprises at least 18 contiguous nucleotides that are identical or complementary to SEQ ID NO: 4, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, or 79. In certain embodiments, the polynucleotide comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, or 79.
(36) In certain embodiments, polynucleotide compositions and methods provided herein typically effect regulation or modulation (e.g., suppression) of gene expression during a period during the life of the treated plant of at least 1 week or longer and typically in systemic fashion. For instance, within days of treating a plant leaf with a polynucleotide composition of this invention, primary and transitive siRNAs can be detected in other leaves lateral to and above the treated leaf and in apical tissue. In certain embodiments, methods of systemically suppressing expression of a gene in a plant, the methods comprising treating said plant with a composition comprising at least one polynucleotide and a transfer agent, wherein said polynucleotide comprises at least 18 or at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a gene or a transcript encoding a Mildew Resistance Locus O (MLO) gene of the plant are provided, whereby expression of the gene in said plant or progeny thereof is systemically suppressed in comparison to a control plant that has not been treated with the composition.
(37) Compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple genes, or to multiple segments of one or more genes. In certain embodiments, compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes from one or more species.
(38) In certain embodiments, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in tandem fashion. In another embodiment, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in inverted repeat fashion (forming an at least partially self-complementary strand). The polynucleotide can include both tandem and inverted-repeat copies. Whether arranged in tandem or inverted repeat fashion, each copy can be directly contiguous to the next, or pairs of copies can be separated by an optional spacer of one or more nucleotides. The optional spacer can be unrelated sequence (i.e., not essentially identical to or essentially complementary to the copies, nor essentially identical to, or essentially complementary to, a sequence of 18 or more contiguous nucleotides of the endogenous target gene or RNA transcribed from the endogenous target gene). Alternatively the optional spacer can include sequence that is complementary to a segment of the endogenous target gene adjacent to the segment that is targeted by the copies. In certain embodiments, the polynucleotide includes two copies of a nucleotide sequence of between about 20 to about 30 nucleotides, where the two copies are separated by a spacer no longer than the length of the nucleotide sequence.
(39) Tiling
(40) Polynucleotide trigger molecules can be identified by tiling gene targets in random length fragments, e.g., 200-300 polynucleotides in length, with partially overlapping regions, e.g., 25 or so nucleotide overlapping regions along the length of the target gene. Multiple gene target sequences can be aligned and polynucleotide sequence regions with homology in common are identified as potential trigger molecules for multiple targets. Multiple target sequences can be aligned and sequence regions with poor homology are identified as potential trigger molecules for selectively distinguishing targets. To selectively suppress a single gene, trigger sequences may be chosen from regions that are unique to the target gene either from the transcribed region or the non-coding regions, e.g., promoter regions, 3 untranslated regions, introns and the like.
(41) Polynucleotides fragments are designed along the length of the full length coding and untranslated regions of a MLO gene or family member as contiguous overlapping fragments of 200-300 polynucleotides in length or fragment lengths representing a percentage of the target gene. These fragments are applied topically (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine the relative effectiveness in providing the yield/quality phenotype. Fragments providing the desired activity may be further subdivided into 50-60 polynucleotide fragments which are evaluated for providing the yield/quality phenotype. The 50-60 base fragments with the desired activity may then be further subdivided into 19-30 base fragments which are evaluated for providing the yield/quality phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or in combination in one or more pools to determine effective trigger composition or mixture of trigger polynucleotides for providing the yield/quality phenotype.
(42) Coding and/or non-coding sequences of gene families in the crop of interest are aligned and 200-300 polynucleotide fragments from the least homologous regions amongst the aligned sequences are evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in providing the yield/quality phenotype. The effective segments are further subdivided into 50-60 polynucleotide fragments, prioritized by least homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by least homology, and again evaluated for induction of the yield/quality phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or again evaluated in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the yield/quality phenotype.
(43) Coding and/or non-coding sequences of gene families in the crop of interest are aligned and 200-300 polynucleotide fragments from the most homologous regions amongst the aligned sequences are evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in inducing the yield/quality phenotype. The effective segments are subdivided into 50-60 polynucleotide fragments, prioritized by most homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by most homology, and again evaluated for induction of the yield/quality phenotype. Once relative effectiveness is determined, the fragments may be utilized singly, or in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the yield/quality phenotype.
(44) Also, provided herein are methods for identifying a preferred polynucleotide for improving fungal disease and/or nematode resistance in a plant. Populations of candidate polynucleotides that are essentially identical or essentially complementary to a MLO gene or transcript of the gene can be generated by a variety of approaches, including but not limited to, any of the tiling, least homology, or most homology approaches provided herein. Such populations of polynucleotides can also be generated or obtained from any of the polynucleotides or genes provided herewith in SEQ ID NO: 29, 31, 33, 35, 37, 39, 41, 42, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, or 79. Such populations of polynucleotides can also be generated or obtained from any genes that are orthologous to the genes provided herewith in SEQ ID NO: 29, 31, 33, 35, 37, 39, 41, 42, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, or 79. Such populations of polynucleotides can also be generated or obtained from any genes that encode proteins that are orthologous to a protein of Table 2 or 3 (SEQ ID NO:1-27, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, or 78). Such polynucleotides can be topically applied to a surface of plants in a composition comprising at least one polynucleotide from said population and a transfer agent to obtain treated plants. Treated plants that exhibit suppression of the MLO gene and/or exhibit an improvement fungal disease and/or nematode resistance are identified, thus identifying a preferred polynucleotide that improves improving fungal disease and/or nematode resistance in a plant. Suppression of the gene can be determined by any assay for the levels and/or activity of a gene product (i.e., transcript or protein). Suitable assays for transcripts include, but are not limited to, semi-quantitative or quantitative reverse transcriptase PCR (qRT-PCR) assays. Suitable assays for proteins include, but are not limited to, semi-quantitative or quantitative immunoassays, biochemical activity assays, or biological activity assays. In certain embodiments, the polynucleotides can be applied alone. In other embodiments, the polynucleotides can be applied in pools of multiple polynucleotides. When a pool of polynucleotides provides for suppression of the MLO gene and/or an improvement in fungal disease resistance and/or nematode disease resistance are identified, the pool can be de-replicated and retested as necessary or desired to identify one or more preferred polynucleotide(s) that improves fungal disease resistance and/or nematode disease resistance in a plant.
(45) Methods of making polynucleotides are well known in the art. Such methods of making polynucleotides can include in vivo biosynthesis, in vitro enzymatic synthesis, or chemical synthesis. In certain embodiments, RNA molecules can be made by either in vivo or in vitro synthesis from DNA templates where a suitable promoter is operably linked to the polynucleotide and a suitable DNA-dependent RNA polymerase is provided. DNA-dependent RNA polymerases include, but are not limited to, E. coli or other bacterial RNA polymerases as well as the bacteriophage RNA polymerases such as the T7, T3, and SP6 RNA polymerases. Commercial preparation of polynucleotides often provides two deoxyribonucleotides on the 3 end of the sense strand. Long polynucleotide molecules can be synthesized from commercially available kits, for example, kits from Applied Biosystems/Ambion (Austin, Tex.) have DNA ligated on the 5 end that encodes a bacteriophage T7 polymerase promoter that makes RNA strands that can be assembled into a dsRNA. Alternatively, dsRNA molecules can be produced from expression cassettes in bacterial cells that have regulated or deficient RNase III enzyme activity. Long polynucleotide molecules can also be assembled from multiple RNA or DNA fragments. In some embodiments design parameters such as Reynolds score (Reynolds et al. Nature Biotechnology 22, 326-330 (2004) and Tuschl rules (Pei and Tuschl, Nature Methods 3(9): 670-676, 2006) are known in the art and are used in selecting polynucleotide sequences effective in gene silencing. In some embodiments random design or empirical selection of polynucleotide sequences is used in selecting polynucleotide sequences effective in gene silencing. In some embodiments, the sequence of a polynucleotide is screened against the genomic DNA of the intended plant to minimize unintentional silencing of other genes.
(46) While there is no upper limit on the concentrations and dosages of polynucleotide molecules that can be useful in the methods and compositions provided herein, lower effective concentrations and dosages will generally be sought for efficiency. The concentrations can be adjusted in consideration of the volume of spray or treatment applied to plant leaves or other plant part surfaces, such as flower petals, stems, tubers, fruit, anthers, pollen, leaves, roots, or seeds. In one embodiment, a useful treatment for herbaceous plants using 25-mer polynucleotide molecules is about 1 nanomole (nmol) of polynucleotide molecules per plant, for example, from about 0.05 to 1 nmol polynucleotides per plant. Other embodiments for herbaceous plants include useful ranges of about 0.05 to about 100 nmol, or about 0.1 to about 20 nmol, or about 1 nmol to about 10 nmol of polynucleotides per plant. In certain embodiments, about 40 to about 50 nmol of a ssDNA polynucleotide are applied. In certain embodiments, about 0.5 nmol to about 2 nmol of a dsRNA is applied. In certain embodiments, a composition containing about 0.5 to about 2.0 mg/mL, or about 0.14 mg/mL of dsRNA or ssDNA (21-mer) is applied. In certain embodiments, a composition of about 0.5 to about 1.5 mg/mL of a long dsRNA polynucleotide (i.e., about 50 to about 200 or more nucleotides) is applied. In certain embodiments, about 1 nmol to about 5 nmol of a dsRNA is applied to a plant. In certain embodiments, the polynucleotide composition as topically applied to the plant contains the at least one polynucleotide at a concentration of about 0.01 to about 10 milligrams per milliliter, or about 0.05 to about 2 milligrams per milliliter, or about 0.1 to about 2 milligrams per milliliter. In certain embodiments, a composition of about 0.5 to about 1.5 mg/mL of a long dsRNA polynucleotide (i.e. about 50 to about 200 or more nucleotides) is applied. Very large plants, trees, or vines may require correspondingly larger amounts of polynucleotides. When using long dsRNA molecules that can be processed into multiple polynucleotides, lower concentrations can be used. To illustrate embodiments of the invention, the factor 1, when applied to polynucleotide molecules is arbitrarily used to denote a treatment of 0.8 nmol of polynucleotide molecule per plant; 10, 8 nmol of polynucleotide molecule per plant; and 100, 80 nmol of polynucleotide molecule per plant.
