Microfluidic Devices and Methods for Use Thereof in Multicellular Assays of Secretion
20200363401 ยท 2020-11-19
Assignee
Inventors
- Marketa Ricicova (Vancouver, CA)
- Kevin Albert Heyries (Vancouver, CA)
- Hans Zahn (Munich, DE)
- Oleh Petriv (Richmond, CA)
- Veronique Lecault (Vancouver, CA)
- Anupam Singhal (Mississauga, CA)
- Daniel J. Da Costa (Pitt Meadows, CA)
- Carl L. G. Hansen (Vancouver, CA)
- Brad Nelson (Victoria, CA)
- Julie Nielsen (Victoria, CA)
- Kathleen Lisaingo (Port Moody, CA)
Cpc classification
B01L2300/0627
PERFORMING OPERATIONS; TRANSPORTING
G01N33/6845
PHYSICS
B01L3/502738
PERFORMING OPERATIONS; TRANSPORTING
C07K16/00
CHEMISTRY; METALLURGY
B01L3/50273
PERFORMING OPERATIONS; TRANSPORTING
B01L2200/0647
PERFORMING OPERATIONS; TRANSPORTING
C12Q1/6888
CHEMISTRY; METALLURGY
C07K2317/70
CHEMISTRY; METALLURGY
B01L3/502715
PERFORMING OPERATIONS; TRANSPORTING
B01L2200/12
PERFORMING OPERATIONS; TRANSPORTING
C07K2317/14
CHEMISTRY; METALLURGY
G01N33/54313
PHYSICS
International classification
G01N33/50
PHYSICS
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
C07K16/00
CHEMISTRY; METALLURGY
C12Q1/6888
CHEMISTRY; METALLURGY
G01N33/543
PHYSICS
Abstract
Methods and devices are provided herein for identifying a cell population comprising an effector cell that exerts an extracellular effect. In one embodiment the method comprises retaining in a microreactor a cell population comprising one or more effector cells, wherein the contents of the microreactor further comprise a readout particle population comprising one or more readout particles, incubating the cell population and the readout particle population within the microreactor, assaying the cell population for the presence of the extracellular effect, wherein the readout particle population or subpopulation thereof provides a direct or indirect readout of the extracellular effect, and determining, based on the results of the assaying step, whether one or more effector cells within the cell population exerts the extracellular effect on the readout particle. If an extracellular effect is measured, the cell population is recovered for further analysis to determine the cell or cells responsible for the effect.
Claims
1-218. (canceled)
219. A method of identifying an antibody secreting cell (ASC) that secretes a virus neutralizing antibody, comprising: retaining in a plurality of microreactors a plurality of cell populations, wherein individual cell populations of the plurality comprise one or more ASCs, wherein the contents of individual microreactors of the plurality of microreactors each comprise a readout particle population comprising one or more readout particles, and wherein the individual cell populations are retained in the individual microreactors; introducing a plurality of accessory particle populations into the individual microreactors, wherein individual accessory particle populations of the plurality comprise a plurality of virus particles and the individual accessory particle populations are retained in individual microreactors; incubating the individual cell populations, the readout particle populations and the accessory particle populations within the individual microreactors to provide secreted antibodies; assaying the individual microreactors for the presence of a virus neutralizing antibody, determining, based on the results of the assaying step, whether one or more of the cell populations comprises an ASC that secretes a virus neutralizing antibody.
220. The method of claim 219, wherein the readout particle population comprises a homogeneous population of readout particles.
221. The method of claim 219, wherein the readout particle population comprises a heterogeneous population of readout particles.
222. The method of claim 220, wherein the homogeneous population of readout particles comprises a homogeneous population of readout cells.
223. The method of claim 221, wherein the heterogeneous population of readout particles comprises a heterogeneous population of readout cells.
224. The method of claim 219, wherein the readout particle population or subpopulation thereof is immobilized on a surface of the individual microreactors.
225. The method of claim 219, further comprising maintaining the individual cell populations in substantially a single plane.
226. The method of claim 219, further comprising maintaining the readout particle populations in substantially a single plane.
227. The method of claim 219, wherein the plurality of accessory particles further comprise a fluorescent substrate, fluorophore, a secondary antibody, or a combination thereof.
228. The method of claim 219, wherein the individual accessory particle populations of the plurality are heterogeneous accessory particle populations.
229. The method of claim 219, wherein the plurality of virus particles is engineered to include a fluorescent protein expressed by a readout cell following virus infection of the readout cell.
230. The method of claim 219, wherein assaying the individual microreactors comprises assaying the morphology of the readout particle populations.
231. The method of claim 219, wherein assaying the individual microreactors comprises assaying binding of the secreted antibodies to the virus particles.
232. The method of claim 219, wherein assaying the individual microreactors comprises assaying the expression of fluorescent proteins within the readout particle populations that are upregulated during viral infection.
233. The method of claim 219, wherein assaying the individual microreactors comprises assaying the death of the readout particle populations.
234. The method of claim 219, further comprising substantially isolating the individual microreactors from their surrounding environments.
235. The method of claim 219, wherein if a cell population comprises an ASC that secretes a virus neutralizing antibody, the method further comprises recovering the cell population comprising the ASC that secretes the virus neutralizing antibody or a portion thereof to obtain a recovered cell population.
236. The method of claim 230, wherein the recovering step comprises positioning the open end of a microcapillary in a microreactor comprising the cell population comprising the ASC that secretes the virus neutralizing antibody and aspirating the microreactor's contents or a portion thereof to obtain a recovered aspirated cell population.
237. The method of claim 236, wherein the microcapillary is mounted on a robotic micromanipulation system on a microscope or the microcapillary is controlled robotically.
238. The method of claim 235, further comprising, retaining a plurality of cell subpopulations originating from the recovered cell population in a plurality of vessels, wherein each cell subpopulation is present in an individual vessel, lysing the individual cell subpopulations to provide lysed cell subpopulations, and amplifying one or more nucleic acids within each of the lysed cell populations.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
DETAILED DESCRIPTION OF THE INVENTION
[0181] As used herein, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a thing includes more than one such thing. Citation of references herein is not an admission that such references are prior art to the present invention.
[0182] Readout, as used herein, refers to the method by which an extracellular effect is reported. A readout particle population can comprise one or more readout particles, as described herein.
[0183] Extracellular effect, as used herein, is a direct or indirect effect on a readout particle that is extracellular of an effector cell, including but not limited to increased cellular proliferation, decreased growth, apoptosis, lysis, differentiation, infection, binding (e.g., binding to a cell surface receptor or an epitope), morphology change, induction or inhibition of a signaling cascade, enzyme inhibition, viral inhibition, cytokine inhibition, activation of complement. As provided herein, the extracellular effect in one embodiment is the binding of a biomolecule of interest, secreted by an effector cell, to a readout particle. In another embodiment, the extracellular effect is a response such as apoptosis of a readout cell or accessory cell.
[0184] The methods provided herein are used to identify an effector cell or cell population comprising an effector cell(s) that displays a variation in an extracellular effect. The variation in the extracellular effect is a variation compared to a control (negative or positive control), or a variation compared to one or more of other cell populations.
[0185] A heterogeneous population as referred to herein, particularly with respect to a heterogeneous population of particles or cells, means a population of particles or cells that includes at least two particles or cells that have a differing feature. For example, the feature in one embodiment is morphology, size, type of fluorescent reporter, a different cell species, phenotype, genotype, cell differentiation type, the sequence of one or more expressed RNA species or a functional property.
[0186] A subpopulation, as referred to herein, means a fraction of a greater population of particles (cells). A population of cells in one embodiment is divided into subpopulations, for example, by isolating individual subpopulations in individual microfluidic chambers. Additionally, an individual subpopulation can be partitioned into further subpopulations, for example, in a plurality of microfluidic chambers or other reaction vessels. A subpopulation may also be a fraction of particles within a greater population, located in the same microfluidic chamber. A subpopulation contains one or more particles, and where a plurality of particles are present in a subpopulation, the individual particles within the plurality can be homogeneous or heterogeneous with respect to one another.
[0187] A cell retainer in one embodiment, defines at least one effector zone and at least one readout zone either continuously or intermittently. The retainer may be a structural element such as a valve, a cell fence, the orientation in an external field or field gradient (e.g., gravitational, magnetic, electromagnetic, acceleration, etc.), the orientation and/or localization of a locally generated field by an electrode or optical component or magnetic probe, surface modifications (for example texturing, coatings, etc.) that facilitate or inhibit cell adhesion, or by the specific gravity of a solution within the chamber, or may be achieved by a combination of one or more of the preceding.
[0188] Coating as used herein may be any addition to the chamber surface, which either facilitates or inhibits the ability of an effector cell or a readout particle to adhere to a surface of the chamber. The coating may be selected from one or more of the following: a cell; a polymer brush; a polymer hydrogel; self assembled monolayers (SAM), photo-grafted molecules, a protein or protein fragment having cell binding properties (for example, a cell binding domain from actin, fibronectin, integrin, protein A, protein G, etc.). More generally Arginine-glycine-aspartate-(serine) (RGD(S)) peptide sequence motif are used. Poly-L-Lysine is also widely used as a polymer coating with PDMS to enhance cell adhesion via electrostatic interactions; a phospholipid having cell binding properties, a cholesterol having cell binding properties, a glycoprotein having cell binding properties and a glycolipid having cell binding properties. In addition PDMS surface functionalization using biotinylated biomolecules is a simple, highly attractive and yet flexible approach. It is widely known that bovine serum albumin (BSA) due to hydrophobic domains readily adsorbs via hydrophobic effect on hydrophobic PDMS surfaces enabling further direct coupling of streptavidin based conjugates in the chambers (protein, DNA, polymers, fluorophores). Polyethylene glycol based polymers are also known for their bio-fouling properties and can be coated on PDMS surface (adsorption, covalent grafting), preventing cell adhesion. Poly(paraxyxlylene), e.g., parylene C can also be deposited using chemical vapor deposition (CDV) on PDMS surfaces and prevent cellular adhesion.
[0189] Isolated, as used herein, refers the circumstances under which a given chamber does not permit substantial contamination of an effector cell and/or readout particle being analyzed with a particle(s) or biomolecule(s) of another chamber of the microfluidic device. Such isolation may be achieved, for example, by sealing a chamber or a set of chambers in the case of compound chambers, by limiting fluid communication between chambers or by restricting fluid flow between chambers.
[0190] An inlet or an outlet, as used herein, includes any aperture whereby fluid flows into and out of a chamber. Fluid flow may be restricted through the inlet or outlet or both to isolate a chamber from its surrounding environment. There may be one or more valves to control flow, or flow may be controlled by restricting the fluid channels, which lead to the inlets and outlets with a layer which prevents flow (for example, a control layer or isolation layer). Alternatively, flow may be regulated by the rate at which fluids are passed through the device. The inlet or outlet may also provide fluid flow to the device for the delivery of an effector cell or readout particle, or other components carried in the flow as needed during analysis. In some embodiments, the inlet and outlet may be provided by a single aperture at the top of the chamber over which fluid flows from an inlet side to an outlet side.
[0191] A magnet, as used herein, includes any ferromagnetic or paramagnetic material. Ferromagnetic as used herein is meant to include materials which may be comprised of iron, nickel, chromium, or cobalt or combinations thereof and various alloys, such that the magnetic material is attracted to a magnet or is a magnet itself. For example, a magnetic material may be made from ferromagnetic stainless steel or may be made from a rare earth magnet or a stainless steel having magnetic properties. A magnet may also be made by use of a ferrofluid in a defined shape or orientation. A magnet may also be implemented using a coil or other electrically actuated device designed to generate a magnetic field when energized with electrical current.
[0192] An array of wells, as used herein, refers to any array of structures within a chamber that may limit the movement of an effector cell and/or a readout particle by localizing one or the other to a particular readout zone or effector zone, whereby a zone (i.e., either effector or readout) may be defined by what type of particle resides within it. For example, one embodiment of an array of wells is shown in
[0193] A particle trap, as used herein, refers to a structure that is capable of spatially confining an effector cell or a readout particle(s) (bead(s)) to a specific spatial position to limit movement during an assay. A cell fence is one type of particle trap. In one embodiment, a particle trap is used to confine effector cells, in which case it may be referred to as an effector cell trap. In some embodiments, a particle trap will be used to confine readout particles, in which case it may be referred to as a readout particle trap, or a readout cell trap, as the case may be. A particle trap, in one embodiment, allows for the particle being trapped to have a fixed position. Having a fixed position may simplify imaging and image analysis. Having a fixed position for a readout particle or particles may also have the advantage of limiting or controlling the diffusion distance between an effector cell and a readout particle. Having a fixed position may also prevent interaction of effector cells and readout particles.
[0194] A textured surface, as used herein, may be any type of surface modification that would promote or reduce cell adhesion to the chamber surface. For example, the surface may be textured with one or more of: bumps, indentations, roughness, protrusions, hooks, pegs, wells, grooves, ridges, grain, weave, web, hydrophobicity, hydrophillicity, etc.
[0195] The human body makes millions to billions of different types of antibodies at any given time, each produced by a different single plasma cell called an antibody secreting cell or ASC. Each ASC has a diameter of from about 7 m about 15 m, depending on source, a diameter approximately 1/10.sup.th the width of a human hair, and generates only a minute amount of antibody. Of the billions of different ASCs in the human body, only a very rare few make an antibody that is suitable to be used as a therapeutic. When analyzed in the volume of conventional formats this small amount of antibody is too dilute, making it completely undetectable. For this reason antibody discovery currently requires that each ASC be isolated, fused to an immortal cancer cell to create a hybridoma and grown, ultimately generating many thousands of identical cells that can produce enough antibody to be measured (see
[0196] ASCs are terminally differentiated cells that cannot be directly expanded in culture. Existing methods for overcoming this issue as set forth above (e.g., the hybridoma method, see
[0197] A variety of technologies have been advanced to increase the speed and throughput of antibody screening, but these technologies do so at the expense of information. Specifically, existing technologies are restricted to the selection of antibodies based on binding, affinity and specificity. While sufficient for research applications, many therapeutic applications require high affinity antibodies that do more than just bind to the target. Rather, therapeutic applications require antibodies that induce the desired biological response (e.g., agonists/antagonists of cell signaling; activation of immune responses; induction of apoptosis; inhibition of cellular growth or differentiation). Presently, all high-throughput antibody discovery technologies require that this functional characterization be performed downstream, after binding of a target is assessed, using methods that are cumbersome, costly, and low-throughput, even as compared to the hybridoma approach. For this reason the hybridoma method, developed over 40 years ago, is still a mainstay in therapeutic antibody discovery.
[0198] The present invention in one aspect, harnesses the small reaction volumes and massively parallel assay capabilities of a microfluidic platform in order to screen cell populations for a property of interest, referred to herein as an extracellular effect. Each cell population optionally comprises one or more effector cells. The extracellular effect is not limited to a particular effect; rather, it may be a binding property (specificity, affinity) or a functional property, for example agonism or antagonism of a cell surface receptor. In one embodiment, the extracellular effect is an effect exerted by a secretion product of a particular effector cell.
[0199] The integrated microfluidic devices and methods provided herein are based in part on the concept that small is sensitiveeach device comprises many thousands of nanoliter volume cell analysis chambers, each approximately 100,000 times smaller than conventional plate-based assays. In these small nanoliter chambers, each single effector cell produces high concentrations of secreted biomolecule within minutes. For example, each sing ASC produces high concentrations of antibodies within minutes. This concentration effect, in one embodiment, is harnessed to implement cell-based screening assays that identify antibodies, made by single primary ASCs, with a specific functional property(ies), such as the modulation (e.g., agonism or antagonism) of cell surface receptor activity. Functional assays amenable for use with the methods and devices provided herein are described in detail below. Importantly, the in the screening methods provided herein, it is not necessary that a specific effector cell or subpopulation of effector cells, having the particular property be identified so long as the presence of the extracellular effect is detected within a particular microfluidic chamber comprising a cell population. Some or all of the cells within the chamber where the effect is measured can be recovered for further characterization to identify the specific cell or cells responsible for the extracellular effect. By completely eliminating the need for cell culture prior to screening, the single-cell approach provided herein enables, for the first time, the direct selection of functional antibodies from any species, in only days, and at a throughput of greater than 100,000 cells per run (
[0200] The microfluidic devices and methods provided herein provide advantages over currently available strategies for assessing an extracellular effect of a single cell, for example, an extracellular effect of an antibody secreted by a single ASC. For example, the devices described herein are scalable, enable reduced reagent consumption and increased throughput to provide a large single cell assay platform for studies that would otherwise be impractical or prohibitively expensive. Moreover, currently available single cell assay platforms analyses require multiple cell handling and processing steps in conventional tubes in order to generate products needed for downstream analysis, for example qPCR. The inclusion of microfluidic cell handling and processing as described herein thus offers important avenues to improved throughput and cost, while also improving precision and sensitivity through small-volume confinement.
[0201] Without wishing to be bound by theory, the concentration enhancement and rapid diffusive mixing afforded by the nanoliter microfluidic chambers provided herein, along with precise cellular handling and manipulation (e.g., spatio-temporal control of medium conditions) enables the single cell analysis of effector cells such as immune cells (e.g., B cells, T cells, and macrophages) whose primary functions include the secretion of different effector proteins such as antibodies and cytokines.
[0202] Embodiments described herein provide microfluidic systems and methods capable of performing multicellular assays of secreted products from cell populations comprising one or more effector cells, followed by recovery of the cell populations for subsequent analysis. In some embodiments, the cell populations are heterogeneous cell populations. That is, two or more cells in a population differ in genotype, phenotype or some other property. Moreover, where cell populations are assayed in parallel on one device, at least two of the populations are heterogeneous with respect to one another (e.g., different number of cells, cell type, etc.). In the assays described herein, a readout particle population comprising one or more readout particles, which serve as detection reagents (e.g., readout cells expressing a cell receptor, readout bead, sensor, soluble enzyme, etc.) are exposed to a cell population comprising one or more effector cells, and secreted products from the one or more effector cells, at a sufficient concentration for a readout signal (e.g., a fluorescent signal) to be detected. In some embodiments, the readout signal reports a biological response/functional effect (e.g., apoptosis) induced by one or more the effector cells in the population on one or more readout particles (e.g., readout cells). For example, for an antibody produced from a given ASC, the ASC or a cell population comprising one or more ASCs, along with readout particle(s) and optionally accessory detection reagents are sequestered in a small volume so on a device, and the assay is carried out (chambers having a volume of about 100 L to about 50 nL, e.g. about 1 nL to about 5 nL). Importantly, because effector cells in one embodiment are rare cells, not all cell populations assayed by the methods described herein will initially contain an effector cell. For example, where thousands of cell populations are assayed on a single device, in one embodiment, only a fraction of the chambers will comprise an effector cell. The methods provided herein allow for the identification of the chambers with the effector cell.
[0203] The present invention takes a different approach than previously described microfluidic methods. The latter take the approach of loading single cells at a density to maximize the number of single cells in individual chambers (for example, where droplets or microwells are used). This is accomplished by isolating single cells by limiting dilution followed by analysis of the fraction of chambers or volumes that contain a single cell. Such a strategy sacrifices throughput because the optimal single cell loading is achieved at approximately 1 cell per well average density. Similarly, the geometries described for these methods usually do not allow for more than a few cells in a chamber and in many cases are designed to physically accommodate only a single cell. Besides a decreased throughput, a number of technical challenges result from the approach of isolating and assaying a single cell in a single microfluidic chamber. For example, achieving sufficient cell concentrations to achieve a meaningful readout from heterogeneous populations, keeping individual cells alive due to nutrient depletion, the need for aeration, unwanted vapor permeation effects, poorly controlled medium conditions, and the need for waste removal, can pose serious problems for achieving a reliable reproducible single cell microfluidic assay. In many functional assays, like cell growth inhibition, it is necessary to keep both the effector cells and the readout cells alive for several days. Such an assay is not feasible in microwell based systems and droplets. However, as discussed herein, the present invention provides a robust platform for assays spanning days.
[0204] The devices and assays described herein provide single cell assays whereby one or more effector cells are present in individual cell populations, in single microfluidic chambers. The cell populations are assayed for their respective ability to exert an extracellular effect in each chamber, thereby providing a higher total throughput than previously described methods. Importantly, effects of a single effector cell can be detected within a larger cell population, for example a heterogeneous cell population. By taking the multicellular assay approach within a single microfluidic chamber, the embodiments described herein can operate at greater than or equal to 100 times the throughput reported previously. Once a cell population is identified that an extracellular effect on a readout particle, or a variation in an extracellular effect as compared to another population, the cell population, in one embodiment, is recovered and further assayed as individual cell subpopulations (e.g., the recovered cell population is assayed at limiting dilution) to determine which effector cell(s) within the population is responsible for the extracellular effect.
