Method for preparing bacterial polysaccharide-modified recombinant fusion protein and use of the protein

10844098 ยท 2020-11-24

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provided a method for preparing a bacterial polysaccharide-modified recombinant fusion protein and use of the bacterial polysaccharide-modified recombinant fusion protein. The method comprises: co-expressing a recombinant fusion protein and the Neisseria meningitidis O-oligosaccharyltransferase PglL in an O-antigen ligase gene-defective bacterium, and linking a polysaccharides endogenous or exogenous for the bacterium to the recombinant fusion protein by the O-oligosaccharyltransferase PglL, to obtain the bacterial polysaccharide-modified recombinant fusion protein. The protein can be used for preparing antibodies against bacterial polysaccharides and vaccines.

Claims

1. A method for preparing a bacterial polysaccharide-modified recombinant fusion protein, comprising co-expressing a recombinant fusion protein and Neisseria meningitidis O-oligosaccharyltransferase PglL in a O-antigen ligase gene-defective bacterium, and linking a polysaccharide endogenous or exogenous for the bacterium to the recombinant fusion protein by the Neisseria meningitidis O-oligosaccharyltransferase PglL, to obtain the bacterial polysaccharide-modified recombinant fusion protein; wherein the recombinant fusion protein comprises an N-terminal signal peptide, a peptide fragment having a glycosylation site of Neisseria meningitidis O-oligosaccharyltransferase PglL, and a carrier protein; the carrier protein is a nontoxic mutant of a bacterial toxin protein or a fragment of a bacterial toxin protein; the glycosylation site of Neisseria meningitidis O-oligosaccharyltransferase PglL is the serine at position 63 starting from N-terminus of Neisseria meningitidis pilin PilE; and, the peptide fragment having a glycosylation site of Neisseria meningitidis O-oligosaccharyltransferase PglL is a peptide fragment comprising at least the amino acids from positions 55 to 66 starting from N-terminus of Neisseria meningitidis pilin PilE, and is any one of the following peptide fragments: (1) the peptide fragment set forth in the amino acid sequence from positions 128 to 156 starting from N-terminus of SEQ ID No.32 or a tandem repeat sequence thereof; (2) the peptide fragment set forth in the amino acid sequence from positions 128 to 154 starting from N-terminus of SEQ ID No.34 or a tandem repeat sequence thereof; (3) the peptide fragment set forth in the amino acid sequence from positions 128 to 152 starting from N-terminus of SEQ ID No.36 or a tandem repeat sequence thereof; (4) the peptide fragment set forth in the amino acid sequence from positions 128 to 150 starting from N-terminus of SEQ ID No.38 or a tandem repeat sequence thereof; (6) the peptide fragment set forth in the amino acid sequence from positions 22 to 40 starting from N-terminus of SEQ ID No.48 or a tandem repeat sequence thereof; and (7) the peptide fragment set forth in the amino acid sequence from positions 22 to 36 starting from N-terminus of SEQ ID No.50 or a tandem repeat sequence thereof.

2. The method according to claim 1, characterized in that the nontoxic mutant of the bacterial toxin protein is a nontoxic mutant of Pseudomonas aeruginosa exotoxin A; the nontoxic mutant of Pseudomonas aeruginosa exotoxin A is set forth in the amino acid sequence from positions 20 to 631 starting from N-terminus of SEQ ID No.46.

3. The method according to claim 1, characterized in that the fragment of the bacterial toxin protein is cholera toxin B subunit or fragment C of tetanus toxin; wherein the amino acid sequence of the cholera toxin B subunit is set forth in the amino acid sequence from positions 20 to 122 starting from N-terminus of SEQ ID No.32; and the amino acid sequence of the fragment C of tetanus toxin is set forth in the amino acid sequence from positions 20 to 455 starting from N-terminus of SEQ ID No.60.

4. The method according to claim 1, characterized in that the recombinant fusion protein has an amino acid sequence set forth in any one of: (1) the amino acid sequence set forth in SEQ ID No.32; (2) the amino acid sequence set forth in SEQ ID No.34; (3) the amino acid sequence set forth in SEQ ID No.36; (4) the amino acid sequence set forth in SEQ ID No.38; (5) the amino acid sequence set forth in SEQ ID No.46; (6) the amino acid sequence set forth in SEQ ID No.48; (7) the amino acid sequence set forth in SEQ ID No.50; (8) the amino acid sequence set forth in SEQ ID No.56; (9) the amino acid sequence set forth in SEQ ID No.58; and (10) the amino acid sequence set forth in SEQ ID No.60.

5. The method according to claim 1, characterized in that the recombinant fusion protein is introduced into the bacterium by a recombinant expression vector, and the recombinant expression vector is obtained by inserting a gene encoding the recombinant fusion protein into the multiple cloning site of pMMB66EH.

6. The method according to claim 1, characterized in that the Neisseria meningitidis O-oligosaccharyltransferase PglL is introduced into the bacterium by a recombinant expression vector, the recombinant expression vector is obtained by inserting an expression cassette of the Neisseria meningitidis O-oligosaccharyltransferase PglL into the multiple cloning site of pET28a(+); and the expression cassette of the Neisseria meningitidis O-oligosaccharyltransferase PglL is set forth in SEQ ID No.30.

7. The method according to claim 1, characterized in that the polysaccharide exogenous for the bacterium is obtained by introducing a recombinant expression vector comprising a gene cluster for polysaccharide synthesis into the bacterium; and the sequence of the gene cluster for polysaccharide synthesis is set forth in SEQ ID No.79.

8. The method according to claim 7, characterized in that the recombinant expression vector comprising a gene cluster for polysaccharide synthesis is prepared by the following method: subjecting the DNA molecule set forth in SEQ ID No.79 to double enzyme digestion by Ascl and Notl, to obtain a gene fragment; subjecting the DNA molecule set forth in SEQ ID No.82 to double enzyme digestion by AscI and NotI, to obtain a large vector fragment; and ligating the gene fragment to the large vector fragment to obtain the recombinant expression vector comprising a gene cluster for polysaccharide synthesis.

9. The method according to claim 1, characterized in that the O-antigen ligase gene-defective bacterium is an O-antigen ligase gene-defective Shigella flexneri, an O-antigen ligase gene-defective Salmonella paratyphi A or an O-antigen ligase gene-defective Escherichia coli.

10. The method according to claim 9, characterized in that the O-antigen ligase gene-defective Escherichia coli is a strain of E. coli K12.

11. The method according to claim 1, characterized by further comprising the steps of cell lysis, centrifugation and collection of supernatant, desalting and/or separation and purification, after the expression.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows the results of PCR identification of S. flexneri 2a 301pCP.

(2) FIG. 2 shows the results of PCR identification of S. flexneri 2a 301pCPwaaI.

(3) FIG. 3 shows the verification results of lipopolysaccharide synthesis deficiency in S. flexneri 2a 301pCPwaaI by silver staining.

(4) FIG. 4 shows the tertiary structure of Neisseria meningitidis pilin PilE.

(5) FIG. 5 shows the detection result of glycosylation of the recombinant CTB fusion protein by WB assay.

(6) FIG. 6 shows the detection result of glycosylation of the recombinant EPA fusion protein by WB assay.

(7) FIG. 7 shows the purification result of the glycoprotein rCTB4573-OPS.sub.Sf301 detected by SDS-PAGE and WB assay.

(8) FIG. 8 shows the purification result of the glycoprotein rEPA4573-OPS.sub.Sf301 detected by SDS-PAGE and WB assay.

(9) FIG. 9 shows the immunogenicity evaluation of the glycoproteins.

(10) FIG. 10 shows the detection result of glycosylation of the recombinant fusion proteins having multiple glycosylation sites by WB assay.

(11) FIG. 11 shows the result of WB assay for the glycoprotein rTTC4573-OPS.sub.Sf301.

(12) FIG. 12 shows the results of PCR identification of S. paratyphi CMCC50973waaL.

(13) FIG. 13 shows the verification result of lipopolysaccharide synthesis deficiency in S. paratyphi CMCC50973waaL by silver staining.

(14) FIG. 14 shows the result of WB assay for glycoprotein rEPA4573-OPS.sub.Spty50973.

(15) FIG. 15 shows the result of WB assay for the glycoprotein rCTB4573-OPS.sub.Spty50973.

(16) FIG. 16 shows the result of PCR identification of E. coli W3110waaL.

(17) FIG. 17 shows the result of WB assay for the glycoprotein rCTB4573-OPS.sub.EcO157.

SPECIFIC MODES FOR CARRYING OUT THE INVENTION

(18) Unless otherwise specified, the experimental methods used in the following examples are the conventional methods. Unless otherwise specified, the materials, reagents and the like used in the following examples are commercially available. pMD18-T was purchased from TaKaRa Company, with a catalog number of D101A. Plasmid pET-22b was purchased from Novagen Company, with a catalog number of 69744. pET28a(+) was purchased from Novagen. pMMB66EH was purchased from ATCC, under an accession number of ATCC 37620. Anti-His tag mouse monoclonal antibody was purchased from Sigma, with a catalog number of A7058. Anti-EPA antibody was purchased from Sigma, with a catalog number of P2318. Rabbit Anti-OPS.sub.Sf301 antiserum (Shigella flexneri 2a type antiserum) was purchased from DENKA SEIKEN Co., Ltd, with a catalog number of 210227. Rabbit anti-E. coli O157 antiserum was purchased from DENKA SEIKEN Co., Ltd. with a catalog number of 210753. HRP-goat anti-rabbit IgG was purchased from TransGen Company, with a catalog number of HS-101-01. CHELATING SEPH 6 FF affinity chromatographic column was purchased from GE Healthcare, with a catalog number of 17-5203-06. G25 chromatographic packing was purchased from GE Healthcare. ProteinPak DEAE8HR cation exchange chromatography column was purchased from Waters. Superdex 75 FPLC chromatographic column was purchased from GE Healthcare, with a catalog number of 17-1047-01. Female Balb/c mice were purchased from Laboratory Animal Center of the Academy of Military Medical Sciences. The aluminium hydroxide adjuvant Rehydragel LV was purchased from General Chemical Company.

(19) The recombinant plasmid pKDinc, which has been disclosed in the paper Global Analysis of a Plasmid-Curred Shigella flexneri Strain: New Insights into the Interaction between the Chromosome and a Virulence Plasmid, Journal of Proteome Research, 2010, 9(2):843-854, and is available to the public by Biological Engineering Institute of Academy of Military Medical Sciences, is a temperature-sensitive plasmid resistant to ampicillin. The plasmid pKOBEG, which has been disclosed in the paper A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans[J]. Nucleic Acids Res. 2000 Nov. 15; 28(22):E97, and is available to the public by Biological Engineering Institute of Academy of Military Medical Sciences, is a temperature-sensitive plasmid resistant to chloramphenicol. The plasmid pCP20, which has been disclosed in the paper Datsenko, K. A. and B. L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products[J]. Proc. natl. Acad. Sci. U.S.A, 2000, 97(12): 6640-6645, and is available to the public by Biological Engineering Institute of Academy of Military Medical Sciences, is resistant to chloramphenicol. pKD3 has been disclosed in Datsenko, K. A. and B. L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA, 2000. 97(12): p. 6640-5., and is available to the public by Biological Engineering Institute of Academy of Military Medical Sciences. The plasmid pKD46 has been disclosed in the paper Datsenko, K. A. and B. L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA, 2000. 97(12): p. 6640-5., and is available to the public by Biological Engineering Institute of Academy of Military Medical Sciences. The replicon of pKD46 is sensitive to temperature, and is lost when culturing at 37 C., and the plasmid comprises genes encoding the three recombinases of Red recombination system and controlled by arabinose promoter. pACYC184 has been disclosed in the paper Yu Mei, Zhou Jianguang, Chenwei, et al., Construction of a mobile recombineering system pYM-Red [J]. PROGRESS IN BIOCHEMISTRY AND BIOPHYSICS, 2005, 32(4): 359-364., and is available to the public by Biological Engineering Institute of Academy of Military Medical Sciences. Shigella flexneri 2a 301 wild-type strain (S. flexneri 2a 301) has been disclosed in the paper Genome sequence of Shigella flexneri 2a: insights into pathogenicity through comparison with genomes of Escherichia coli K12 and O157, Nucl. Acids Res 2002, 30(20):4432-4441, and is available to the public by Biological Engineering Institute of Academy of Military Medical Sciences. Salmonella paratyphi A 50973 strain (S. paratyphi CMCC50973) was purchased from National Center for Medical Culture Collections. E. coli W3110 has been disclosed in the paper Yu Mei, Li Shanhu, Chen Wei, et al., Reconstruction of plasmid DNA with Red-mediated homologous recombination combined with restriction digestion [J]. Bulletin of the Academy of Military Medical Sciences, 2005, 29(3): 241-243., and is available to the public by Biological Engineering Institute of Academy of Military Medical Sciences.