(47) The polynucleotide compositions of this invention are useful in compositions, such as liquids that comprise polynucleotide molecules, alone or in combination with other components either in the same liquid or in separately applied liquids that provide a transfer agent. As used herein, a transfer agent is an agent that, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enables the polynucleotide to enter a plant cell. In certain embodiments, a transfer agent is an agent that conditions the surface of plant tissue, e.g., seeds, leaves, stems, roots, flowers, or fruits, to permeation by the polynucleotide molecules into plant cells. The transfer of polynucleotides into plant cells can be facilitated by the prior or contemporaneous application of a polynucleotide-transferring agent to the plant tissue. In some embodiments the transferring agent is applied subsequent to the application of the polynucleotide composition. The polynucleotide transfer agent enables a pathway for polynucleotides through cuticle wax barriers, stomata and/or cell wall or membrane barriers into plant cells. Suitable transfer agents to facilitate transfer of the polynucleotide into a plant cell include agents that increase permeability of the exterior of the plant or that increase permeability of plant cells to polynucleotides. Such agents to facilitate transfer of the composition into a plant cell include a chemical agent, or a physical agent, or combinations thereof. Chemical agents for conditioning or transfer include (a) surfactants, (b) an organic solvent or an aqueous solution or aqueous mixtures of organic solvents, (c) oxidizing agents, (d) acids, (e) bases, (f) oils, (g) enzymes, or combinations thereof. Embodiments of the method can optionally include an incubation step, a neutralization step (e.g., to neutralize an acid, base, or oxidizing agent, or to inactivate an enzyme), a rinsing step, or combinations thereof. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include emulsions, reverse emulsions, liposomes, and other micellar-like compositions. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include counter-ions or other molecules that are known to associate with nucleic acid molecules, e.g., inorganic ammonium ions, alkyl ammonium ions, lithium ions, polyamines such as spermine, spermidine, or putrescine, and other cations. Organic solvents useful in conditioning a plant to permeation by polynucleotides include DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions). Naturally derived or synthetic oils with or without surfactants or emulsifiers can be used, e.g., plant-sourced oils, crop oils (such as those listed in the 9.sup.th Compendium of Herbicide Adjuvants, publicly available on the worldwide web (internet) at herbicide.adjuvants.com can be used, e.g., paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine. Transfer agents include, but are not limited to, organosilicone preparations.
(48) In certain embodiments, an organosilicone preparation that is commercially available as Silwet L-77 surfactant having CAS Number 27306-78-1 and EPA Number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, N.Y. can be used to prepare a polynucleotide composition. In certain embodiments where a Silwet L-77 organosilicone preparation is used as a pre-spray treatment of plant leaves or other plant surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.3 to about 1 percent by weight (wt percent) or about 0.5 to about 1%. by weight (wt percent) is used or provided.
(49) In certain embodiments, any of the commercially available organosilicone preparations provided in the following Table 1 can be used as transfer agents in a polynucleotide composition. In certain embodiments where an organosilicone preparation of Table 1 is used as a pre-spray treatment of plant leaves or other surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation of Table 1 in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.
(50) TABLE-US-00001 TABLE 1 Examples of organosilicone preparations Name CAS number Manufacturer.sup.1,2 BREAK-THRU S 321 na Evonik Industries AG BREAK-THRU S 200 67674-67-3 Evonik Industries AG BREAK-THRU OE 441 68937-55-3 Evonik Industries AG BREAK-THRU S 278 27306-78-1 Evonik Goldschmidt BREAK-THRU S 243 na Evonik Industries AG Silwet L-77 27306-78-1 Momentive Performance Materials Silwet HS 429 na Momentive Performance Materials Silwet HS 312 na Momentive Performance Materials BREAK-THRU S 233 134180-76-0 Evonik Industries AG Silwet HS 508 Momentive Performance Materials Silwet HS 604 Momentive Performance Materials .sup.1Evonik Industries AG, Essen, Germany .sup.2Momentive Performance Materials, Albany, New York
(51) Organosilicone preparations used in the methods and compositions provided herein can comprise one or more effective organosilicone compounds. As used herein, the phrase effective organosilicone compound is used to describe any organosilicone compound that is found in an organosilicone preparation that enables a polynucleotide to enter a plant cell. In certain embodiments, an effective organosilicone compound can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide mediated suppression of a target gene expression in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that can comprise: i) a trisiloxane head group that is covalently linked to, ii) an alkyl linker including, but not limited to, an n-propyl linker, that is covalently linked to, iii) a poly glycol chain, that is covalently linked to, iv) a terminal group. Trisiloxane head groups of such effective organosilicone compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers can include, but are not limited to, an n-propyl linker. Poly glycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Poly glycol chains can comprise a mixture that provides an average chain length n of about 7.5. In certain embodiments, the average chain length n can vary from about 5 to about 14. Terminal groups can include, but are not limited to, alkyl groups such as a methyl group. Effective organosilicone compounds are believed to include, but are not limited to, trisiloxane ethoxylate surfactants or polyalkylene oxide modified heptamethyl trisiloxane.
(52) ##STR00001##
(53) (Compound I: polyalkyleneoxide heptamethyltrisiloxane, average n=7.5).
(54) One organosilicone compound believed to be ineffective comprises the formula:
(55) ##STR00002##
(56) In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a trisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a heptamethyltrisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and one or more effective organosilicone compound in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.
(57) In certain embodiments, the polynucleotide compositions that comprise an organosilicone preparation can comprise a salt such as ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate. Ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate can be provided in the polynucleotide composition at a concentration of about 0.5% to about 5% (w/v). An ammonium chloride, tetrabutylphosphonium bromide, and/or ammonium sulfate concentration of about 1% to about 3%, or about 2% (w/v) can also be used in the polynucleotide compositions that comprise an organosilicone preparation. In certain embodiments, the polynucleotide compositions can comprise an ammonium salt at a concentration greater or equal to 300 millimolar. In certain embodiments, the polynucleotide compositions that comprise an organosilicone preparation can comprise ammonium sulfate at concentrations from about 80 to about 1200 mM or about 150 mM to about 600 mM.
(58) In certain embodiments, the polynucleotide compositions can also comprise a phosphate salt. Phosphate salts used in the compositions include, but are not limited to, calcium, magnesium, potassium, or sodium phosphate salts. In certain embodiments, the polynucleotide compositions can comprise a phosphate salt at a concentration of at least about 5 millimolar, at least about 10 millimolar, or at least about 20 millimolar. In certain embodiments, the polynucleotide compositions will comprise a phosphate salt in a range of about 1 mM to about 25 mM or in a range of about 5 mM to about 25 mM. In certain embodiments, the polynucleotide compositions can comprise sodium phosphate at a concentration of at least about 5 millimolar, at least about 10 millimolar, or at least about 20 millimolar. In certain embodiments, the polynucleotide compositions can comprise sodium phosphate at a concentration of about 5 millimolar, about 10 millimolar, or about 20 millimolar. In certain embodiments, the polynucleotide compositions will comprise a sodium phosphate salt in a range of about 10 mM to about 160 mM or in a range of about 20 mM to about 40 mM. In certain embodiments, the polynucleotide compositions can comprise a sodium phosphate buffer at a pH of about 6.8.
(59) In certain embodiments, other useful transfer agents or adjuvants to transfer agents that can be used in polynucleotide compositions provided herein include surfactants and/or effective molecules contained therein. Surfactants and/or effective molecules contained therein include, but are not limited to, sodium or lithium salts of fatty acids (such as tallow or tallowamines or phospholipids) and organosilicone surfactants. In certain embodiments, the polynucleotide compositions that comprise a transfer agent are formulated with counter-ions or other molecules that are known to associate with nucleic acid molecules. Illustrative examples include, but are not limited to, tetraalkyl ammonium ions, trialkyl ammonium ions, sulfonium ions, lithium ions, and polyamines such as spermine, spermidine, or putrescine. In certain embodiments, the polynucleotide compositions are formulated with a non-polynucleotide herbicide. Non-polynucleotide herbicidal molecules include, but are not limited to, glyphosate, auxin-like benzoic acid herbicides including dicamba, chloramben and TBA, glufosinate, auxin-like herbicides including phenoxy carboxylic acid herbicide, pyridine carboxylic acid herbicide, quinoline carboxylic acid herbicide, pyrimidine carboxylic acid herbicide, and benazolin-ethyl herbicide, sulfonylureas, imidazolinones, bromoxynil, delapon, cyclohezanedione, protoporphyrionogen oxidase inhibitors, and 4-hydroxyphenyl-pyruvate-dioxygenase inhibiting herbicides.