[0205] Methods and apparatuses known in the art which are designed to accommodate more than a single cell have limitations that make them unsuitable for the types of assays described herein, for example, maintaining cells in a viable state, the inability to selectively recover effector cells of interest, evaporation within a device, pressure variability, cross-contamination, device architecture that limits imaging capabilities (e.g., by providing particles in different focal planes, reduced resolution) and lack of throughput (WO 2012/072822 and Bocchi et al. (2012), each incorporated by reference in their entireties).
[0206] Embodiments described herein relate in part to functional effector cell assays (also referred to herein as extracellular effect assays) that allow for the detection of a single effector cell of interest present in an individual microfluidic chamber in a heterogeneous cell population. Specifically, in the case where a chamber contains a heterogeneous cell population, where each cell of the population secretes antibodies (i.e., a heterogeneous ASC population within a single microfluidic chamber), or only a fraction of the cells in the population secrete antibodies, whereby only one effector cell or a subpopulation of effector cells secretes an antibody that produces a desired extracellular effect on a readout particle(s), the embodiments described herein provide a method for measuring and detecting the desired extracellular effect. Once a chamber is identified that comprises a cell population exhibiting the effect, the population is recovered for downstream analysis, for example, by splitting the cell population into subpopulations at limiting dilution. As described below, in one embodiment, one or more heterogeneous populations of cells displaying an extracellular effect, are recovered and subjected to further screening at limiting dilution (e.g., from 1 to about 25 cells per assay), to determine which cell the extracellular effect is attributable to.
[0207] In one embodiment, a microfluidic assay is carried out on a plurality of cell populations, present in individual microfluidic chambers, to determine whether an effector cell within one of the populations secretes an antibody or other biomolecule that inhibits the growth of a readout cell. In this embodiment, even in the presence a heterogeneous cell population comprising a plurality of ASCs that secrete antibodies which do not affect the growth of the readout cell, the readout cell growth is still equally inhibited and the microfluidic chamber is identifiable as containing the desired effector cell and secretion product. The chamber's contents can then be recovered for further microfluidic analysis, or benchtop analysis, for example, at limiting dilution of the effector cells to determine which effector cell displays the effect. Antibody sequences can also be recovered by methods known to those of skill in the art.
[0208] In one embodiment, novel antibodies are provided by the methods described herein. For example, one or more ASCs can be identified by the methods described herein, recovered, and their antibody genes sequenced and cloned.
[0209] Where single cells are loaded into individual chambers at a density of approximately 1 cell per chamber, the devices provided herein allow for the screening of approximately 1000 single cells (e.g., ASCs) per experiment. One or more of the single cells can be ASCs or a different type of effector cell. Although approximately 10-fold higher than hybridoma methods, it is desirable in many instances to screen tens of thousands, or even hundreds of thousands of cells. Examples of this include when ASCs cannot be obtained at high purity (e.g., for species for which ASC markers/antibodies are not available or cases of poor immune response), or when antibodies that bind are frequent but those with desired properties are exceedingly rare (such as blocking of a receptor). However, after identifying a cell population(s) that contain one or more effector cells displaying the extracellular effect of interest, the cell population(s), in one embodiment, are analyzed again, but at limiting dilution, e.g., as single cells in individual microfluidic chambers, or smaller populations in individual chambers (as compared to the first screen), in order to determine the identity of the individual effector cell(s) responsible for the extracellular effect. One embodiment of this two step screening method is shown in
[0210] In the embodiment shown in
[0211] In another embodiment, cell populations displaying the extracellular effect are recovered using an integrated system microfluidic valves that allow chambers to be individually addressed (e.g., Singhal et al. (2010). Anal. Chem. 82, pp. 8671-8679, incorporated by reference herein in its entirety). Notably, the present invention is not limited to the type of extracellular effect assay carried out on the contents of the positive chambers of array 1 (
[0212] With respect to the single cell and multicellular microfluidic assays described herein, reference is made herein to a chamber in which a cell population optionally comprising one or more effector cells is assayed for an extracellular effect, for example, a functional effect or a binding effect. However, one of ordinary skill in the art will recognize that the devices provided herein provide a massively parallel system that incorporates tens of thousands of chambers, and that assays are carried out in parallel in all or substantially all of the chambers, or all of the chambers in a subarray on one device, on a plurality of individual cell populations each optionally comprising an effector cell or a plurality of effector cells. Because of the rarity of some effector cells, not all cell populations will comprise an effector cell when present in a microfluidic chamber. Fluidic architectures to address multiple chambers individually or together, such as multiplexers, are described below.
[0213] Some of the embodiments described herein provide one or more of the following features:
[0214] The ability to load and concentrate a cell population comprising one or more effector cells into a microfluidic chamber having a small volume to assay the effector cell products, and to co-localize into within the chamber a readout particle (readout bead, readout cell, etc.) used to detect the presence of an individual effector cell product (e.g., secreted protein) having a desired property.
[0215] The ability to maintain the viability and/or growth of a cell population, assisted by the osmotic bath described herein as well as the ability to exchange medium around individual cells, at concentrations that have been reported previously to result in poor cell survival or growth using conventional culture methods or previously described microfluidic devices.
[0216] The ability to concentrate effector cell products within a chamber in a time sufficient to measure a desired effector cell product property prior to the effector cell becoming unhealthy or outgrowing its respective microfluidic chamber.
[0217] The ability to selectively exchange medium contents or add detection reagents to clusters of cells while maintaining populations of cells in the microfluidic chambers.
[0218] The ability to addressably recover a selected cell population using one or more microfluidic structures, a manual method or a robotic method.
[0219] The ability to transfer recovered populations of cells into a secondary lower-throughput screen that enables the analysis of an effector cell product from each single cell in the heterogeneous population, or a clone or plurality of clones generated from each single cell in the heterogeneous population.
[0220] The ability to directly analyze the aggregate genetic material from recovered heterogeneous populations of single cells and then use this information or genetic material to identify the genes associated with the cells of interest.
[0221] In some embodiments, a method of enriching for effector cells exhibiting an extracellular effect from a starting population of cells that includes one or more effector cells that exhibit the extracellular effect is provided. In one embodiment, the method includes retaining the starting population of cells in a plurality of microfluidic chambers to obtain a plurality of cell subpopulations. An average number of effector cells per chamber is greater than Y, the total number of cells in the population is greater than X and an expected fraction of effector cells in the population is 1/X. The cell subpopulations in the microfluidic chambers are subjected to an extracellular effect assay to identify one or more chambers containing one or more effector cells exhibiting the extracellular effect. Based on the results of the extracellular effect assay, one or more chambers are then identified as comprising one or more effector cells exhibiting the extracellular effect. The contents of the identified chamber(s) are then recovered to provide an enriched population of cells. The enriched population of cells enriched for the effector cells has a fraction of effector cells of 1/Y. In a further embodiment, 1/X is less than 0.05, or less than 0.01, or less than 0.001. The extracellular effect can be one or more of the extracellular effects described herein. In one embodiment, the starting population of cells are peripheral blood mononuclear cells (PBMCs) isolated from an animal that has been immunized or exposed to an antigen. In another embodiment, the starting population of cells is a population of B-cells isolated from an animal that has been immunized or exposed to an antigen. In yet another embodiment, the source of the starting population of cells is whole blood from the animal that has been immunized or exposed to an antigen.
[0222] As provided herein, in one aspect, the devices and methods of the invention are used to assay a cell population optionally comprising one or more effector cells for the presence of an extracellular effect. In another aspect, the devices and methods provided herein allow for identification of a cell population displaying a variation in an extracellular effect compared to other cell populations. In this aspect, a plurality of individual cell populations are retained in separate microfluidic chambers, wherein at least one of the individual cell populations comprises one or more effector cells and the separate microfluidic chambers further comprise a readout particle population comprising one or more readout particles. The cell populations are assayed for the presence of the extracellular effect, whereby the readout particle population or subpopulation thereof provides a readout of the extracellular effect. A cell population from amongst the plurality can then be identified that exhibits a variation in the extracellular effect, as compared to one or more of the remaining cell populations of the plurality. Once a cell population is identified that displays the variation in the extracellular effect, the population is recovered and may be further assayed at limiting dilution to identify the cell or cells within the population responsible for the extracellular effect.
[0223] Cell populations that can be analyzed herein are not limited to a specific type. For example, in one embodiment a starting population of cells partitioned into individual cell populations in microreactors may be peripheral blood mononuclear cells (PBMCs) isolated from an animal that has been immunized or exposed to an antigen. The starting population of cells in another embodiment are B-cells isolated from an animal that has been immunized or exposed to an antigen. The source of the starting population of cells may be whole blood from the animal that has been immunized or exposed to an antigen.
[0224] An effector cell, as used herein, refers to a cell that has the ability to exert an extracellular effect. The extracellular effect is a direct or indirect effect on a readout particle, as described in detail below. The extracellular effect is attributable to the effector cell, or a molecule secreted by the effector cell, for example a signaling molecule, metabolite, an antibody, neurotransmitter, hormone, enzyme, cytokine. In one embodiment, the effector cell is a cell that secretes or displays a protein (e.g., T cell receptor). In embodiments described herein, the extracellular effect is characterized via the use of a readout particle, e.g., a readout cell or a readout bead, or a readout particle population or subpopulation. For example, in one embodiment described herein, the extracellular effect is the agonizing or antagonizing of a cell surface receptor, ion channel or ATP binding cassette (ABC) transporter, present on a readout cell or readout bead. In one embodiment, the effector cell is an antibody secreting cell (ASC). An ASC, as used herein, refers to any cell type that produces and secretes an antibody. Plasma cells (also referred to as plasma B cells, plasmocytes and effector B cells) are terminally differentiated, and are one type of ASC. Other ASCs that qualify as effector cells for the purposes of the present invention include plasmablasts, cells generated through the expansion of memory B cells, cell lines that express recombinant monoclonal antibodies, hybridoma cell lines. In another embodiment, the effector cell is a cell that secretes a protein. Other cell types that qualify as effector cells include T cells (e.g., CD8+ T cell, and CD4+ T cell), hematopoietic cells, cell lines derived from humans and animals, recombinant cell lines, e.g., a recombinant cell line engineered to produce antibodies, a recombinant cell line engineered to express a T cell receptor.
[0225] Individual cell populations optionally comprising one or more effector cells are assayed to determine whether the respective cell populations comprise an effector cell that exhibits an extracellular effect, or a variation in an extracellular effect as compared to another individual cell population or a plurality thereof. As stated above, when cell populations are assayed in parallel on one device, not all cell populations will comprise an effector cell, and the methods described herein allow for the identification of a cell population that contains one or more effector cells. Additionally, a cell population comprising an effector cell need not include multiple effector cells, or be a population of only effector cells. Rather, non-effector cells, in embodiments described herein, are included in the population. The non-effector cells can be a majority or minority of the population. A heterogeneous population comprising an effector cell need not include multiple effector cells. Rather, a heterogeneous cell population is heterogeneous as long as two cells are heterogeneous with respect to one another. A cell population can comprise zero effector cells, one effector cell or a plurality of effector cells. Similarly, a cell subpopulation can comprise zero effector cells, one effector cell or a plurality of effector cells.
[0226] The extracellular effect in one embodiment is the binding interaction with an antigen, or a functional effect. For example, in one embodiment, the extracellular effect is agonism or antagonism of a cell surface receptor, agonism or antagonism of an ion channel or agonism or antagonism of an ABC transporter, modulation of apoptosis, modulation of cell proliferation, a change in a morphological appearance of a readout particle, a change in localization of a protein within a readout particle, expression of a protein by a readout particle, neutralization of the biological activity of an accessory particle, cell lysis of a readout cell induced by an effector cell, cell apoptosis of a readout cell induced by the effector cell, cell necrosis of the readout cell, internalization of an antibody by a readout cell, internalization of an accessory particle by a readout cell, enzyme neutralization by the effector cell, neutralization of a soluble signaling molecule, or a combination thereof.
[0227] The presence and identification of an effector cell that secretes a biomolecule (e.g., antibody) that binds a target of interest (e.g., antigen) is readily ascertained in embodiments where the effector cell is present in a heterogeneous cell population comprising a plurality of effector cells that secrete antibodies that are not specific to the target of interest. In one embodiment, this is achieved in an individual microfluidic chamber by first capturing in the chamber, all or substantially all of the secreted antibodies of the population on a readout particle(s) (e.g., bead) functionalized to capture antibodies (for example, functionalized with protein G or protein A), addition of fluorescently labeled antigen into the chamber and imaging of the particle(s) to detect the presence or absence of an increase in fluorescence due to binding of the antigen to immobilized antibody(ies). An estimate of minimum number of antibodies captured on a bead that is required for reliable detection may be obtained by performing experiments to measure antibody secretion from single cells. In one embodiment, it is possible to detect antigen-specific antibodies secreted from a single ASC in a heterogeneous population of approximately 500 cells. In the case of the present invention, a cell population present in an individual microfluidic chamber can comprise from about two to about 500 cells, for example, about two to about 250 ASCs. As stated above, a cell population can contain cells other than effector cells and not all cell populations will contain an effector cell. This is particularly true when conventional enrichment protocols (e.g., FACS) are not able to be used to obtain a substantially pure cell population of the same cell type.
[0228] With respect to a heterogeneous cell population, all of the cells not be heterogeneous with respect to each other, provided that there are at least two cells in the population that are heterogeneous with respect to each other, for example, an effector cell and a non-effector cell. A heterogeneous cell population may consist of as few as two cells. A cell population or cell subpopulation may consist of a single cell. In principle, a heterogeneous cell population may include any number of cells that can be maintained in a viable state for the required duration of the extracellular effect assay, e.g., one of the extracellular effect assays provided herein. In one embodiment, the number of cells in a cell population is from 1 cell to about 500 cells per chamber. In one embodiment, where the imaging of individual cells or readout particles is required, the number of cells in a population is chosen to be insufficient to cover the floor of the chamber, so that the cells being imaged are arranged in a monolayer. Alternatively, the cell population includes a number of cells that is insufficient to form a bilayer covering a surface of the chamber.
[0229] In some embodiments, larger populations of cells can be present in a population within a single microfluidic chamber or microreactor, without inhibiting the detection of an effect that stems from a single effector cell or a small number of effector cells within the particular population. For example, in one embodiment, the number of cells in a cell population is from two to about 900, or from about 10 to about 900, or from about 100 to about 900. In another embodiment, the number of cells in a cell population is from two to about 800, or from about 10 to about 800, or from about 100 to about 800. In another embodiment, the number of cells in a cell population is from two to about 700, or from about 10 to about 700, or from about 100 to about 700. In another embodiment, the number of cells in a cell population is from two to about 600, or from about 10 to about 600, or from about 100 to about 600. In another embodiment, the number of cells in a cell population is from two to about 500, or from about 10 to about 500, or from about 100 to about 500. In another embodiment, the number of cells in a cell population is from two to about 400, or from about 10 to about 400, or from about 100 to about 400. In another embodiment, the number of cells in a cell population is from two to about 300, or from about 10 to about 300, or from about 100 to about 300. In another embodiment, the number of cells in a cell population is from two to about 200, or from about 10 to about 200, or from about 100 to about 200. In another embodiment, the number of cells in a cell population is from two to about 100, or from about 10 to about 100, for from about 50 to about 100. In another embodiment, the number of cells in a cell population is from two to about 90, or from about 10 to about 90, or from about 50 to about 900. In yet another embodiment, the number of cells in a cell population is from two to about 80, or from 10 to about 80, or from two to about 70, or from about 10 to about 70, or from about two to about 60, or from about 10 to about 60, or from about two to about 50, or from about 10 to about 50, or from about two to about 40, or from about 10 to about 40, or from two to about 30, or from about 10 to about 20, or from two to about 10. In some embodiments, the majority of cells in a cell population are effector cells.
[0230] In one aspect of the invention, a cell or cell population analyzed by the methods provided herein comprises one or more effector cells, e.g., an antibody secreting cell (ASC) or a plurality of ASCs. Cells, in one embodiment, are separated into a plurality of cell populations in thousands of microfluidic chambers, and individual cell populations comprising one or more effector cells (i.e., within single microfluidic chambers) are assayed for an extracellular effect. One or more individual cell populations are identified and recovered if an effector cell within the one or more populations exhibits the extracellular effect or a variation in an extracellular effect. The extracellular effect is determined by the user and in one embodiment, is a binding interaction with an antigen, cell surface receptor, ABC transporter or an ion channel.
[0231] Although the methods provided herein can be used to identify a single effector cell (alone or within a heterogeneous population) based on a binding interaction, e.g., antigen affinity and specificity, the invention is not limited thereto. Rather, identification of a cell population, in one embodiment, is carried out via the implementation of a direct functional assay. Accordingly, one aspect of the invention includes methods and devices that enable the direct discovery of an ASC within a cell population that secretes a functional antibody, without the need to initially screen the functional antibody for binding properties such as affinity and selectivity to an antigen target.
[0232] Along these lines, in one aspect, functional antibodies and receptors discoverable by the methods herein are provided. In one embodiment of this aspect, the nucleic acid of an effector cell responsible for an extracellular effect is amplified and sequenced. The nucleic acid is a gene encoding for a secreted biomolecule (e.g., antibody, or fragment thereof), or a gene encoding a cell receptor or fragment thereof, for example a T-cell receptor. The antibody or fragment thereof or cell receptor or fragment thereof can be cloned and/or sequenced by methods known in the art. For example, in one embodiment, an ASC that secretes a functional antibody discoverable by the methods and devices provided herein is one that modulates cell signaling by binding to a targeted cell surface protein, such as an ion-channel receptor, ABC transporter, a G-protein coupled receptor (GPCR), a receptor tyrosine kinase (RTK) or a receptor with intrinsic enzymatic activity such as intrinsic guanylate cyclase activity.
[0233] In one aspect of the invention, a cell population comprising one or a plurality of effector cells is identified in a microreactor, e.g., microfluidic chamber, based on the result of an extracellular effect assay carried out in the chamber. If an extracellular effect or variation in extracellular effect is measured in the microreactor, the cell population is recovered and analyzed to determine the effector cell or effector cells within the population responsible for the effect (see, e.g.,
[0234] As described herein, a heterogeneous cell population typically includes populations of cells having numbers ranging from 2 to about 1000, or from 2 to about 500, or from about 2 to about 250, or from about 2 to about 100. A heterogeneous cell population describes a population of cells that contains at least two cells with a fundamental difference in genotype, protein expression, mRNA expression or differentiation state where at least one of the cells is an effector cell. In particular, a heterogeneous cell population, in one embodiment, include two or more effector cells (e.g., from about to about 250 cells) that contain or express different immunoglobulin genes, that contain or express different genes derived from immunoglobin genes, that contain or express different genes derived from T cell receptor genes, secrete different immunoglobulin proteins, secrete different proteins derived from immunoglobulin proteins, secrete different proteins or express different proteins derived from T cell receptor proteins.
[0235] In one embodiment, a cell population comprises a population of cells genetically engineered to express libraries of molecules that may bind a target epitope, cells genetically engineered to express genes or fragments of genes derived from cDNA libraries of interest, cells genetically engineered with reporters for various biological functions, and cells derived from immortalized lines or primary sources. Notably, clones originating from a single cell, in one embodiment, are heterogeneous with respect to one another due to for example, gene silencing, differentiation, altered gene expression, changes in morphology, etc. Additionally, cells derived from immortalized lines or primary sources are not identical clones of a single cell and are considered heterogeneous with respect to one another. Rather, a clonal population of cells has originated from a single cell and has not been modified genetically, transduced with RNA, transduced with DNA, infected with viruses, differentiated, or otherwise manipulated to make the cells different in a significant functional or molecular way. Cells derived from a single cell, but which naturally undergo somatic hypermutation or are engineered to undergo somatic hypermutation (e.g., by inducing expression of activation-induced cytidine deaminase, etc.), are not considered clones and therefore these cells, when present together, are considered a heterogeneous cell population.
[0236] As provided throughout, in one aspect, methods and apparatuses are provided for assaying a plurality of individual cell populations each optionally comprising one or more effector cells, in order identify one or more of the cell populations that includes at least one effector cell having an extracellular effect on a readout particle population or subpopulation thereof, e.g., secretion of a biomolecule having a desired property. Once the cell population(s) is identified, in one embodiment, it is selectively recovered to obtain a recovered cell population. If multiple cell populations are identified, in one embodiment, they are recovered and pooled, to obtain a recovered cell population. The recovered cell population is enriched for effector cells, compared to the starting population of cells originally loaded onto the device in that the former has a larger percentage of effector cells as compared to the latter.
[0237] Subpopulations of the recovered cell population are assayed for the presence of a second extracellular effect on a readout particle population, wherein the readout particle population or subpopulation thereof provides a readout of the second extracellular effect. The extracellular effect can be the same effect that was assayed, on the identified cell population, or a different extracellular effect. In a further embodiment, the subpopulations of the identified population each comprise from about 1 to about 10 cells. In even a further embodiment, the subpopulations of the identified population comprise an average of 1 cell each. One or more of the subpopulations displaying the extracellular effect are then identified and recovered to obtain a recovered subpopulation, which in one embodiment, is enriched for effector cells. If multiple cell subpopulations are identified, in one embodiment, they are recovered and pooled, to obtain a recovered cell subpopulation. The genetic information from the recovered cell subpopulation can then be isolated, amplified and/or sequenced.