Example 1. Preparation of Shigella flexneri O-glycosylated Recombinant Fusion Protein and a Vaccine Thereof by One-Step Bioconjugate Method

(20) Shigella spp. is a highly infectious Gram-negative pathogenic enterobacterium, which generally invades the epithelial cells of human colon and is finally located in large intestine, resulting in typical bacillary dysentery (fever, bellyache, tenesmus, and purulent and bloody stool). The large virulence plasmid is the primary pathogenic factor, and the large virulence plasmid comprises about 32 virulence-associated genes, mainly including mxi-spa gene associated with type III secretion system, and virulence genes closely associated with the invasion of bacteria into epithelia, such as ipaBCD and ipgC. In order to develop it into a safe host bacterium, the large plasmid pCP encoding virulent factors has to be deleted first, and then make it be defective in O-antigen ligase gene waaI, so as to develop a host bacterium suitable for the invention.

(21) I. Host Bacterium Engineering

(22) (I) Construction of Large Virulence Plasmid-Deficient Strain S. flexneri 2a 301pCP

(23) 1. Preparation of Competent Cells of Shigella flexneri 2a 301 Wild-Type Strain

(24) 1) Shigella flexneri 2a 301 wild strain (S. flexneri 2a 301) was seeded in a LB liquid medium. After culturing at 30 C. overnight, 1 ml culture medium was transferred to 100 mL low salt LB liquid medium, and the culture was carried out at 30 C. until OD.sub.600 reached 0.6.

(25) 2) The bacteria were collected by centrifugation, and washed with a sterilized aqueous solution containing 10% (v/v) glycerol for four times. Finally, the bacteria were re-suspended in 400 L sterilized aqueous solution containing 10% (v/v) glycerol, to obtain S. flexneri 2a 301 competent cells for use in electrotransformation, and were sub-packaged for later use.

(26) 2. Deletion of Large Virulence Plasmid

(27) 1) inc as a sequence fragment associated with replication in large virulence plasmid pCP of Shigella spp., and the recombinant plasmid pKDinc carrying the inc fragment was transformed into the S. flexneri 2a 301 competent cells prepared in Step 1 by electroporation, to obtain the intermediate recombinant bacterium, designated as S. flexneri 2a 301/pKDinc.

(28) 2) The S. flexneri 2a 301/pKDinc was passaged serially for more than three times in LB liquid medium containing ampicillin at a concentration of 50 L, to ensure the loss of large virulence plasmid, and then the cultured bacterial liquid was spread on the ampicillin-resistant LB solid medium. When monoclonal colonies were formed, the genomic DNA of the monoclonal colonies was extracted, and was used as template to carry out PCR amplification, with the primers of ipaA, ipgB, mxiD, virG as primers, respectively. Whether large virulence plasmid pCP was deleted or not was determined by detection of virulence genes ipaA, ipgB, mxiD, and virG, and meanwhile the genomic DNA of S. flexneri 2a 301 was used as control to carry out said PCR amplification.

(29) The primers of ipaA are as follows:

(30) TABLE-US-00001 ipaAp1: (SEQIDNo.1) 5-AAGATTCTGCCTTTGGACC-3 ipaAp2: (SEQIDNo.2) 5-GTGGTTGAAGAGTTCTGTATG-3

(31) The primers of ipgB are as follows:

(32) TABLE-US-00002 ipgB1U: (SEQIDNo.3) 5-TGCTTTGACGGTATACAGC-3 ipgB1L: (SEQIDNo.4) 5-ACTTCCACAGGTTGAATTCG-3

(33) The primers of mxiD are as follows:

(34) TABLE-US-00003 mxiDU: (SEQIDNo.5) 5-AAGCAGGTTTCTTCTATTGG-3 mxiDL: (SEQIDNo.6) 5-GAACACATTACCGATTACAGG-3

(35) The primers of virG are as follows:

(36) TABLE-US-00004 VirGp1: (SEQIDNo.7) 5-CATCAATCCGTTACTCACT-3 VirGp2: (SEQIDNo.8) 5-ACTACCAGCAACAATACG-3

(37) The results are shown in FIG. 1A. In FIG. 1A, 301 represents Shigella flexneri 2a 301 wild-type strain S. flexneri 2a 301; and 301pCP represents the monoclonal colonies screened in Step 2). FIG. 1A shows that in the Shigella flexneri 2a 301 wild-type strain, the target amplified fragments appeared for the genes ipaA, ipgB, mxiD, virG, which were the target fragment of 888 bp for ipaA, the target fragment of 595 bp for ipgB, the target fragment of 986 bp for mxiD, and the target fragment of 777 bp for virG, respectively. However, in the monoclonal colonies screened for ampicillin-resistance, no amplified fragments appeared for genes ipaA, ipgB, mxiD, virG, indicating successful loss of large virulence plasmid. The monoclonal colonies screened in the Step 2) (based on the plasmid incompatibility, the recombinant bacteria had the large virulence plasmid knocked out and only retained the plasmid pKDinc) were designated as S. flexneri 2a 301pCP/pKDinc.

(38) 3) By the utilization of the temperature sensitivity of the plasmid pKDinc, S. flexneri 2a 301pCP/pKDinc was subjected to continuous culture for two generations in liquid LB medium free of antibiotics at 42 C., and the bacterial strain, which could grow in LB solid medium free of antibiotics, but not in ampicillin-containing LB solid medium, was designated as the bacterial strain S. flexneri 2a 301pCP.

(39) The genomic DNA of S. flexneri 2a 301pCP was extracted, the virulence genes ipaA, ipgB, mxiD, virG were detected in accordance with the method in Step 2), and meanwhile the genomic DNA of the Shigella flexneri 2a 301 wild-type strain S. flexneri 2a 301 was used as control to carry out the PCR amplification. The results were consistent with the results in FIG. 1A. In the Shigella flexneri 2a 301 wild-type strain S. flexneri 2a 301, the target amplified fragments appeared for the genes ipaA, ipgB, mxiD, virG, while in the S. flexneri 2a 301pCP, no amplified fragments appeared for the genes ipaA, ipgB, mxiD, virG, indicating the absence of large virulence plasmid.

(40) The genomic DNA of the S. flexneri 2a 301pCP was extracted, and the primers of inc were used as primers to carry out PCR amplification. Whether the plasmid pKDinc was successfully deleted or not was confirmed by detection of the inc fragment in the plasmid pKDinc, and meanwhile the genomic DNA of Shigella flexneri 2a 301 wild-type strain S. flexneri 2a 301 was used as control to carry out the PCR amplification.

(41) The primers of inc are as follows:

(42) TABLE-US-00005 incF: (SEQIDNo.9) 5-TGCGAGAGAGAGGGGATAAC-3 incR: (SEQIDNo.10) 5-CGCCTTTTCCATCAGTTTC-3

(43) The results are shown in FIG. 1B. In FIG. 1B, 301 represents Shigella flexneri 2a 301 wild-type strain S. flexneri 2a 301; 301pCP represents S. flexneri 2a 301pCP. FIG. 1B shows that in the Shigella flexneri 2a 301 wild-type strain S. flexneri 2a 301, the target fragment of 488 bp appeared for inc gene, while in the S. flexneri 2a 301pCP, no target amplified fragment appeared, indicating successful loss of the plasmid pKDinc.

(44) The above results show that the S. flexneri 2a 301pCP had the large virulence plasmid pCP lost, and also had the exogenous plasmid pKDinc lost, i.e., the large virulence plasmid-deleted strain S. flexneri 2a 301pCP was constructed successfully.

(45) (II) The Preparation of O-Antigen Ligase Gene waaI-Defective Avirulent Shigella flexneri S. flexneri 2a 301pCPwaaI

(46) 1. Preparation of linear targeting DNA fragments

(47) 1) Design and Synthesis of PCR Primers

(48) A pair of primers were designed for each of the upstream (5end) and the downstream (3end) of Shigella flexneri 2a 301waaI gene, respectively, i.e., 301waaIu5/301waaIu3 and 301 waaId5/301 waaId3; wherein 301waaIu5 had the restriction enzyme cleavage site for BamHI, 301 waaIu3 had the restriction enzyme cleavage site for SalI, 301waaId5 had the restriction enzyme cleavage site for HindIII, and 301 waaId3 had the restriction enzyme cleavage site for XhoI.

(49) In order to confirm whether the mutant was constructed successfully, a pair of primers (301waaIw5/301waaIw3) located outside the upstream and downstream homologous arms of waaI gene in the genome, a pair of inner primers for identification (301waaIn5/301waaIn3), a pair of primers for kan gene (Kan5/Kan3) and a pair of inner primers for kan gene (Kanf5/Kanf3), were designed to carry out PCR verification, and sequencing verification.

(50) The primers are shown in Table 1 (in Table 1, the underlined sequences refer to the enzyme recognition sites).

(51) TABLE-US-00006 TABLE1 Primersequencelisting1 length/ Primer Sequence(5.fwdarw.3) bp Use 301waaIu5 CGGGATCCGGGTATGG 628 for GAAGAATCAAG amplification (SEQIDNo.11) ofup 301waaIu3 GCGTCGACTCAGAAAT fragment GCTACGGTGT (SEQIDNo.12) 301waaId5 CCAAGCTTTGGACCTT 680 for TAGACAATCAA amplification (SEQIDNo.13) ofdown 301waaId3 CCCTCGAGATGTTAGG fragment AAGCATACCG (SEQIDNo.14) 301waaIn5 TGGGTGGGATTACAAG 562 for GT identification (SEQIDNo.15) ofthe 301waaIn3 CCAATGACTAACACGG mutantstrain AAA (SEQIDNo.16) 301waaIw5 CTACAGATGCTGGCGA 1777 for ATA identification (SEQIDNo.17) ofthe 301waaIw3 TCACTACAGTTGGGAT mutantstrain GG (SEQIDNo.18) Kanf5 AGCCGAGTCTGTTGTG 1600 for CC identification (SEQIDNo.19) ofthe Kanf3 TTGTCACTGAAGCGGG mutantstrain AAGG (SEQIDNo.20) Kan5 GCGTCGACGTGTAGGC for TGGAGCTGCTTC identification (SEQIDNo.21) ofthe Kan3 CCAAGCTTATGGGAAT mutantstrain TAGCCATGGTCC (SEQIDNo.22)

(52) 2) Construction of Linear Targeting DNA Fragments

(53) (1) The genomic DNA of S. flexneri 2a 301pCP was used as template, and 301waaIu5/301waaIu3 and 301waaId5/301waaId3 were used to amplify the upstream and downstream homologous arms of waaI, i.e., up and down, respectively.

(54) PCR program was as followed: 94 C. 10 min; 94 C. 30 s, 56 C. 30 s, 72 C. 1 min, 30 cycles, 72 C. 10 min.

(55) The nucleotide sequence of the up fragment obtained by PCR amplification was set forth in the nucleotide sequence from positions 7 to 634 starting from 5end of SEQ ID No.23, and the nucleotide sequence of the down fragment was set forth in the nucleotide sequence from positions 2143 to 2822 starting from 5end of SEQ ID No.23.

(56) (2) Construction of pETKan

(57) The DNA molecule set forth in the nucleotide sequence from positions 641 to 2136 starting from 5end of SEQ ID No.23 was used as template, with 5-GCGTCGACGTGTAGGCTGGAGCTGCTTC-3(SEQ ID No.24) and 5-CCAAGCTTATGGGAATTAGCCATGGTCC-3(SEQ ID No.25) as primers, to carry out PCR amplification, to obtain a PCR amplification product;

(58) The PCR amplification product was subjected to double enzyme digestion by SalI and HindIII to obtain gene fragments; the plasmid pET-22b was subjected to double enzyme digestion by SalI and HindIII to obtain a large fragment; the gene fragment was ligated to the large fragment, to obtain a recombinant plasmid, designated as pETKan. The pETKan was sequenced, and the result was correct.

(59) (3) The up fragment was subjected to double enzyme digestion by BamHI and SalI, to obtain the gene fragment 1; the plasmid pETKan was subjected to double enzyme digestion by BamHI and SalI, to obtain the large fragment 1; and the gene fragment 1 was ligated to the large fragment 1, to obtain the intermediate vector 1;

(60) The down fragment was subjected to double enzyme digestion by HindIII and XhoI, to obtain the gene fragment 2; the intermediate vector 1 was subjected to double enzyme digestion by HindIII and XhoI, to obtain the large fragment 2; and the gene fragment 2 was ligated to the large fragment 2, to obtain the intermediate vector 2.

(61) (4) The intermediate vector 2 was subjected to double enzyme digestion by BamHI and XhoI, to obtain the targeting fragment of interest, as set forth in SEQ ID No.23. The flanking sequences of the targeting fragment are the homologous arms, and the kan gene was comprised in the middle region. The nucleotide sequence from positions 7 to 634 starting from 5 end of SEQ ID No.23 refer to the up fragment, the nucleotide sequence from positions 641 to 2136 starting from 5 end of SEQ ID No.23 refer to the kan gene, and the nucleotide sequence from positions 2143 to 2822 starting from 5 end of SEQ ID No.23 refer to the down fragment.

(62) 2. Construction of S. flexneri 2a 301pCP/pKOBEG

(63) Since the plasmid pKOBEG comprised the genes encoding the enzymes necessary for -Red recombination system, the plasmid pKOBEG was transformed into S. flexneri 2a 301pCP by electroporation, and the transformed cells were spread onto the LB-plate containing chloramphenicol at a concentration of 50 g/mL and cultured at 30 C. overnight, to obtain the positive clone, designated as S. flexneri 2a 301 pCP/pKOBEG strain.