(60) In certain embodiments, the polynucleotides used in the compositions that are essentially identical or essentially complementary to the MLO target gene or transcript will comprise the predominant nucleic acid in the composition. Thus in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript will comprise at least about 50%, 75%, 95%, 98%, or 100% of the nucleic acids provided in the composition by either mass or molar concentration. However, in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, or about 30% to about 50% of the nucleic acids provided in the composition by either mass or molar concentration. Also provided are compositions where the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to 100%, about 10% to 100%, about 20% to about 100%, about 30% to about 50%, or about 50% to a 100% of the nucleic acids provided in the composition by either mass or molar concentration.
(61) Polynucleotides comprising ssDNA, dsDNA, ssRNA, dsRNA, or RNA/DNA hybrids that are essentially identical or complementary to certain plant target genes or transcripts and that can be used in compositions containing transfer agents that include, but are not limited to, organosilicone preparations, to suppress those target genes when topically applied to plants are disclosed in co-assigned U.S. patent application Ser. No. 13/042,856. Various polynucleotide herbicidal molecules, compositions comprising those polynucleotide herbicidal molecules and transfer agents that include, but are not limited to, organosilicone preparations, and methods whereby herbicidal effects are obtained by the topical application of such compositions to plants are also disclosed in co-assigned U.S. patent application Ser. No. 13/042,856, and those polynucleotide herbicidal molecules, compositions, and methods are incorporated herein by reference in their entireties. Genes encoding proteins that can provide tolerance to an herbicide and/or that are targets of a herbicide are collectively referred to herein as herbicide target genes. Herbicide target genes include, but are not limited to, a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), a glyphosate oxidoreductase (GOX), a glyphosate decarboxylase, a glyphosate-N-acetyl transferase (GAT), a dicamba monooxygenase, a phosphinothricin acetyltransferase, a 2,2-dichloropropionic acid dehalogenase, an acetohydroxyacid synthase, an acetolactate synthase, a haloarylnitrilase, an acetyl-coenzyme A carboxylase (ACCase), a dihydropteroate synthase, a phytoene desaturase (PDS), a protoporphyrin IX oxygenase (PPO), a hydroxyphenylpyruvate dioxygenase (HPPD), a para-aminobenzoate synthase, a glutamine synthase, a cellulose synthase, a beta tubulin, and a serine hydroxymethyltransferase gene. The effects of applying certain compositions comprising polynucleotides that are essentially identical or complementary to certain herbicide target genes and transfer agents on plants containing the herbicide target genes was shown to be potentiated or enhanced by subsequent application of an herbicide that targets the same gene as the polynucleotide in co-assigned U.S. patent application Ser. No. 13/042,856. For example, compositions comprising polynucleotides targeting the EPSPS herbicide target gene were potentiated by glyphosate in experiments disclosed in co-assigned U.S. patent application Ser. No. 13/042,856.
(62) In certain embodiments of the compositions and methods disclosed herein, the composition comprising a polynucleotide and a transfer agent can thus further comprise a second polynucleotide comprising at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a transcript to a protein that confers resistance to a herbicide. In certain embodiments, the second polynucleotide does not comprise a polynucleotide that is essentially identical or essentially complementary to a transcript encoding a protein of a target plant that confers resistance to said herbicidal molecule. Thus, in an exemplary and non-limiting embodiment, the second polynucleotide could be essentially identical or essentially complementary to a transcript encoding a protein that confers resistance to a herbicide in a weed (such as an EPSPS encoding transcript) but would not be essentially identical or essentially complementary to a transcript encoding a protein that confers resistance to that same herbicide in a crop plant.
(63) In certain embodiments, the polynucleotide compositions that comprise a transfer agent can comprise glycerin. Glycerin can be provided in the composition at a concentration of about 0.1% to about 1% (w/v or v/v). A glycerin concentration of about 0.4% to about 0.6%, or about 0.5% (w/v or v/v) can also be used in the polynucleotide compositions that comprise a transfer agent.
(64) In certain embodiments, the polynucleotide compositions that comprise a transfer agent can further comprise organic solvents. Such organic solvents include, but are not limited to, DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions).
(65) In certain embodiments, the polynucleotide compositions that comprise a transfer agent can further comprise naturally derived or synthetic oils with or without surfactants or emulsifiers. Such oils include, but are not limited to, plant-sourced oils, crop oils (such as those listed in the 9th Compendium of Herbicide Adjuvants, publicly available on line at www.herbicide.adjuvants.com), paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine.
(66) In aspects of the invention, methods include one or more applications of the composition comprising a polynucleotide and a transfer agent or one or more effective components contained therein. In certain embodiments of the methods, one or more applications of a transfer agent or one or more effective components contained therein can precede one or more applications of the composition comprising a polynucleotide and a transfer agent. In embodiments where a transfer agent and/or one or more effective molecules contained therein is used either by itself as a pre-treatment or as part of a composition that includes a polynucleotide, embodiments of the polynucleotide molecules are double-stranded RNA polynucleotides, single-stranded RNA polynucleotides, double-stranded DNA polynucleotides, single-stranded DNA polynucleotides, chemically modified RNA or DNA polynucleotides or mixtures thereof.
(67) Compositions and methods of the invention are useful for modulating or suppressing the expression of an endogenous Mildew Resistance Locus O (MLO) target gene or transgenic Mildew Resistance Locus O (MLO) target gene in a plant cell or plant. In certain embodiments of the methods and compositions provided herein, expression of MLO target genes can be suppressed completely, partially and/or transiently to result in an improvement in in fungal disease resistance and/or nematode resistance. In various embodiments, a Mildew Resistance Locus O (MLO) target gene includes coding (protein-coding or translatable) sequence, non-coding (non-translatable) sequence, or both coding and non-coding sequence. Compositions of the invention can include polynucleotides designed to target multiple Mildew Resistance Locus O (MLO) genes, or multiple segments of one or more Mildew Resistance Locus O (MLO) genes. The target gene can include multiple consecutive segments of a target Mildew Resistance Locus O (MLO) gene, multiple non-consecutive segments of a Mildew Resistance Locus O (MLO) target gene, multiple alleles of a target gene, or multiple Mildew Resistance Locus O (MLO) target genes from one or more species. Mildew Resistance Locus O (MLO) target genes include, but are not limited to, the endogenous Mildew Resistance Locus O (MLO) plant genes of SEQ ID NO: 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, or 79. Mildew Resistance Locus O (MLO) target genes include, but are not limited to, Mildew Resistance Locus O (MLO) plant genes that encode proteins that are orthologous to the proteins of SEQ ID NO: 1-28. Mildew Resistance Locus O (MLO) target genes include, but are not limited to, Mildew Resistance Locus O (MLO) plant genes that encode the proteins of SEQ ID NO: 1-28.
(68) Target genes and plants containing those target genes can be obtained from: i) row crop plants including, but are not limited to, corn, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, potato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e.g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i.e., a plant not grown from a seed) include fruit trees and plants that include, but are not limited to, citrus, apples, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants. Such row crop, vegetable, culinary, fruit, tree, or ornamental plants exhibiting improvements in fungal disease resistance and/or nematode resistance that result from suppressing Mildew Resistance Locus O (MLO) gene expression are provided herein. Such row crop, vegetable, culinary, fruit, tree, or ornamental plant parts or processed plant products exhibiting improvements in fungal disease resistance and/or nematode resistance that result from suppressing Mildew Resistance Locus O (MLO) gene expression are also provided herein. Such plant parts can include, but are not limited to, flowers, stems, tubers, fruit, anthers, meristems, ovules, pollen, leaves, or seeds. Such processed plant products obtained from the plant parts can include, but are not limited to, a meal, a pulp, a feed, or a food product.
(69) An aspect of the invention provides a method for modulating or suppressing expression of an Mildew Resistance Locus O (MLO) gene in a plant including (a) conditioning of a plant to permeation by polynucleotides and (b) treatment of the plant with the polynucleotide molecules, wherein the polynucleotide molecules include at least one segment of 18 or more contiguous nucleotides cloned from or otherwise identified from the Mildew Resistance Locus O (MLO) target gene in either anti-sense or sense orientation, whereby the polynucleotide molecules permeate the interior of the plant and induce modulation of the target gene. The conditioning and polynucleotide application can be performed separately or in a single step. When the conditioning and polynucleotide application are performed in separate steps, the conditioning can precede or can follow the polynucleotide application within minutes, hours, or days. In some embodiments more than one conditioning step or more than one polynucleotide molecule application can be performed on the same plant. In embodiments of the method, the segment can be cloned or identified from (a) coding (protein-encoding), (b) non-coding (promoter and other gene related molecules), or (c) both coding and non-coding parts of the Mildew Resistance Locus O (MLO) target gene. Non-coding parts include DNA, such as promoter regions or the RNA transcribed by the DNA that provide RNA regulatory molecules, including but not limited to: introns, 5 or 3 untranslated regions, and microRNAs (miRNA), trans-acting siRNAs, natural anti-sense siRNAs, and other small RNAs with regulatory function or RNAs having structural or enzymatic function including but not limited to: ribozymes, ribosomal RNAs, t-RNAs, aptamers, and riboswitches. In certain embodiments where the polynucleotide used in the composition comprises a promoter sequence essentially identical to, or essentially complementary to, at least 18 contiguous nucleotides of the promoter of the endogenous target gene, the promoter sequence of the polynucleotide is not operably linked to another sequence that is transcribed from the promoter sequence.
(70) Compositions comprising a polynucleotide and a transfer agent provided herein can be topically applied to a plant or plant part by any convenient method, e.g., spraying or coating with a powder, or with a liquid composition comprising any of an emulsion, suspension, or solution. Such topically applied sprays or coatings can be of either all or of any a portion of the surface of the plant or plant part. Similarly, compositions that comprise a transfer agent or other pre-treatment can in certain embodiments be applied to the plant or plant part by any convenient method, e.g., spraying or wiping a solution, emulsion, or suspension. Compositions comprising a polynucleotide and a transfer agent provided herein can be topically applied to plant parts that include, but are not limited to, flowers, stems, tubers, meristems, ovules, fruit, anthers, pollen, leaves, or seeds.