[0238] The present invention is not limited by the type of effector cell or cell population that can be assayed according to the methods of the present invention. Examples of types of effector cells for use with the present invention are provided above, and include primary antibody secreting cells from any species (e.g., human, mouse, rabbit, etc.), primary memory cells (e.g., can assay IgG, IgM, IgD or other immunoglobins displayed on surface of cells or expand/differentiate into plasma cells), T-cells, hybridoma fusions either after a selection or directly after fusion, a cell line that has been transfected (stable or transient) with one or more libraries of monoclonal antibodies (mAbs) (e.g., for affinity maturation of an identified mAb using libraries of mutants in fab regions or effector function optimization using identified mAbs with mutations in Fc regions or cell lines transfected with heavy chain (HC) and light chain (LC) combinations from amplified HC/LC variable regions obtained from a person/animal/library or combinations of cells expressing mAbs (either characterized or uncharacterized to look for synergistic effects, etc.).
[0239] Plasma cells (also referred to as plasma B cells, plasmocytes and effector B cells) are terminally differentiated, and are one type of effector cell (ASC) that can be assayed with the devices and methods of the invention. Other ASCs that qualify as effector cells for the purposes of the present invention include plasmablasts, cells generated through the expansion of memory B cells, cell lines that express recombinant monoclonal antibodies, primary hematopoietic cells that secrete cytokines, T cells (e.g., CD4+ and CD8+ T-cells), dendritic cells that display protein or peptides on their surface, recombinant cell lines that secrete proteins, hybridoma cell lines, a recombinant cell engineered to produce antibodies, a recombinant cell engineered to express a T cell receptor.
[0240] It will be appreciated that the cell populations for use with the invention are not limited by source, rather, they may be derived from any animal, including human or other mammal, or alternatively, from in vitro tissue culture. Cells may be analyzed directly, for example, analyzed directly after harvesting from a source, or after enrichment of a population having a desired property (such as the secretion of antibodies that bind a specific antigen) by use of various protocols that are known in the art, e.g., flow cytometry. Prior to harvesting from an animal source, in one embodiment, the animal is subject to one or more immunizations. In one embodiment, flow cytometry is used to enrich for effector cells prior to loading onto one of the devices provided herein, and the flow cytometry is fluorescence activated cell sorting (FACS). Where a starting cell population is used that has been enriched for effector cells, e.g., ASCs, and retained as individual cell populations in individual microfluidic chambers, the individual cell populations need not be comprised entirely of effector cells. Rather, other cell types may be present as a majority or minority. Additionally, one or more of the individual cell populations may contain zero effector cells.
[0241] There are several methods for the enrichment of ASCs derived from animals known to those of skill in the art, which can be used to enrich a starting population of cells for analysis by the methods and devices provided herein. For example, in one embodiment, FACS is used to enrich for human ASCs using surface markers CD19.sup.+CD20.sup.lowCD27.sup.hiCD38.sup.hi (Smith et al. (2009). Nature Protocols 4, pp. 372-384, incorporated by reference herein in its entirety). In another embodiment, a cell population is enriched by magnetic immunocapture based positive or negative selection of cells displaying surface markers. In another embodiment, a plaque assay (Jerne et al. (1963). Science 140, p. 405, incorporated by reference herein in its entirety), ELISPOT assay (Czerkinsky et al. (1983). J. Immunol. Methods 65, pp. 109-121, incorporated by reference herein in its entirety), droplet assay (Powel et al. (1990). Bio/Technology 8, pp. 333-337, incorporated by reference herein in its entirety), cell surface fluorescent-linked immunosorbent assay (Yoshimoto et al. (2013), Scientific Reports, 3, 1191, incorporated by reference herein in its entirety) or a cell surface affinity matrix assay (Manz et al. (1995). Proc. Natl. Acad. Sci. U.S.A. 92, pp. 1921-1925, incorporated by reference herein in its entirety) is used to enrich for ASCs prior to performing one of the methods provided herein or prior to loading a starting cell population onto one of the devices provided herein.
[0242] In various embodiments, two or more effector cells within a cell population produce and secrete cell products, e.g., antibodies that have a direct or indirect effect on a readout particle population or subpopulation thereof. With respect to the devices provided herein, it is noted that not all chambers on the device necessarily include a cell population and/or a readout particle population, e.g., empty chambers or partially filled chambers may be present. Additionally, as provided throughout, within an individual chamber it may be only a subset of the cells within the cell population, or an individual cell within a population that produces and secretes antibodies. In some embodiments, cell populations in the microfluidic chambers do not comprise an effector cell. These chambers are identifiable by running one or more extracellular effect assays on each of the cell populations.
[0243] In some embodiments, it is desirable to have one or more accessory particles, which can include one or more accessory cells present in the microreactors, e.g., microfluidic chambers, to support the viability and/or function of one or more cells in the cell populations or to implement an extracellular effect assay. For example, in one embodiment an accessory cell, or plurality of accessory cells comprise a fibroblast cell, natural killer (NK) cell, killer T cell, antigen presenting cell, dendritic cell, recombinant cell, or a combination thereof.
[0244] An accessory particle or cells, or a population comprising the same, in one embodiment, is delivered to microreactors, e.g., microfluidic chambers together with the cell population. In other words, accessory cells in one embodiment are part of cell populations delivered to microfluidic chambers. Alternatively or additionally, the accessory particle(s) or accessory cell(s) are delivered to a chamber prior to, or after, the loading of the heterogeneous population of cells comprising an effector cell or plurality of effector cells to the microreactor or plurality of microreactors (e.g., microfluidic chamber or plurality of microfluidic chambers).
[0245] Accessory particle as referred to herein means any particle, including but not limited to a protein, protein fragment, cell, that (i) supports the viability and/or function of an effector cell, (ii) facilitates an extracellular effect, (iii) facilitates the measurement of an extracellular effect, or (iv) detection of an extracellular effect of an effector cell.
[0246] Accessory particles include but are not limited to proteins, peptides, growth factors, cytokines, neurotransmitters, lipids, phospholipids, carbohydrates, metabolites, signaling molecules, amino acids, monoamines, glycoproteins, hormones, virus particles or a combination thereof. In one embodiment, one or more accessory particles comprises sphingosine-1-phosphate, lysophosphatidic acid or a combination thereof.
[0247] As an example of an accessory cell, in one embodiment, a population of fibroblast cells (that do not secrete antibodies) is included within a cell population enriched for effector cells (e.g., ASCs) in order to enhance the viability of the effector cell(s) (e.g., ASC(s)) within the population. In another embodiment, a population of NK cells may be added as accessory particles to implement an antibody-dependent cell-mediated cytotoxicity assay, where the NK cells will attack and lyse the target cells upon binding of an antibody on their surface. In embodiments where functional cellular assays are carried out on one or more cell populations, it will be appreciated that the effector cell(s) within the one or more cell populations will need to stay viable for an extended period of time while within a chamber of the microfluidic device. To this end, accessory particles and/or accessory cells, in one embodiment, are used to sustain the viability of the cell population that optionally comprises one or more effector cells. As explained below, accessory particles, e.g., accessory cells can also be used to sustain or enhance the viability of a readout cell population or subpopulation thereof, either of which can be a single readout cell.
[0248] One advantage of embodiments described herein is that the analysis of more than one effector cell within a single microreactor (e.g., microfluidic chamber), and/or the analysis of single or a few effector cells in the presence of other cells, allows for much greater assay throughput and hence the identification and selection of desired effector cells that would otherwise be too rare to detect efficiently. This is advantageous in many instances where there are limited methods to enrich for a desired cell type or where such enrichment has deleterious effects such as the reduction of viability of the cells being assayed. One embodiment of the invention that has been built features an array of 3500 cell analysis chambers. When this device is operated with an average of 30 cells per chamber, the total assay throughput is 105,000 cells per experiment. This throughput may be used for the selection of tens or hundreds of effector cells that are present at less than, for example, 1% of the total cell population.
[0249] For example, antibody secreting cells may be identified and isolated without the need for enrichment based on surface markers. In B-cells isolated from peripheral mononuclear blood cells (PBMCs) following immunization, the frequency of ASCs may be between 0.01% and 1%. At a throughput of 105,000 cells per device run, it is possible to directly select for hundreds of ASCs without further purification. This is particularly important, since FACS purification of ASCs can reduce cell viability. This is also important because appropriate reagents for the enrichment of ASCs may not be available for a host species of interest. Indeed, following immunization, the frequency of antibody secreting cells in peripheral blood mononuclear cells (PBMCs) may be between 0.01 and 1% and is thus detectable by using the microfluidic arrays provided herein, for example, a microfluidic array of 3500 chambers loaded at an average density of 30 cells per chamber. Thus, since the isolation of peripheral blood mononuclear cells (PBMCs) may be performed on any species without specific capture reagents, some of the present methods provide for the rapid and economical selection of cells secreting antibodies of interest from any species.
[0250] ASCs from basal levels in humans, in one embodiment, are identified by the methods and devices provided herein. While animals can be immunized to generate new antibodies against most antigens, the same procedure cannot be performed widely in humans except for approved vaccines. However, humans that have been naturally exposed to an antigen, or vaccinated at some point in their lifespan, typically possess low basal levels of antibody-secreting cells for the antigen. The present invention can be used to identify and isolate extremely rare effector cells secreting specific antibodies from a large number of cells (e.g., greater than 100,000 per device run). Such methods are used herein for the discovery of functional antibodies, e.g., as therapeutics for autoimmune diseases and cancers where autoantibodies may be present.
[0251] As provided throughout, the present invention relates in part to extracellular effect carried out in a massively parallel fashion in single microfluidic chambers. The assays are carried out to measure and detect an extracellular effect exerted by an effector cell, or plurality thereof, present in a cell population. A population of readout particles or subpopulation thereof provides a readout of the extracellular effect. For example, the methods described herein allow for the identification of a heterogeneous cell population which contains an effector cell that exerts the extracellular effect, e.g., secretion of an antibody specific to a desired antigen, in a background of up to about 250 cells that do not exert the extracellular effect.
[0252] Readout particle, as used herein, means any particle, including a bead or cell, e.g., a functionalized bead or a cell that reports a functionality or property, or is used in an assay to determine an extracellular effect (e.g., functionality or property) of an effector cell, or a product of an effector cell such as an antibody. As described herein, a readout particle can be present as a single readout particle or within a homogeneous or heterogeneous population of readout particles within a single microfluidic chamber. In one embodiment, a readout particle is a bead functionalized to bind one or more biomolecules secreted by an effector cell (e.g., one or more antibodies), or released by an effector or accessory cell upon lysis. A single readout particle may be functionalized to capture one or more different types of biomolecules, for instance a protein and/or nucleic acid, or one or more different monoclonal antibodies. In one embodiment, the readout particle is a bead or a cell that is capable of binding antibodies produced by an effector cell that produces and/or secretes antibodies. In some embodiments, an effector cell may also be a readout particle, e.g., where a secretion product of one effector cell in a population has an effect on a larger, or different, sub-population of the effector cells or, alternatively, where the secretion product of one effector cell is captured on the same cell for readout of the capture.
[0253] A readout cell, as used herein, is a type of readout particle that exhibits a response in the presence of a single effector cell or a cell population comprising one or more effector cells, for example one or more effector cells that secrete antibodies. In various embodiments, the readout cell is a cell that displays a surface antigen or a receptor (e.g., GPCR or RTK) specific to a secreted molecule. In one embodiment, the binding of the secreted molecule to a readout cell is the extracellular effect. The readout cell may be fluorescently labeled and/or possess fluorescent reporters that are activated upon binding.
[0254] As described above, in some embodiments, a cell population subjected to the methods described herein comprises an ASC or a plurality of ASCs, and the readout particle population or subpopulation thereof displays a target epitope or a plurality of target epitopes. The readout particle population in one embodiment is a population of beads functionalized to capture antibodies by a particular epitope or epitopes. Alternatively or additionally, the readout particle population is specific for an antibody's Fc region, and therefore, does not discriminate between antibodies having different epitopes. The readout particle population or subpopulation thereof, in one embodiment is labeled with a fluorescently-conjugated molecule containing the target epitope, for example to perform an ELISA assay. Fluorescent based antibody and cytokine bead assays are known in the art, see, e.g., Singhal et al. (2010). Anal. Chem. 82, pp. 8671-8679, Luminex Assays (Life Technologies), BD Cytometric Bead Array, the disclosures of which are incorporated by reference in their entireties. These methods can be used herein to determine whether an effector cell has an extracellular effect on a readout particle.
[0255] Moreover, as described herein, individual microreactors (e.g., microfluidic chambers) are structured so that reagent exchange within the individual chambers is possible, whereby cross-contamination is eliminated or substantially eliminated between chambers. This allows for the detection of multiple extracellular effects in a single chamber, for example, multiple antigen binding effects and/or functional effects in a single chamber, for example, by exchanging antigens and secondary antibodies to label the respective binding complexes, followed by imaging. In these serial detection embodiments, the assays can be carried out with the same fluorophores, as each reaction is performed serially after a wash step. Alternatively, different fluorophores can be used to detect different extracellular effects in a serial manner, or in parallel, in one microreactor (e.g., microfluidic chamber).
[0256] In another embodiment, the readout particle population is a readout cell population wherein at least some of the readout cells display a target epitope on their surfaces. In one embodiment, the readout cell population, or a subpopulation thereof, is alive and viable. In another embodiment, the readout cell population or a subpopulation thereof is fixed. As will be recognized from the discussion above, where antibody binding is assayed for, antibody binding is considered the extracellular effect of an effector cell or plurality of effector cells. Antibody binding can be detected by, for example, staining of the cell with one or more fluorescently labeled secondary antibodies. In another embodiment, binding of an antibody to the target epitope on a readout particle or readout cell causes the death of a readout cell, or some other readout cell response as discussed herein (e.g., secretion of biomolecule, activation or inhibition of a cell signaling pathway).
[0257] Readout cells in a population may be distinguished, e.g., by features such as morphology, size, surface adhereance, motility, fluorescent response. For example, in one embodiment, a population of readout cells is labeled on their surfaces, or intracellulary, in order to determine whether the readout cells exhibit a response as chosen by the user of assay. For example, a calcein, carboxyfluorescein succinymyl ester reporter (CFSE), GFP/YFP/RFP reporters can be used to label one or more reporter cells, including extracellular receptors and intracellular proteins and other biomolecules.
[0258] In some embodiments, the readout particle population is a heterogeneous readout particle population, which can be a heterogeneous readout cell population. Where, for example, an ASC or plurality of ASCs are present in a cell population, the individual readout particles in the population may display different target epitopes, or display two different cell receptors (e.g., a GPCR or RTK or a combination thereof). Accordingly, the specificity of the extracellular effect, e.g., the specificity of an antibody for a target epitope, or the inhibition of a specific cell surface receptor, can be assessed. In another embodiment, an effector cell within a cell population is an ASC, and the readout particle population comprises a heterogeneous bead population that non-selectively capture all antibodies (e.g., Fc region specific) and a bead population that is specific for a unique target epitope.
[0259] In one embodiment, accessory particles are provided to facilitate the measurement of an extracellular effect, or to facilitate the readout of an extracellular effect. As described throughout, an extracellular effect includes an effect that is exhibited by an effector cell secretion product (e.g., antibody). For example, in one embodiment, a natural killer (NK) cell is provided as an accessory particle, to facilitate the measurement of lysis of a readout cell. In this embodiment, the extracellular effect includes lysis of a readout cell that binds to a specific epitope or cell receptor, by the natural killer (NK) cell, when an antibody secreted by an effector cell binds to the aforementioned readout cell.
[0260] In some embodiments, accessory particles include proteins, protein fragments, peptides, growth factors, cytokines, neurotransmitters (e.g., neuromodulators or neuropeptides), lipids, phospholipids, amino acids, monoamines, glycoproteins, hormones, virus particles, or a factor required to activate the complement pathway, upon binding of an effector cell secretion product to a readout cell or a combination thereof. In one embodiment, one or more accessory particles sphingosine-1-phosphate, lysophosphatidic acid or a combination thereof. Various extracellular effects that are measurable with the devices and methods provided herein, including lysis of the readout cell that binds the antibody, are discussed in detail below.
[0261] For example, cytokines that can be used as accessory particles include chemokines, interferons, interleukins, lymphokines, tumor necrosis factors. In some embodiments the accessory particles are produced by readout cells. In some embodiments, a cytokine is used as an accessory particle and is one or more of the cytokines provided in Table 1, below. In another embodiment, one or more of the following cytokines is used as an accessory particle: interleukin (IL)-1a, IL-1(3, IL-1RA, IL18, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL17, IL-18, IL-19, IL-20, granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage-colony stimulating factor (GM-CSF), leukemia inhibitor factor, oncostatin M, interferon (IFN)-, IFN-, IFN-, CD154, lymphotoxin beta (LTB), tumor necrosis factor (TNF)-, TNF-, transforming growth factor (TGF)-, erythropoietin, megakaryocyte growth and development factor (MGDF), Fms-related tyrosine kinase 3 ligand (Flt-3L), stem cell factor, colony stimulating factor-1 (CSF-1), macrophage stimulating factor, 4-1BB ligand, a proliferation-inducing ligand (APRIL), cluster of differentiation 70 (CD70), cluster of differentiation 153 (CD153), cluster of differentiation 178 (CD17)8, glucocorticoid induced TNF receptor ligand (GITRL), LIGHT (also referred to as TNF ligand superfamily member 14, HVEM ligand, CD258), OX40L (also referred to as CD252 and is the ligand for CD134), TALL-1, TNF related apoptosis inducing ligand (TRAIL), tumor necrosis factor weak inducer of apoptosis (TWEAK), TNF-related activation-induced cytokine (TRANCE) or a combination thereof
TABLE-US-00001 TABLE 1 Representative cytokines and their receptors. Cytokine Receptor(s)(Da) and Name Synonym(s) Amino Acids Chromosome Molecular Weight Form Receptor Location(s) Interleukins IL-1 hematopoietin-1 271 2q14 30606 CD121a, CDw121b 2q12, 2q12-q22 IL-1 catabolin 269 2q14 20747 CD121a, CDw121b 2q12, 2q12-q22 IL-1RA IL-1 receptor antagonist 177 2q14.2 20055 CD121a 2q12 IL-18 interferon- inducing 193 11q22.2-q22.3 22326 IL-18R, 2q12 factor Common g chain (CD132) IL-2 T cell growth factor 153 4q26-q27 17628 CD25, 122,132 10p15-p14, 22q13.1, Xq13.1 IL-4 BSF-1 153 5q31.1 17492 CD124,213a13, 132 16p11.2-12.1, X, Xq13.1 IL-7 177 8q12-q13 20186 CD127, 132 5p13, Xq13.1 IL-9 T cell growth factor P40 144 5q31.1 15909 IL-9R, CD132 Xq28 or Yq12, Xq13.1 IL-13 P600 132 5q31.1 14319 CD213a1, 213a2, X, Xq13.1-q28, CD1243, 132 16p11.2-12.1, Xq13.1 IL-15 162 4q31 18086 IL-15Ra, CD122, 132 10p14-p14, 22q13.1, Xq13.1 Common b chain (CD131) IL-3 multipotential CSF, 152 5q31.1 17233 CD123, CDw131 Xp22.3 or Yp11.3, MCGF 22q13.1 IL-5 BCDF-1 134 5q31.1 15238, homodimer CDw125, 131 3p26-p24, 22q13.1 Also related GM-CSF CSF-2 144 5q31.1 16295 CD116, CDw131 Xp22.32 or Yp11.2, 22q13.1 IL-6-like IL-6 IFN-2, BSF-2 212 7p21 23718 CD126, 130 1q21, 5q11 IL-11 AGIF 199 19q13.3-13.4 21429 IL-11Ra, CD130 9p13, 5q11 Also related G-CSF CSF-3 207 17q11.2-q12 21781 CD114 1p35-p34.3 IL-12 NK cell stimulatory 219/328 3p12-p13.2/ 24844/37169 CD212 19p13.1, 1p31.2 factor 5q31.1-q33.1 heterodimer LIF leukemia inhibitory factor 202 22q12.1-q12.2 22008 LIFR, CD130 5p13-p12 OSM oncostatin M 252 22q12.1-q12.2 28484 OSMR, CD130 5p15.2-5p12 IL-10-like IL-10 CSIF 178 1q31-q32 20517, homodimer CDw210 11q23 IL-20 176 2q32.2 20437 IL-20R, ? Others IL-14 HMW-BCGF 498 1 54759 IL-14R ? IL-16 LCF 631 15q24 66694, homotetramer CD4 12pter-p12 IL-17 CTLA-8 155 2q31 17504, homodimer CDw217 22q11.1 Interferons IFN- 189 9p22 21781 CD118 21q22.11 IFN- 187 9p21 22294 CD118 21q22.11 IFN- 166 12q14 19348, homodimer CDw119 6q23-q24 TNF CD154 CD40L, TRAP 261 Xq26 29273, homotrimer CD40 20q12-q13.2 LT- 244 6p21.3 25390, heterotrimer LTR 12p13 TNF- cachectin 233 6p21.3 25644, homotrimer CD120a, b 12p13.2, 1p36.3-p36.2 TNF- LT- 205 6p21.3 22297, heterotrimer CD120a, b 12p13.2, 1p36.3-p36.2 4-1BBL 254 19p13.3 26624, trimer? CDw137 (4-1BB) 1p36 APRIL TALL-2 250 17p13.1 27433, trimer? BCMA, TACI 16p13.1, 17p11.2 CD70 CD27L 193 19p13 21146, trimer? CD27 12p13 CD153 CD30L 234 9q33 26017, trimer? CD30 1p36 CD178 FasL 281 1q23 31485, trimer? CD95 (Fas) 10q24.1 GITRL 177 1q23 20307, trimer? GITR 1p36.3 LIGHT 240 16p11.2 26351, trimer? LTbR, HVEM 12p13, 1p36.3-p36.2 OX40L 183 1q25 21050, trimer? OX40 1p36 TALL-1 285 13q32-q34 31222, trimer? BCMA, TACI 16p13.1, 17p11.2 TRAIL Apo2L 281 3q26 32509, trimer? TRAILR1-4 8p21 TWEAK Apo3L 249 17p13.3 27216, trimer? Apo3 1p36.2 TRANCE OPGL 317 13q14 35478, trimer? RANK, OPG 18q22.1, 8q24 TGF- TGF-1 TGF- 390 19q13.1 44341, homodimer TGF-R1 9q22 TGF-2 414 1q41 47747, homodimer TGF-R2 3p22 TGF-3 412 14q24 47328, homodimer TGF-R3 1p33-p32 Miscellaneous hematopoietins Epo erythropoietin 193 7q21 21306 EpoR 19p13.3-p13.2 Tpo MGDF 353 3q26.3-q27 37822 TpoR 1p34 Flt-3L 235 19q13.1 26416 Flt-3 13q12 SCF stem cell factor, c-kit 273 12q22 30898, homodimer CD117 4q11-q12 ligand M-CSF CSF-1 554 1p21-p13 60119, homodimer CD115 5q33-q35 MSP Macrophage stimulating 711 3p21 80379 CDw136 3p21.3 factor, MST-1 Adapted from Cytokines, Chemokines and Their Receptors. Madame Curie Bioscience Database. (Landes Biosceince)
[0262] In one embodiment, an accessory particle is a cytokine or other factor operable to stimulate a response of the readout cell. For example, readout cells may be incubated with an effector cell or plurality thereof and pulsed with a cytokine that is operable to affect the readout cell. Alternatively or additionally, cytokine-secreting cells operable to affect the readout particles are provided to the chamber as accessory cells. Neutralization of the secreted cytokines by an effector cell secretion product in one embodiment, are detected by the absence of the expected effect of the cytokine on the readout cell. In another embodiment, an accessory particle is provided and is a virus operable to infect one or more readout cells, and neutralization of the virus is detected as the reduced infection of readout cells by the virus.