(64) 3. Electrotransformation of S. flexneri 2a 301pCP/pKOBEG with the linear targeting DNA fragments

(65) 1) The S. flexneri 2a 301pCP/pKOBEG was seeded in low salt LB liquid medium containing chloramphenicol at a concentration of 30 g/mL, cultured at 30 C. overnight, and then passaged in low salt LB liquid medium at a volume ratio of 1:100 for fixture culture.

(66) 2) When the OD.sub.600 value of the culture medium in Step 1) reached 0.2, and L-arabinose was added at a final concentration of 1 mmol/L to induce the expression of Red recombination system.

(67) 3) When the OD.sub.600 of the culture medium in Step 2) reached 0.6, the S. flexneri 2a 301pCP/pKOBEG was transformed with the targeting fragments as prepared in Step 1 at a concentration of 300 ng/L by electroporation, to obtain the transformed cells.

(68) 4) To the transformed cells, 1 mL precooled low salt LB liquid medium was added quickly. The cells were thawed at 30 C. for about 2.5 h, and then were spread onto a LB plate containing kanamycin at a concentration of 50 g/mL, cultured in a 30 C. incubator overnight, to screen out the positive clone.

(69) 5) The positive clone was seeded to LB liquid medium containing kanamycin at a concentration of 50 g/mL, and cultured at 42 C. and passaged twice (12 h for each passage), thereby resulting in the deletion of the plasmid pKOBEG. The kanamycin-resistant, waaI-deleted mutant strain was obtained finally, designated as S. flexneri 2a 301pCP waaI::kan1.

(70) 4. The plasmid pCP20 encoding a FRT site-specific recombinase was transformed into S. flexneri 2a 301pCP waaI::kan by means of electroporation, and cultured in kanamycin-free LB plate containing chloramphenicol at a concentration of 50 g/mL at 30 C. The positive clone of Cm.sup.rKm.sup.s (chloramphenicol-resistant, kanamycin-sensitive) was screened.

(71) 5. The positive clone screened in Step 4, was transferred to liquid LB, and cultured at 42 C. for 12 h, to obtain the O-antigen ligase gene waaI-defective, avirulent Shigella flexneri 2a 301, designated as S. flexneri 2a 301pCPwaaI.

(72) (the replicon of pCP20 was sensitive to temperature, and lost when cultured at 42 C.; the plasmid comprised the DNA encoding FLP recombinase, controlled by temperature-sensitive promoter, and the expression of FLP recombinase was induced when cultured at 42 C., with the deletion of the plasmid.)

(73) (III) Molecular Identification of S. flexneri 2a 301pCPwaaI

(74) The genomic DNA of S. flexneri 2a 301 pCPwaaI was used as template, and a pair of waaI inner primers (301waaIn5/301 waaIn3), a pair of waaI outer primers (301waaIw5/301waaIw3), a pair of cross primers (301waaIw5 and kanf3) and kan gene primers (kan5/kan3) were used separately to carry out PCR amplification, and meanwhile the genomic DNA of the wild-type strain S. flexneri 2a 301 was used as control to carry out the PCR amplification.

(75) The results are shown in FIG. 2. In FIG. 2, 301pCPwaaI represents S. flexneri 2a 301pCPwaaI, and wild-type strain 301 represents wild-type strain S. flexneri 2a 301; 1,5: the PCR product when the waaI inner primers were used as primers; 2,6: the PCR product when the waaI outer primers were used as primers; 3,7: the PCR product when the waaIw5 and kanf3 were used as primers; 4,8: the PCR product when the Kan gene primers were used as primers. FIG. 2 shows that when the genomic DNA of S. flexneri 2a 301pCPwaaI was used as template, and the waaI inner primers were used as primers to carry out PCR amplification, no target bands appeared; when the waaI outer primers were used as primers to carry out PCR amplification, the bands obtained were smaller than the PCR amplification bands obtained when the genomic DNA of wild-type strain was used as template; no amplification bands appeared when the cross primers and the kan gene primers were used as primers. However, when the genomic DNA of wild-type strain was used as template, and the waaI inner primers were used as primer to carry out PCR amplification, the target bands appeared, and no amplification bands appeared when the cross primers and the kan gene primers were used as primers.

(76) The above results demonstrated that the S. flexneri 2a 301pCPwaaI was Shigella flexneri 2a 301 that was deficient in waaI gene and the large virulence plasmid pCP and had no antibiotic resistance gene.

(77) (IV) Phenotype Identification of S. flexneri 2a 301pCPwaaI

(78) 1 mL culture of S. flexneri 2a 301pCPwaaI cultured at 37 C. overnight, was centrifuged to collect bacteria. The bacteria were washed with PBS once, and 100 L lysis buffer (the lysis buffer was prepared by well mixing 2 mL 10% SDS, 0.4 mL 2-mercaptoethanol, 1 mL 100% glycerol, 5 mL 2M pH6.8 Tris-HCl, 20 L 10% bromophenol blue and 1.6 mL ddH.sub.2O) was added and mixed well. After heating in boiling water for 10 min, 4 L of 20 mg/mL protease K aqueous solution was added, and the reaction was carried out at 60 C. for 1-2 h, to obtain lysates. 15 l of the lysates was loaded to carry out SDS-PAGE electrophoresis, the gel was placed in the fixing solution overnight, and a sensitizing solution was added and reacted for 30 min. After washing with deionized water for three times, 15 min for each time, a silver nitrate solution was added and reacted for 20 min, and deionized water was used for washing twice, 1 min for each time. A developing solution was added for color development, the reaction was stopped finally, and deionized water was used for washing.

(79) The wild-type strain S. flexneri 2a 301 was also subjected to the above experiment, as control.

(80) The results are shown in FIG. 3. In FIG. 3, 301pCPwaaI represents S. flexneri 2a 301pCPwaaI, 301 represents wild-type strain S. flexneri 2a 301. FIG. 3 shows that S. flexneri 2a 301 wild-type strain had the ladder-like bands of LPS, while S. flexneri 2a 301pCPwaaI had no ladder-like bands of LPS due to the knockout of O-antigen ligase gene waaI (waaI functions to ligate O-antigen polysaccharide (OPS) to lipoid A-core oligosaccharide to form lipopolysaccharide(LPS)).

(81) II. Identification of Core Peptide Fragments

(82) According to the tertiary structure of Neisseria meningitidis pilin PilE (GeneBank: NC_003112.2), polypeptides of different lengths containing serine at position 63 (S63) of PilE (the amino acid is a glycosylation site) were prepared. To construct a series of recombinant fusion proteins, cholera toxin B submit (CTB) (GenBank: X76390.1) was used as a carrier protein, and the polypeptides of different lengths were fused to the C-temrinus of CTB; alternatively, the nontoxic mutant of pseudomonas aeruginosa exotoxin A (rEPA) was used as a carrier protein, and the polypeptides of different lengths were fused to its N-terminus or C-terminus. The recombinant fusion protein and Neisseria meningitidis O-oligosaccharyltransferase PglL were co-expressed in S. flexneri 2a 301pCPwaaI, whole bacterial proteins were subjected to western blot, and detected by specific antibodies, to determine the shortest polypeptide that enabled the recombinant fusion protein to be O-glycosylated. The steps were as followed:

(83) (I) Construction of an Expression Vector of Neisseria meningitidis O-Oligosaccharyltransferase PglL

(84) 1. The amino acid sequence of Neisseria meningitidis O-oligosaccharyltransferase PglL (GeneBank: JN200826.1) is set forth in SEQ ID No.26, and its DNA sequence is set forth in SEQ ID No.27.

(85) The primers 223tac-box5: 5-ATCGAGATCTACTGCATAATTCGTGTCGCTCAAG-3(SEQ ID No.28) and 223tac-box3: 5-ATCGAGATCTGTCTCATGAGCGGATACATATTTG-3 (SEQ ID No.29) were used for amplification to obtain the expression cassette of PglL, set forth in SEQ ID No.30.

(86) 2. The DNA molecule set forth in SEQ ID No.30 was subjected to enzyme digestion by BglII, to obtain a gene fragment; pET28a(+) was subjected to enzyme digestion by BglII, to obtain a large fragment; the gene fragment was ligated to the large fragment, to obtain the recombinant plasmid, designated as pETtac28-pglL. The pETtac28-pglL was sequenced, and the result was correct.

(87) (II) Construction of S. flexneri 2a 301 pCPwaaI/pETtac28-pglL Strain

(88) The pETtac28-pglL was transformed into S. flexneri 2a 301 pCPwaaI by electroporation, to obtain the S. flexneri 2a 301 pCPwaaI/pETtac28-pglL strain.

(89) (III) Identification of C-Terminal Sequence of the Core Peptide Fragment that Enables the Recombinant Fusion Protein to be O-Glycosylated

(90) 1. Construction of an Expression Vector of Recombinant CTB Fusion Protein

(91) According to the tertiary structure of Neisseria meningitidis pilin PilE (as shown in FIG. 4), polypeptides of different lengths containing serine (S63) at position 63 of PilE were truncated, CTB was used as carrier protein, and the polypeptides of different lengths were fused to the C-terminus of CTB. The particular method was as followed:

(92) With the N-terminus started from the serine (S45) at position 45 of PilE, and the C-terminus ended at lysine (K73) at position 73 of PilE, 29 amino acids from S45K73 were truncated, and fused to the C-terminus of CTB; and meanwhile, with the N-terminus of the PilE peptide fragment unchanged, and the C-terminus decreased successively by 2 or 1 amino acids, i.e., the peptide fragments of S45E71, S45S69, S45A67, S45V66, S45G65, S45A64 were fused to the C-terminus of CTB, respectively. In order to avoid steric hindrance effect between CTB and the peptide fragment, CTB was linked to the peptide fragment via 5 amino acids. Since glycosylation occurs in periplasmic space, according to the amino acid sequence of cholera toxin B subunit (X76390.1) published on GenBank, its signal peptide (the first 21 amino acids) was replaced with DsbA signal peptide, and meanwhile the C-terminus of the recombinant fusion protein was fused to a 6His tag, for the convenience of further detection, thereby constructing a series of recombinant CTB-recombinant fusion protein rCTB4573, rCTB4571, rCTB4569, rCTB4567, rCTB4566, rCTB4565, rCTB4564.

(93) The sequence encoding rCTB4573 is set forth in SEQ ID No.31, wherein starting from 5 end, the sequence from positions 64 to 372 is the CTB coding sequence, the sequence from positions of 388 to 474 is the sequence encoding the amino acids from positions of 45 to 73 of PilE, and the sequence from positions of 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rCTB4573 is set forth in SEQ ID No.32, wherein starting from N-terminus, the sequence from positions 20 to 122 is the CTB amino acid sequence, the sequence from positions 123 to 127 is the flexible linker, the sequence from positions 128 to 156 is the amino acids from positions 45 to 73 of PilE, the sequence from positions 157 to 166 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(94) The sequence encoding rCTB4571 is set forth in SEQ ID No.33, wherein starting from 5 end, the sequence from positions 64 to 372 is the CTB coding sequence, the sequence from positions 388 to 468 is the sequence encoding the amino acids from positions 45 to 71 of PilE, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rCTB4571 is set forth in SEQ ID No.34, wherein starting from N-terminus, the sequence from positions 20 to 122 is the CTB amino acid sequence, the sequence from positions 123 to 127 is the flexible linker, the sequence from positions 128 to 154 is the amino acids from positions 45 to 71 of PilE, the sequence from positions 155 to 163 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(95) The sequence encoding rCTB4569 is set forth in SEQ ID No.35, wherein starting from 5 end, the sequence from positions 64 to 372 is the CTB coding sequence, the sequence from positions 388 to 462 is the sequence encoding the amino acids from positions 45 to 69 of PilE, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rCTB4569 is set forth in SEQ ID No.36, wherein starting from N-terminus, the sequence from positions 20 to 122 is the CTB amino acid sequence, the sequence from positions 123 to 127 is the flexible linker, the sequence from positions 128 to 152 is the amino acids from positions 45 to 69 of PilE, the sequence from positions 153 to 161 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(96) The sequence encoding rCTB4567 is set forth in SEQ ID No.37, wherein starting from 5 end, the sequence from positions 64 to 372 is the CTB coding sequence, the sequence from positions 388 to 456 is the sequence encoding the amino acids from positions 45 to 67 of PilE, the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rCTB4567 is set forth in SEQ ID No.38, wherein starting from N-terminus, the sequence from positions 20 to 122 is the CTB amino acid sequence, the sequence from positions 123 to 127 is the flexible linker, the sequence from positions 128 to 150 is the amino acids from positions 45 to 67 of PilE, the sequence from positions 151 to 159 is the flexible linker and his-tag and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(97) The sequence encoding rCTB4566 is set forth in SEQ ID No.39, wherein starting from 5 end, the sequence from positions 64 to 372 is the CTB coding sequence, the sequence from positions 388 to 453 is the sequence encoding the amino acids from positions 45 to 66 of PilE, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rCTB4566 is set forth in SEQ ID No.40, wherein starting from N-terminus, the sequence from positions 20 to 122 is the CTB amino acid sequence, the sequence from positions 123 to 127 is the flexible linker, the sequence from positions 128 to 149 is the amino acids from positions 45 to 66 of PilE, the sequence from positions 150 to 158 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(98) The sequence encoding rCTB4565 is set forth in SEQ ID No.41, wherein starting from 5 end, the sequence from positions 64 to 372 is the CTB coding sequence, the sequence from positions 388 to 450 is the sequence encoding the amino acids from positions 45 to 65 of PilE, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rCTB4565 is set forth in SEQ ID No.42, herein starting from N-terminus, the sequence from positions 20 to 122 is the CTB amino acid sequence, the sequence from positions 123 to 127 is the flexible linker, the sequence from positions 128 to 148 is the amino acids from positions 45 to 65 of PilE, the sequence from positions 149 to 157 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(99) The sequence encoding rCTB4564 is set forth in SEQ ID No.43, wherein starting from 5 end, the sequence from positions 64 to 372 is the CTB coding sequence, the sequence from positions 388 to 447 is the sequence encoding the amino acids from positions 45 to 65 of PilE, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rCTB4564 is set forth in SEQ ID No.44, herein starting from N-terminus, the sequence from positions 20 to 122 is the CTB amino acid sequence, the sequence from positions 123 to 127 is the flexible linker, the sequence from positions 128 to 147 is the amino acids from positions 45 to 64 of PilE, the sequence from positions 148 to 156 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(100) EcoRI and HindIII were used in double enzyme digestion of the DNA molecules set forth in SEQ ID No.31, SEQ ID No.33, SEQ ID No.35, SEQ ID No.37, SEQ ID No.39, SEQ ID No.41, and SEQ ID No.43, to obtain gene fragments, respectively; and EcoRI and HindIII were used in double enzyme digestion of pMMB66EH, to obtain a large fragment; each of the gene fragments was ligated to the large fragment, to obtain the recombinant plasmid, designated as pMMB66EH-rCTB4573, pMMB66EH-rCTB4571, pMMB66EH-rCTB4569, pMMB66EH-rCTB4567, pMMB66EH-rCTB4566, pMMB66EH-rCTB4565, and pMMB66EH-rCTB4564, respectively. The recombinant plasmids were sequenced, and the results were correct.