(71) Application of compositions comprising a polynucleotide and a transfer agent to seeds is specifically provided herein. Seeds can be contacted with such compositions by spraying, misting, immersion, and the like.
(72) In certain embodiments, application of compositions comprising a polynucleotide and a transfer agent to plants, plant parts, or seeds in particular can provide for an improvement in fungal disease resistance and/or nematode resistance in progeny plants, plant parts, or seeds derived from those treated plants, plant parts, or seeds. In certain embodiments, progeny plants, plant parts, or seeds derived from those treated plants, plant parts, or seeds will exhibit an improvement in fungal disease resistance and/or nematode resistance that result from suppressing expression of an MLO gene. In certain embodiments, the methods and compositions provided herein can provide for an improvement in fungal disease resistance and/or nematode resistance in progeny plants or seeds as a result of epigenetically inherited suppression of MLO expression. In certain embodiments, such progeny plants exhibit an improvement in fungal disease resistance and/or nematode resistance from epigenetically inherited suppression of MLO gene expression that is not caused by a transgene where the polynucleotide is operably linked to a promoter, a viral vector, or a copy of the polynucleotide that is integrated into a non-native location in the chromosomal DNA of the plant. Without seeking to be limited by theory, progeny plants or seeds derived from those treated plants, plant parts, or seeds can exhibit an improvement in an improvement in fungal disease resistance and/or nematode resistance through an epigenetic mechanism that provides for propagation of an epigenetic condition where suppression of MLO gene expression occurs in the progeny plants, plant parts, or plant seeds. In certain embodiments, progeny plants or seeds exhibiting an improvement in fungal disease resistance and/or nematode resistance as a result of epigenetically inherited suppression of MLO gene expression can also exhibit increased methylation, and in particular, increased methylation of cytosine residues, in the endogenous MLO gene of the plant. Plant parts, including seeds, of the progeny plants that exhibit an improvement in an improvement in fungal disease resistance and/or nematode resistance as a result of epigenetically inherited suppression of MLO gene expression, can also in certain embodiments exhibit increased methylation, and in particular, increased methylation of cytosine residues, in the endogenous MLO gene. In certain embodiments, DNA methylation levels in DNA encoding the endogenous MLO gene can be compared in plants that exhibit an improvement in fungal disease resistance and/or nematode resistance and control plants that do not exhibit an improvement in fungal disease resistance and/or nematode resistance to correlate the presence of the an improvement in fungal disease resistance and/or nematode resistance to epigenetically inherited suppression of MLO gene expression and to identify plants that comprise the epigenetically inherited improvement in fungal disease resistance and/or nematode resistance.
(73) Various methods of spraying compositions on plants or plant parts can be used to topically apply to a plant surface a composition comprising a polynucleotide that comprises a transfer agent. In the field, a composition can be applied with a boom that extends over the crops and delivers the composition to the surface of the plants or with a boomless sprayer that distributes a composition across a wide area. Agricultural sprayers adapted for directional, broadcast, or banded spraying can also be used in certain embodiments. Sprayers adapted for spraying particular parts of plants including, but not limited to, leaves, the undersides of leaves, flowers, stems, male reproductive organs such as tassels, meristems, pollen, ovules, and the like can also be used. Compositions can also be delivered aerially, such as by a crop dusting airplane. In certain embodiments, the spray can be delivered with a pressurized backpack sprayer calibrated to deliver the appropriate rate of the composition. In certain embodiments, such a backpack sprayer is a carbon dioxide pressurized sprayer with a 11015 flat fan or equivalent spray nozzle with a customized single nozzle assembly (to minimize waste) at a spray pressure of about 0.25 MPa and/or any single nozzle sprayer providing an effective spray swath of 60 cm above the canopy of 3 to 12 inch tall growing plants can be used. Plants in a greenhouse or growth chamber can be treated using a track sprayer or laboratory sprayer with a 11001XR or equivalent spray nozzle to deliver the sample solution at a determined rate. An exemplary and non-limiting rate is about 140 L/ha at about 0.25 MPa pressure.
(74) In certain embodiments, it is also contemplated that a plant part can be sprayed with the composition comprising a polynucleotide that comprises a transfer agent. Such plant parts can be sprayed either pre- or post-harvest to provide for an improvement in fungal disease resistance and/or nematode resistance in the plant part that results from suppression of MLO gene expression. Compositions can be topically applied to plant parts attached to a plant by a spray as previously described. Compositions can be topically applied to plant parts that are detached from a plant by a spray as previously described or by an alternative method. Alternative methods for applying compositions to detached parts include, but are not limited to, passing the plant parts through a spray by a conveyor belt or trough, or immersing the plant parts in the composition.
(75) Compositions comprising polynucleotides and transfer agents can be applied to plants or plant parts at one or more developmental stages as desired and/or as needed. Application of compositions to pre-germination seeds and/or to post-germination seedlings is provided in certain embodiments. Seeds can be treated with polynucleotide compositions provided herein by methods including, but not limited to, spraying, immersion, or any process that provides for coating, imbibition, and/or uptake of the polynucleotide composition by the seed. Seeds can be treated with polynucleotide compositions using seed batch treatment systems or continuous flow treatment systems. Seed coating systems are at least described in U.S. Pat. Nos. 6,582,516, 5,891,246, 4,079,696, and 4,023,525. Seed treatment can also be effected in laboratory or commercial scale treatment equipment such as a tumbler, a mixer, or a pan granulator. A polynucleotide composition used to treat seeds can contain one or more other desirable components including, but not limited to liquid diluents, binders to serve as a matrix for the polynucleotide, fillers for protecting the seeds during stress conditions, and plasticizers to improve flexibility, adhesion and/or spreadability of the coating. In addition, for oily polynucleotide compositions containing little or no filler, drying agents such as calcium carbonate, kaolin or bentonite clay, perlite, diatomaceous earth or any other adsorbent material can be added. Use of such components in seed treatments is described in U.S. Pat. No. 5,876,739. Additional ingredients can be incorporated into the polynucleotide compositions used in seed treatments. Such ingredients include but are not limited to: conventional sticking agents, dispersing agents such as methylcellulose (Methocel A15LV or Methocel A15C, for example, serve as combined dispersant/sticking agents for use in seed treatments), polyvinyl alcohol (e.g., Elvanol 51-05), lecithin (e.g., Yelkinol P), polymeric dispersants (e.g., polyvinylpyrrolidone/vinyl acetate PVPNA S-630), thickeners (e.g., clay thickeners such as Van Gel B to improve viscosity and reduce settling of particle suspensions), emulsion stabilizers, surfactants, antifreeze compounds (e.g., urea), dyes, colorants, and the like that can be combined with compositions comprising a polynucleotide and a transfer agent. Further ingredients used in compositions that can be applied to seeds can be found in McCutcheon's, vol. 1, Emulsifiers and Detergents, MC Publishing Company, Glen Rock, N.J., U.S.A., 1996 and in McCutcheon's, vol. 2, Functional Materials, MC Publishing Company, Glen Rock, N.J., U.S.A., 1996. Methods of applying compositions to seeds and pesticidal compositions that can be used to treat seeds are described in US Patent Application publication 20080092256, which is incorporated herein by reference in its entirety.
(76) Application of the compositions in early, mid-, and late vegetative stages of plant development is provided in certain embodiments. Application of the compositions in early, mid- and late reproductive stages is also provided in certain embodiments. Application of the compositions to plant parts at different stages of maturation is also provided.
(77) The following examples are included to demonstrate examples of certain preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches the inventors have found function well in the practice of the invention, and thus can be considered to constitute examples of preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLES
Example 1. Polynucleotides of the Invention Related to the MLO Target Gene Sequences
(78) The amino acid sequences of proteins encoded by targeted MLO genes and transcripts are provided in Table 2 with reference to SEQ ID NOs. 1-27 of the sequence listing. Such protein sequences can be used to identify orthologous MLO genes and transcripts from other plants not provided herewith. Such orthologous genes and their transcripts can then serve as targets of polynucleotides provided herein or as a source of polynucleotides that are specifically designed to target the orthologous genes or transcripts.
(79) The target MLO polynucleotide molecule at least occurs in the genome of plants provided in Table 2. The MLO genes provided in Table 3, or their corresponding transcripts, can be used as targets of polynucleotide compositions comprising a polynucleotide of at least 18 contiguous nucleotides that are essentially identical or essentially complementary to those genes or transcripts. The proteins and genes respectively provided in Tables 2 and 3, or sequences contained within those proteins or genes can also be used to identify orthologous MLO genes from plants not listed in Tables 2 and 3. Such orthologous genes and their transcripts can then serve as targets of polynucleotides provided herein or as a source of polynucleotides that are specifically designed to target the orthologous genes or transcripts.