[0263] Notably, and as should be evident by the discussion provided above regarding accessory particles, the extracellular effect measurable and detectable by the devices and methods provided herein is not limited to the binding of an antibody to a target epitope. Rather an extracellular effect as described herein, in one embodiment, is a functional effect. The functional effect, in one embodiment is apoptosis, modulation of cell proliferation, a change in a morphological appearance of the readout particle, a change in aggregation of multiple readout particles, a change in localization of a protein within the readout particle, expression of a protein by the readout particle, secretion of a protein by the readout particle, triggering of a cell signaling cascade, readout cell internalization of a molecule secreted by an effector cell, neutralization of an accessory particle operable to affect the readout particle.
[0264] Once an extracellular effect is identified in a microreactor (e.g., microfluidic chamber) comprising a cell population, the population is recovered and a downstream assay can be performed on subpopulations of the recovered cell population, to determine which effector cell(s) is responsible for the measured extracellular effect. The downstream assay in one embodiment is a microfluidic assay. In a further embodiment, the downstream assay is carried out on the same device as the first extracellular effect assay. However, in another embodiment, the downstream assay is carried out in a different microfluidic device, or via a non-microfluidic method, for example, a benchtop single cell reverse transcriptase (RT)-PCR reaction. Antibody gene sequences of identified and recovered effector cells in one embodiment are isolated, cloned and expressed to provide novel functional antibodies.
[0265] Although functional effects of single ASCs are measurable by the methods and devices provided herein, affinity, binding and specificity can also be measured as the effect of an effector cell, e.g., an effect of an effector cell secretion product. For example, the binding assay provided by Dierks et al. (2009). Anal. Biochem. 386, pp. 30-35, incorporated by reference herein in its entirety, can be used in the devices provided herein to determine whether an ASC secretes an antibody that binds to a specific target.
[0266] In another embodiment, the extracellular effect is affinity for an antigen or cell receptor, and the method described by Singhal et al. (2010). Anal. Chem. 82, pp. 8671-8679, incorporated by reference herein for all purposes, is used to assay the extracellular effect.
[0267] In one embodiment, parallel analyses of multiple extracellular effects are carried out in one microreactor (e.g., microfluidic chamber) by employing multiple types of readout particles. Alternatively or additionally, parallel analyses of multiple functional effects are carried out on a single microfluidic device by employing different readout particles in at least two different chambers.
[0268] In one embodiment, the readout particle is an enzyme that is present as a soluble molecule, or that is tethered to the microfluidic chamber surface or to another physical support in the readout zone of the chamber. In this case, the binding of an antibody that inhibits the enzymatic activity of the readout particle, in one embodiment, is detected by reduced signal that reports on the enzymatic activity, including a fluorescent signal or colorometric signal or precipitation reaction.
[0269] In various embodiments, determining whether an effector cell or multiple effector cells within a cell population have an extracellular effect on a population of readout particles or subpopulation thereof involves light and/or fluorescence microscopy of the microfluidic chamber containing the cell population. Accordingly, one embodiment of the invention involves maintaining the readout particle population in a single plane so as to facilitate imaging of the particles by microscopy. In one embodiment, a readout particle population in a chamber is maintained in a single plane that is imaged through the device material, or portion thereof (e.g., glass or PDMS) to generate one, or many, high-resolution images of the chamber. In one embodiment, a high-resolution image is an image comparable to what is achieved using standard microscopy formats with a comparable optical instrument (lenses and objectives, lighting and contrast mechanisms, etc.).
[0270] According to one aspect of the invention, a method is provided for identifying a cell population comprising one or more effector cells that displays a variation in an extracellular effect. In one embodiment, the method comprises retaining a plurality of individual cell populations in separate microreactors (e.g., microfluidic chambers), wherein at least one of the individual cell populations comprises one or more effector cells and the contents of the separate microfluidic chambers further comprise a readout particle population comprising one or more readout particles. The cell populations and the readout particle populations are incubated within the microreactor, and the cell populations are assayed for the presence of the extracellular effect. The readout particle population or a subpopulation thereof provides a direct or indirect readout of the extracellular effect. Based on the results of the assay, it is determined whether a cell population from amongst the plurality comprising one or more effector cells that exhibit the extracellular effect.
[0271] In some embodiments, one or more of the individual cell populations and the readout particle populations are positioned in an effector zone and readout zone of a microreactor, respectively. However, the invention is not limited thereto. When effector zones and readout zones are employed, in one embodiment, each are essentially defined by the nature of the cells or particles positioned within it. That is, the one or more effector cells are segregated into the effector zone and the one or more readout particles are segregated into the readout zone. The effector zone is in fluid communication with the readout zone. Accordingly, in some embodiments, where a cell population and readout particles are provided to a chamber at low densities, e.g., less than two effector cells and readout particles per chamber, physical separation of the readout particles from an effector cell is accomplished. It will be recognized however, that the invention need not be practiced with discrete zones within a chamber. As should be evident by the present description, such a separation is not necessary to carry out the extracellular effect assays set forth herein.
[0272] The cell population and readout particle population can be loaded simultaneously into a microreactor (e.g., through different inlet ports or in one mixture through a single inlet port. Alternatively, the effector cells and readout particles are loaded serially into a microreactor (e.g., microfluidic chamber). A person skilled in the art will understand that the cell population can be provided to a microreactor prior to (or after) the loading of the readout particle(s) to the chamber. However, it is possible that the readout particle population and cell population be provided together as a mixture.
[0273] The devices and methods disclosed herein provide robust platforms for carrying out one or more extracellular effect assays on a plurality of cell populations, for example, to identify a cell population from the plurality displaying a variation in an extracellular effect. The variation is attributable to one or more effector cells present in the cell population. Each cell population is confined to a single microfluidic chamber, and the effector cell assay performed in each chamber of a device can be the same (e.g., all cell toxicity assays, all binding assays, etc.) or different (e.g., one binding assay, one apoptosis assay). The addressability of specific chambers on the device, for example with different readout particles and reagents for performing effector cell assays, makes diverse analyses methods possible.
[0274] The microfluidic devices described herein comprise a plurality of chambers, and each of the plurality has the capability for housing a cell population and a readout particle population, to determine whether any effector cell(s) in the cell population demonstrate an extracellular effect on a readout particle population or a subpopulation thereof. A readout particle population may consist of a single readout particle. As provided below, devices provided herein are designed and fabricated to assay a plurality of cell populations on one device, for example, where hundreds to thousands of cell populations are assayed on one device in order to identify one or more of the cell populations displaying a variation in the extracellular effect. At least a portion of the cell populations are heterogeneous with respect to one another. The variation, for example, is a variation compared to the extracellular effect displayed by other populations of the plurality. For example, in one embodiment, a method is provided for identifying a cell population(s) from among a plurality of cell populations, wherein the selected population(s) has a variation in an extracellular effect, as compared to the remaining cell populations. The variation in the extracellular effect is detectable for example, by a difference in fluorescence intensity of one of the chambers compared to the remaining plurality or a subplurality thereof.
[0275] According to one aspect of the invention, a method is provided for identifying a cell population from amongst a plurality of cell populations that displays a variation in an extracellular effect, wherein the extracellular effect is induced by the binding of one or more soluble factors secreted from an effector cell(s) to a readout particle population or subpopulation thereof. The readout particle population can be a homogeneous or a heterogeneous population. In one embodiment, a method provided herein involves retaining individual readout particle populations within different chambers of a microfluidic device. The number of readout particles analyzed can vary and will be determined according to considerations analogous to those for cell populations as outlined above.
[0276] An individual readout particle population and cell population are retained in a single chamber of one of the microfluidic devices provided herein. Optionally, the chamber is substantially isolated from other chambers of the microfluidic device that also comprise individual cell populations and a readout particle population, for example, to minimize contamination between chambers. However, isolation is not necessary to practice the methods provided herein. In one embodiment, where isolation is desired, isolation comprises fluidic isolation, and fluidic isolation of chambers is achieved by physically sealing them, e.g., by using valves surrounding the chambers. However, isolation in another embodiment is achieved without physically sealing the chamber, by limiting fluid communication between chambers so as to preclude contamination between one chamber and another chamber of the microfluidic device.
[0277] Once a chamber or plurality of chambers each comprising a cell population which optionally comprise one or more effector cells, and a readout particle population is isolated, the chamber or chambers, and specifically the cell population with the chamber (or chambers) is incubated. It will be appreciated that an initial incubation step can occur prior to the addition of readout particles, and/or after readout particles are added to a chamber comprising a cell population.
[0278] For example, an incubation step can include a medium exchange to keep the cell population healthy, or a cell wash step. Incubation can also comprise addition of accessory particles used to carry out an extracellular effect assay.
[0279] An incubating step, in one embodiment, includes controlling one or more of properties of the chamber, e.g., humidity, temperature and/or pH to maintain cell viability (effector cell, accessory cell or readout cell) and/or maintain one or more functional properties of the a cell in the chamber, such as secretion, surface marker expression, gene expression, signaling mechanisms, etc. In one embodiment, an incubation step includes flowing a perfusing fluid through the chamber. The perfusing fluid is selected depending on type of effector cell and/or readout cell is in the particular chamber. For example, a perfusing liquid in one embodiment, is selected to maintain cell viability, e.g., to replenish depleted oxygen or remove waste productions, or to maintain cellular state, e.g., to replenish essential cytokines, or to assist in assaying the desired effect, e.g., to add fluorescent detection reagents. Perfusion can also be used to exchange reagents, for example, to assay for multiple extracellular effects in a serial manner.
[0280] In another embodiment, incubating a cell population includes flowing a perfusing fluid through the chamber to induce a cellular response of a readout particle (e.g., readout cell). For example, the incubating step in one embodiment comprises adding a fluid comprising signaling cytokines to a chamber comprising the cell population. The incubating step can be periodic, continuous, or a combination thereof. For example, flowing a perfusing fluid to a microfluidic chamber or chambers is periodic or continuous, or a combination thereof. In one embodiment, the flow rate of an incubating fluid (e.g., perfusing fluid) is controlled by integrated microfluidic micro-valves and micro-pumps. In another embodiment, the flow of an incubating liquid is pressure driven, for example by using compressed air, syringe pumps or gravity to modulate the flow.
[0281] Once individual chambers within a device are provided with a cell population and a readout particle population, a method is carried out to determine whether a cell within the population exhibits an extracellular effect on the readout particle population or subpopulation thereof. The cell population and, readout particle population and/or subpopulation thereof, as appropriate, is then examined to determine whether or not a cell(s) within a population exhibits the extracellular effect, or if compared to other cell populations, a variation in the extracellular effect. It is not necessary that the specific cell or cells exhibiting the extracellular effect or variation thereof be identified within the chamber, so long as the presence and/or variation is detected within the chamber. In one embodiment, once a cell population is identified as exhibiting an extracellular effect or variation of the extracellular effect, the cell population is recovered for further characterization to identify the specific effector cell(s) responsible for the extracellular effect or variation thereof. In another embodiment, once the cell population is identified as exhibiting the extracellular effect or variation in extracellular effect, it is recovered and the nucleic acid from the cell population is amplified and sequenced.
[0282] The extracellular effect in one embodiment is a binding interaction between the protein produced by an effector cell(s) and a readout particle, e.g., a bead or a cell. In one embodiment, one or more of the effector cells in the population is an antibody producing cell, and the readout particle includes an antigen having a target epitope. The extracellular effect in one embodiment is the binding of an antibody to an antigen and the variation, for example, is greater binding as compared to a control chamber or other populations of the plurality. Alternatively, the variation in the extracellular effect is the presence of an effector cell that secretes an antibody with a modulated affinity for a particular antigen. That is, the binding interaction is a measure of one or more of antigen-antibody binding specificity, antigen-antibody binding affinity, and antigen-antibody binding kinetics. Alternatively or additionally, the extracellular effect is a modulation of apoptosis, modulation of cell proliferation, a change in a morphological appearance of a readout particle, a change in localization of a protein within a readout particle, expression of a protein by a readout particle, neutralization of the biological activity of an accessory particle, cell lysis of a readout cell induced by the effector cell, cell apoptosis of the readout cell induced by the effector cell, readout cell necrosis, internalization of an antibody, internalization of an accessory particle, enzyme neutralization by the effector cell, neutralization of a soluble signaling molecule or a combination thereof. In some embodiments, at least two different types of readout particles are provided to a chamber in which one of the types of readout particles does not include the target epitope.
[0283] Different types of readout particles may be distinguished by one or more characteristics such as by fluorescence labeling, varying levels of fluorescence intensity, morphology, size, surface staining and location in the chamber.
[0284] Once incubated with a cell population comprising an effector cell(s), the readout particle population or subpopulation thereof is examined to determine whether one or more cells within the cell population exhibits an extracellular effect on one or more readout particles, whether direct or indirect, or a variation in the extracellular effect. Cell populations are identified that have a variation in the extracellular effect assayed for, and then recovered for downstream analysis. Importantly, as provided throughout, it is not necessary that the specific effector cell(s), having the particular extracellular effect on the one or more readout particles be identified so long as the presence of the extracellular effect is detected within a particular microreactor (e.g., microfluidic chamber).
[0285] In some embodiments, the one or more effector cells within the cell population secretes defined biomolecules, e.g., antibodies, and the extracellular effect of these factors is evaluated on a readout particle or a plurality of readout particles (e.g., readout cells) in order to detect a cell population that demonstrates the extracellular effect. The extracellular effect, however, is not limited to an effect of a secreted biomolecule. For example, in one embodiment, the extracellular effect is an effect of a T-cell receptor, for example, binding to an antigen.
[0286] In one embodiment, a readout particle population is a heterogeneous population of readout cells and comprises readout cells engineered to express a cDNA library, whereby the cDNA library encodes for cell surface proteins. The binding of antibody to these cells is used to recover, and possibly to analyze, cells that secrete antibodies that bind to a target epitope.
[0287] In some embodiments, methods for measuring an extracellular effect on a readout particle population or subpopulation thereof includes the addition of one or more accessory particles to the chamber where the effect is being measured. For example, at least one factor required to activate complement on binding of an antibody to the readout cells may be provided as an accessory particle. As provided above, a natural killer cell or plurality thereof, in one embodiment, is added to a chamber as an accessory cell in cases where cell lysis is being measured. One of skill in the art will be able to determine what accessory particles are necessary, based on the assay being employed.
[0288] In some embodiments, where one or more readout particles include a readout cell displaying or expressing a target antigen, a natural killer cell, or a plurality thereof is provided to the chamber as an accessory cell(s) that facilitates the functional effect (lysis) being measured. The accessory cell can be provided to the chamber with the cell population, the readout particle(s), prior to the readout particle(s) being loaded, or after the readout particle(s) is loaded into the chamber. In embodiments where a natural killer cell is employed, the natural killer cell targets one or more readout cells to which an antibody produced by an effector cell has bound. The extracellular effect may thus include lysis of the one or more readout cells by the natural killer cell. Lysis can be measured by viability dyes, membrane integrity dyes, release of fluorescent dyes, enzymatic assays, etc.
[0289] In some embodiments, the extracellular effect is neutralization of an accessory particle (or accessory reagent) operable to affect the readout particle, e.g. a cytokine (accessory particle) operable to stimulate a response of the at least one readout cell. For example, cytokine-secreting cells operable to affect the readout particle cells may further be provided to the chamber. Neutralization of the secreted cytokines by an effector cell may be detected as the absence of the expected effect of the cytokine on the readout cell, e.g. proliferation. In another embodiment, the accessory particle is a virus operable to infect the readout cell(s), and neutralization of the virus is detected as the reduced infection of readout cells by the virus.
[0290] In some embodiments, the extracellular effect of one effector cell type may induce activation of a different type of effector cells (e.g., secretion of antibodies or cytokine) which can then elicit a response in the at least one readout cell.
[0291] As provided throughout, the methods and devices provided herein are used to identify an effector cell that exhibits a variation in an extracellular effect on a readout particle. The effector cell can be present as a single effector cell in a microfluidic chamber, or in a cell population within a single chamber. The extracellular effect, for example, can be an extracellular effect of a secretion product of the effector cell. In the case where the effector cell is present in a larger cell population, the extracellular effect is first attributed to the cell population, and the population is isolated and subpopulations of the isolated population are analyzed to determine the cellular basis for the extracellular effect. Subpopulation(s) displaying the extracellular effect can then be isolated and further analyzed at limiting dilution, for example as single cells, or subjected to nucleic acid analysis. In one embodiment, a subpopulation of an isolated cell population contains a single cell.
[0292] In one embodiment, the cell population comprises an ASC that secretes a monoclonal antibody. In one embodiment, a readout bead based assay is used in a method of detecting the presence of an effector cell secreting the antibody amid a background of one or more additional cells not secreting the antibody. For example, a bead based assay is employed in one embodiment, in a method of detecting an ASC within a cell population, whose antibody binds a target epitope of interest, in the presence of one or more additional ASCs that secrete antibodies that do not bind the target epitope of interest.
[0293] In another embodiment, the ability of an antibody to bind specifically to a target cell is assessed. Referring to
[0294] Such an assay may also be used to assess the location of antibody binding on or inside the readout cell(s) using high resolution microscopy. In this embodiment, the readout particles include different particle types (e.g., cell types) or particles/cells prepared in different ways (for example, by permeabilization and fixation) to assess binding specificity and/or localization. For instance, such an assay could be used to identify antibodies that bind the natural conformation of a target on live cells and the denatured form on fixed cells. Such an assay may alternatively be used to determine the location of an epitope on a target molecule by first blocking other parts of the molecule with antibodies against known epitopes, with different populations of readout particles having different blocked epitopes.