(101) 2. Preparation of Glycoengineered Shigella flexneri

(102) The expression vectors pMMB66EH-rCTB4573, pMMB66EH-rCTB4571, pMMB66EH-rCTB4569, pMMB66EH-rCTB4567, pMMB66EH-rCTB4566, pMMB66EH-rCTB4565, and pMMB66EH-rCTB4564 prepared in Step 1 were transformed into the S. flexneri 2a 301 pCPwaaI/pETtac28-pglL strain prepared in the Step (II) by electroporation, and then the transformed cells were spread onto the LB solid medium containing kanamycin at a final concentration of 50 g/mL and ampicillin at a final concentration of 100 g/mL. The positive clones were the glycoengineered Shigella flexneri, i.e., S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4573, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4571, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4569, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4567, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4566, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4565 and S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4564.

(103) 3. Glycosylation of Recombinant CTB Fusion Protein and Identification Thereof

(104) The monoclonal colonies of glycoengineered Shigella flexneri, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4573, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4571, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4569, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4567, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4566, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4565 and S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4564 were seeded in LB medium containing ampicillin at a final concentration of 100 g/mL and kanamycin a final concentration of 50 g/mL, and cultured at 37 C.; when OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM, and the culture was cooled to 16 C. and induced for 20 h.

(105) The next day, 1 mL each of the bacterial liquids induced at 16 C. for 20 h, was centrifuged to extract bacteria, and the extracted bacteria were slowly suspended in 1 reducing buffer (50 mM pH 6.8 Tris-HCl, 1.6% SDS, 0.02% bromophenol blue, 8% glycerol, 20 mM DTT), in a boiling water bath for 10 min, to obtain the sample for electrophoresis. The sample was then subjected to 15% SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred onto PVDF membrane by Bio-Lab Semi-Dry Blotter, at a constant voltage of 20V for 1 h, and detected by Anti-His tag mouse monoclonal antibody, and the results are shown in FIG. 5.

(106) FIG. 5 shows that the truncated PilE peptide fragment with the C-terminus ended at V66, still enabled the recombinant CTB fusion protein to be O-glycosylated, but the glycosylation efficiency was significantly decreased compared to other recombinant CTB fusion proteins modified by a relatively longer peptide fragment.

(107) (IV) Identification of the N-Terminus Sequence of the Core Peptide Fragment that Enables the Recombinant Fusion Protein to be O-Glycosylated

(108) 1. Construction of an Expression Vector of the Recombinant EPA Fusion Protein

(109) According to the tertiary structure of Neisseria meningitidis pilin PilE (as shown in FIG. 4), polypeptides of different lengths containing serine (S63) at position 63 of PilE were truncated, rEPA was used as carrier protein, and the polypeptides of different lengths were fused to the N-terminus or C-terminus of rEPA. The particular method was as followed:

(110) With the N-terminus started from the glycine (G55) at position 55 of PilE, and the C-terminus ended at lysine (K73) at position 73 of PilE, 19 amino acids from G55K73 were truncated, and fused to the N-terminus of rEPA; or with the N-terminus started from the glycine (G55) at position 55 of PilE, and the C-terminus ended at serine (S69) at position 69 of PilE, 15 amino acids from G55S69 were truncated, and fused to the N-terminus of rEPA; or with the N-terminus started from the glycine (G55) at position 55 of PilE, and the C-terminus ended at valine (V66) at position 66 of PilE, 12 amino acids from G55V66 were truncated, and fused to the N-terminus of rEPA; or with the N-terminus started from the proline (P58) at position 58 of PilE, and the C-terminus ended at valine (V66) at position 66 of PilE, 9 amino acids from P58V66 were truncated, and fused to the N-terminus of rEPA; or with the N-terminus started from the seine (S45) at position 45 of PilE, and the C-terminus ended at lysine (K73) at position 73 of PilE, 29 amino acids from S45K73 were truncated, and fused to the C-terminus of rEPA; i.e., the peptide fragments of G55K73, G55S69, G55V66, P58V66 were fused to the N-terminus of rEPA, respectively, or the peptide fragment of S45K73 was fused to the C-terminus of rEPA. Since glycosylation occurs in periplasmic space, according to the amino acid sequence of Pseudomonas aeruginosa exotoxin A (AE004091.2) published on GenBank, its signal peptide (the first 25 amino acids) was replaced with DsbA signal peptide, E at position 553 was deleted, L at position 552 was mutated to V, and the C-terminus of the recombinant fusion protein was fused to a 6His tag, for the convenience of further detection, thereby constructing a series of recombinant EPA recombinant fusion proteins rEPA5573.sub.N, rEPA5569.sub.N, rEPA5566.sub.N, rEPA5866.sub.N, and rEPA4573.

(111) The sequence encoding rEPA4573 is set forth in SEQ ID No.45, wherein starting from 5 end, the sequence from positions 64 to 1899 is the rEPA coding sequence, the sequence from positions 1915 to 2001 is the sequence encoding the amino acids from positions 45 to 73 of PilE, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rEPA4573 is set forth in SEQ ID No.46, wherein starting from N-temrinus, the sequence from positions 20 to 631 is the rEPA amino acid sequence, the sequence from positions 632 to 636 is the flexible linker, the sequence from positions 637 to 665 is the amino acids from positions 45 to 64 of PilE, the sequence from positions 666 to 674 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(112) The sequence encoding rEPA5573.sub.N is set forth in SEQ ID No.47, wherein starting from 5 end, the sequence from positions 70 to 126 is the sequence encoding the amino acids from positions 55 to 73 of PilE, the sequence from positions 133 to 1962 is the rEPA coding sequence, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rEPA5573.sub.N is set forth in SEQ ID No.48, wherein starting from N-terminus, the sequence from positions 22 to 40 is the amino acids from positions 55 to 73 of PilE, the sequence from positions 41 to 42 is the flexible linker, the sequence from positions 43 to 652 is the rEPA amino acid sequence, the sequence from positions 653 to 666 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(113) The sequence encoding rEPA5569.sub.N is set forth in SEQ ID No.49, wherein starling from 5 end, the sequence from positions 70 to 114 is the sequence encoding the amino acids from positions 55 to 69 of PilE, the sequence from positions 121 to 1950 is the rEPA coding sequence, the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rEPA5569.sub.N is set forth in SEQ ID No.50, wherein starting from N-terminus, the sequence from positions 22 to 36 is the amino acids from positions 55 to 69 of PilE, the sequence from positions 37 to 38 is the flexible linker, the sequence from positions 39 to 648 is the rEPA amino acid sequence, the sequence from positions 649 to 662 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(114) The sequence encoding rEPA5566.sub.N is set forth in SEQ ID No.51, wherein starting from 5 end, the sequence from positions 70 to 105 is the sequence encoding the amino acids from positions 55 to 66 of PilE, the sequence from positions 112 to 1941 is the rEPA coding sequence, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rEPA5566.sub.N is set forth in SEQ ID No.52, wherein starting from N-terminus, the sequence from positions 22 to 33 is the amino acids from positions 55 to 66 of PilE, the sequence from positions 34 to 35 is the flexible linker, the sequence from positions 36 to 645 is the rEPA amino acid sequence, the sequence from positions 646 to 659 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(115) The sequence encoding rEPA5866.sub.N is set forth in SEQ ID No.53, wherein starting from 5 end, the sequence from positions 70 to 96 is the sequence encoding the amino acids from positions 58 to 66 of PilE, the sequence from positions 103 to 1932 is the rEPA coding sequence, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rEPA5866.sub.N is set forth in SEQ ID No.54, wherein starting from N-terminus, the sequence from positions 22 to 30 is the amino acids from positions 58 to 66 of PilE, the sequence from positions 31 to 32 is the flexible linker, the sequence from positions 33 to 642 is the rEPA amino acid sequence, the sequence from positions 643 to 656 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(116) EcoRI and HindIII were used in double enzyme digestion of the DNA molecules set forth in SEQ ID No.45, SEQ ID No.47, SEQ ID No.49, SEQ ID No.51, and SEQ ID No.53, to obtain gene fragments, respectively; EcoRI and HindIII were used in double enzyme digestion of pMMB66EH, to obtain a large fragment; each of the gene fragments was ligated to the large fragment to obtain the recombinant plasmid, designated as pMMB66EH-rEPA4573, pMMB66EH-rEPA5573.sub.N, pMMB66EH-rEPA5569.sub.N, pMMB66EH-rEPA5566.sub.N, and pMMB66EH-rEPA5866.sub.N, respectively. The recombinant plasmids were sequenced, and the results were correct.

(117) 2. Preparation of Glycoengineered Shigella flexneri

(118) The expression vectors pMMB66EH-rEPA4573, pMMB66EH-rEPA5573.sub.N, pMMB66EH-rEPA5569.sub.N, pMMB66EH-rEPA5566.sub.N, and pMMB66EH-rEPA5866.sub.N prepared in Step 1 were electrotransformed into S. flexneri 2a 301 pCPwaaI/pETtac28-pglL strain prepared in the Step (II), respectively, and the transformed cells were spread onto LB solid medium containing kanamycin at a final concentration of 50 g/mL and ampicillin at a final concentration of 100 g/mL. The positive clones were the glycoengineered Shigella flexneri, i.e., S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA4573, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA5573.sub.N, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA5569.sub.N, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA5566.sub.N, and S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA5866.sub.N.

(119) 3. Glycosylation of EPA Fusion Protein and Identification Thereof

(120) The monoclonal colonies of glycoengineered bacteria S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA4573, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA5573.sub.N, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA5569.sub.N, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA5566.sub.N, and S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA5866.sub.N, were seeded in LB medium containing ampicillin at a final concentration of 100 g/mL and kanamycin at a final concentration of 50 g/mL, and cultured at 37 C. When the OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM, and the culture were cooled to 16 C. and induced for 20 h.

(121) The next day, 1 mL each of the bacterial liquids induced at 16 C. for 20 h, was centrifuged to extract the bacteria, and the extracted bacteria were slowly suspended in 1 reducing buffer, in a boiling water bath for 10 min, to obtain the sample for electrophoresis. The sample was subjected to 8% SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred onto PVDF membrane by Bio-Lab Semi-Dry Blotter, at a constant voltage of 20V for 1 h, and detected by anti-EPA antibody, and the results are shown in FIG. 6.

(122) FIG. 6 shows that the truncated PilE proteins, i.e., the peptide fragments of G55K73, G55S69, and G55V66, fused to the N-terminus of EPA protein, still successfully enabled the recombinant EPA fusion protein to be O-glycosylated, but the glycosylation efficiency of the recombinant EPA fusion protein gradually decreased with the shortening of the truncated peptide fragment.

(123) The above results show that the core peptide fragment, which enables the recombinant fusion protein to be O-glycosylated, is G55V66 of PilE. However, in view of the practical application, in the invention, relevant studies are carried out by fusing the amino acid sequence of P1a (i.e., S45K73 of PilE) (PilE with a Genbank accession number of NC_003112.2) to a different carrier protein at a suitable position.