(80) TABLE-US-00002 TABLE 2 Target MLO gene protein sequences SEQ ID NO: 1 Hordeum vulgare 1 MLO-like protein from barley SEQ ID NO: 2 Sorghum bicolor 2 MLO-like protein from sorghum SEQ ID NO: 3 Zea mays 3 MLO-like protein from corn SEQ ID NO: 4 Gossypium hirsutum MLO-like protein from cotton SEQ ID NO: 5 Glycine max 3 MLO-like protein from soybeans SEQ ID NO: 6 Glycine max 4 MLO-like protein from soybeans SEQ ID NO: 7 Cucumis sativus 2 MLO-like protein from cucumber SEQ ID NO: 8 Cucumis sativus 4 MLO-like protein from cucumber SEQ ID NO: 9 Cucumis sativus 5 MLO-like protein from cucumber SEQ ID NO: 10 Cucumis sativus 6 MLO-like protein from cucumber SEQ ID NO: 11 Vitis vinifera 1 MLO-like protein from grape SEQ ID NO: 12 Vitis vinifera 7 MLO-like protein from grape SEQ ID NO: 13 Arabidopsis thaliana 3 MLO-like protein from Arabidopsis SEQ ID NO: 14 Arabidopsis thaliana 9 MLO-like protein from Arabidopsis SEQ ID NO: 15 Arabidopsis thaliana 4 MLO-like protein from Arabidopsis SEQ ID NO: 16 Arabidopsis thaliana 8 MLO-like protein from Arabidopsis SEQ ID NO: 17 Arabidopsis thaliana 7 MLO-like protein from Arabidopsis SEQ ID NO: 18 Arabidopsis thaliana 2 MLO-like protein from Arabidopsis SEQ ID NO: 19 Arabidopsis thaliana 10 MLO-like protein from Arabidopsis SEQ ID NO: 20 Arabidopsis thaliana 11 MLO-like protein from Arabidopsis SEQ ID NO: 21 Arabidopsis thaliana 6 MLO-like protein from Arabidopsis SEQ ID NO: 22 Arabidopsis thaliana 13 MLO-like protein from Arabidopsis SEQ ID NO: 23 Arabidopsis thaliana 14 MLO-like protein from Arabidopsis SEQ ID NO: 24 Arabidopsis thaliana 12 MLO-like protein from Arabidopsis SEQ ID NO: 25 Arabidopsis thaliana 1 MLO-like protein from Arabidopsis SEQ ID NO: 26 Arabidopsis thaliana 15 MLO-like protein from Arabidopsis SEQ ID NO: 27 Arabidopsis thaliana 5 MLO-like protein from Arabidopsis
(81) TABLE-US-00003 TABLE 3 Target gene sequences SEQ ID NO: 28 Hordeum vulgare MLO protein from barley SEQ ID NO: 29 Hordeum vulgare MLO cDNA from barley SEQ ID NO: 30 Cucumis sativus 1 MLO-like protein from cucumber SEQ ID NO: 31 Cucumis sativus 1 MLO-like cDNA from cucumber SEQ ID NO: 32 Cucumis sativus 3 MLO-like protein from cucumber SEQ ID NO: 33 Cucumis sativus 3 MLO-like cDNA from cucumber SEQ ID NO: 34 Cucumis sativus 7 MLO-like protein from cucumber SEQ ID NO: 35 Cucumis sativus 7 MLO-like cDNA from cucumber SEQ ID NO: 36 Cucumis sativus 8 MLO-like protein from cucumber SEQ ID NO: 37 Cucumis sativus 8 MLO-like cDNA from cucumber SEQ ID NO: 38 Lactuca sativa MLO-like protein from lettuce SEQ ID NO: 39 Lactuca sativa MLO-like cDNA from lettuce SEQ ID NO: 40 Pisum sativum 1 MLO-like protein from pea SEQ ID NO: 41 Pisum sativum 1 MLO-like cDNA from pea SEQ ID NO: 42 Medicago truncatula MLO-like protein from barrel clover SEQ ID NO: 43 Medicago truncatula MLO-like cDNA from barrel clover SEQ ID NO: 44 Glycine max 1 MLO-like protein from soybean SEQ ID NO: 45 Glycine max 1 MLO-like cDNA from soybean SEQ ID NO: 46 Glycine max 2 MLO-like protein from soybean SEQ ID NO: 47 Glycine max 2 MLO-like cDNA from soybean SEQ ID NO: 48 Capsicum annuum MLO-like protein from pepper SEQ ID NO: 49 Capsicum annuum MLO-like cDNA from pepper SEQ ID NO: 50 Solanum lycopersicum 1 MLO-like protein from tomato SEQ ID NO: 51 Solanum lycopersicum 1 MLO-like cDNA from tomatos SEQ ID NO: 52 Solanum lycopersicum 2 MLO-like protein from tomato SEQ ID NO: 53 Solanum lycopersicum 2 MLO-like cDNA from tomato SEQ ID NO: 54 Triticum aestivum MLO-like protein from wheat SEQ ID NO: 55 Triticum aestivum MLO-like cDNA from wheat SEQ ID NO: 56 Triticum aestivum 1 MLO-like protein from wheat SEQ ID NO: 57 Triticum aestivum 1 MLO-like cDNA from wheat SEQ ID NO: 58 Triticum aestivum 2 MLO-like protein from wheat SEQ ID NO: 59 Triticum aestivum 2 MLO-like cDNA from wheat SEQ ID NO: 60 Vitis vinifera 17 MLO-like protein from grape SEQ ID NO: 61 Vitis vinifera 17 MLO-like cDNA from grape SEQ ID NO: 62 Vitis vinifera 13 MLO-like protein from grape SEQ ID NO: 63 Vitis vinifera 13 MLO-like cDNA from grape SEQ ID NO: 64 Vitis vinifera 6 MLO-like protein from grape SEQ ID NO: 65 Vitis vinifera 6 MLO-like cDNA from grape SEQ ID NO: 66 Vitis vinifera 3 MLO-like protein from grape SEQ ID NO: 67 Vitis vinifera 3 MLO-like cDNA from grape SEQ ID NO: 68 Zea mays 1 MLO-like protein from corn SEQ ID NO: 69 Zea mays 1 MLO-like cDNA from corn SEQ ID NO: 70 Sorghum bicolor 1 MLO-like protein from sorghum SEQ ID NO: 71 Sorghum bicolor 1 MLO-like cDNA from sorghum SEQ ID NO: 72 Oryza sativa japonica 1 MLO-like protein from rice SEQ ID NO: 73 Oryza sativa japonica 1 MLO-like cDNA from rice SEQ ID NO: 74 Oryza sativa japonica 2 MLO-like protein from rice SEQ ID NO: 75 Oryza sativa japonica 2 MLO-like cDNA from rice SEQ ID NO: 76 Oryza sativa japonica 3 MLO-like protein from rice SEQ ID NO: 77 Oryza sativa japonica 3 MLO-like cDNA from rice SEQ ID NO: 78 Oryza sativa indica MLO-like protein from rice SEQ ID NO: 79 Oryza sativa indica MLO-like cDNA from rice
(82) The sequence listing contains the target MLO DNA sequences from the indicated plant species of Table 3. For each gene having a DNA sequence provided in the sequence listing and listed in Table 3, polynucleotides such as single stranded or double stranded DNA or RNA fragments in sense and/or antisense orientation will be mixed with an organosilicone preparation. These compositions will be topically applied to plants to effect expression of the target genes in the specified plant to obtain the plants that exhibit disease resistance. In particular, plants that are resistant to powdery mildew, downy mildew, and/or rust infection and/or nematodes will be obtained through the application of such compositions.
Example 2. Identification of Orthologous MLO Genes
(83) A bootstrapped phylogenetic tree is provided in
(84) The sequences disclosed in SEQ ID NO: 1 through 79, along with the phylogentic method for functional assignment described above, can be used to efficiently identify and clone MLO homologs useful for the control of pathogens causing powdery mildews, downy mildews or rusts, from other plant species not explicitly described herein.
Example 3. Polynucleotides that can be Used to Reduce MLO Expression in Various Plants
(85) Examples of polynucleotides that can be used to reduce expression of MLO genes in various plants is provided herewith as SEQ ID NOS: 80-195. The SEQ ID NOS: 80-195 describe sense/antisense double stranded RNA targeted to the coding regions of Mildew Resistance Locus O (MLO) sequences from a variety of dicot and monocot plants and are useful for downregulating MLO expression using methods described herein. Other regions of MLO genes can also be targeted to modify expression including coding regions and/or promoter regions. Polynucleotides that can be used to reduce MLO expression include sense/antisense dsRNA, antisense RNA, sense or antisense ssDNA as well as sense/antisense double stranded DNA. For example, a polynucleotide that comprises at least 18 contiguous nucleotides that are essentially identical or essentially complementary to SEQ ID NO: 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, or 79 can be used to downregulate expression of those MLO genes.
Example 4. Topical Polynucleotide Application and Powdery Mildew Testing Methods
(86) Barley seeds are planted in 2 inch pots in the greenhouse. Five days later, barley seedlings are sprayed with polynucleotides such as ssDNA and/or dsRNA polynucleotides directed to the promoter and/or the coding region of a target gene of interest. For example, polynucleotides directed to MLO include polynucleotides that comprise at least 18 contiguous nucleotides that are essentially identical or complementary to SEQ ID NO:28 or 29. Other examples of polynucleotides that target MLO for down regulation include polynucleotides of SEQ ID NO:80 to 83. A nucleotide solution of 6-20 nm of each ssDNA or 0.5-4 nm dsRNA, 0.1 to 0.3% L77 silwet, 50 mM NaPO.sub.4 in a final volume of 40 microliters of water is applied. Two to 4 days post spraying, seedlings will be infected with dry spores of barley powdery mildew (Blumeria graminis f. sp. hordei) and 7 days post infection, disease development is determined by scoring for the percentage of leaf area covered with powdery mildew.