[0295] In another embodiment, individual heterogeneous readout particle populations, (e.g., a readout cell population comprising malignant and normal cells) and individual cell populations, wherein at least one of the individual cell populations comprises an effector cell, are provided to a plurality of microfluidic chambers (e.g., greater than 1000 chambers) of one of the devices provided herein. For example, referring to
[0296] If present within a chamber, the cell population containing the one or more ASCs that secretes an antibody that binds a malignant readout cell 425, but not the healthy readout cells 426, can then be recovered to retrieve the sequences of the antibodies within the chamber, or to perform other downstream assays on the individual cells within the population, for example, an assay to determine which effector cell in the population has the desired binding property. Accordingly, novel functional antibodies are provided that are discovered by one or more of the methods described herein. The epitope on the malignant readout cell 425 may be known or unknown. In the later case, the epitope for the antibody can be identified by the method described below.
[0297] In one embodiment, a single cell type can serve as both an effector cell and a readout cell. Referring to
[0298] In one embodiment, an extracellular effect assay is performed in parallel in a plurality of microfluidic chambers with a heterogeneous population of readout particles (e.g., a heterogeneous readout cell population) and a substantially homogeneous population of cells in each chamber, where the individual effector cells within the substantially homogeneous population each produces the same antibody. In a further embodiment, the readout particles are readout cells genetically engineered to express a library of proteins or protein fragments in order to determine the target epitope of the antibody secreted by the effector cells. Referring to
[0299] Cell populations that include antibodies 191 that bind readout cell 194 (or another epitope) can then be recovered from the device and subjected to a further assay.
[0300] In one embodiment, a functional assay is provided to determine whether an individual ASC within a cell population activates cell lysis of a target cell, i.e., activates antibody-dependent cell-mediated cytotoxicity (ADCC). ADCC is a mechanism of cell-mediated immune defense whereby an effector cell of the immune system lyses a target cell, whose membrane-surface antigens have been bound by specific antibodies, i.e., antibodies secreted by an ASC within a particular microfluidic chamber provided herein. Classical ADCC is mediated by natural killer (NK) cells. However, macrophages, neutrophils and eosinophils can also mediate ADCC, and can be provided herein as accessory cells to be used in an ADCC extracellular effect assay.
[0301] One embodiment of an ADCC assay provided herein includes a cell population comprising an effector cell or plurality thereof, a readout cell population (having an epitope of interest on their surfaces) and NK cells as accessory cells. The assay is run to determine if an ASC from the cell population induces the NK cells to attack the target cells and lyse them. Referring to
[0302] A person skilled in the art will understand that the NK cells may be added to the chamber during or after the incubation of the effector cells with the readout cells, provided that they are added to the chamber in a manner that facilitates access to the readout cells. The NK cells may be from a heterogeneous population of accessory cells, for instance peripheral blood mononuclear cells. The NK cells may be from an animal- or human-derived cell line, and engineered to increase ADCC activity. A person skilled in the art will further understand that this assay could be performed with other hematopoietic cell types capable of mediating ADCC such as macrophages, eosinophils or neutrophils. In this case, macrophages, eosinophils or neutrophils are the accessory cells in the assay. Cell types capable of mediating ADCC can also be animal- or human-derived cell lines engineered to increase ADCC activity or to report signal upon binding antibodies on target cells. In the latter, the target cells are accessory particles while the cells mediating ADCC are the readout particles.
[0303] An ADCC extracellular effect assay can be performed on a single effector cell, a homogeneous cell population, or a heterogeneous cell population as depicted in
[0304] Cell lysis, in one embodiment, is quantified by a clonogenic assay, by the addition of a membrane integrity dye, by the loss of intracellular fluorescent molecules or by the release of intracellular molecules in solution. The released biomolecules are measurable directly in solution or captured onto readout particles for measurement. In some cases, additional accessory molecules are added, such as a substrate for a redox assay or a substrate for an enzymatic assay. Referring to
[0305] ADCC assays are known in the art and components are commercially available. For example, the Guava Cell Toxicity Kit for Flow Cytometry (Millipore), the ADCC Reporter Bioassay Core Kit (Promega), the ADCC Assay (GenScript), the LIVE/DEAD Cell Mediated Cytotoxicity Kit (Life Technologies) and the DELFIA cell toxicity assays can be utilized in the devices provided herein.
[0306] In another embodiment, the extracellular effect assay is a complement-dependent cytotoxicity (CDC) assay. In one CDC embodiment, a method is provided for identifying the presence of an ASC (or secreted antibody of an ASC) within a cell population that binds to a readout cell in the presence of soluble factors necessary and/or sufficient to induce lysis of the readout cell via the classic complement pathway. Accordingly, the assay is to determine whether an antibody secreted by an ASC stimulates lysis of one or more target cells by the classic complement pathway.
[0307] A CDC assay includes at least one effector cell and at least one readout cell, and one CDC embodiment is depicted in
[0308] The soluble factors necessary to induce lysis of the readout cells (i.e., the accessory particles necessary for the assay) are added during or after the incubation of the effector cells with the readout cells, provided that they are added to the chamber in a manner that facilitates access to the readout cells. CDC assays provided herein can be performed on a single effector cell, a homogeneous effector cell population, or a heterogeneous cell population as depicted in
[0309] Cell lysis by the complement pathway is quantified according to methods known to those of skill in the art. For example, cell lysis is quantified by a clonogenic assay, by the addition of a membrane integrity dye, by the loss of intracellular fluorescent molecules or by the release of intracellular molecules in solution. The released biomolecules are measured directly in solution or captured onto readout particles. In some cases, additional accessory molecules may be added such as a substrate for a redox assay or a substrate for an enzymatic assay. Referring to
[0310] In another embodiment, an assay is provided to determine whether an effector cell, alone or within a cell population modulates cell growth. Specifically, the assay is used to determine whether the effector cell secretes a biomolecule, e.g., a cytokine or antibody that modulates the growth rate of readout cells. Referring to
[0311] A cell growth modulation assay can be performed using a cell population that optionally comprises one or more effector cells. As noted above, in some embodiments, not all cell populations will contain effector cells because of their rarity and/or difficulty to be enriched for in a starting population that is initially loaded onto one of the devices provided herein. The present invention allows for the identification of these rare cells by identifying cell populations that comprise one or more effector cells.
[0312] The cell growth modulation assay can also be performed with a single readout cell, or a heterogeneous readout cell population in a single chamber. However, in many instances, it is desirable to perform the cell growth modulation assay with a homogeneous readout cell population to permit a more accurate measurement of growth rate.
[0313] The cell growth modulation assay, in one embodiment, is adapted to screen for cells producing biomolecules that inhibit cell growth. In another embodiment, the method is adapted to screen for cells producing molecules that modulate, i.e., increase or decrease, proliferation rates of readout cells. Growth rate, in one embodiment, is measured by manual or automated cell count from light microscopy images, total fluorescence intensity of cell expressing a fluorescence, average fluorescence intensity of cells labeled with a dilutive dye (e.g. CFSE), nuclei staining or some other method known to those of skill in the art.
[0314] Commercially available assay to measure proliferation include the alamarBlue Cell Viability Assay, the CellTrace CFSE Cell Proliferation Kit and the CellTrace Violet Cell Proliferation Kit (all from Life Technologies), each of which can be used with the methods and devices described herein.
[0315] In another embodiment, an apoptosis functional assay is provided to select a cell population comprising one or more effector cells that induces apoptosis of another cell, i.e., a readout cell or an accessory cell. In one embodiment, the method is used to identify the presence of an effector cell that secretes a biomolecule, e.g., a cytokine or an antibody that induces apoptosis of a readout cell or accessory cell. Referring to
[0316] An apoptosis assay, in one embodiment, is performed on a cell population comprising a single effector cell, a cell population optionally comprising one or more effector cells or a cell population comprising one or more effector cells. In one embodiment, the apoptosis assay is performed with a single readout cell, or a heterogeneous readout cell population. However, in many instances, it is desirable to perform the apoptosis assay with a homogeneous readout cell population to permit a more accurate assessment of apoptosis.
[0317] In another embodiment, the microfluidic devices provided herein are used to select an effector cell that secretes a biomolecule, e.g., a cytokine or antibody that induces autophagy of a readout cell. One embodiment of this method is shown in
[0318] In one embodiment, an autophagy assay is performed on a cell population comprising a single effector cell, a cell population optionally comprising one or more effector cells or a cell population comprising one or more effector cells. In one embodiment, an autophagy assay is performed with a single readout cell, or a heterogeneous readout cell population, or a homogeneous readout cell population. The assay, in one embodiment, is performed with a homogeneous readout cell population.
[0319] In another embodiment, a method is provided for identifying the presence of an effector cell or to select an effector cell that secretes a biomolecule, e.g., an antibody, that interferes with the ability of a known biomolecule, e.g., a cytokine, to induce a readout cell to undergo a response. The response is not limited by type. For example, the response in one embodiment is selected from cell death, cell proliferation, expression of a reporter, change in morphology, or some other response selected by the user of the method. One embodiment of the method is provided in
[0320] In one embodiment, a cytokine neutralization assay is used to identify the presence of an effector cell that produces a biomolecule targeting a receptor for the cytokine, present on the readout cell. In this case, binding of an antibody, e.g., antibody 242 to receptors 246 for cytokine 245 on readout cells 244 blocks the interaction of the cytokine and the receptor, so that no response would be stimulated. The cytokine receptor, in another embodiment, is solublized or stabilized, for example, is a cytokine receptor that has been engineered via the Heptares StaR platform.
[0321] The response to the cytokine, in one embodiment, is ascertained by microscopic measurements of the associated signaling as known in the art including, but not limited to cell death, cell growth, the expression of a fluorescent reporter protein, the localization of a cellular component, a change in cellular morphology, motility, chemotaxis, cell aggregation, etc. In one embodiment, the response of chambers with effector cells are compared to chambers lacking effector cells to determine whether the response is inhibited. If a response is inhibited, the effector cells within the chamber are harvested for further analysis.
[0322] In one embodiment, a cytokine assay is performed within an individual microreactor on a cell population comprising a single effector cell, a cell population optionally comprising one or more effector cells or a cell population comprising one or more effector cells. Of course, the method can be carried out in parallel in a plurality of microchambers on a plurality of cell populations. In one embodiment, the cytokine assay is performed with a single readout cell, or a heterogeneous readout cell population. In one embodiment, the method is carried out with a homogeneous readout cell population to permit a more accurate assessment of stimulation, or rather lack thereof, of the readout cells.
[0323] Examples of commercially available cytokine-dependent or cytokine-sensitive cell lines for such assays include, but are not limited to TF-1, NR6R-3T3, CTLL-2, L929 cells, A549, HUVEC (Human Umbilical Vein Endothelial Cells), BaF3, BW5147.G.1.4.OUAR.1, (all available from ATCC), PathHunter CHO cells (DiscoveRx) and TANGO cells (Life Technologies). A person skilled in the art will understand that primary cells (e.g., lymphocytes, monocytes) may also be used as readout cells for a cytokine assay.
[0324] In one embodiment, a signaling assay is used to identify a cell population comprising one or more effector cells that secretes a molecule (e.g., an antibody or a cytokine) that has agonist activity on a receptor of a readout cell. Upon binding to the receptor, the effect on the readout cell population may include activation of a signaling pathway visualized by expression of a fluorescent reporter, translocation of a fluorescent reporter within a cell, a change in growth rate, cell death, a change in morphology, differentiation, a change in the proteins expressed on the surface of the readout cell, etc.
[0325] Several engineered reporter cell lines are commercially available and can be used to implement such an assay. Examples include PathHunter cells (DiscoverRx), TANGO cells (Life Technologies) and EGFP reporter cells (ThermoScientific).
[0326] In one embodiment, a virus neutralization assay is carried out to identify and/or select a cell population comprising one or more effector cells that secretes a biomolecule, e.g., an antibody that interferes with the ability of a virus to infect a target readout cell or target accessory cell. One embodiment of this method is shown in
[0327] A virus neutralization assay is also amenable for identifying the presence of an effector cell that produces a biomolecule which binds a receptor for the virus on the readout cell. In this case, binding of an antibody, e.g., antibody 252 to receptor 256 of virus 255 on readout cell 254 blocks the interaction of the virus and the receptor, so that no infection would be observed.
[0328] Assessment of viral infection may be done using methods known in the art. For example, the virus can be engineered to include fluorescent proteins that are expressed by the readout cell following infection, the expression of fluorescent proteins within the readout cell that are upregulated during viral infection, the secretion of proteins from a readout cell or accessory cell, which are captured and measured on readout particles that are increased during viral infection, the death of the of a readout cell or accessory cell, the change in morphology of a readout cell or accessory cell, and/or the agglutination of readout cells.
[0329] In one embodiment, within an individual microreactor, a virus neutralization assay is performed on a cell population comprising a single effector cell, a cell population optionally comprising one or more effector cells or a cell population comprising one or more effector cells. In one embodiment, the virus neutralization assay is performed with a single readout cell, or a heterogeneous readout cell population. In one embodiment, the method is carried out with a homogeneous readout cell population to permit a more accurate assessment of the stimulation, or rather lack thereof, of the readout cells to undergo the response. Of course, the method can be carried out in parallel in a plurality of microchambers on a plurality of cell populations.
[0330] For example, commercially available cell lines for virus neutralization assays are MDCK cells (ATCC) and CEM-NKR-CCR5 cells (NIH Aids Reagent Program) can be used with the methods and devices described herein.
[0331] In another embodiment, an enzyme neutralization assay is performed to determine whether an effector cell displays or secretes a biomolecule that inhibits a target enzyme. One embodiment of the method is provided in
[0332] In another embodiment, an enzyme neutralization assay is performed on a cell population comprising a single effector cell, a cell population optionally comprising one or more effector cells or a cell population comprising one or more effector cells, per individual chamber. In one embodiment, the enzyme neutralization assay is performed with a single readout particle in an individual chamber. In one embodiment, an enzyme neutralization assay is carried out on a plurality of cell populations to identify a cell population having a variation in a response of the assay.
[0333] In another embodiment, an assay method is provided for identifying the presence of an effector cell that displays or secretes a molecule that elicits the activation of a second type of effector particle, which in turn secretes a molecule that has an effect on a readout particle. Accordingly, in this embodiment, a cell population is provided to individual microfluidic chambers. One embodiment of this method is provided in
[0334] In another embodiment, the effector cell, upon activation by an accessory particle, may exhibit changes in phenotype such as proliferation, viability, morphology, motility or differentiation. In this case the effector cell is also a readout particle. This effect can be caused by the accessory particles and/or by autocrine secretion of proteins by the activated effector cells.
[0335] Referring to
[0336] As provided herein, monoclonal antibodies with low off-rates are detectable in the presence of a large background (in the same chamber) of monoclonal antibodies that are also specific to the same antigen but which have faster off-rates. However, affinity is also measurable with the devices and methods provided herein, and therefore, on-rate can also be measured. These measurements depend on the sensitivity of the optical system as well as the binding capacity of the capture reagents (e.g., beads). To assay for specificity, the capture reagents (readout particles) may be designed to present the epitope of interest so that it only binds antibodies with a desired specificity.
[0337] Referring to
[0338] Referring to
[0339] In the illustrated embodiment, beads 262 and 263 are optically distinguishable by shape in order to assess cross-reactivity. However, readout particles are also be distinguishable by other means, e.g., one or more characteristics such as fluorescence labeling (including different fluorescence wavelengths), varying levels of fluorescence intensity (e.g., using Starfire beads with different fluorescence intensities, morphology, size, surface staining and location in the microfluidic chamber).
[0340] In one embodiment, beads 262 and 263 are optically distinguishable when segregated into separate readout zones, e.g., by a cell fence. Alternatively, different color fluorophores can be used to optically distinguish readout beads.
[0341] Alternatively, specificity may be measured by inclusion of another antibody that competes with the secreted antibody to bind the target epitope. For instance, in one embodiment the presence a secreted antibody bound to a readout particle displaying the antigen is identified with a fluorescently labeled secondary antibody. The subsequent addition of a non-labeled competing antibody generated from a different host and known to bind a known target epitope on the antigen results in decreased fluorescence due to displacement of the secreted antibody only if the secreted antibody is bound to the same target epitope as the competing antibody. Alternatively, specificity is measured by adding a mixture of various antigens that compete with binding of the secreted antibody to the target epitope if the secreted antibody has low specificity. Alternatively, specificity is measured by capturing secreted antibody on a bead and then using differentially labeled antigens to assess the binding properties of the secreted antibody.
[0342] The specificity measurements described herein, when conducted on a cell population that includes two or more effector cells that secrete antibody that bind one of the targets, are inherently polyclonal measurements.
[0343] In various embodiments of the invention, a method for identifying the presence of an effector cell secreting a biomolecule is coupled with the analysis of the presence or absence of one or more intracellular compounds of the effector cell. Referring to
[0344] In one embodiment, methods are provided for identifying polyclonal mixtures of secreted biomolecules with desirable binding properties. Assays may be performed as with heterogeneous mixtures of effector cells producing antibodies with known affinities for a target epitope, target molecule, or target cell type. Binding of the target in the context of the mixture can then be compared to binding of the target in the context of the individual effector cells alone to determine, for example, if mixtures provide enhanced effects.
[0345] Multifunctional analysis that combines the binding and/or functional assays described herein may be performed by having multiple readout regions, multiple effector regions, multiple readout particle types, or some combination thereof. For example, perfusion steps can be carried out between extracellular effect assays to exchange reagents for different functional experiments.
[0346] One embodiment of a multifunctional assay is provided in
[0347] In the embodiment depicted in
[0348] Alternatively, readout particles 412, 413, and 414 are identical and allow for multiple independent measurements of an extracellular effect conferred by a single set of effector cells in a single chamber. Alternatively, particles 412 and 414 are distinguishable and the assay is performed serially.
[0349] In one embodiment, the presence of one or more extracellular effects is analyzed. Depending on the effect, one of skill in the art will recognize that the presence or the absence of the combined extracellular effects may be desired. Similarly, it is also possible that the desired properties include the presence of one or more types of extracellular effect and the absence of a different type of extracellular effect. For instance, in one embodiment, a multifunctional assay is used to identify an effector cell secreting an antibody that binds to a receptor epitope on a readout cell but that does not induce the activation of the corresponding signaling pathway.
[0350] In one embodiment, a multifunctional assay is carried out in a chamber comprising multiple effector zones, for example, by introducing different effector cells, or combinations of effector cells, into the different regions. For example, in one embodiment, different cell populations producing antibodies of known affinity for a target antigen are introduced into different effector zones of a chamber. Binding of the target in the context of the mixtures can then be compared to binding of the target in the context of the individual effector cells alone. Accordingly, such use of multiple effector zones allows for the screening of multiple combinations in a single chamber.
[0351] In one embodiment of the assays provided herein, after readout particles are incubated with a cell population in a microfluidic chamber, a fluorescent measurement is taken to determine if a cell within the population demonstrates an extracellular effect. In this embodiment, the readout particle population is fluorescently labeled and a change in fluorescence is correlated with the presence and/or size of the extracellular effect. The readout particle population can be fluorescently labeled directly or indirectly. In some embodiments, as provided throughout, accessory particles (e.g., accessory cells) are provided to a chamber to aid in facilitating the fluorescent readout. As will be appreciated by one of skill in the art, care is taken to design assays that provide readout particles and effector cells in one focal plane, to allow for accurate imaging and fluorescent measurement.
[0352] In one embodiment, readout particle responses are monitored using automated high resolution microscopy. For example, imaging can be monitored by using a 20 (0.4 N.A.) objective on an Axiovert 200 (Zeiss) or DMIRE2 (Leica) motorized inverted microscope. Using the automated microscopy system provided herein allows for complete imaging of a 4000 chamber array, including 1 bright-field and 3 fluorescent channels, in approximately 30 minutes. This platform can be adapted to various chip designs, as described in Lecault et al. (2011). Nature Methods 8, pp. 581-586, incorporated by reference herein in its entirety for all purposes. Importantly, the imaging methods used herein achieve a sufficient signal in effect positive chambers while minimizing photodamage to cells.
[0353] In one embodiment, the effector cell assays provided herein benefit from long-term cell culture, and therefore require that the effector cells maintained in the device are viable and healthy cells. It will be appreciated that in embodiments where readout cells or accessory cells are used in an effector cell assay, that they too be maintained in a healthy state and are viable and healthy. The fluidic architectures provided herein enable careful and precise control of medium conditions to maintain effector and readout cell viability so that functional assays can be carried out. For example, some cell types require autocrine or paracrine factors that depend on the accumulation of secreted products. For instance, CHO cell growth rates are highly dependent on seeding density. Confining a single CHO cell in 4-nL chamber corresponds to a seeding density of 250,000 cells/ml, which is comparable to conventional macroscale cultures. As shown in
[0354] In one aspect, the present invention provides a method for determining whether a cell population optionally comprising one or more effector cells exerts an extracellular effect a readout particle (e.g., a cell comprising a cell surface receptor). The effector cell can be present in a heterogeneous cell population, a homogeneous population, or as a single cell. In one embodiment, the effector cell is an antibody secreting cell. The one or more extracellular properties, in one embodiment, comprise an extracellular effect on a readout particle, for example, the inhibition (antagonism) or activation (agonism) of a cell surface receptor (e.g., the agonist and/or antagonist properties of an antibody secreted by an antibody secreting cell) on a readout cell. In a further embodiment, the extracellular effect is an agonist or antagonist effect on a transmembrane protein, which in a further embodiment is a G protein coupled receptor (GPCR), a receptor tyrosine kinase (RTK), an ion channel or an ABC transporter. In a further embodiment, the receptor is a cytokine receptor. An extracellular effect on other metabotropic receptors besides GPCRs and RTKs can be assessed, for example, an extracellular effect on a guanylyl cyclase receptor can be assessed incubating a cell population with a readout cell population expressing the guanylyl cyclase receptor.