(124) III. Preparation of Shigella flexneri O-Polysaccharide-Recombinant CTB Fusion Protein Conjugate by One-Step Bioconjugate Method

(125) (I) The monoclonal colony of the glycoengineered bacterium S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4573, was seeded to LB medium containing 100 g/mL ampicillin and 50 g/mL kanamycin, and cultured at 37 C. When OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM, and the culture was cooled to 16 C. and induced for 20 h.

(126) (II) Purification of O-polysaccharide-recombinant CTB fusion protein conjugate rCTB4573-OPS.sub.Sf301

(127) 1. Sample Pretreatment

(128) To 10 g bacteria induced at 16 C. for 20 h in the Step (I), 100 mL purified water was added. The bacteria were broken ultrasonically (ultrasonication for 3 s and pause for 5 s, with an accumulative period of ultrasonication for 30 min), and centrifuged at 1200 g. The supernatant as collected, and a sample loading buffer (20 mM pH7.5 Tris-HCl, 0.2M NaCl, 10 mM imidazole) was added to the supernatant. After well stirring, centrifugation was carried out at 12000 g again. The supernatant was collected, and the supernatant was the crude extract containing O-polysaccharide-recombinant CTB fusion protein conjugate rCTB4573-OPS.sub.Sf301.

(129) 2. Purification of a Sample with Chelating Affinity Chromatographic Column

(130) The sample was preliminarily purified with Chelating affinity chromatographic column (1.6 cm*15 cm).

(131) Firstly, the column was washed with at least three column volumes of 0.5M NaOH aqueous solution, and then equilibrated with deionized water to a neutral pH. The column was then equilibrated with at least 3 column volumes of 0.5M NiSO.sub.4 aqueous solution, further equilibrated with at least one column volume of B1 solution (20 mM pH7.5 Tris-HCl, 0.5M NaCl, 500 mM imidazole), and finally equilibrated with at least 3 column volumes of A1 solution (20 mM pH7.5 Tris-HCl, 0.5M NaCl, 10 mM imidazole), all at a flow rate of 4 mL/min. The crude extract of rCTB4573-OPS.sub.Sf301 obtained in Step 1 was loaded from A pipeline, and A1 solution (20 mM pH7.5 Tris-HCl, 0.5M NaCl, 10 mM imidazole) was used to wash the unbound protein, until the ultraviolet absorption (280 nM) was close to 0 mAU. Finally, 100% B1 (20 mM pH7.5 Tris-HCl, 0.5M NaCl, 500 mM imidazole) was used for elution, and 30 mL eluate was collected to obtain the preliminarily purified sample.

(132) 3. Sample Desalting

(133) The preliminarily purified sample obtained in Step 2 was desalted with G25 fine chromatographic column (1.6 cm*30 cm), wherein the mobile phase was A2 solution (20 mM pH5.4 HAcNaAc).

(134) Firstly, the column was washed with at least 3 column volumes of 0.5M NaOH aqueous solution, then equilibrated with deionized water to a neutral pH, and finally equilibrated with at least 3 column volumes of A2 solution. The preliminarily purified sample obtained in Step 2 was loaded from A pipeline, wherein the mobile phase was A2 solution (20 mM pH5.4 HAcNaAc). 60 mL sample was collected to obtain the desalted sample. And all the flow rates involved in each step of the above described process were 4 mL/min.

(135) 4. Further Purification of rCTB4573-OPS.sub.Sf301 with ProteinPak SP8HR Cation Exchange Chromatographic Column

(136) The desalted sample obtained in Step 3 was further purified with ProteinPak SP8HR cation exchange chromatographic column.

(137) Firstly, the column was washed with at least 3 column volumes of 0.5M NaOH aqueous solution, and then equilibrated with deionized water to a neutral pH. The column was then equilibrated with at least 3 column volumes of A2 solution (20 mM pH5.4 HAcNaAc). The sample was loaded from A pipeline, the A2 solution was used to wash the unbound glycoprotein, and linear elution from 0 to 50% B2 solution was carried out (the A2 solution entered from A pipeline and the B2 solution entered from B pipeline, were automatically mixed by the purifier) within 30 min. The eluate was collected. And all the flow rates involved in each step of the above described process were 1 mL/min. The peak of the glycoprotein rCTB4573-OPS.sub.Sf301 appeared with an electric conductivity of about 3545 mS/cm, i.e., the target protein rCTB4573-OPS.sub.Sf301.

(138) The sample was analyzed by 12% SDS-PAGE and western blot, and the results are shown in FIG. 7. In FIG. 7, M represents protein marker bacteria-breaking supernatant represents the crude extract of rCTB4573-OPS.sub.Sf301 obtained in Step 1; Ni represents the preliminarily purified sample obtained in Step 2; SP8HR represents the target protein rCTB4573-OPS.sub.Sf301 further purified by ProteinPak SP8HR cation exchange chromatographic column; anti-His represents the western blot result by Anti-His tag mouse monoclonal antibody; and anti-OPS.sub.Sf301 represents the western blot result by rabbit Anti-OPS.sub.Sf301 antiserum.

(139) IV. Preparation of Shigella flexneri O-Polysaccharide-Recombinant EPA Fusion Protein Conjugate by One-Step Bioconjugate Method

(140) (I) The monoclonal colony of glycoengineered bacterium S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA4573, was seeded to a LB medium containing 100 g/mL ampicillin and 50 g/mL kanamycin, and cultured at 37 C. When OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM, and the culture was cooled to 16 C. and induced for 20 h.

(141) (II) Purification of O-polysaccharide-recombinant EPA fusion protein conjugate rEPA4573-OPS.sub.Sf301

(142) 1. Sample Pretreatment

(143) To 10 g bacteria induced at 16 C. for 20 h in the Step (1), 100 mL purified water was added. The bacteria were broken ultrasonically (ultrasonation for 3 s and pause for 5 s, with an accumulative period of ultrasonation for 30 min), and centrifuged at 12000 g. The supernatant was collected, a sample loading buffer (20 mM pH7.5 Tris-HCl, 0.2M NaCl, 10 mM imidazole) was added to the supernatant. After well stirring, the centrifugation was carried out at 12000 g again. The supernatant was collected, and the supernatant was the crude extract containing the O-antigen polysaccharide-recombinant EPA fusion protein conjugate rEPA4573-OPS.sub.Sf301.

(144) 2. Purification of a Sample with Chelating Affinity Chromatographic Column

(145) The sample was preliminarily purified with Chelating affinity chromatographic column (1.6 cm*15 cm).

(146) Firstly, the column was washed with at least three column volumes of 0.5M NaOH aqueous solution, and then equilibrated with deionized water to a neutral pH. The column was then equilibrated with at least 3 column volumes of 0.5M NiSO.sub.4 aqueous solution, further equilibrated with at least one column volume of B1 solution (20 mM pH7.5 Tris-HCl, 0.5M NaCl, 500 mM imidazole), and finally equilibrated with at least 3 column volumes of A1 solution (20 mM pH7.5 Tris-HCl, 0.5M NaCl, 10 mM imidazole), all at a flow rate of 4 mL/min. The crude extract of rEPA4573-OPS.sub.Sf301 obtained in Step 1 was loaded from A pipeline, and A1 solution (20 mM pH7.5 Tris-HCl, 0.5M NaCl, 10 mM imidazole) was used to wash the unbound protein. Finally, 100% B1 (20 mM pH7.5 Tris-HCl, 0.5M NaCl, 500 mM imidazole) was used for elution, and 30 mL eluate was collected to obtain the preliminarily purified sample.

(147) 3. Sample Desalting

(148) The sample preliminarily purified with Chelating affinity chromatographic column was desalted with G25 fine chromatographic column (1.6 cm*30 cm), wherein the mobile phase was A3 solution (20 mM pH7.5 Tris-HCl).

(149) Firstly, the column was washed with at least 3 column volumes of 0.5M NaOH aqueous solution, then equilibrated with deionized water to a neutral pH, and finally equilibrated with at least 3 column volumes of A3 solution. The preliminarily purified sample obtained in Step 2 was loaded from A pipeline, and 60 mL sample was collected to obtain the desalted sample, wherein the mobile phase was A3 solution (20 mM pH7.5 Tris-HCl). And all the flow rates involved in each step of the above described process were 4 mL/min.

(150) 4. Further Purification of rEPA4573-OPS.sub.Sf301 with ProteinPak DEAE8HR Anion Exchange Chromatographic Column

(151) The desalted sample obtained in Step 3 was further purified with ProteinPak DEAE8HR anion exchange chromatographic column (waters).

(152) Firstly, the column was washed with at least 3 column volumes of 0.5M NaOH aqueous solution, and then equilibrated with deionized water to a neutral pH. The column was then equilibrated with at least 3 column volumes of A3 solution (20 mM pH7.5 Tris-HCl). The sample was loaded from A pipeline, the A3 solution was used to wash the unbound glycoprotein, and linear elution from 0 to 50% B3 solution was carried out (the A3 solution entered from A pipeline, and the B3 solution entered from B pipeline, were automatically mixed by the purifier) within 30 min. The eluate was collected. And all the flow rates involved in each step of the above described process were 1 mL/min. The peak of the glycoprotein rEPA4573-OPS.sub.Sf301 appeared with an electric conductivity of about 818 mS/cm, i.e., the crude extract of the target protein rEPA4573-OPS.sub.Sf301.

(153) 5. Fine Purification of rEPA4573-OPS.sub.Sf301 with Superdex 75 Chromatographic Column

(154) The sample purified with ProteinPak DEAE8HR anion exchange chromatographic column was further purified with Superdex 75 FPLC(1 cm*30 cm, GE Company).

(155) Firstly, the column was washed with at least 3 column volumes of 0.5M NaOH aqueous solution, and than equilibrated with deionized water to a neutral pH. The column was then equilibrated with at least 3 column volumes of A4 solution (20 mM pH7.5 PB, 0.9 g/100 ml NaCl), and 1 mL of the crude extract of the protein rEPA4573-OPS.sub.Sf301 was loaded via a loading loop. 811 mL effluent sample was collected. The sample was the finely purified rEPA4573-OPS.sub.Sf301, i.e., the target protein rEPA4573-OPS.sub.Sf301.

(156) The sample was analyzed by 8% SDS-PAGE and western blot, and the S. flexneri 2a 301 pCPwaaI/pMMB66EH-rEPA4573, which as transformed only with pMMB66EH-rEPA4573, but not with pETtac28-pglL, was used as control.

(157) The results are shown in FIG. 8. In FIG. 8, from left to right, Lane 1 represents the control protein; Lane 2 represents the crude extract of rEPA4573-OPS.sub.Sf301 obtained in Step 1; the purified sample represents the target protein rEPA4573-OPS.sub.Sf301 finely purified in Step 5; CB straining represents the Commassie Blue staining result of the purified sample; Anti-his represents the western blot result by Anti-His tag mouse monoclonal antibody; Anti-OPS.sub.Sf301 represents the western blot result by rabbit Anti-OPS.sub.Sf301 anti-serum.

(158) V. Preparation and Animal Experiment Evaluation of rCTB4573-OPS.sub.Sf301 and rEPA4573-OPS.sub.Sf301 Polysaccharide-Protein Conjugate Vaccines

(159) (I) Preparation of rCTB4573-OPS.sub.Sf301 and rEPA4573-OPS.sub.Sf301 polysaccharide-protein conjugate vaccines

(160) The rCTB4573-OPS.sub.Sf301 purified in Step III and the rEPA4573-OPS.sub.Sf301 purified in Step IV were sterilized by filtration, and separately mixed with aluminium hydroxide adjuvant in a volume ratio of 9:1, to obtain the samples of rCTB4573-OPS.sub.Sf301 and rEPA4573-OPS.sub.Sf301 for intraperitoneal injection.

(161) (II) Animal Immunization with rCTB4573-OPS.sub.Sf301 and rEPA4573-OPS.sub.Sf301 and Effect Evaluation Thereof

(162) 1. Preparation of O-Antigen (OPS.sub.Sf301)

(163) LPS (see, the paper Sun Yang, Feng Shuzhang, Zhu Lingwei, et al., Preparation and identification of monoclonal antibodies against LPS of entero-hemorrhagic E. coli O157 [J]. Chinese Journal of Zoonoses, 2007, 23(10): 971-973.) was extracted by means of hot phenol-water extraction, and lyophilized. The lyophilized sample was dissolved in 1% glacial acetic acid at a concentration of 10 mg/ml, in a boiling water bath for 90 min, and then cooled to room temperature. pH was adjusted to 7.0. After centrifugation at 64000g for 5 h, the supernatant was collected, and was lyophilized after extensive dialysis with deionized water.

(164) 2. Mouse Experiment

(165) 40 6-week-old female Balb/c mice, were randomly divided into the following four groups: the aluminium hydroxide group, the OPS.sub.Sf301 group, the rCTB4573-OPS.sub.Sf301 group and the rEPA4573-OPS.sub.Sf301 group, wherein the aluminium hydroxide group was used as negative control, and each of the other three groups was injected with 2.5 g of polysaccharide as calculated based on the polysaccharide content of the conjugate vaccine as used. Each of the groups was immunized at Day 1, 14, 28, and eyeball was removed to collect blood 10 days after the last immunization.