(87) Cucumber seeds are planted in 3-inch square pots and thinned to one plant per pot after emergence. When the first true leaf is fully expanded and the second leaf is opening, a polynucleotide solution, such as ssDNA and/or dsRNA polynucleotides directed to the promoter and/or the coding region of a target gene of interest, is applied to the first true leaf or the cotyledons. For example, polynucleotides directed to MLO include polynucleotides that comprise at least 18 contiguous nucleotides that are essentially identical or complementary to SEQ ID NO:38 or 39. Examples of polynucleotides also include polynucleotides of SEQ ID NO:100 to 103. A nucleotide solution of 6-20 nm of each ssDNA or 0.5-4 nm dsRNA, 0.1 to 0.3% L77 Silwet, 50 mM NaPO.sub.4 in a final volume of 40 microliters of water is applied. Two days later the entire cucumber plant is inoculated with a shower of dry spores of cucumber powdery mildew (Sphaerotheca fuliginea) shaken off diseased plants. Disease severity will be evaluated on the treated leaf and succeeding leaves 10 days later and at subsequent intervals.
(88) Tomato seeds are planted in a 3-inch square pots and thinned to one plant per pot after emergence. Two weeks old tomato seedlings are treated with 6-20 nm of each ssDNA or 0.5-4 nm dsRNA, 0.2-0.5% L77 silwet, 50 mM NaPO.sub.4, 1% ammonium sulfate in a final volume of 30 microliters of water. For example, polynucleotides directed to MLO include polynucleotides that comprise at least 18 contiguous nucleotides that are essentially identical or complementary to SEQ ID NO:50, 51, 52, or 53. Examples of polynucleotides also include polynucleotides of SEQ ID NO:126 to 131. Two to 4 days post spraying plants are inoculated with dry spores of tomato powdery mildew (Oidium neolycopersici) and 13 days post infection, disease development is scored for the percentage of leaf area covered with powdery mildew.
Example 5. Protection of Barley from Powdery Mildew by Topical Polynucleotide Application
(89) Barley seeds were planted in 2 inch pots in the greenhouse. Five days later, barley seedlings were sprayed with the indicated polynucleotides or a control formulation according to either the Treatment 1 or Treatment 2 methods of Tables 4 and 5, respectively. The liquids applied to the plants are provided in Table 6 and the description of nucleic acid sequences of the ssDNA polynucleotides used is provided in Table 7. Post spraying, the seedlings were infected with dry spores of barley powdery mildew (Blumeria graminis f sp. hordei) and 7 days post infection, disease development was scored for the percentage of leaf area covered with powdery mildew. The average leaf length was also scored. Results of this analysis are shown in
(90) TABLE-US-00004 TABLE 4 Treatment 1 Treatment 1 5 mM NaPO4 0.3% Silwet 2 5 ul/leaf Disease infection 3 days later
(91) TABLE-US-00005 TABLE 5 Treatment 2 Treatment 2 5 mM NaPO4 1% AMS 0.2% Silwet 2 7.5 ul/leaf Disease infection 2 day later
(92) TABLE-US-00006 TABLE 6 Liquids Tested Liquid trigger type nucleotide ID # conc silwet Treatment # S Formulation 0.30% first leaf Treatment 1 C DNA GFP GFP_as 1 12 nmol 0.30% first leaf Treatment 1 1 DNA mlo T4213as, T4214as, T4215as 3 12 nmol 0.30% first leaf Treatment 1 2 DNA mlo T4216as, T4217as, T4218as 3 12 nmol 0.30% first leaf Treatment 1 3 DNA mlo T4211as, T4219as, T4220as 3 36 nmol 0.20% first leaf Treatment 2 4 DNA mlo T4212as, T4214as, T4222as 3 36 nmol 0.20% first leaf Treatment 2 5 Formulation 0.20% first leaf Treatment 2 6 DNA GFP GFP_as 1 36 nmol 0.20% first leaf Treatment 2
(93) TABLE-US-00007 TABLE7 Polynucleotidesused Target Plant and SEQ Gene Type Name Sequence ID Length Target barley antisense T4211_AS GGGGTGCTGGAGAGGCCCAGGTGG 184 24 ORF MLO DNA barley antisense T4212_AS CGACGTCTGGTGCGTGAACCGGA 185 23 ORF MLO DNA barley antisense T4213_AS CTGGTATTCCAAGGAGGTGGTCT 186 23 ORF MLO DNA barley antisense T4214_AS GATGAGGAGCAGGGATATGAAGC 187 23 ORF MLO DNA barley antisense T4215_AS ATGAGCTCCGCCTTCATCTTCTC 188 23 ORF MLO DNA barley antisense T4216_AS GGCCTTCTTGTGCCGGTGCTGGA 189 23 ORF MLO DNA barley antisense T4217_AS CTGTCCACACAAAATGCGCCATC 190 23 ORF MLO DNA barley antisense T4218_AS GTTCTGGAACAACGTCAGGTGT 191 22 ORF MLO DNA barley antisense T4219_AS GTCGGGGCGGTGGAACCAGAAG 192 22 ORF MLO DNA barley antisense T4220_AS AAAAATCTGCACTGGGGATGT 193 21 ORF MLO DNA barley antisense T4221_AS GATTTAGTCTGTGCACCGGGTGCG 194 24 ORF MLO DNA barley antisense T4222_AS AACCGGGTACATGTCCCTAGCCTC 195 24 ORF MLO DNA
(94)
Example 6. Protection of Barley from Powdery Mildew by Topical Polynucleotide Application
(95) Barley seeds were planted in 2 inch pots in the greenhouse. Five days later, barley seedlings were sprayed with the indicated polynucleotides or a control formulation according to either the Treatment 1 or Treatment 2 methods of Tables 8 and 9, respectively. The liquids applied to the plants are provided in Table 10 and the description of nucleic acid sequences of the ssDNA polynucleotides used is provided in Table 7. Post spraying, the seedlings were infected with dry spores of barley powdery mildew (Blumeria graminis f sp. hordei) and 7 days post infection, disease development was scored for the percentage of leaf area covered with powdery mildew. The average leaf length was also scored. Results of this analysis are shown in Table 11.
(96) TABLE-US-00008 TABLE 8 Treatment 1 Treatment 1 5 mM NaPO4 1% AMS 0.25% Silwet 2 5 ul Disease infection 2 days later
(97) TABLE-US-00009 TABLE 9 Treatment 2 Treatment 2 5 mM NaPO4 1% AMS 0.25% Silwet 2 6 ul Disease infection 1 day later
(98) TABLE-US-00010 TABLE 10 Liquids Tested Concentration trigger of Liquid type polynucleotide ID # polynucleotides Treatment # 0 0 Treatment 1 7 DNA GFP GFP_as 40 nmol Treatment 1 8 DNA GFP GFP_as 80 nmol Treatment 1 9 DNA mlo, T4211as, 13, 15, 22 4 10 nmol Treatment 1 antisense 10 DNA mlo, T4212as, T4219as, 4 20 nmol Treatment 1 antisense T4220as, T4221as 11 DNA GFP GFP_as 48 nmol Treatment 2 12 DNA GFP GFP_as 96 nmol Treatment 2 13 DNA mlo, T4211as, T4215as, 4 12 nmol Treatment 2 antisense T4216as, T4218as 14 DNA mlo, T4219as, T4220as, 4 24 nmol Treatment 2 antisense T4221as, T4222as 15 0 Treatment 2
(99) Table 11 shows that the percentage disease area was significantly decreased in plants treated with Silwet formulations containing the barley MLO antisense DNA polynucleotides relative to both the non-treated control or the Silwet formulation combined with a control GFP (Green Fluorescent Protein) polynucleotide.
(100) TABLE-US-00011 TABLE 11 Percentage of disease area trigger Liquid type R1 R2 R3 R4 R5 R6 avr stdev NT NT 10 25 10 5 13 8.7 15 Blank 25 5 5 5 10 10 11 DNA 5 5 10 5 1 10 6 3.5 GFP 12 DNA 5 1 1 5 5 3.4 2.2 GFP 13 DNA 1 1 1 1 1 5 1.7 1.6 MLO 14 DNA 1 1 1 5 1 1.8 1.8 MLO 7 DNA 25 10 10 10 10 10 12.5 7.1 GFP 8 DNA 10 5 5 5 10 5 3.5 GFP 9 DNA 5 1 1 5 1 2.6 2.1 MLO 10 DNA 5 5 5 5 1 4.1 1.7 MLO R1-R6 are replicates 1 through 6.
Example 7. Topical Polynucleotide Application and Nematode Testing Methods
(101) Application of Polynucleotides to Leaves for Nematode Control
(102) Ten day old cucumber plants grown in sand are spotted with nucleotides, either ssDNA and/or dsRNA polynucleotides, directed to the promoter and/or the coding region of a target gene of interest. A nucleotide solution of 6-20 nm of each ssDNA or 0.5-1 nm dsRNA, 0.1% L77 silwet, 50 mM NaPO4 in a final volume of 40 uL water is applied. Two cotyledon or leaves are spotted with 20 uL of the nucleotide solution for a total of 40 uL per plant. After 6-24 hours, 1000 vermiform eggs or 1000 J2 Meloidogyne incognita (RKN) are inoculated into each pot. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours. After the 24 hour restricted watering, normal sub-irrigation watering is done for the duration of the test. Cucumber plants are harvested approximately 14 days after inoculation by washing sand off the roots. A root gall rating and visual phytotoxicity rating is assigned using the following scales: Gall rating scale (Gall: % root mass galled): 0=0-5%; 1=6-20%; 2=21-50%; and 3=51-100%. Visual phytotoxicity scale is also assigned (Vis. tox; visual reduction in root mass compared to the control): rs1=mild stunting; rs2=moderate stunting; rs3=severe stunting.