[0355] In embodiments where a readout cell is used, the readout cell can be alive or fixed. With respect to a fixed readout cell, the extracellular effect in one embodiment, is an effect on an intracellular protein of the fixed readout cell. Extracellular effects can also be measured on extracellular proteins of an alive or fixed readout cell, or a secreted protein of an alive readout cell.
[0356] In another embodiment, a readout cell expresses one of the following types of cell receptors, and the extracellular effect assay measures binding, agonism or antagonism of the cell receptor: receptor serine/threonine kinase, histidine-kinase associated receptor.
[0357] In embodiments where a particular receptor (e.g., receptor serine/threonine kinase, histidine-kinase associated receptor or GPCR) is an orphan receptor, that is, the ligand for activating the particular receptor is unknown, the methods provided herein allow for the discovery of a ligand for the particular orphan receptor by performing an extracellular assay on readout cells expressing the orphan receptor, and identifying a cell population or subpopulations comprising an effector cell having a variation of an extracellular effect on the readout cell expressing the orphan receptor.
[0358] In one embodiment, the cell surface protein is a transmembrane ion channel. In a further embodiment, the ion channel is a ligand gated ion channel and the extracellular effect measured in the microfluidic assay is modulation of the ion channel gating, for example, opening of the ion channel by agonist binding or closing/blocking of the ion channel by antagonist binding. The antagonist or agonist can be for example, a biomolecule (e.g., antibody) secreted by one or more effector cells in the heterogeneous population of cells comprising one or more effector cells. Extracellular assays described herein can be used to measure the extracellular effect of an effector cell on a cell expressing a ligand gated ion channel in the Cys-loop superfamily, an ionotropic glutamate receptor and/or an ATP gated ion channel. Specific examples of anionic cys-loop ion gated channels include the GABAA receptor and the glycine receptor (GlyR). Specific examples of cationic cys-loop ion gated channels include the serotonin (5-HT) receptor, nicotinic acetylcholine (nAChR) and the zinc-activated ion channel. One or more of the aforementioned channels can be expressed by a readout cell to determine whether an effector cell has an extracellular effect on the respective cell by agonizing or antagonizing the ion channel. Ion flux measurements typically occur in short periods of time (i.e., seconds) and require precise fluidic control for their implementation. Examples of commercially available ion channel assays include Fluo-4-Direct Calcium Assay Kit (Life Technologies), FLIPR Membrane Potential Assay Kit (Molecular Devices). Ion-channel expressing cell lines are also commercially available (e.g. PrecisION cell lines, EMD Millipore).
[0359] In one embodiment, the cell surface protein is an ATP-binding cassette (ABC) transporter, and the extracellular effect measured is the transport of a substrate across a membrane. The readout particles can be membrane vesicles derived from cells expressing the protein (e.g., GenoMembrane ABC Transporter Vesicles (Life Technologies)), which can be immobilized on beads. For instance, the ABC transporter could be a permeability glycoprotein (multidrug resistant protein) and the effect can be measured by the fluorescence intensity of calcein in readout cells. The Vybrant Multidrug Resistance Assay Kit (Molecular Probes) is commercially available to implement such an assay.
[0360] An extracellular effect can also be assessed on a readout cell expressing an ionotropic glutamate receptor such as the AMPA receptor (class GluA), kainite receptor (class GluK) or NMDA receptor (class GluN). Similarly, an extracellular effect can also be assessed on a readout cell expressing an ATP gated channel or a phosphatidylinositol 4-5-bisphosphate (PIP2)-gated channel.
[0361] As provided throughout, the present invention provides a method of identifying a cell population displaying a variation in an extracellular effect. In one embodiment, the method comprises, retaining a plurality of individual cell populations in separate microfluidic chambers, wherein at least one of the individual cell populations comprises one or more effector cells and the contents of the separate microfluidic chambers further comprise a readout particle population comprising one or more readout particles, incubating the individual cell populations and the readout particle population within the microfluidic chambers, assaying the individual cell populations for the presence of the extracellular effect, wherein the readout particle population or subpopulation thereof provides a readout of the extracellular effect. In one embodiment, the extracellular effect is an effect on a receptor tyrosine kinase (RTK), for example, binding to the RTK, antagonism of the RTK, or agonism of the RTK. RTKs are high affinity cell surface receptors for many polypeptide growth factors, cytokines and hormones. To date, there have been approximately sixty receptor kinase proteins identified in the human genome (Robinson et al. (2000). Oncogene 19, pp. 5548-5557, incorporated by reference in its entirety for all purposes). RTKs have been shown to regulate cellular processes and to have a role in development and progression of many types of cancer (Zwick et al. (2001). Endocr. Relat. Cancer 8, pp. 161-173, incorporated by reference in its entirety for all purposes).
[0362] Where the extracellular effect is an effect on an RTK, the present invention is not limited to a specific RTK class or member. Approximately twenty different RTK classes have been identified, and extracellular effects on members of any one of these classes can be screened for with the methods and devices provided herein. Table 2 provides different RTK classes and representative members of each class, each amenable for use herein when expressed on a readout particle, e.g., readout cell or vesicle. In one embodiment, a method is provided herein for screening a plurality of cell populations in a parallel manner in order to identify one or more populations comprising an effector cell having an extracellular effect on an RTK of one of the subclasses provided in Table 2. In one embodiment, the method further comprises isolating the one or more cell populations comprising the ASC having the extracellular effect to provide an isolated cell population and further subjecting the isolated subpopulation to one or more additional extracellular effect assay, at limiting dilution, to identify the ASC having the extracellular effect. The additional extracellular effect assay can be carried out via a microfluidic method provided herein, or a benchtop assay. Alternatively, once a cell population is identified that has a cell exhibiting an extracellular effect on the RTK, the cell population is recovered, lysed and the nucleic acid amplified. In a further embodiment, the nucleic acid is one or more antibody genes.
[0363] In one embodiment, the present invention relates to the identification of a cell population comprising an effector cell that antagonizes or agonizes an RTK (i.e., the extracellular effect), for example, via a secretion product, e.g., a monoclonal antibody. The effector cell is present a lone effector cell, or is present in a cell population comprising one or more effector cells.
TABLE-US-00002 TABLE 2 RTK classes and representative members of each class. Representative Representative Cellular RTK class members Ligands Process(es) RTK class I ErbB-1 (epidermal epidermal growth overexpression (epidermal growth factor factor (EGF) implicated in growth factor receptor) transforming growth turmorigenesis receptor factor (TGF-) (EGFR) heparin-binding family, also EGF-like growth known as the factor (HB-EGF) ErbB family) amphiregulin (AREG) betacellulin epigen epiregulin ErbB-2 (human Monoclonal turmorigenesis epidermal growth antibody (e.g., breast, factor receptor 2 trastuzumab ovarian, stomach, (HER2)/ cluster of (Herceptin) uterine) differentiation 340 (CD340) / proto- oncogene Neu) Neuregulin 1 Proliferation and ErbB-3 (human Proliferation differentiation epidermal growth associated Oncogenesis factor receptor protein 2G4 (overexpression) 2 (HER3)) (PA2G4) (EBP1 or ErbB3 binding protein 1) Phosphatidylinositol 3 kinase regulatory subunit alpha (PIK3R1) Regulator of G protein signaling 4 (RGP4) ErbB-4 (human heparin-binding Mutations in epidermal EGF-like growth the RTK have been growth factor factor (HB- associated with receptor 2 (HER4)) EGF) betacellulin cancer epiregulin Neuregulin 1 Neuregulin 2 Neuregulin 3 Neuregulin 4 RTK class II Insulin receptor Insulin inducing glucose (Insulin insulin-like growth uptake receptor factor 1 (IGF-1) / family) somatomedin C insulin-like growth factor 2 (IGF-2) RTK class III PDGFR PDGF A/B/C and D Fibrosis (Platelet PDGFR PDGF A/B/C and D cancer derived Mast/stem cell Stem cell factor Oncogenesis growth growth factor (SCF) / c-kit Cell survival, factor receptor (SCFR) / ligand / steel factor proliferation, (PDGF) c-Kit / CD117 differentiation receptor Colony stimulating Colony stimulating Production, family) factor 1 factor 1 differentiation and receptor / (CD 115) / function of macrophage colony- macrophages stimulating factor receptor (M-CSFR) Expressed on Cluster of Flt3 ligand (FLT3L) surface of many differentiation hematopoietic antigen progenitor cells 135 (CD 135) / Mutated in acute Fms-like tyrosine myeloid leukemia kinase 3 (FLT-3) Cell survival Proliferation differentiation RTK class IV Fibroblast growth Fibroblast growth Wound healing (FGF receptor factor receptor-1 factor 1-10 Embryonic family) (CD331) development Fibroblast angiogenesis growth factor receptor-2 (CD332) Fibroblast growth factor receptor-3 (CD333) Fibroblast growth factor receptor-4 (CD334) Fibroblast growth factor receptor-6 RTK class V VEGFR1 VEGF-A Mitogenesis (VEGF receptor VEGF-B Cell migration family) VEGFR2 VEGF-A Vasculogenesis (membrane VEGF-C angiogenesis bound VEGF-D or soluble VEGF-E depending on VEGFR3 VEGF-C alternative VEGF-D splicing) RTK class VI Hepatocyte growth Hepatocyte growth Deregulated in certain (Hepatocyte factor receptor factor malignancies, leads to growth (GHFR) (encoded by angiogenesis factor MET or MNNG HOS Stem cells and receptor transforming gene). progenitor cells express family) Mitogenesis, morphogenesis RTK class VII Tropomyosin- Neurotrophins Regulate synaptic (Trk receptor receptor kinases Nerve growth factor strength and family) (Trk) (TrkA) plasticity in TrkA Brain-derived the mammalian TrkB neurotrophic factor nervous system TrkC (BDNF) (TrkB) Neurotrophin-3 (NT3) (TrkC) RTK class VIII EphA Ephrin-A Embryonic development (Ephrin (Eph) (1, 2, 3, 4, 5, 6, (Ephrin-A1-5) Axon guidance receptor 7, 8, 9, 10) Ephrin-B (1-4 Formation of tissue family) EphB (1, 2, 3, and ephrin-B6) boundaries 4, 5, 6) Retinopic mapping Cell migration Cell segmentation Angiogenesis Cancer RTK class IX Tyrosine-protein Tensin-like C1 epithelial-to- (AXL receptor kinase receptor domain containing mesenchymal family) UFO (AXL) phosphatase transition-induced (TENC1) regulator of breast cancer metastasis Regulation of cell migration RTK class X Leukocyte receptor Insulin receptor Apoptosis (Leukocyte tyrosine kinase substrate 1 (IRS-1) Cell growth and receptor (LTK) Src homology 2 differentiation tyrosine kinase domain containing (LTK) family) protein (Shc) Phosphatidylinositol 3-kinase regulatory subunit alpha (PIK3R1) RTK class XI Tyrosine kinase with Angiopoietin 1 Promotion of (TIE receptor immunoglobulin-like (Tie2 agonist) angiogenesis TIE1 has family) and EGF-like Angiopoietin 2 a proinflammatory domains (TIE) 1 (Tie2 antagonist) effect and may play a TIE 2 Angiopoietin 3 role in atherosclerosis (Tie2 antagonist) (Chan et al. (2008). Angiopoietin 4 Biochem. Biophys. (Tie2 agonist) Res. Commun. 371, pp. 475-479. RTK class XII ROR-1 (neurotrophic Wnt ligands ROR-1 modulates (Receptor tyrosine kinase, (ROR-2) neurite growth typrosine kinase- receptor-related 1 in the central like orphan (NTRKR1) nervous system. receptors ROR-2 (ROR) family) RTK class XIII DDR-1 (CD167a) Various types of DDR-1 is (discoidin DDR-2 collagen overexpressed in breast, domain ovarian, esophageal receptor and pediatric (DDR) family) brain tumors RTK class XIV Rearranged during Glial cell line- Loss of function (RET receptor transfection derived associated with family) (RET) proto- nuerotrophic Hirschsprung's disease oncogene 3 different factor (GDNF) Gain of function isoforms (51, 43, 9) family ligands mutations associated with various types of cancer (e.g., medullary thyroid carcinoma, multiple endocrine neoplasias type 2A and 2D) RTK class XV Tyrosine-protein No ligand has Development (KLG receptor kinase-like 7 been identified Oncogenesis (colon family) (PTK7) / CCK-4 cancer, melanoma, breast cancer, acute myeloid leukemia) Wnt pathway regulation Angiogenesis RTK class XVI RYK receptor Wnt ligands Stimulating (Related to (different Wnt signaling receptor tyrosine isoforms due to pathways such kinase(RYK) alternative splicing) as regulation of receptor family) axon pathfinding RTK class XVII Muscle-Specific Agrin (nerve- Formation of the (Muscle-Specific kinase (MuSK) derived neuromuscular kinase (MuSK) receptor proteoglycan) junction receptor family)
[0364] In one embodiment, the RTK is a platelet derived growth factor receptor (PDGFR), e.g., PDGFR. PDGFs are a family of soluble growth factors (A, B, C, and D) that combine to form a variety of homo- and hetero-dimers. These dimers are recognized by two closely related receptors, PDGFR and PDGFR, with different specificities. In particular, PDGF- binds selectively to PDGFR and has been shown to drive pathological mesenchymal responses in fibrotic diseases, including pulmonary fibrosis, liver cirrhosis, scleroderma, glomerulosclerosis, and cardiac fibrosis (see Andrae et al. (2008). Genes Dev. 22, pp. 1276-1312, incorporated by reference herein in its entirety). It has also been demonstrated that constitutive activation of PDGFR in mice leads to progressive fibrosis in multiple organs (Olson et al. (2009). Dev. Cell 16, pp. 303-313, incorporated by reference herein in its entirety). Thus therapies that inhibit PDGFR have high potential for the treatment of fibrosis, a condition that complicates up to 40% of diseases, and represents a huge unmet medical problem in the aging population. Although antibodies (Imatinib and Nilotinib) have been explored as inhibitors of PDGFR, each has significant off-target effects on other central RTKs, including c-kit and Flt-3, resulting in numerous side effects. Thus, while Imatinib and Nilotinib can effectively inhibit PDGFR and PDGFR, their side effects make them unacceptable in the treatment of fibrotic diseases, highlighting the potential for highly specific antibody inhibitors. The present invention overcomes this problem by providing in one embodiment, antibodies with greater PDGFR specificity, as compared to Imatinib and Nilotinib.
[0365] PDGFR has been previously established as a target for the treatment of fibrosis. Two anti-human PDGFR mAb antagonists entering early clinical trials for the treatment of cancer are in development (see, e.g., Shah et al (2010). Cancer 116, pp. 1018-1026, incorporated by reference herein in its entirety). The methods provided herein facilitate the identification of an effector cell secretion product that binds to the PDGFR. In a further embodiment, the secretion product blocks the activity of both human and murine PDGFR in both cancer and fibrosis models.
[0366] One embodiment of the effector cell assay to determine whether an effector cell secretion product binds to PDGFR is based on the use of suspension cell lines (e.g., 32D and Ba/F3) that are strictly dependent on the cytokine IL-3 for survival and growth, but can be cured of this IL-3 addiction through the expression and activation of nearly any tyrosine kinase. This approach was first used by Dailey and Baltimore to evaluate the BCR-ABL fusion oncogene and has been used extensively for high-throughput screening of small molecule tyrosine kinase inhibitors (see, e.g., Warmuth et al. (2007). Curr. Opin. Oncology 19, pp. 55-60; Daley and Baltimore (1988). Proc. Natl. Acad. Sci. U.S.A. 85, pp. 9312-9316, each incorporated by reference in their entireties for all purposes). To monitor signaling, PDGFR and PDGFR (both human and mouse forms) are expressed in 32D cells (readout cells), a murine hematopoietic cell line that does not naturally express either receptor. This allows for separation of each pathway, something that is otherwise difficult since both receptors are often co-expressed. Expression of human PDGFR/ in 32D cells has been previously confirmed to give a functional PDGF-induced mitogenic response (Matsui et al. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, pp. 8314-8318, incorporated by reference in its entirety). In the absence of IL-3, 32D cells do not divide at all, but PDGF stimulation of the cells expressing the RTK relieves the requirement for IL-3 and gives a rapid mitogenic response that is detectable by microscopy. The detectable response, in one embodiment, is cell proliferation, a morphological change, increased motility/chemotaxis, or cell death/apoptosis in the presence of an antagonist. An optical multiplexing method, in one embodiment, is used to simultaneously measure the inhibition/activation of both PDGFR and PDGFR responses in one of the devices provided herein. In another embodiment, inhibition/activation of both PDGFR and PDGFR responses in one of the devices provided herein is measured by two extracellular assays, carried out serially in the same microfluidic chamber.
[0367] Full length cDNA for human/mouse PDGFR and PDGFR (Sino Biological), in one embodiment, is expressed in 32D cells (ATCC; CRL-11346) using modified pCMV expression vectors that also include an IRES sequence with either GFP or RFP, thereby making two types of readout cells, each distinguishable by fluorescent imaging. The readout cells are characterized to optimize medium and feeding conditions, determine the dose response to PDGF ligand, and to characterize the morphology and kinetics of response. The use of suspension cells (such as 32D or Ba/F3) provides the advantage that single cells are easily identified by image analysis, and are also physically smaller (in projected area) than adherent cells so that a single chamber can accommodate 100 readout cells before reaching confluence. In another embodiment, instead of 32D cells, Ba/F3 cells, another IL-3 dependent mouse cell line with similar properties to 32D are used as readout cells. Both 32D and Ba/F3 cells are derived from bone marrow, grow well in medium optimized for ASCs, and also secrete IL-6 which is a critical growth factor for the maintenance of ASCs (see, e.g., Cassese et al. (2003). J. Immunol. 171, pp. 1684-1690, incorporated by reference in its entirety herein).
[0368] Preclinical models for evaluating the role of PDGFR in fibrosis have been developed. Specifically, two models of cardiac fibrosis are provided herein. The first is based on ischemic damage (isoproterenol-induced cardiac damage; ICD) and the second is based on coronary artery ligation-induced myocardial infarction (MI). Upon damage, the fibrotic response is initiated by the rapid expansion of PDGFR+/Sca1+ positive progenitors, accounting for over 50% of the cells proliferating in response to damage followed by differentiation of these progeny into matrix producing PDGFR low/Sca1 low myofibroblasts. Gene expression by RT-qPCR demonstrates expression of multiple markers related to fibrotic matrix deposition, including -smooth muscle actin (aSMA) and collagen type I (Coll), which are detectable in (Sca1+) progenitors, but are substantially up-regulated in the differentiated population. In one embodiment, a cell population is identified that comprises an effector cell that secretes a monoclonal antibody that attenuates progenitor expansion leading to reduced fibrosis. This extracellular effect assay is carried out by monitoring two independent markers: early proliferation of Sca1+/PDGFR+ progenitors cells and Coll-driven GFP. Specifically, following MI, fibrotic responses are characterized by GFP expression first in PDGFR+/Sca1+ progenitors, and later, with increased intensity, in the emerging myofibroblast population.
[0369] The present invention provides methods and devices for screening a plurality of cell populations in a parallel manner to identify one or more of the cell populations having an extracellular effect, or a variation in an extracellular effect as compared to another population in the plurality. The identified cell population comprises one or more effector cells that are responsible for the extracellular effect. The extracellular effect, for example, is an extracellular effect on a GPCR, e.g., GPCR binding, agonism or antagonism. As described herein, the extracellular effect need not be attributable to every cell in the population, or even multiple cells. Rather, the methods provided herein allow for the detection of an extracellular effect of a single effector cell, when the effector cell is present in a heterogeneous population comprising tens to hundreds of cells (e.g., from about 10 to about 500 cells, or from about 10 to about 100 cells), or comprising from about 2 to about 100 cells, e.g., from about 2 to about 10 cells.
[0370] GPCRs are a superfamily of seven transmembrane receptors that includes over 800 members in the human genome. Each GPCR has its amino terminus located on the extracellular face of the cell and the C-terminal tail facing the cytosol. On the inside of the cell GPCRs bind to heterotrimeric G-proteins. Upon agonist binding, the GPCR undergoes a conformational change that leads to activation of the associated G-protein. Approximately half of these are olfactory receptors with the rest responding to a gamut of different ligands that range from calcium and metabolites to cytokines and neurotransmitters. The present invention, in one embodiment, provides a method for selecting one or more ASCs that have an extracellular effect on a GPCR. The GPCR is not limited herein. Rather, screening methods for any GPCR are amenable for use with the present invention.