(166) Indirect ELISA was used to determine the titer of antibody against the Shigella flexneri 2a type O-antigen polysaccharide in the serum of each group of mice. The assay plates were coated with the extracted LPS of the Shigella flexneri 2a 301 strain, and each well was coated with 10 g LPS. As to the other operating steps, please refer to Short Protocols in Molecular Biology [M]. Science Press, 2008.

(167) The results are shown in FIG. 9. In FIG. 9, A1 group represents the aluminium hydroxide group; OPS group represents the OPS.sub.Sf301 group; rCTB-OPS group represents the rCTB4573-OPS.sub.Sf301 group; rEPA4573-OPS group represents the rEPA4573-OPS.sub.Sf301 group. FIG. 9 shows that as compared with OPS.sub.Sf301, the rCTB4573-OPS.sub.Sf301 purified in Step III and the rEPA4573-OPS.sub.Sf301 purified in Step IV could significantly induce the generation of specific antibodies against OPS (O-polysaccharide) of Shigella flexneri 2a 301 in mice.

(168) VI. Increasing the Ratio of Polysaccharides/Protein by Connection of O-Glycosylation Sites in Tandem

(169) (I) Construction of an Expression Vector of the Recombinant CTB Fusion Protein rCTB4573.sub.2 Containing Two P1a Sequences

(170) In order to increase the percentage of polysaccharides in a glycoprotein, the amino acid sequences of two P1a (i.e., S45K73 of PilE) were fused in tandem to the C-terminus of CTB, to synthesize rCTB4573.sub.2.

(171) The sequence encoding rCTB4573.sub.2 is set forth in SEQ ID No.55, wherein starting from 5 end, the sequence from positions 64 to 372 is the CTB coding sequence, the sequence from positions 388 to 474, and the sequence from positions 487 to 573 each are the sequence encoding the amino acids from positions 45 to 67 of PilE, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rCTB4573.sub.2 is set forth in SEQ ID No.56, wherein starting from N-terminus, the sequence from positions 20 to 122 is the CTB amino acid sequence, the sequence from positions 123 to 127, and the sequence from positions 157 to 160 is the flexible linker, the sequence from positions 128 to 156 and the sequence from positions 161 to 189 each are the amino acids from positions 45 to 73 of PilE, the sequence from positions 190 to 199 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(172) EcoRI and HindIII were used in double enzyme digestion of the DNA molecule set forth in SEQ ID No.55, to obtain a gene fragment; EcoRI and HindIII were used in double enzyme digestion of pMMB66EH, to obtain a large fragment; the gene fragment was ligated to the large fragment, to obtain the recombinant plasmid, designated as pMMB66EH-rCTB4573.sub.2. The recombinant plasmid pMMB66EH-rCTB4573.sub.2 was sequenced, and the results were correct.

(173) (II) Construction of an Expression Vector of the Recombinant EPA Fusion Protein (rEPA4573.sub.NMC) Containing Three P1a Sequences

(174) In order to increase the percentage of polysaccharides in a glycoprotein, according to the steric structure of EPA, three P1a sequences (i.e., S45K73 of PilE) was introduced on the molecular surface. The particular method was as followed: two P1a polypeptides were fused at the N-terminus and C-terminus of rEPA, respectively; and one P1a polypeptide was fused between K240 and P241 of rEPA, so as to construct rEPA4573.sub.NMC.

(175) The sequence encoding rEPA4573.sub.NMC is set forth in SEQ ID No.57, wherein starting from 5 end, the sequence from positions 70 to 156, the sequence from positions 877 to 963, and the sequence from positions 2101 to 2187 each are the sequence encoding the amino acids from positions 45 to 67 of PilE, the sequence from positions 2188 to 2217 is the sequence encoding the flexible linker and his-tag, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide. The amino acid sequence of the protein rEPA4573.sub.NMC is set forth SEQ ID No.58. The sequence from positions 1 to 19 is the DsbA signal peptide; the sequence from positions 22 to 50, the sequence from positions 291 to 319, and the sequence from positions 699 to 727 each are the amino acids from positions 45 to 73 of PilE; the sequence from positions 694 to 698 is the flexible linker, and the sequence from positions 728 to 736 is the flexible linker and his-tag sequence.

(176) EcoRI and HindIII were used in double enzyme digestion of the DNA molecule set forth in SEQ ID No. 57, to obtain a gene fragment; EcoRI and HindIII were used in double enzyme digestion of pMMB66EH, to obtain a large fragment; the gene fragment was ligated to the large fragment, to obtain the recombinant plasmid, designated as pMMB66EH-rEPA4573.sub.NMC. The recombinant plasmid pMMB66EH-rEPA4573.sub.NMC was sequenced, and the results were correct.

(177) (III) Preparation of Glycoengineered Shigella flexneri

(178) In accordance with the method for preparing glycoengineered Shigella flexneri as disclosed in Step II (III), the glycoengineered bacteria S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4573.sub.2 and S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA4573.sub.NMC were constructed, respectively.

(179) (IV) Glycosylation of rCTB4573.sub.2 and rEPA4573.sub.NMC in the Glycoengineered Shigella flexneri and Identification Thereof

(180) The monoclonal colonies of glycoengineered bacteria S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4573.sub.2 and S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA4573.sub.NMC, were seeded in LB medium containing ampicillin at a final concentration of 100 g/mL and kanamycin at a final concentration of 50 g/mL, respectively, and cultured at 37 C. When OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM. The culture was cooled to 16 C. and induced for 20 h.

(181) The next day, 1 mL bacterial liquid induced at 16 C. for 20 h, was centrifuged to extract bacteria, and the extracted bacteria were slowly suspended in 1 reducing buffer in a boiling water bath for 10 min, to obtain the sample for electrophoresis. The sample was then subjected to SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred onto PVDF membrane by Bio-Lab Semi-Dry Blotter, at a constant voltage of 20V for 1 h, and detected by Anti-His tag mouse monoclonal antibody. The results are shown in FIG. 10.

(182) Meanwhile, S. flexneri 2a 301 pCPwaaI/pMMB66EH-rCTB4573.sub.2, S. flexneri 2a 301 pCPwaaI/pMMB66EH-rEPA4573.sub.NMC, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4573, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA4573, S. flexneri 2a 301 pCPwaaI/pMMB66EH-rCTB4573, and S. flexneri 2a 301 pCPwaaI/pMMB66EH-rEPA4573 were used as control.

(183) FIG. 10 shows that the recombinant fusion proteins rCTB4573, rEPA4573 expressed in the glycoengineered bacteria S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rCTB4573.sub.2 and S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rEPA4573.sub.NMC, were O-glycosylated, and after the introduction of multiple glycosylation sites, the appearance of several groups of glycosylated bands indicated that the proteins were effectively glycosylated at multiple sites.

(184) VII. Preparation of Shigella flexneri O-Polysaccharide-Recombinant TTC Fusion Protein Conjugate by One-Step Bioconjugate Method

(185) (I) Construction of an Expression Vector of the TTC Fusion Protein

(186) According to the amino acid sequence of fragment C of tetanus toxin (AF154828.1) published on GenBank, DsbA signal peptide is fused to its N-terminus, the polypeptide of P1a (i.e., S45K73 of PilE) and a 6His tag were fused to its C-terminus, so as to construct the recombinant fragment C of tetanus toxin, rTTC4573.

(187) The sequence encoding rTTC4573 is set forth in SEQ ID No.59, wherein starting from 5 end, the sequence from positions 64 to 1371 is the TTC coding sequence, the sequence from positions 1387 to 1473 is the sequence encoding the amino acids from positions 45 to 67 of PilE, and the sequence from positions 7 to 63 is the sequence encoding DsbA signal peptide.

(188) The amino acid sequence of the protein rTTC4573 is set forth in SEQ ID No.60, wherein starting from N-terminus, the sequence from positions 20 to 455 is the TTC amino acid sequence, the sequence from positions 461 to 489 is the amino acids from positions 45 to 73 of PilE, the sequence from positions 490 to 498 is the flexible linker and his-tag, and the sequence from positions 1 to 19 is the DsbA signal peptide sequence.

(189) EcoRI and HindIII were used in double enzyme digestion of the DNA molecule set forth in SEQ ID No.59, to obtain a gene fragment; EcoRI and HindIII were used in double enzyme digestion of pMMB66EH, to obtain a large fragment; and the gene fragment was ligated to the large fragment, to obtain the recombinant plasmid, designated as pMMB66EH-rTTC4573. The pMMB66EH-rTTC4573 was sequenced, and the result was correct.

(190) (II) Preparation of Glycoengineered Shigella flexneri

(191) S. flexneri 2a 301 pCPwaaI/pETtac28-pglL was transformed with the pMMB66EH-rTTC4573, to construct the glycoengineered Shigella flexneri, S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rTTC4573.

(192) (III) Glycosylation of rTTC4573 in the Glycoengineered Shigella flexneri and Identification Thereof

(193) The monoclonal colony of glycoengineered bacterium S. flexneri 2a 301 pCPwaaI/pETtac28-pglL/pMMB66EH-rTTC4573 was seeded to LB medium containing 100 g/mL ampicillin and 50 g/mL kanamycin, and cultured at 37 C. When OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM. The culture was cooled to 25 C. and induced for 20 h.

(194) Meanwhile, S. flexneri 2a 301 pCPwaaI/pMMB66EH-rTTC4573 was subjected to said induction experiment, as control.

(195) The next day, 1 mL of the bacterial liquid induced at 25 C. for 20 h, was centrifuged to extract bacteria, and the extracted bacteria were slowly suspended in 1 reducing buffer, in a boiling water bath for 10 min, to obtain the sample for electrophoresis. The sample was then subjected to SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred onto PVDF membrane by Bio-Lab Semi-Dry Blotter, at a constant voltage of 20V for 1 h, and detected Anti-His tag mouse monoclonal antibody. The results are shown in FIG. 11.

(196) FIG. 11 shows that the substrate protein rTTC4573, in the presence of oligosaccharyltransferase PglL, was O-glycosylated.

Example 2. Preparation of Salmonella paratyphi A O-Polysaccharide-Recombinant CTB Fusion Protein by One-Step Bioconjugate Method

(197) I. Preparation of O-Antigen Ligase Gene waaL-Defective Salmonella paratyphi A

(198) (I) Preparation of linear targeting DNA fragment

(199) 1. Design and Synthesis of PCR Primers

(200) According to the waaL gene (GenBank number of CP000026, from positions 3696236 to 3697450) listed in the complete genomic sequence (NC_006511) of Salmonella paratyphi A 50973 strain (S. paratyphi CMCC50973) on NCBI, as well as upstream and downstream sequences thereof, a pair of primers, i.e., 73waaLu1/73waaLu2 and 73waaId1/73waaLd2, were designed for each of the upstream (5end) and the downstream (3end) of Salmonella paratyphi A 50973 waaI gene. For the convenience of operation, the BamHI and SalI restriction enzyme cleavage sites were added to the end of the primer for the upstream homologous arm up, and the HindIII and XhoI restriction enzyme cleavage sites were added to the end of the primer for the downstream homologous arm down.

(201) In addition, in order to confirm whether the mutant was constructed successfully, a pair of primers (73waaLw1/73waaLw2) located outside the regions of the upstream and downstream homologous arms of waaI gene in the genome, a pair of internal primers for identification (73waaLn1/73waaLn2) and a pair of primers for kan gene (Kan1/Kan2) were designed to carry out PCR verification, and sequencing verification.

(202) The primes are shown in Table 2 (in Table 2, the underlined sequences refer to the enzyme recognition sites).

(203) TABLE-US-00007 TABLE2 Primersequencelisting2 Primer Sequence(5 .fwdarw. 3) Use 73waaLu1 CGGGATCCAGGCTTTGACTATG for TGGA(SEQIDNo.61) amplification 73waaLu2 GCGTCGACATCTGGCGATATGA ofup GTATG(SEQIDNo.62) fragment 73waaLd1 CCAAGCTTTAGTGCAGGCATAT for TGGG(SEQIDNo.63) amplification 73waaLd2 CCCTCGAGTATCACCTCGCAGA ofdown ACCT(SEQIDNo.64) fragment 73waaLw1 AACACCGGATTACGGATAA for (SEQIDNo.65) identification 73waaLw2 TGCATGGTGGCTGTAGAA ofthe (SEQIDNo.66) mutantstrain 73waaLn1 AGAAACGGTTGCGAAAAT for (SEQIDNo.67) identification 73waaLn2 ATAGCCGTAGCCCTTGAT ofthe (SEQIDNo.68) mutantstrain Kan1 GCGTCGACGTGTAGGCTGGAGC for TGCTTC(SEQIDNo.69) identification Kan2 CCAAGCTTATGGGAATTAGCCA ofthe TGGTCC(SEQIDNo.70) mutantstrain

(204) 2. Construction of Linear Targeting DNA Fragments

(205) 1) The genomic DNA of Salmonella paratyphi A 50973 strain was used as template, and 73waaLu1/73waaLu2 and 73waaLd1/73waaLd2 were used to amplify the upstream and downstream homologous arms of waaL gene, i.e., up and down, respectively.