(103) Experiments in soybeans using soy cyst nematodes (SCN) are similar to the cucumber RKN assay except for the following changes. Soybean seeds are planted in 100% sand in two inch square plastic pots. The polynucleotide solution is applied when the soybeans show the first trifoliate beginning to emerge, about 10 to 12 days after planting. At least six hours after application of the polynucleotide solution, the nematode soybean cyst nematode (SCN) inoculum (1000 vermiform eggs or 1000 J2s) is applied to the pots. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours. After the 24 hour restricted watering, normal sub-irrigation watering is done for the duration of the test. Twenty eight days after inoculation the plants are harvested and cysts counted.
(104) Experiments in corn using lesion nematodes are similar to above except for the following changes. Corn plants growing in a sand:Turface mix 2:1 in 4 inch deep pots (Turface MVP, Profile Products, LLC., Buffalo Grove, Ill.). Treatment with polynucleotide solution is done when the plants are approximately 8-10 days old. At least six hours after inoculation of the polynucleotide solution, plants are inoculated with 2 gm of P. scribneri infested corn roots which are then removed from the pot after 7 days. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours after inoculation. After the 24 hour restricted watering, normal sub-irrigation watering as needed is done for the duration of the test. 12-14 days post inoculation, plants are harvested and nematodes extracted for 6 days from the cut up roots in a mist tent.
(105) Application of Polynucleotides to Seeds for Nematode Control
(106) Cucumber seeds are soaked approximately 5-72 hours in nucleotides, either ssDNA and/or dsRNA polynucleotides directed to the promoter and/or targeting the coding region of a target of interest. Seeds can also be soaked in water for a few hours prior to soaking in polynucleotide solution. Soaking solution consists of 20 nm of each ssDNA or 0.03-1 nm dsRNA, 0.1% silwet L77, 50 mM NaPO4 in a final volume 200 uL in water. The radicals of the cucumber seeds emerge within 72 hours, after which the seeds are placed on germination paper until root length is approximately 2 inches. Seedlings are transplanted to sand vials for RKN inoculation 24 hours later. Ten mL dry sand is added to each vial and seedlings are planted by tilting the vial and laying the seedling in the correct orientation so that the cotyledons are just above the sand and then tilting back to cover the radicles with sand. 3.3 ml water is added to each vial and the vials placed in racks under fluorescent light banks. 500 vermiform eggs or 300 J2 RKN are inoculated in each tube in 50 uL of deionized or spring water. Harvest of the cucumber plants is performed 10 to 12 days after inoculation by washing sand off the roots. A root gall rating and visual phytotoxicity rating is assigned using the following scales: Gall rating scale (Gall: % root mass galled): 0=0-5%; 1=6-20%; 2=21-50%; and 3=51-100%. The average of the triplicate gall rating is then calculated: green=0.00-0.33 (no galls); yellow=0.67-1.33 (mild galling); orange=1.67-2.33 (moderate galling); red=2.67-3.00 (severe galling). Visual phytotoxicity scale is also assigned (Vis. tox; visual reduction in root mass compared to the control): rs1=mild stunting; rs2=moderate stunting; rs3=severe stunting.
(107) Experiments in soybeans using soy cyst nematodes (SCN) are similar to RKN assays except for the following changes. After 5-72 hours of soaking soybean seeds are planted in 100% sand in two inch square plastic pots. Seeds can also be soaked in water for a few hours prior to soaking in polynucleotide solution. Seven days after planting the soybean seed, the nematode soybean cyst nematode (SCN) inoculum (1000 vermiform eggs or 1000 J2s) are applied to the pot. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours. After the 24 hour restricted watering, normal sub-irrigation watering is done for the duration of the test. Twenty eight days after inoculation the test is harvested and cysts counted.
(108) Experiments in corn using lesion nematodes are similar to above except for the following changes. After 5-72 hours of soaking corn seeds are planted in a sand:turface mix 2:1 in 4 inch deep pots. Seeds can also be soaked in water for a few hours prior to soaking in polynucleotide solution. Inoculum of 2 gm of roots P. scribneri infested corn roots are applied at seeding and removed from the pot after 7 days. Watering of the test plants is then restricted to only water as needed to prevent wilt for a period of 24 hours after inoculation. After the 24 hour restricted watering, normal sub-irrigation watering as needed is done for the duration of the test. 12-14 days post inoculation, plants are harvested and nematodes extracted for 6 days from the cut up roots in a mist tent.
(109) RKN and SCN J2s are prepared from hatchbowls using the following solutions: RKN solution: 1 L aerated tap water, 1 ml of 50 mg/ml kanamycin, 0.5 ml of 20 mg/ml imazalil sulfate; SCN solution: 1 L aerated tap water, 1 ml of 50 mg/ml kanamycin, 0.5 ml of 20 mg/ml imazalil sulfate, 1430 mg zinc sulfate.
(110) Hatchbowls are autoclaved 6 oz bowls, lined with screen mesh and paper filter. Approximately 20 ml of appropriate hatch solution is poured into each bowl. Eggs are then place in the bowls and covered with foil. The bowls are then placed in a 25 C. incubator overnight. The next day the hatched J2's are extracted, additional solution added as needed and replaced in the incubator. Each bowl is used for 2 weeks and then disposed.
Example 8. Protection of Barley from Powdery Mildew by Topical Polynucleotide Application
(111) Barley seeds were planted in 2 inch pots in the greenhouse. Five days later, barley seedlings were sprayed with the indicated polynucleotides or a control formulation according to the methods of Table 12. The description of nucleic acid sequences of the ssDNA polynucleotides used is provided in Table 13. Post spraying, the seedlings were infected with dry spores of barley powdery mildew (Blumeria graminis f sp. hordei) and 7 days post infection, disease development was scored for the percentage of leaf area covered with powdery mildew. Results of these experiments are shown in Table 14, ANOVA statistical calculations are shown in Table 15 and a corresponding graph with LSD bar is shown in
(112) TABLE-US-00012 TABLE 12 Treatment Protocols Trt trigger type nucleotide ID # ratio nmol/plant* 1 DNA GFP GFP 13.4 2 DNA mlo T4211 13.4 3 DNA mlo T4219 13.4 4 DNA mlo T4221 13.4 5 DNA mlo T4211/T4219 1 to 1 6.7/6.7 6 DNA mlo T4211/T4221 1 to 1 6.7/6.7 7 DNA mlo T4219/T4221 1 to 1 6.7/6.7 8 DNA mlo T4211/19as/21 1 to 1 to 1 4.5 each 9 DNA mlo T4211/T4221 1 to 3 3.3/10 10 DNA mlo T4211/GFP 1 to 1 6.7/6.7 11 DNA mlo T4211/TGFP 1 to 3 3.3/10 12 DNA mlo T4211 3.3/11 *The indicated amounts of polynucleotides were provided in 5 mM NaPO.sub.4, 1% Ammonium Sulfate, and 0.25% Silwet (wt percent).
(113) TABLE-US-00013 TABLE13 Polynucleotidesused Seq Sequence # SEQ Name Composition nucleotides IDNO Organism T4211 GGGGTGCTGGAGA 24 184 barley GGCCCAGGTGG T4212 CGACGTCTGGTGC 23 185 barley GTGAACCGGA T4213 CTGGTATTCCAAG 23 186 barley GAGGTGGTCT T4214 GATGAGGAGCAGG 23 187 barley GATATGAAGC T4215 ATGAGCTCCGCCT 23 188 barley TCATCTTCTC T4216 GGCCTTCTTGTGC 23 189 barley CGGTGCTGGA T4217 CTGTCCACACAAA 23 190 barley ATGCGCCATC T4218 GTTCTGGAACAAC 22 191 barley GTCAGGTGT T4219 GTCGGGGCGGTGG 22 192 barley AACCAGAAG T4220 AAAAATCTGCACT 21 193 barley GGGGATGT T4221 GATTTAGTCTGTG 24 194 barley CACCGGGTGCG T4222 AACCGGGTACATG 24 195 barley TCCCTAGCCTC GFP GTTGTAGTTGTAC 25 196 A. TCCATCTTATTG victoria
(114) TABLE-US-00014 TABLE 14 Percent Leaf Infection Area Results Average Percent Infection Treatment No. nucleotide ID # Area STDEV N Variance NT 28.6 9.45 7 89.29 Formulation 17.5 8.22 6 67.50 1 GFP 10.6 6.23 8 38.84 2 T4211 1.38 2.26 8 5.13 4 T4219 2.33 2.07 6 14.17 5 T4221 4.16 2.04 6 4.27 6 T4211/T4219 2.2 2.59 6 4.17 1:1 7 T4211/T4221 2.2 2.59 5 6.70 1:1 8 T4219/T4221 4.2 1.79 5 6.70 1:1 10 T4211/T4221 2.4 2.4 5 3.20 1:3 11 T4211/GFP 1:1 2.4 2.4 5 4.30 12 T4211/TGFP 2.6 2.19 5 5.80 1:3 T4211 1.75 2.22 5 5.80
(115) TABLE-US-00015 TABLE 15 ANOVA ANOVA Source of Variation SS df MS F P-value F crit Between Groups 5351.475 15 356.765 17.96064 7.29E19 1.581213 Within Groups 1469.914 74 19.86371 Total 6821.389 89
Example 9. Topical Application of Short dsRNA Polynucleotides Provides Protection of Barley from Powdery Mildew
(116) Barley seeds were planted in 2 inch pots in the greenhouse. Five days later, barley seedlings were treated by hand application of dsRNA polynucleotides or a control formulation as indicated in Table 16. 1.7-6.7 nm of the dsRNA polynucleotide, as indicated in Table 16, was provided in 5 mM NaPO.sub.4, 1% Ammonium Sulfate, and 0.25% L77-Silwet (wt percent). Two cotyledon or leaves were spotted with 20 uL of the nucleotide solution for a total of 40 uL per plant. The nucleotide sequence of the dsRNA polynucleotides is provided in Table 17. Post application, the seedlings were infected with dry spores of barley powdery mildew (Blumeria graminis f sp. hordei) and disease development was scored at both 7 days and 14 days post infection for the percentage of leaf area covered with powdery mildew. Results of these experiments are shown in Table 18, ANOVA statistical calculations are shown in Table 19 and corresponding graph with LSD bar is shown in
(117) TABLE-US-00016 TABLE 16 Treatment Protocols for dsRNA polynucleotides Trt Trigger type Nucleotide ID# nmol/plant* NT None F None 1 dsRNA T4211_dsRNA 6.7 2 dsRNA T4114_dsRNA 6.7 3 dsRNA T4217_dsRNA 6.7 4 dsRNA T4219_dsRNA 6.7 5 dsRNA T4220_dsRNA 6.7 6 dsRNA T5910_dsRNA 6.7 7 dsRNA T5917_dsRNA 6.7 8 dsRNA T5923_dsRNA 6.7 9 dsRNA M4214_7_9: a mix 2.2 each of T4214, T4217, T4219 10 dsRNA T4220_5910_17_23: 1.7 each a mix of T4220, T5910, T5917, and T5923 11 dsRNA GFP_dsRNA 6.7 *The indicated amounts of polynucleotides were provided in 5 mM NaPO.sub.4, 1% Ammonium Sulfate, and 0.25% Silwet (wt percent).