[0371] The type of G-protein that naturally associates with the specific GPCR dictates the cell signaling cascade that is transduced. For Gq coupled receptors the signal that results from receptor activation is an increase in intracellular calcium levels. For Gs coupled receptors, an increase in intracellular cAMP is observed. For Gi coupled receptors, which make up 50% of all GPCRs, activation results in an inhibition of cAMP production. For embodiments where the effector cell property is activation of a Gi coupled GPCR, it is sometimes necessary to stimulate the readout cell(s) with a nonspecific activator of adenylyl cyclase. In one embodiment, the adenyl cyclase activator is forskolin. Thus, activation of the Gi coupled receptor by one or more effector cells will prevent forskolin induced increase in cAMP. Forskolin, accordingly, can be used as an accessory particle in one or more GPCR extracellular effect assays provided herein.
[0372] The present invention, in one embodiment, provides means for determining whether an effector cell (e.g., an ASC) within a cell population has an extracellular effect on a GPCR. The GPCR is present on one or more readout particles in a microfluidic chamber and the extracellular effect in one embodiment, is binding to the GPCR, a demonstrated affinity or specificity, inhibition or activation. The GPCR may be a stabilized GPCR, such as one of the GPCRs made by the methods of Heptares Therapeutics (stabilized receptor, StaR technology). The effector cell (e.g., ASC), in one embodiment, is present as a single cell, or in a homogeneous or heterogeneous cell population within a microfluidic chamber. In one embodiment, the methods and devices provided herein are used to identify one or more cell populations each comprising one or more ASCs that secrete one or more antibodies that demonstrate an extracellular effect on one of the GPCRs set forth in Table 3A and/or Table 3B, or one of the GPCRs disclosed in International PCT Publication WO 2004/040000, incorporated by reference in its entirety. For example, in one embodiment, the GPCR belongs to one of the following classes: class A, class B, class C, adhesion, frizzled.
[0373] In another embodiment, the extracellular effect is an effect on an endothelial differentiation, G-protein-coupled (EDG) receptor. The EDG receptor family includes II GPCRs (S1P1-5 and LPA1-6) that are responsible for lipid signalling and bind lysophosphandic acid (LPA) and sphingosine I-phosphate (SIP). Signalling through LPA and SIP regulates numerous functions in health and disease, including cell proliferation, immune cell activation, migration, invasion, inflammation, and angiogenesis. There has been little success in generating potent and specific small molecule inhibitors to this family, making mAbs a very attractive, alternative. In one embodiment, the EDG receptor is S1P3 (EDG3), S1PR1 (EDG1), the latter of which has been shown to activate NF-B and STAT3 in several types of cancers including breast, lymphoma, ovarian, and melanoma, and plays a key role in immune cell trafficking and cancer metastasis (Milstien and Spiegel (2006). Cancer Cell 9, pp. 148-15, incorporated by reference in its entirety herein). A monoclonal antibody that neutralizes the SIP ligand (Sonepcizumab) has recently entered phase II trials for treatment of advanced solid tumours (NCT00661414). In one embodiment, the methods and devices provided herein are used to identify and isolate an ASC that secretes an antibody with greater affinity than Sonepcizumab, or an antibody that inhibits SIP to a greater extent than Sonepcizumab. In another embodiment, the extracellular effect is an effect on the LPA2 (EDG4) receptor. LPA2 is overexpressed in thyroid, colon, stomach and breast carcinomas, as well as many ovarian tumours, for which LPA2 is the primary contributor to the sensitivity and deleterious effects of LPA.
[0374] In one embodiment, cell populations are assayed for whether they exhibit an extracellular effect on a chemokine receptor, present on a readout particle. In a further embodiment, the chemokine receptor is C-X-C chemokine receptor type 4 (CXCR-4), also known as fusin or CD184. CXCR4 binds SDF1 (CXCL12), a strong chemotactic for immune cell recruitment also known as C-X-C motif chemokine 12 (CXCL12). DNA immunizations were used to generate 92 hybridomas against this target, 75 of which exhibited different chain usage and epitope recognition (Genetic Eng and Biotech news, August 2013), indicating that hybridoma selections capture only a small portion of available antibody diversity. Signalling through the CXCR4/CXCL12 axis has been shown to play a central role in tumour cell growth, angiogenesis, cell survival and to be implicated in mediating the growth of secondary metastases in CXCL12-producing organs like liver and bone marrow (Teicher and Fricker (2010). Clin. Cancer Res. 16, pp. 2927-2931, incorporated by reference herein in its entirety).
[0375] In another embodiment, cell populations are screened for their ability to exert an effect on the chemokine receptor CXCR7, which was recently found to bind SDF1. Unlike CXCR4 which signals through canonical G protein coupling, CXCR7 signals uniquely through the 3-arrestin pathway.
[0376] In another embodiment, the GPCR is protease activated receptors (PAR1, PAR3, and PAR4), which is a class of GPCRs activated by thrombin-mediated cleavage of the exposed N-terminus and are involved in fibrosis. In yet another embodiment, the GPCR is one of the GPCRs in Table 3A or Table 3B, below.
[0377] In embodiments where an extracellular effect is an effect on a GPCR, the invention is not limited to the particular GPCR. For example, cell lines that express particular GPCRs, engineered to provide a readout of binding, activation or inhibition, are commercially available for example, from Life Technologies (GeneBLAzer and Tango cell lines), DiscoveRx, Cisbio, Perkin Elmer, etc., and are amenable for use as readout cells herein.
[0378] In one embodiment, a GPCR from one of the following receptor families is expressed on one or more readout cells herein, and an extracellular effect is measured with respect to one or more of the following GPCRs: acetylcholine receptor, adenosine receptor, adreno receptor, angiotensin receptor, bradykinin receptor, calcitonin receptor, calcium sensing receptor, cannabinoid receptor, chemokine receptor, cholecystokinin receptor, complement component (C5AR1), corticotrophin releasing factor receptor, dopamine receptor, endothelial differentiation gene receptor, endothelin receptor, formyl peptide-like receptor, galanin receptor, gastrin releasing peptide receptor, receptor ghrelin receptor, gastric inhibitory polypeptide receptor, glucagon receptor, gonadotropin releasing hormone receptor, histamine receptor, kisspeptin (KiSS1) receptor, leukotriene receptor, melanin-concentrating hormone receptor, melanocortin receptor, melatonin receptor, motilin receptor, neuropeptide receptor, nicotinic acid, opioid receptor, orexin receptor, orphan receptor, platelet activating factor receptor, prokineticin receptor, prolactin releasing peptide, prostanoid receptor, protease activated receptor, P2Y (purinergic) receptor, relaxin receptor, secretin receptor, serotonin receptor, somatostatin receptor, tachykinin receptor, vasopressin receptor, oxytocin receptor, vasoactive intestinal peptide (VIP) receptor or the pituitary adenylate cyclase activating polypeptide (PACAP) receptor.
TABLE-US-00003 TABLE 3A GPCRs amenable for expression in Readout Cells or as Part of a Stabilized Readout Particle. Human gene Family symbol Human Gene Name Calcitonin receptors CALCR calcitonin receptor Calcitonin receptors CALCRL calcitonin receptor-like Corticotropin- CRHR1 corticotropin releasing releasing hormone factor receptors receptor 1 Corticotropin- CRHR2 corticotropin releasing releasing hormone factor receptors receptor 2 Glucagon receptor GHRHR growth hormone family releasing hormone receptor Glucagon receptor GIPR gastric inhibitory polypeptide family receptor Glucagon receptor GLP1R glucagon-like family peptide 1 receptor Glucagon receptor GLP2R glucagon-like family peptide 2 receptor Glucagon receptor GCGR glucagon receptor family Glucagon receptor SCTR secretin receptor family Parathyroid PTH1R parathyroid hormone hormone receptors 1 receptor Parathyroid PTH2R parathyroid hormone hormone receptors 2 receptor VIP and PACAP ADCYAP1R1 adenylate cyclase activating receptors polypeptide 1 (pituitary) receptor type I VIP and PACAP VIPR1 vasoactive intestinal receptors peptide receptor 1 VIP and PACAP VIPR2 vasoactive intestinal receptors peptide receptor 2 Adenosine ADORA1 Adenosine A1 receptor Adenosine ADORA2A Adenosine A2 receptor Adenosine ADRB3 Adenosine 3 receptor Chemokine CXCR1 C-X-C chemokine receptor 1 Chemokine CXCR2 C-X-C chemokine receptor 2 Chemokine CXCR3 C-X-C chemokine receptor 3 Chemokine CXCR4 C-X-C chemokine receptor 4 Chemokine CXCR5 C-X-C chemokine receptor 5 Chemokine CXCR6 C-X-C chemokine receptor 6 Chemokine CXCR7 C-X-C chemokine receptor 7 Chemokine CCR1 C-C chemokine receptor type 1 Chemokine CCR2 C-C chemokine receptor type 2 Chemokine CCR3 C-C chemokine receptor type 3 Chemokine CCR4 C-C chemokine receptor type 4 Chemokine CCR5 C-C chemokine receptor type 5 Chemokine CCR6 C-C chemokine receptor type 6 Chemokine CCR7 C-C chemokine receptor type 7 Chemokine CMKLR1 Chemokine receptor-like 1 Complement C5AR1 Complement component AR1 component receptor Lysophospholipid LPAR1 lysophosphatidic acid (LPL) receptor receptor 1 Lysophospholipid LPAR2 lysophosphatidic acid (LPL) receptor receptor 2 Lysophospholipid LPAR3 lysophosphatidic acid (LPL) receptor receptor 3 Lysophospholipid LPAR4 lysophosphatidic acid (LPL) receptor receptor 4 Lysophospholipid LPAR5 lysophosphatidic acid (LPL) receptor receptor 5 Lysophospholipid LPAR6 lysophosphatidic acid (LPL) receptor receptor 6 Lysophospholipid SIPR1 sphingosine-1- (LPL) receptor phosphate receptor 1 Lysophospholipid SIPR2 sphingosine-1- (LPL) receptor phosphate receptor 2 Lysophospholipid SIPR3 sphingosine-1- (LPL) receptor phosphate receptor 3 Lysophospholipid SIPR4 sphingosine-1- (LPL) receptor phosphate receptor 4 Lysophospholipid SIPR5 sphingosine-1- (LPL) receptor phosphate receptor 5
TABLE-US-00004 TABLE 3B GPCRs amenable for expression in Readout Cells or as Part of a Stabilized Readout Particle. GPCR (Gene symbol) Ligand(s) 5-hydroxytryptamine 5-hydroxytryptamine 1A receptor (HTR1A) 5-hydroxytryptamine 5-hydroxytryptamine 1B receptor (HTR1B) 5-hydroxytryptamine 5-hydroxytryptamine 1D receptor (HTR1D) 5-hydroxytryptamine 5-hydroxytryptamine 1e receptor (HTR1E) 5-hydroxytryptamine 1F 5-hydroxytryptamine receptor (HTR1F) 5-hydroxytryptamine 2A 5-hydroxytryptamine receptor (HTR2A) 5-hydroxytryptamine 2B 5-hydroxytryptamine receptor (HTR2B) 5-hydroxytryptamine 2C 5-hydroxytryptamine receptor (HTR2C) 5-hydroxytryptamine 4 5-hydroxytryptamine receptor (HTR4) 5-hydroxytryptamine 5a 5-hydroxytryptamine receptor (HTR5A) 5-hydroxytryptamine 5b 5-hydroxytryptamine receptor (HTR5BP) 5-hydroxytryptamine 5-hydroxytryptamine 6 receptor (HTR6) 5-hydroxytryptamine 7 5-hydroxytryptamine receptor (HTR7) Acetylcholine M1 acetylcholine receptor (CHRA11) Acetylcholine M2 acetylcholine receptor (CHR1142) Acetylcholine M3 acetylcholine receptor (CHRI143) Acetylcholine M4 acetylcholine receptor (CHRI144) Acetylcholine M5 acetylcholine receptor (CHRI145) Adenosine Al receptor adenosine (ADORA1) Adenosine A2A receptor (ADORA2A) adenosine Adenosine A2B receptor (ADORA2B) adenosine Adenosine A3 receptor adenosine (ADORA3) .sub.1A-adrenoceptor Adrenaline, noradrenaline (ADRA1A) agonists cirazoline, desvenlafaxine, etilefrine, metaraminol, methoxamine, midodrine, naphazoline, oxymetrazoline, phenylephrine, synephrine, tetrahydrozoline, xylometazoline antagonists alfuzosin, arotinolol, carvedilol, doxazosin, indoramin, labetalol, moxislyte, phenoxybenzamine, phentolamine, prazosin, quetiapine, risperidone, silodosin, tamsulosin, terazosin, tolazoline, trimazosin .sub.1B-adrenoceptor Adrenaline, noradrenaline (ADRA1B) .sub.1D-adrenoceptor Adrenaline (ADRA1D) .sub.2A-adrenoceptor Adrenaline (ADRA2A) .sub.2C-adrenoceptor Adrenaline, noradrenaline (ADRA2B) agonists salbutamol, bitolterol mesylate, isoproteronol, levosalbutamol, metaproterenol, formoterol, salmeterol, terbutaline, clenbuterol, ritodrine antagonists butoxamine, Beta blockers a.sub.2C-adrenoceptor Adrenaline, noradrenaline (ADRA2C) .sub.1-adrenoceptor Adrenaline, noradrenaline (ADRB1) nitrosamine 4- (methylnitrosamino)- 1-(3-pyridyl)-1-butanone (NNK) agonists denopamine, dobutamine, xamoterol antagonists acebutol, atenolol, betaxolol, bisoprolol, esmolol, metoprolol, nebivolol, vortioxetine .sub.2-adrenoceptor Adrenaline (ADRB2) .sub.3-adrenoceptor (ADRB3) Adrenaline Angiotensin recptor 1 Angiotensisn I, angiotensin II, (AT.sub.1) (AGTR1) angiotensin III Angiotensin recptor 2 Angiotensisn II, angiotensin III (AT.sub.2) (AGTR2) Angiotensin recptor 4 Angiotensisn IV (angiotensin II metabolite) Apelin receptor (APLNR) Apelin-13, apelin-17, apelin-36 Bile acid receptor Chenodeoxycholic acid, (GPBAR1) cholic acid, deoxycholic acid, lithocholic acid Bombesin receptor BB.sub.1 (NMBR) Gastrin-releasing peptide, neuromedin B Bombesin receptor BB.sub.2 Gastrin-releasing peptide, (GRPR) neuromedin B Bombesin receptor BB.sub.3 (BRS3) Bradykinin recpetor B1 bradykinin Bradykinin recpetor B2 bradykinin Calcium sensing Calcium receptor (CaSR) Magnesium G-protein coupled receptor family C group 6 member A (GPRC6A) Cannabinoid CB.sub.1 receptor 2-arachidonoylglycerol (CNR1) anandamide Cannabinoid CB.sub.2 receptor 2-arachidonoylglycerol (CNR2) anandamide C-X-C chemokine receptor Interleukin 8 type 4 (CXCR2) Growth-related oncogene- alpha (GRO-) C-X-C chemokine receptor Stromal cell-derived type 4 (CXCR4) factor-1 (SDF1) Cholecystokinin A receptor Cholecystokinin peptide (CCKAR or CCK1) hormones (CCK) Cholecystokinin B receptor Cholecystokinin peptide (CCKAR or CCK2) hormones(CCK) Gastrin Cholecystokinin recptor CCK-33, CCK-4, CCK-8, CCK1 (CCKAR) gastrin-17 Cholecystokinin recptor CCK-33, CCK-4, CCK-8, CCK2 (CCKBR) gastrin-17 endothelin receptor A (ETA) Endothelin-1 endothelin receptor B1 Endothelin-1 (ETB1) Endothelin-3 endothelin receptor B2 Endothelin-1 (ETB2) Endothelin-3 endothelin receptor C (ETC) Endothelin-1 Frizzled 1 (FZD1) Wnt-1, Wnt-2, Wnt-3a, Wnt-5a, Wnt-7b Frizzled 2 (FZD2) Wnt-5a Frizzled 3 (FZD3) Wnt protein ligand Frizzled 4 (FZD4) Wnt protein ligand Frizzled 5 (FZD5) Wnt protein ligand Frizzled 6 (FZD6) Wnt-3a, Wnt-4, Wnt-5a Frizzled 7 (FZD7) Wnt protein ligand Frizzled 8 (FZD8) Wnt protein ligands Frizzled 9 (FZD9) Wnt protein ligands Frizzled 10 (FZD10) Wnt protein ligands GABA.sub.B1 Receptor Agonist GABA.sub.B2 Receptor GABA, Baclofen, gamma- (B1 and B2 assemble as hydroxybutyrate, phenibut, heterodimer) 3-aminopropylphosphinic acid, lesogaberan, SKF-97541, CGP-44532 Allosteric modulator CGP-7930, BHFF, Fendiline, BHF-177, BSPP, GS-39783 Antagonists 2-OH-saclofen, saclofen, phaclofen, SCH-50911, CGP-35348, CGP-52432, SGS-742, CGP-55845 Gastrin-releasing peptide Gastrin releasing peptide receptor (GRPR), also referred to as BB.sub.2 G protein-coupled estrogen Oestrogen receptor 30 (GPR30) Luteinizing hormone/ Luteinizing hormone choriogonadotropin receptor Chroinic gonadotropins (LHCGR), also referred to as Lutenizing hormone receptor (LHR) and lutropin/ choriogonadotroptin receptor (LCGR) Lysophosphatidic acid Lysophosphatidic acid receptor 1 (LPA1) Lysophosphatidic acid Lysophosphatidic acid receptor 2 (LPA2) Lysophosphatidic acid Lysophosphatidic acid receptor 3 (LPA3) Melanocortin 1 receptor Melanocortins (pituitary (MC1R), also referred peptide hormones) including o as melanocyte- adrenocorticotropic hormone stimulating hormone (ACTH) and melanocyte- receptor (MSHR), melanin- stimulating hormone (MSH) activating peptide receptor and melanotropin receptor Neuromedin B receptor Neuromedin B Prostaglandin E2 Prostaglandin E2 receptor EP2 Prostaglandin E2 Prostaglandin E2 receptor EP4 Protease-activated receptor 1 Thrombin Protease-activated receptor 2 Trypsin Protease-activated receptor 3 Thrombin Protease-activated receptor 4 Thrombin Smoothened Sonic hedgehog Thyrotropin receptor Thyrotropin (TSH receptor) Metabotropic glutamate L-glutamic acid receptor 1(GRM1) Metabotropic glutamate L-glutamic acid receptor 2 (GRM2) Metabotropic glutamate L-glutamic acid receptor 3 (GRM3) Metabotropic glutamate L-glutamic acid receptor 4 (GRM4) Metabotropic glutamate L-glutamic acid receptor 5 (GRM5) Metabotropic glutamate L-glutamic acid receptor 6 (GRM6) Metabotropic glutamate L-glutamic acid receptor 7 (GRM7) Metabotropic glutamate L-glutamic acid receptor 8 (GRM8) G protein-coupled receptor 56 (GPR56) G protein-coupled receptor 64 (GPR64) G protein-coupled receptor 97 (GPR97) G protein-coupled receptor 98 (GPR98) G protein-coupled receptor 110 (GPR110) G protein-coupled receptor 111 (GPR111) G protein-coupled receptor 112 (GPR112) G protein-coupled receptor 113 (GPR113) G protein-coupled receptor 114 (GPR114) G protein-coupled receptor 115 (GPR115) G protein-coupled receptor 116 (GPR116) G protein-coupled receptor 123 (GPR123) G protein-coupled receptor 124 (GPR124) G protein-coupled receptor 125 (GPR125) G protein-coupled receptor 126 (GPR126) G protein-coupled receptor 128 (GPR128) G protein-coupled receptor 133 (GPR133) G protein-coupled receptor 144 (GPR144) latrophilin 1 (LPHN1) latrophilin 2 (LPHN2) latrophilin 3 (LPHN3)
[0379] In one embodiment, an effector cell is assayed for an extracellular effect on a readout cell expressing a GPCR by one or more of the assays provided in Table 4, below. In another embodiment, a readout particle population comprises a vesicle or a bead functionalized with a membrane extracts (available from Integral Molecular), or a stabilized solubilized GPCR (e.g., Heptares).
[0380] GPCRs can be phosphorylated and interact with proteins called arrestins. The three major ways to measure arrestin activation are: (i) microscopyusing a fluorescently labeled arrestin (e.g., GFP or YFP); (ii) using enzyme complementation; (iii) using the TANGO Reporter system (-lactamase) (Promega). In one embodiment, the TANGO Reporter system is employed in a readout cell or plurality of readout cells. This technology uses a GPCR linked to a transcription factor through a cleavable linker. The arrestin is fused to a crippled protease. Once the arrestin binds to the GPCR, the high local concentration of the protease and the linker result in cleavage of the linker, releasing the transcription factor into the nucleus to activate transcription. The -lactamase assay can be run on live cells, does not require cell lysis, and can be imaged in as little as 6-hours of agonist incubation.