(206) PCR program was as followed: 94 C. 10 min; 94 C. 30 s, 50 C. 30 s, 72 C. 30 s, 30 cycles; 72 C. 10 min.

(207) 2) Construction of pETKan was performed as disclosed in Example 1.

(208) 3) BamHI and SalI were used in double enzyme digestion of the up fragment, to obtain the gene fragment 3; BamHI and SalI were used in double enzyme digestion of the plasmid pETKan, to obtain the large fragment 3; and the gene fragment 3 was ligated to the large fragment 3, to obtain the intermediate vector 3;

(209) HindIII and XhoI were used in double enzyme digestion of the down fragment, to obtain the gene fragment 4; HindIII and XhoI were used in double enzyme digestion of the intermediate vector 3, to obtain the large fragment 4; and the gene fragment 4 was ligated to the large fragment 4, to obtain the intermediate vector 4.

(210) 4) BamHI and XhoI were used in double enzyme digestion of the intermediate vector 4, to obtain the targeting DNA fragment of interest, flanked by the homologous arms, and having the kan gene in the middle region. The nucleotide sequence of the fragment is set forth in SEQ ID No.71.

(211) In SEQ ID No.71, starting from 5 end, the nucleotides from positions 7 to 571 refer to the up fragment, the nucleotides from positions 578 to 2073 refer to the kan gene, and the nucleotides from positions 2080 to 2543 refer to the down fragment.

(212) The DNA fragment set forth in SEQ ID No.71 was used as template, and 73waaLu1 and 73waaLd2 were used as primers, to further amplify the targeting fragment by PCR, to obtain the linear targeting DNA fragment at a concentration of up to 300 ng/L.

(213) (II) Construction of S. paratyphi CMCC50973/pKOBEG

(214) Since the plasmid pKOBEG comprised the genes encoding the enzymes necessary for -Red recombination system, the plasmid pKOBEG was transformed into Salmonella paratyphi A 50973 competent cells by electroporation, and the transformed cells were spread onto LB-plate containing chloramphenicol (the plasmid pKOBEG is chloramphenicol-resistant), and cultured at 30 C. overnight, to obtain the positive clone, designated as S. paratyphi 50973/pKOBEG strain.

(215) (III) Transformation of S. paratyphi 50973/pKOBEG with the linear targeting DNA fragments by electroporation

(216) 1. The S. paratyphi CMCC50973/pKOBEG was seeded to low salt LB liquid medium containing chloramphenicol at a final concentration of 30 g/mL, cultured at 30 C. overnight, and then passaged in low salt LB liquid medium at a volume ratio of 1:100 for future culture.

(217) 2. L-arabinose was added at a final concentration of 1 mmol/L to induce the expression of Red recombination system at 1 h before the OD.sub.600 value of the culture medium in Step 1 reached 0.6.

(218) 3. When the OD.sub.600 of the culture medium in Step 2 reached 0.6, the S. paratyphi CMCC50973/pKOBEG was transformed with 5 L the targeting DNA fragments as prepared in Step (I) at 300 ng/L by electroporation.

(219) 4. To the transformed cells, 1 mL precooled low salt LB liquid medium was added. The cells were thawed at 30 C. for about 2.5 h, and then were spread onto a LB plate containing kanamycin at a concentration of 50 g/mL, and cultured in a 30 C. incubator overnight; and the positive clone was screened out.

(220) 5. The positive clone was seeded to LB liquid medium containing kanamycin at a concentration of 50 g/mL, and cultured at 42 C. and passaged twice (12 h for each passage), thereby resulting in the deletion of the plasmid pKOBEG. The kanamycin-resistant, waaI-deleted mutant strain was obtained finally, designated as S. paratyphi CMCC50973 waaL::kan.

(221) (IV) The plasmid pCP20 encoding a FRT site-specific recombinase was transformed into S. paratyphi CMCC50973 waaL::kan by electroporation, and cultured in kanamycin-free LB plate containing chloramphenicol at a concentration of 50 g/mL at 30 C. The positive clone of Cm.sup.rKm.sup.s(chloramphenicol-resistant, kanamycin-sensitive) was screened.

(222) (V) The positive clone screened in Step (IV), was transferred to liquid LB, and cultured at 42 C. for 12 h, to obtain the target gene-deleted mutant free of the kanamycin resistance gene and the plasmid pCP20, designated as S. paratyphi CMCC50973waaL, i.e., lipopolysaccharide synthesis-deficient Salmonella paratyphi A.

(223) II. Molecular Identification of S. paratyphi CMCC50973waaL

(224) The genomic DNA of S. paratyphi CMCC50973 and S. paratyphi CMCC50973waaL were used as template, respectively, and a pair of waaL inner primers (73waaLn1/73waaLn2), a pair of waaL outer primers (73waaLw1/73waaLw2) and a pair of kan primers (kan1/kan2) were used to carry out PCR verification, respectively.

(225) The results are shown in FIG. 12. In FIG. 12, 50973waaL represents S. paratyphi CMCC50973waaL; and 50973 represents S. paratyphi CMCC50973. FIG. 12 shows that when the genomic DNA of S. paratyphi CMCC50973waaL was used as template, and the waaL inner primers were used as primers to carry out PCR amplification, no target bands appeared; when the genomic DNA of S. paratyphi CMCC50973 was used as template, and the waaL inner primers were used as primers to carry out PCR amplification, target bands appeared. Moreover, since S. paratyphi CMCC50973waaL had the waaL gene knocked out, the band, obtained when the genomic DNA of S. paratyphi CMCC50973waaL was used as template, and the waaL outer primers were used as primers to carry out PCR amplification, is smaller than the band, obtained when the genomic DNA of S. paratyphi CMCC50973 was used as template, and the waaL outer primers were used as primers to carry out PCR amplification. Since the Kan resistance gene was finally deleted, when the genomic DNA of S. paratyphi CMCC50973waaL was used as template, and the kan primers were used as primers to carry out PCR amplification, no target bands appeared.

(226) The above results demonstrate the successful construction of a waaL gene-deleted Salmonella paratyphi A 50973 mutant with no antibiotic resistance gene, i.e. S. paratyphi CMCC50973waaL.

(227) III. Phenotype Identification of S. paratyphi CMCC50973waaL

(228) 1 mL culture of S. paratyphi CMCC50973waaL cultured at 37 C. overnight, was centrifuged to collect bacteria. The bacteria were washed with PBS once, and 100 L lysis buffer (the lysis buffer was prepared by well mixing 2 mL 10% SDS, 0.4 mL 2-mercaptoethanol, 1 mL 100% glycerol, 5 mL 2M pH6.8 Tris-HCl, 20 L 10% bromophenol blue and 1.6 mL ddH.sub.2O) was added and mixed well. After heating in boiling water for 10 min, 4 L of 20 mg/mL protease K aqueous solution was added, and the reaction was carried out at 60 C. for 1-2 h, to obtain lysates. 15 l of the lysates was loaded to carry out SDS-PAGE electrophoresis, the gel was placed in the fixing solution overnight, and a sensitizing solution was added and reacted for 30 min. After washing with deionized water for three times, 15 min for each time, a silver nitrate solution was added and reacted for 20 min, and deionized water was used for washing twice, 1 min for each time. A developing solution was added for color development, the reaction was stopped finally, and deionized water was used for washing.

(229) S. paratyphi CMCC50973 was also subjected to the above experiment, as control.

(230) The results are shown in FIG. 13. In FIG. 13, 50973waaL represents S. paratyphi CMCC50973waaL; and 50973 represents S. paratyphi CMCC50973. FIG. 13 shows that the wild-type strain S. paratyphi CMCC50973 had ladder-like bands, while the mutant strain had no ladder-like bands due to the knockout of O-antigen ligase gene waaL (waaL functions to ligate O-antigen polysaccharide (OPS) to lipoid A-core oligosaccharide to form lipopolysaccharide(LPS)).

(231) IV. Preparation of Salmonella paratyphi A O-Polysaccharide-Recombinant EPA Fusion Protein Conjugate by One-Step Bioconjugate Method

(232) (I) Construction of Glycoengineered Salmonella paratyphi A, S. paratyphi CMCC50973waaL/pETtac28-pglL/pMMB66EH-rEPA4573

(233) The host bacterium S. paratyphi CMCC50973waaL was transformed with the vectors pETtac28-pglL and pMMB66EH-rEPA4573 sequentially by electroporation, and the transformed cells were spread onto LB solid medium containing kanamycin at a final concentration of 50 g/mL and ampicillin a final concentration of 100 g/mL, and the clone formed was the glycoengineered Salmonella paratyphi A, S. paratyphi CMCC50973waaL/pETtac28-pglL/pMMB66EH-rEPA4573.

(234) (II) Glycosylation of the EPA Fusion Protein and Identification Thereof

(235) The monoclonal colony of glycoengineered bacterium S. paratyphi CMCC509730waaL/pETtac28-pglL/pMMB66EH-rEPA4573, was seeded in LB medium containing ampicillin at a final concentration of 100 g/mL and kanamycin at a final concentration of 50 g/mL, and cultured at 37 C. When OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM. The culture was cooled to 25 C. and induced for 20 h, to obtain the glycoprotein rEPA-OPS.sub.Spty50973.

(236) The next day, 1 mL of the bacterial liquid induced at 25 C. for 20 h, was centrifuged to extract bacteria, and the extracted bacteria were slowly suspended in 1 reducing buffer, in a boiling water bath for 10 min, to obtain the sample for electrophoresis. The sample was then subjected to 8% SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred onto PVDF membrane by Bio-Lab Semi-Dry Blotter, at a constant voltage of 20V for 1 h, and was subjected to western-blot detection using anti-EPA antibody.

(237) Meanwhile, the S. paratyphi CMCC50973waaL/pMMB66EH-rEPA4573, constructed by transforming S. paratyphi CMCC50973waaL with pMMB66EH-rEPA4573 but not with pETtac28-pglL, was used as control, to carry out the above induction experiment.

(238) The results are shown in FIG. 14. FIG. 14 shows that the substrate protein rEPA4573, in the presence of oligosaccharyltransferase PglL, was O-glycosylated.

(239) V. Preparation of Salmonella paratyphi A O-Polysaccharide-Recombinant CTB Fusion Protein Conjugate by One-Step Bioconjugate Method

(240) (I) Construction of Glycoengineered Salmonella paratyphi A, S. paratyphi CMCC50973waaL/pETtac28-pglL/pMMB66EH-rCTB4573

(241) The host bacterium S. paratyphi CMCC50973waaL was transformed with the vectors pETtac28-pglL and pMMB66EH-rCTB4573 sequentially, and spread onto LB solid medium containing kanamycin at a final concentration of 50 g/mL and ampicillin at a final concentration of 100 g/mL, and the clone formed was the glycoengineered Salmonella paratyphi A, S. paratyphi CMCC50973waaL/pETtac28-pglL/pMMB66EH-rCTB4573.

(242) (II) Glycosylation of the Recombinant CTB Fusion Protein and Identification Thereof

(243) The monoclonal colony of glycoengineered bacterium S. paratyphi CMCC50973waaL/pETtac28-pglL/pMMB66EH-rCTB4573, was seeded in LB medium containing ampicillin at a final concentration of 100 g/mL and kanamycin at a final concentration of 50 g/mL, and cultured at 37 C. When OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM. The culture was cooled to 16 C. and induced for 20 h, to obtain the glycoprotein CTB-OPS.sub.Spty50973.

(244) The next day, 1 mL of the bacterial liquid induced at 16 C. for 20 h, was centrifuged to extract bacteria, and the extracted bacteria wee slowly suspended in 1 reducing buffer, in a boiling water bath for 10 min, to obtain the sample for electrophoresis. The sample was then subjected to 8% SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred onto PVDF membrane by Bio-Lab Semi-Dry Blotter, at a constant voltage of 20V for 1 h, and subjected to western-blot detection using Anti-His tag mouse monoclonal antibody.

(245) The S. paratyphi CMCC50973waaL/pMMB66EH-rCTB4573, constructed by transforming S. paratyphi CMCC50973waaL with pMMB66EH-rCTB4573 but not with pETtac28-pglL, was used as control, to carry out the induction experiment.

(246) The results are shown in FIG. 15. FIG. 15 shows that the substrate protein rCTB4573, in the presence of O-oligosaccharyltransferase PglL, was O-glycosylated.

Example 3. Modification of the Recombinant CTB Fusion Protein with Exogenous O-Polysaccharides of E. coli O157

(247) When a recombinant fusion protein is modified by an exogenous polysaccharide, it needs a bacterium defective in both O-antigen ligase gene and host O-antigen synthesis, as a host. When O-antigen ligase gene is deleted, no matter the polysaccharides expressed in the host bacterium are endogenous or exogenous, they cannot be utilized in LPS synthesis pathway in the host, while the O-antigen synthesis deficiency in the host ensures that the glycosylation system only utilizes exogenous polysaccharides to modify the recombinant fusion protein, thereby avoiding the contamination due to the modification of the recombinant fusion protein with the endogenous O-antigen polysaccharides in the host. In a host bacterium, a recombinant fusion protein gene, Neisseria meningitidis O-oligosaccharyltransferase PglL gene, a gene cluster for synthesis of exogenous polysaccharide, are co-expressed in the host bacterium; and in the presence of O-oligosaccharyltransferase PglL as catalyst, the exogenous polysaccharide is transferred to the recombinant fusion protein.