(118) TABLE-US-00017 TABLE17 dsRNApolynucleotidesused # SEQ Sequence nucleo- ID SeqName Composition tides NO Organism T4211_dsRNA GGGGUGCUGGAGA 24 197 barley GGCCCAGGUGG T4114_dsRNA GAUGAGGAGCAGG 23 198 barley GAUAUGAAGC T4217_dsRNA CUGUCCACACAAA 23 199 barley AUGCGCCAUC T4219_dsRNA GUCGGGGCGGUGG 22 200 barley AACCAGAAG T4220_dsRNA AAAAAUCUGCACU 21 201 barley GGGGAUGU T5910_dsRNA CGCCUUCAUCUUC 25 202 barley UCCAGCGCCUCC T5917_dsRNA GUCGUCCUCCAUC 25 203 barley GACCUCUUGAUG T5923_dsRNA UCAGCCCGAUCUG 25 204 barley CGUGUGGUAGCA GFP_dsRNA GUUGUAGUUGUAC 25 205 A. UCCAUCUUAUUG victoria
(119) TABLE-US-00018 TABLE 18 Percent Infection Area on treated plants Average Percent Infection Variance Treatment No. nucleotide ID # Area STDEV N (LSD) 1 T4211_dsRNA 0.285714286 0.487950036 7 3 2 T4114_dsRNA 3.857142857 3.484660262 7 3 3 T4217_dsRNA 3.285714286 2.138089935 7 3 4 T4219_dsRNA 8.71428571 7.846746368 7 3 5 T4220_dsRNA 9.428571429 7.678045386 7 3 6 T5910_dsRNA 6.285714286 8.920281866 7 3 7 T5917_dsRNA 5.142857143 2.60950643 7 3 8 T5923_dsRNA 7.428571429 8.323804075 7 3 9 T4214, T4217, T4219 12 7.582875444 5 3 all dsRNA 10 T4220, T5910, T5917, 10 7.745966692 6 3 T5923 all dsRNA 11 GFP_dsRNA 13.57142857 8.017837257 7 3
(120) Table 18 shows the percentage disease area was significantly reduced in plants treated with the Silwet formulation containing the barley MLO dsRNA triggers.
(121) TABLE-US-00019 TABLE 19 ANOVA Source of Variation SS df MS F P-value F crit Between Groups 5242.448052 12 436.870671 9.63 5.29233E11 1.63 Within Groups 3403.142857 75 45.3752381 Total 8645.590909 87
(122)
Example 10. Topical Application of Long dsRNA Polynucleotides Provides Protection of Barley from Powdery Mildew
(123) Barley seeds were planted in 2 inch pots in the greenhouse. Five days later, barley seedlings were treated by hand application with dsRNA polynucleotides or a control formulation as indicated in Table 20. 13.5-28 pmol of dsRNA polynucleotide as indicated in Table 20 was provided in 5 mM NaPO.sub.4, 1% Ammonium Sulfate, and 0.25% L77-Silwet (wt percent). Two cotyledon or leaves were spotted with 20 uL of the nucleotide solution for a total of 40 uL per plant. The description of the nucleotide sequences of the dsRNA polynucleotides is provided in Table 21. Following application of the dsRNA polynucleotides, the seedlings were infected with dry spores of barley powdery mildew (Blumeria graminis f sp. hordei) and disease development was scored at 6 days post infection for the percentage of leaf area covered with powdery mildew. Results of these experiments are shown in Table 22, ANOVA statistical calculations are shown in Table 23 and corresponding graph with LSD bar is shown in
(124) TABLE-US-00020 TABLE 20 Treatment Protocol for long dsRNA polynucleotides Trt Trigger type Nucleotide ID# pmol/plant* NT None F None 1 Long dsRNA 5946_150a 18.6 2 Long dsRNA 5947_150a 18.6 3 Long dsRNA 5948_150a 18.6 4 Long dsRNA 5946_100a 28 5 Long dsRNA 5947_100a 28 6 Long dsRNA 5948_100a 28 7 Long dsRNA 5946_80b 16.9 8 Long dsRNA dsGFP_100b 28 9 Long dsRNA dsGFP_100b 13.5
(125) TABLE-US-00021 TABLE21 Polynucleotidesused # Seq Seq nucleo- SEQ Name Composition tides IDNO Organism 5946_150a AUGUCGGACAAAAAAGGGGUGCCGGCGCGGGA 150 206 Barley GCUGCCGGAGACGCCGUCGUGGGCGGUGGCGG UGGUCUUCGCCGCCAUGGUGCUCGUGUCCGUC CUCAUGGAACACGGCCUCCACAAGCUCGGCCA UUGGUUCCAGCACCGGCACAAG 5947_150a CGUCGUCGGCCCUCGAAGCCGACAUCCCCAGU 150 207 Barley GCAGAUUUUUCCUUCAGCCAGGGAUGAGACAA GUUUCUGUAUUCAUGUUAGUCCCAAUGUAUAG CCAACAUAGGAUGUGAUGAUUCGUACAAUAAG AAAUACAAUUUUUUACUGAGUC 5948_150a UGGUGGUGGGGCUAGCUCUCCAGUUCCUCUGC 150 208 Barley AGCUAUAUGACCUUCCCCCUCUACGCGCUCGU CACACAGAUGGGAUCAAACAUGAAGAGGUCCA UCUUCGACGAGCAGACGUCCAAGGCGCUCACC AACUGGCGGAACACGGCCAAGG 5946_100a GUGGGCGGUGGCGGUGGUCUUCGCCGCCAUGG 100 209 Barley UGCUCGUGUCCGUCCUCAUGGAACACGGCCUC CACAAGCUCGGCCAUUGGUUCCAGCACCGGCA CAAG 5947_100a CAGGGAUGAGACAAGUUUCUGUAUUCAUGUUA 100 210 Barley GUCCCAAUGUAUAGCCAACAUAGGAUGUGAUG AUUCGUACAAUAAGAAAUACAAUUUUUUACUG AGUC 5948_100a CUCUACGCGCUCGUCACACAGAUGGGAUCAAA 100 211 Barley CAUGAAGAGGUCCAUCUUCGACGAGCAGACGU CCAAGGCGCUCACCAACUGGCGGAACACGGCC AAGG 5946_80b UCGCCGCCAUGGUGCUCGUGUCCGUCCUCAUG 80 212 Barley GAACACGGCCUCCACAAGCUCGGCCAUUGGUU CCAGCACCGGCACAAG dsGFP_100a UCAAGGAGGAUGGCAACAUCCUGGGCAAUAAG 100 213 A. AUGGAGUACAACUACAACGCCCACAAUGUGUA victoria CAUCAUGACCGACAAGGCCAAGAAUGGCAUCA AGGUGAACUUCAAGAUCCGCCACAACAUCGAG GAUGGCAGCGUGCAGCUGGCCGAC
(126) TABLE-US-00022 TABLE 22 Percent Leaf Infection Area Results Avg Percent Trt No. Nucleotide ID N Infection STDEV LSD NT 8 23.125 5.303301 2.82 Formulation 8 19.375 7.763238 2.82 1 dsGFP_100a 8 13.125 7.529703 2.82 2 5946_150a 9 5.777778 3.562926 2.82 3 5947_150a 9 9 6.819091 2.82 4 5948_150a 9 8.444444 6.930208 2.82 5 5946_100a 8 10 6.546537 2.82 6 5947_100a 9 12.77778 7.120003 2.82 7 5948_100a 9 12.22222 7.546154 2.82 8 dsGFP_100b 9 12.77778 7.120003 2.82 9 5946_80b 8 13.75 6.943651 2.82
(127) TABLE-US-00023 TABLE 23 ANOVA Source of Variation SS df MS F P-value F crit Between Groups 2013.068853 10 201 4.4 0 1.7 Within Groups 3777.569444 83 46 Total 5790.638298 93
(128)