(248) In the Example, E. coli K12 W3110 strain is used as host bacterium; for naturally occurring insertional inactivation of the wbbL gene of the key glycosyltransferase, rhamnosyl transferase, in the O-antigen synthesis pathway in K12 strain, endogenous O-antigen cannot be synthesized; therefore only the O-antigen ligase gene waaL needs to be knocked out to construct a host bacterium defective in both O-antigen ligase and O-antigen synthesis.

(249) I. Construction of a host bacterium defective in both O-antigen ligase and O-antigen synthesis

(250) (I) Preparation of Linear Targeting DNA Fragments

(251) 1. Design and Synthesis of PCR Primers

(252) According to the genomic sequence (AC_000091.1) of the E. coli W3110 strain published on GenBank, the targeting fragment for the waaL gene (from positions 3696236 to 3697450) was designed. Two fragments of 41 bp were selected from the upstream and downstream of the waaL gene, respectively, and used as the homologous arms, and 3 end of each homologous arm was linked with one of the primers for amplification of chloramphenicol-resistant gene flanked by FRT sites, thereby obtaining the chloramphenicol-resistant gene fragment flanked by the 41 bp upstream and downstream homologous arms of the waaL gene and FRT sites, by PCR amplification; and the primers 3110waaL up 5 and 3110waaL down 3 located outside the waaL gene region were designed to identify whether the waaL gene was knocked out or not.

(253) The primers are shown in Table 3.

(254) TABLE-US-00008 TABLE3 Primersequencelisting3 Primer Useoftheprimer name Primersequence(5.fwdarw.3) Note pair 3110waaLcat GCAGTTTTGGAAAAGTTATCATC thewaaL Foramplificationof 5 ATTATAAAGGTAAAACATAGCGA homologous chloramphenicol- TTGTGTAGGCTGGAG armswere resistantgene (SEQIDNo.72) underlined fragmentcomprising 3110waaLcat AGTGAGTTTTAACTCACTTCTTA upstreamand 3 AACTTGTTTATTCTTAATAATTA downstream ACGGCTGACATGGGAATTAG homologousarmsof (SEQIDNo.73) thewaaLgene 3110waaL TACAAATAGTATCCCCAAC primersfor up5 (SEQIDNo.74) identifyingwaaL 3110waaL AATTAACCTCAACAGTCAA knock-out down3 (SEQIDNo.75)

(255) 2. Construction of Linear Targeting DNA Fragments

(256) The plasmid pKD3 was used as a template, and 3110waaLcat 5 and 3110waaLcat 3 were used as primers to carry out PCR amplification, to obtain the chloramphenicol-resistant gene fragment flanked by the 41 bp upstream and downstream homologous arms of the waaL gene and FRT sites. The fragment was set forth in SEQ ID No.76.

(257) (II) Obtainment of O-Antigen Ligase Gene waaL-Defective E. coli W3110 (E. coli W3110waaL)

(258) 1. Preparation of E. coli W3110/pKD46

(259) 1) E. coli W3110 was seeded in LB liquid medium, after incubating at 37 C. overnight, the culture was transferred to 100 mL LB liquid medium at a volume ratio of 1:100, and cultured at 37 C. until OD.sub.600 reached 0.6.

(260) 2) The bacteria were collected by centrifugation, and washed with the autoclaved 10% glycerol (v/v) for four times, and finally re-suspended in 400 L 10% glycerol, to obtain E. coli W3110 competent cells for use in electrotransformation, sub-packaged for later use.

(261) 3) The plasmid pKD46 (the replicon of pKD46 is sensitive to temperature, and lost when cultured at 37 C., and the plasmid comprises the genes encoding three recombinases of Red recombination system and controlled by arabinose promoter) was transformed into the prepared E. coli W3110 competent cell by electroporation, and the transformed cells were spread onto the LB plate containing ampicillin at a final concentration of 100 g/mL. After culturing at 30 C. overnight, the obtained positive clone was the E. coli W3110/pKD46 strain.

(262) 2. Preparation of E. coli W3110 waaL::cat

(263) 1) The E. coli W3110/pKD46 was cultured at 30 C. overnight, and then passaged in LB liquid medium containing 100 g/mL ampicillin at a volume ratio of 1:100 for future culture.

(264) 2) When the OD.sub.600 value was about 0.2, L-arabinose was added at a final concentration of 0.2 g/100 ml to induce the expression of Red recombination system; when the OD.sub.600 value was about 0.6, the E. coli W3110/pKD46 competent cell was prepared.

(265) 3) 10 L of the linear targeting DNA fragments prepared in the step (I) was transformed into the E. coli W3110/pKD46 competent cell by electroporation.

(266) 4) 1 mL precooled low salt LB liquid medium was added quickly. The cells were thawed at 30 C. for about 2.5 h, and then were spread onto a LB plate containing chloramphenicol at a concentration of 30 g/mL, and cultured in a 30 C. incubator overnight.

(267) 5) The positive clone was screened out. Its genomic DNA was extracted and used as template, and 3110waaL up 5 and 3110waaL down 3 were used as primers to carry out PCR identification, to obtain PCR amplification product. Meanwhile, the genomic DNA of E. coli W3110 was used as template, to carry out the PCR amplification, as control.

(268) The PCR amplification product of E. coli W3110 was of 1444 bp, while the PCR amplification product of the positive clone in Step 5) was of 1246 bp when the waaL gene was replaced with the cat gene, the positive clone was designated as E. coli W3110 waaL::cat/pKD46.

(269) 6) the E. coli W3110 waaL::cat/pKD46 was seeded in LB liquid medium containing chloramphenicol at a final concentration of 30 g/mL, and passaged for three times at 37 C. (culturing for 12 h for each passage), resulting in the deletion of the plasmid pKD46, to obtain E. coli W3110 waaL::cat strain.

(270) 3. Obtainment of E. coli W3110 waaL Strain

(271) 1) The pCP20 was transformed into E. coli W3110 waaL::cat cell by electroporation, and the transformed cells were spread onto LB plate containing 100 g/mL ampicillin, to obtain W3110 waaL::cat/pCP20 strain.

(272) 2) The monoclonal colony of E. coli W3110 waaL::cat/pCP20 was seeded in LB liquid medium, cultured at 30 C. until OD.sub.600 was about 0.6, and then cultured at 42 C. overnight.

(273) (the replicon of pCP20 is sensitive to temperature, and lost when cultured at 42 C., the plasmid comprises the DNA encoding FLP recombinase, controlled by temperature-sensitive promoter, and the expression of FLP recombinase was induced when cultured at 42 C., with the loss of the plasmid.)

(274) 3) The monoclonal colony was isolated by streak plate method from the bacterial liquid cultured at 42 C. overnight on LB plate, and the colonies were grown on LB plate with or without chloramphenicol. The colonies, which grew on LB plate but not on LB plate containing chloramphenicol, were picked and designated as E. coli W3110waaL. Its genomic DNA was used as template, and 3110waaL up 5 and 3110waaL down 3 were used as primers to carry out PCR identification, to obtain the PCR amplification product. The genomic DNA of E. coli W3110 and E. coli W3110 waaL::cat were separately used as template, to carry out the PCR amplification, as control.

(275) The results are shown in FIG. 16. The PCR amplification fragment of E. coli W3110 was of 1444 bp, and the PCR amplification fragment of W3110 waaL::cat resulted from the replacement of the waaL gene with the cat gene was of 1246 bp, and the PCR amplification fragment of E. coli W3110waaL with the cat gene deleted, was of 316 bp. FIG. 16 shows the successful construction of E. coli W3110waaL.

(276) II. The construction of the recombinant CTB fusion protein expression vector pMMB66EH-rCTB4573 was performed as disclosed in Step II (III) in Example 1.

(277) III. Construction of Neisseria meningitidis O-oligosaccharyltransferase PglL expression vector pETtac28-pglL was performed as disclosed in Step II (I) in Example 1.

(278) IV. Construction of expression vector pACYC184-O157 comprising a gene cluster for synthesis of the exogenous bacterial polysaccharide

(279) (I) According to the gene sequence of O157 (GeBank:AF061251.1) on NCBI website, the following primers were designed:

(280) TABLE-US-00009 O157-5 (theunderlinedsequenceistheAscI enzymerecognitionsite): (SEQIDNo.77) 5-AGAAGGCGCGCCAAGAATGACGAATTTAAAAGCAGTTATACCG GTAGCAGGT-3 O157-3 (theunderlinedsequenceistheNotI enzymerecognitionsite): (SEQIDNo.78) 5-ATATGCGGCCGCTTAATCCACTCCATTCCTGTATGGAACACAC CTTCTTT-3

(281) (II) The genomic DNA of E. coli O157 was used as template, and O157-5 and O157-3 were used as primers to carry out PCR amplification, to obtain PCR amplification product, i.e., the gene cluster for O157 polysaccharide synthesis, as set forth in SEQ ID No.79.

(282) (III) According to the gene sequences of the plasmid pACYC184, the following primers were designed:

(283) TABLE-US-00010 p184-5: (SEQIDNo.80) 5-ATATGGCGCGCCTCTGAGTTACAACAGTCCGC-3 (theunderlinedsequenceistheAscIenzyme recognitionsite) p184-3: (SEQIDNo.81) 5-ATAAGCGGCCGCTTCAGGTGCTACATTTGAAG-3 (theunderlinedsequenceistheNotIenzyme recognitionsite)

(284) (IV) pACYC184 was used as template, and p184-5 and p184-3 were used as primers to carry out PCR amplification, to obtain the PCR amplification product, i.e., the linear pACYC184 vector fragment, set forth in SEQ ID No.82.

(285) (V) AscI and NotI were used in double enzyme digestion of the DNA molecule set forth in SEQ ID No.79, to obtain a gene fragment; AscI and NotI were used in double enzyme digestion of the DNA molecule set forth in SEQ ID No.82, to obtain a large fragment; the gene fragment was ligated to the large fragment, to obtain the recombinant plasmid, designated as pACYC184-O157. The pACYC184-O157 was sequenced, and the result was correct.

(286) V. Construction of Glycoengineered E. coli

(287) The three recombinant plasmids pMMB66EH-rCTB4573, pETtac28-pglL and pACYC184-O157 were transformed into the host bacterium E. coli W3110waaL by electroporation, and the transformed cells were spread onto LB plate containing ampicillin, kanamycin and chloramphenicol, and the formed clone was the glycoengineered E. coli, E. coli W3110waaL/pMMB66EH-rCTB4573/pETtac28-pglL/pACYC184-O157.

(288) VI. Glycosylation of the Recombinant CTB Fusion Protein r CTB4573-OPS.sub.EcO157 and Identification Thereof

(289) The monoclonal colony of glycoengineered bacterium E. coli W3110waaL/pMMB66EH-rCTB4573/pETtac28-pglL/pACYC184-O157, was seeded to LB medium containing 100 g/mL ampicillin, 50 g/mL kanamycin and 30 g/mL chloramphenicol, and cultured at 37 C. When OD.sub.600 was about 0.6, IPTG was added at a final concentration of 1 mM. The culture was cooled to 16 C. and induced for 20 h, to express rCTB4573-OPS.sub.EcO157.

(290) 1 mL of the bacterial liquid induced at 16 C. for 20 h, was centrifuged to extract bacteria, and the the extracted bacteria were slowly suspended in 1 reducing buffer, in a boiling water bath for 10 min, to obtain the sample for electrophoresis. The sample was then subjected to 15% SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred onto PVDF membrane by Bio-Lab Semi-Dry Blotter, at a constant voltage of 20V for 1 h, and detected by rabbit anti-E. coli O157 antiserum.

(291) E. coli W3110waaL/pMMB66EH-rCTB4573/pETtac28-pglL was used as control.

(292) The results are shown in FIG. 17. FIG. 17 shows that the substrate protein rCTB4573, in the presence of oligosaccharyltransferase PglL and a gene cluster for synthesis of exogenous polysaccharide, was O-glycosylated.

INDUSTRIAL APPLICATION

(293) As compared with the polysaccharide proteins prepared by the existing chemical crosslinking methods, the bacterial polysaccharide-modified recombinant fusion proteins prepared by the method of the invention have the advantages such as homogeneous polysaccharide binding sites, and controllable quality; and the preparation of bacterial polysaccharide-modified recombinant fusion proteins by culturing engineering bacteria, has the advantages such as high-efficient production, low production cost, and good biosafety, as it does not comprises the steps such as the preparation of polysaccharides, the preparation of carrier protein, and chemical crosslinking. Specific antibodies against bacterial polysaccharides can be obtained by immunizing a mouse with the bacterial polysaccharide-modified recombinant fusion protein prepared by the method of the invention. The use of the bacterial polysaccharide-modified recombinant fusion protein in the preparation of a bacterial polysaccharide-protein conjugate vaccine, can avoid a variety of problems concerning the culture of pathogenic bacteria, enhance the homogeneity of vaccines and production efficiency, and reduce the cost for vaccine preparation. The invention has a wide application prospect in the preparation of polysaccharide-modified protein vaccines.