[0381] In one embodiment, a -arrestin GPCR assay that can be universally used for the detection of antagonists and agonists of GPCR signaling is used in the methods and devices provided herein to identify and an effector cell that secretes a biomolecule that binds to a GPCR (Rossi et al. (1997). Proc. Natl. Acad. Sci. U.S.A. 94, pp. 8405-8410, incorporated by reference in its entirety for all purposes). This assay is based on a -galactosidase (-Gal) enzyme-complementation technology, now commercialized by DiscoveRx. The GPCR target is fused in frame with a small N-terminal fragment of the -Gal enzyme. Upon GPCR activation, a second fusion protein, containing -arrestin linked to the N-terminal sequences of -Gal, binds to the GPCR, resulting in the formation of a functional -Gal enzyme. The -Gal enzyme then rapidly converts non-fluorescent substrate Di--D-Galactopyranoside (FDG) to fluorescein, providing large amplification and excellent sensitivity. In this embodiment, readout cells (with GPCRs) are preloaded, off chip, with cell-permeable pro-substrate (acetylated FDG) which is converted to cell-impermeable FDG by esterase cleavage of acetate groups. Although fluorescein is actively transported out of live cells, by implementing this assay within a microfluidic chamber the fluorescent product is concentrated, providing greatly enhanced sensitivity over plate-based assays. DiscoveRx has validated this assay strategy, used in microwell format, across a large panel of GPCRs.
[0382] In one embodiment, activation of a GPCR by an effector cell is determined in a microfluidic format by detecting the increase in cytosolic calcium in one or more readout cells. In a further embodiment, the increase in cytosolic calcium is detected with one or more calcium sensitive dyes. Calcium sensitive dyes have a low level of fluorescence in the absence of calcium and undergo an increase in fluorescent properties once bound by calcium. The fluorescent signal peaks at about one minute and is detectable over a 5 to 10 minute window. Thus, to detect activity using fluorescent calcium the detection and addition of the agonist are closely coupled. In order to achieve this coupling, the effector cell is exposed simultaneously to the population of readout cells and the one or more calcium sensitive dyes. In one embodiment, the one or more calcium sensitive dyes are one provided in a FLIPR calcium assay (Molecular Devices).
[0383] The recombinant expressed jellyfish photoprotein, aequorin, in one embodiment, is used in a functional GPCR screen, i.e., an extracellular effect assay where the extracellular effect is the modulation of a GPCR. Aequorin is a calcium-sensitive reporter protein that generates a luminescent signal when a coelenterazine derivative is added. Engineered cell lines with GPCRs expressed with a mitochondrially targeted version of apoaequorin are available commercially (Euroscreen). In one embodiment, the one or more of the cell lines available from Euroscreen is used as a population of readout cells in a method of assessing an extracellular effect of an effector cell, or a variation in an extracellular effect.
[0384] In one embodiment, an extracellular effect on a GPCR is measured by using one of the ACTOne cell lines (Codex Biosolutions), expressing a GPCR and a cyclic nucleotide-gated (CNG) channel, as a population of readout cells. In this embodiment, the extracellular effect assay works with cell lines that contain an exogenous Cyclic Nucleotide-Gated (CNG) channel. The channel is activated by elevated intracellular levels of cAMP, which results in ion flux (often detectable by calcium-responsive dyes) and cell membrane depolarization which can be detected with a fluorescent membrane potential (MP) dye. The ACTOne cAMP assay allows both end-point and kinetic measurement of intracellular cAMP changes with a fluorescence microplate reader.
[0385] A reporter gene assay, in one embodiment, is used to determine whether an effector cell modulates a particular GPCR. In this embodiment, the modulation of the GPCR is the extracellular effect being assessed. A reporter gene assay, in one embodiment, is based on a GPCR second messenger such as calcium (AP1 or NFAT response elements) or cAMP (CRE response element) to activate or inhibit a responsive element placed upstream of a minimal promoter, which in turn regulates the expression of the reporter protein chosen by the user. Expression of the reporter, in one embodiment, is coupled to a response element of a transcription factor activated by signaling through a GPCR. For example, reporter gene expression can be coupled to a responsive element for one of the following transcription factors: ATF2/ATF3/AFT4, CREB, ELK1/SRF, FOS/JUN, MEF2, GLI, FOXO, STAT3, NFAT, NFB. In a further embodiment, the transcription factor is NFAT. Reporter gene assays are available commercially, for example from SA Biosciences
[0386] Reporter proteins are known in the art and include, for example, -galactosidase, luciferase (see, e.g., Paguio et al. (2006). Using Luciferase Reporter Assays to Screen for GPCR Modulators, Cell Notes Issue 16, pp. 22-25; Dual-Glo Luciferase Assay System Technical Manual #TM058; pGL4 Luciferase Reporter Vectors Technical Manual #TM259, each incorporated by reference in their entireties for all purposes), GFP, YFP, CFP, -lactamase. Reporter gene assays for measuring GPCR signaling are available commercially and can be used in the methods and devices described herein. For example, the GeneBLAzer assay from Life Technologies is amenable for use with the present invention.
[0387] In one embodiment, overexpression of a G protein in a reporter cell is carried out to force a cAMP coupled GPCR to signal through calcium. This is referred to as force coupling.
[0388] In one embodiment, a Gq coupled cell line is used as a readout cell line in the methods described herein. In one embodiment, the Gq coupled cell line reports GPCR signaling through -lactamase. For example, one of the cell-based GPCR reporter cell lines (GeneBLAzer, Life Technologies). The reporter cell line can be division arrested or include normal dividing cells.
[0389] cAMP responsive element-binding protein (CREB) is a transcription factor as mentioned above, and is used in one embodiment for a Gs and/or Gi coupled GPCR. In a further embodiment, forskolin is utilized as an accessory particle. The CRE reporter is available in plasmid or lentiviral form to drive GFP expression from SA Biosciences, and is amenable for use with the methods and devices described herein. For example, the assay system available from SA Biosciences in one embodiment is employed herein to produce a readout cell (world-wide-website: sabiosciences.com/reporter assayproduct/HTML/CCS-002G.html). Life Technologies also has CRE-responsive cell lines that express specific GPCRs, and these can be used in the methods described herein as well as readout cells.
[0390] In one embodiment, one or more effector cells present in a cell population are assayed for the ability to activate or antagonize a GPCR present on one or more readout cells by detecting the increase or decrease in cAMP levels inside the one or more readout cells. ELISA based assays, homogeneous time-resolved fluorescence (HTRF) (see Degorce et al. (2009). Current Chemical Genomics 3, pp. 22-32, the disclosure of which is incorporated by reference in its entirety), and enzyme complementation can all be used with the microfluidic devices and assays provided herein to determine cAMP levels in readout cells. Each of these cAMP detection methods requires cell lysis to liberate the cAMP for detection, as it is the cyclic AMP that is actually measured.
[0391] Assays for measuring cAMP in whole cells and for measuring adenyl cyclase activity in membranes are commercially available (see, e.g., Gabriel et al. (2003). Assay Drug Dev. Technol. 1, pp. 291-303; Williams (2004). Nat. Rev. Drug Discov. 3, pp. 125-135, each incorporated by reference in their entireties), and are amenable for use in the devices and methods provided herein. That is, cell populations in one or more microfluidic chambers can be assayed according to these methods.
[0392] Cisbio International (Codolet, France) has developed a sensitive high-throughput homogenous cAMP assay (HTRF, see Degorce et al. (2009). Current Chemical Genomics 3, pp. 22-32, the disclosure of which is incorporated by reference in its entirety) based on time resolved fluorescence resonance energy transfer technology and can be used herein to screen for an effector cell exhibiting an effect on a GPCR. The method is a competitive immunoassay between native cAMP produced by cells and a cAMP-labeled dye (cAMP-d2). The cAMP-d2 binding is visualized by a MaB anti-cAMP labeled with Cryptate. The specific signal (i.e., energy transfer) is inversely proportional to the concentration of cAMP in the sample, in this case, the amount of cAMP activated in a readout cell by an effector cell or an effector cell secretion product. As cAMP is being measured, readout cells are first lysed to free the cAMP for detection. This assay has been validated for both G.sub.s-(.sub.2-adrenergic, histamine H2, melanocortin MC4, CGRP and dopamine D.sub.1) and G.sub.i/o-coupled (histamine H.sub.3) receptors.
[0393] cAMP assay kits based on fluorescence polarization are also commercially, e.g., from Perkin Elmer, Molecular Devices and GE Healthcare, and each is amenable for use as an effector cell assay in the methods and devices provided herein. Accordingly, one embodiment of the present invention comprises selecting an effector cell and/or cell population comprising one or more effector cells based on the result of a cAMP fluorescence polarization assay. The method is used in one embodiment to determine whether the effector cell activates (agonism) or inhibits (antagonism) on a particular GPCR.
[0394] In one embodiment, the AlphaScreen cAMP assay from Perkin Elmer, a sensitive bead-based chemiluminescent assay requiring laser activation, is used in the devices provided herein to screen for an effector cell having an effect on a readout cell, specifically, the activation or inhibition of a GPCR.
[0395] DiscoveRx (world-wide-website: discoverx.com) offers a homogenous high-throughput cAMP assay kit called HitHunter based on a patented enzyme (-galactosidase) complementation technology using either fluorescent or luminescent substrates (Eglen and Singh (2003). Comb Chem. High Throughput Screen 6, pp. 381-387; Weber et al. (2004). Assay Drug Dev. Technol. 2, pp. 39-49; Englen (2005). Comb. Chem. High Throughput Screen 8, pp. 311-318, each incorporated by reference in their entireties). This assay can be implemented herein to detect an effector cell having an extracellular effect or a variation in an extracellular effect on a readout cell expressing a GPCR.
[0396] Cellular events that result from GPCR receptor activation or inhibition can also be detected to determine an effector cell's property(ies) (e.g., an antibody producing cell's ability to activate or antagonize) on a readout cell. For example, in the case of the Gq coupled receptors, when the GPCR is activated, the Gq protein is activated, which results in the phospholipase C cleavage of membrane phospholipids. This cleavage results in the generation of inositol triphosphates 3 (IP3). Free IP3 binds to its target at the surface of the endoplasmic reticulum causing a release of calcium. The calcium activates specific calcium responsive transcription vectors such as nuclear factor of activated T-cells (NFAT). Thus, by monitoring NFAT activity or expression, an indirect readout of the GPCR in a readout cell is established. See. e.g., Crabtree and Olson (2002). Cell 109, pp. S67-S79, incorporated by reference herein in its entirety.
[0397] Once activated more than 60% of all GPCRs are internalized. Utilizing a tagged GPCR (typically done with a C-terminal GFP tag) the distribution of the receptor in one embodiment, is imaged in the presence and absence of ligand. Upon ligand stimulation a normally evenly distributed receptor will often appear as endocytosed puncta.
TABLE-US-00005 TABLE 4 GPCR functional assays for use with the present invention. Biological Reagents (accessory Assay measurements particles) Basis Endpoint Notes Europium- Membrane-based Europium-GTP Binding of Time-resolved Proximal to GTP GPCR europium- fluorescence receptor binding (Perkin mediated labeled GTP to activation, Elmer) Guanine receptor activated nonradioactive. nucleotide G proteins exchange AlphaScreen Cell-based cAMP MAb cAMP competes Luminescence High sensitivity, (Perkin Elmer) cAMP conjugated with biotinyl-cAMP homogeneous, accumulation acceptor bead, binding to high- amenable to streptavidin-coated affinity streptavidin- automation, donor beads with coated donor beads, broad chemoluminescence loss of signal due to linear compound, reduced proximity of range of biotinyl-cAMP acceptor-donor bead detection Fluorescence Cell- or cAMP MAb, cAMP competes with Fluorescence Homogeneous, polarization membrane-based fluorescent Fluor-cAMP polarization amenable to (Perkin cAMP cAMP binding to cAMP automation Elmer, accumulation MAb, loss of Molecular signal due to Devices, GE decrease in rotation Healthcare) and polarization HTRF cAMP Cell-based, cAMP MAb cAMP competes Time-resolved Broad linear (Cisbio) cAMP conjugated with acceptor-labeled fluorescence range, accumulation with eurocryptate, cAMP binding to high signal- acceptor molecule europium-conjugated to-noise, labeled cAMP cAMP MAb, loss of homogenous, signal due to reduced amenable to europium-acceptor automation molecule proximity HitHunter Cell-based, cAMP MAb, ED- cAMP competes with Fluorescence or Low compound (DiscoveRx) cAMP cAMP (enzyme ED-cAMP for luminescence interference, accumulation fragment dono- complementation of high cAMP conjugate) -Gal activity with sensitivity, conjugated peptide, binding of acceptor homogeneous, acceptor protein, peptide, loss of amenable to lysis buffer signal as enzyme automation complementation is reduced IP.sub.1 (Cisbio) Cell-based IP.sub.1 Europium- Loss of signal Time-resolved Homogeneous, accumulation conjugated IP.sub.1 as IP.sub.1 competes fluorescence can be used for MAb, acceptor for binding of constitutively labeled IP.sub.1 acceptor-labeled active Gq- IP.sub.1 binding to coupled GPCRs europium-MAb FLIPR Cell-based, Caldium Increased Fluorescence Sensitive, (Molecular increases in sensitive dye; fluorescence as homogeneous, Devices) intracellular caldium-3 intracellular dye amenable to calcium binds calcium automation AequoScreen Cell-based, Cell lines Calcium-sensitive Luminescence Sensitive, (EuroScreen) increases in expressing aequorin generates homogeneous, intracellular select GPCRs a luminescent amenable to calcium along with signal when a automation promiscuous coelenterazine or chimeric derivative G proteins and a is added mitochondrially targeted version of apoaequorin Reporter gene Cell-based, Several promoter GPCR changes Fluorescence, Homogeneous, increases in plasmids and in secondary luminescence, amplification reporter reporters messengers alter absorbance of gene expression expression signal due to increases of a selected in second reporter gene messengers activated by GPCR binding Melanophore Cell-based, Melanosomes Absorbance Sensitive, (Arena changes in aggregate homogeneous, Pharmaceuticals) pigment with inhibition no cell lysis, dispersion of PKA disperse amenable to with activation of automation PKA or PKC Adapted from Thomsen et al. (2005). Current Opin. Biotechnol. 16, pp. 655-665, incorporated by reference herein in its entirety for all purposes.
[0398] One embodiment of a work flow for a single cell antibody secreting cell (ASC)/antibody selection pipeline is shown in
[0399] In another embodiment, after an animal is immunized and cells are obtained from spleen, blood, lymph nodes and/or bone marrow, the cells make up a starting population that are loaded directly into individual chambers of a microfluidic device provided herein, i.e., as a plurality of cell populations, wherein individual cell populations are present in each microfluidic chamber. An extracellular effect assay is then carried out in the individual chambers on the individual cell populations to determine if any of the individual cell populations comprise one or more effector cells responsible for an extracellular effect.
[0400] Although a host animal can be immunized with a target antigen prior to microfluidic analysis, the invention is not limited thereto. For example, in one embodiment, cells are obtained from spleen, blood, lymph nodes or bone marrow from a host (including human) followed by an enrichment for ASCs. Alternatively, no enrichment step takes place and cells are directly loaded into chambers of a device provided herein, i.e., as a plurality of cell populations, where individual cell populations are present in each chamber.
[0401] The methods provided herein allow for the selection of antibodies from any host species. This provides two key advantages for the discovery of therapeutic antibodies. First, the ability to work in species other than mice and rats allows for the selection of mAbs to targets with high homology to mouse proteins, as well as mAbs to human proteins that cross-react with mice and can thus be used in easily accessible pre-clinical mouse models. Second, mouse immunizations often result in responses that feature immunodominance to a few epitopes, resulting in a low diversity of antibodies generated; expanding to other species thus greatly increases the diversity of antibodies that recognize different epitopes. Accordingly, in embodiments described herein, mice rats and rabbits are used for immunizations, followed by the selection of ASCs from these immunized animals. In one embodiment, a rabbit is immunized with an antigen, and ASCs from the immunized rabbit are selected for with the methods and devices provided herein. As one of skill in the art will recognize, rabbits offer advantages of a distinct mechanism of affinity maturation that uses gene conversion to yield greater antibody diversity, larger physical size (more antibody diversity), and greater evolutionary distance from humans (more recognized epitopes).
[0402] The immunization strategy, in one embodiment is a protein, cellular, and/or DNA immunization. For example, for PDGFR, the extracellular domain obtained from expression in a mammalian cell line, or purchased from a commercial source (Calixar) is used to immunize an animal. For CXCR4, in one embodiment, virus-like particle (VLP) preparations, a nanoparticle having a high expression of GPCR in native conformation, from a commercial source (Integral Molecular) is used. Cell-based immunization is performed by overexpression of full-length proteins in a cell line (e.g., 32D-PDGFR cells for mice/rats, and a rabbit fibroblast cell line (SIRC cells) for rabbits; including protocols in which a new cell line is used in the final boost to enrich for specific mAbs. A variety of established DNA immunization protocols are also amenable for use with the present invention. DNA immunization has become the method of choice for complex membrane proteins since it 1) eliminates the need for protein expression and purification, 2) ensures native conformation of the antigen, 3) reduces the potential for non-specific immune responses to other cell membrane antigens, and 4) has been proven effective for challenging targets (Bates et al. (2006). Biotechniques 40, pp. 199-208; Chambers and Johnston (2003). Nat. Biotechnol. 21, pp. 1088-1092; Nagata et al. (2003). J. Immunol. Methods 280, pp. 59-72; Chowdhury et al. (2001). J. Immunol Methods 249, pp. 147-154; Surman et al. (1998). J. Immunol. Methods 214, pp. 51-62; Leinonen et al. (2004). J. Immunol. Methods 289, pp. 157-167; Takatasuka et al. (2011). J. Pharmacol. and Toxicol. Methods 63, pp. 250-257, each incorporated by reference in their entireties for all purposes). All immunizations are performed in accordance with animal care requirements and established protocols.
[0403] Anti-PDGFR antibodies have been previously produced in rats, mice, and rabbits, and comparison of the extracellular domain of PDGFR shows several sites of substantial variation (
[0404] The devices provided herein are based on Multilayer Soft Lithography (MSL) microfluidics (Unger et al. (2000). Science 7, pp. 113-116, incorporated by reference in its entirety). MSL is a fabrication method that provides for increased sensitivity through small volume reactions; high scalability and parallelization; robust cell culture; flexibility and fluid handling control needed for complex assays; and greatly reduced cost and reagent consumption.
[0405] The number of effector cells isolated per device run (i.e., number of cells in each chamber of a device) is a function of the concentration of cells in a cell suspension loaded onto a device, the frequency in the cell suspension of the specific effector cells being selected for, and the total number of chambers on a device. Devices with arrays up to and greater than 40,000 effector cell assay chambers are contemplated.
[0406] Amongst all microfluidics technologies, MSL is unique in its rapid and inexpensive prototyping of devices having thousands of integrated microvalves (Thorsen et el. (2002). Science 298, pp. 58-584, incorporated by reference in its entirety). These valves can be used to build higher-level fluidic components including mixers, peristaltic pumps (Unger et al. (2000). Science 7, pp. 113-116) and fluidic multiplexing structures (Thorsen et el. (2002). Science 298, pp. 58-584; Hansen and Quake (2003). Curr. Opin. Struc. Biol. 13, pp. 538-544, incorporated by reference in their entireties herein) thus enabling high levels of integration and on-chip liquid handling (Hansen et al. (2004). Proc. Natl. Acad. Sci. U.S.A. 101, pp. 14431-1436; Maerkl and Quake (2007). Science 315, pp. 233-237, each incorporated by reference in their entireties). (
[0407]
[0408] The assay chambers of a device, in one embodiment has an average volume of from about 100 L to about 100 nL. For example, in one embodiment, one or more properties of an effector cell is assayed within a microfluidic chamber comprising a cell population wherein the volume of the microfluidic chamber is about 100 L, about 200 L, about 300 L, about 400 L, about 500 L, about 600 L, about 700 L, about 800 L, about 900 L or about 1 nL. In another embodiment, the volume of the microfluidic chamber is about 2 nL. In another embodiment, the volume of the microfluidic chamber for assaying a property of an effector cell in a cell population is from about 100 L to about 100 nL, from about 100 L to about 50 nL, from about 100 L to about 10 nL, from about 100 L to about 1 nL, from about 50 L to about 100 nL, from about 50 L to about 50 nL, from about 50 L to about 10 nL or from about 50 L to about 1 nL. In even another embodiment, the volume of the microfluidic chamber for assaying a property of an effector cell in a cell population is about 10 nL, about 20 nL, about 30 nL, about 40 nL, about 50 nL, about 60 nL, about 70 nL, about 80 nL, about 90 nL or about 100 nL.
[0409] The MSL fabrication process takes advantage of well-established photolithography techniques and advances in microelectronic fabrication technology. The first step in MSL is to draw a design of flow and control channels using computer drafting software, which is then printed on high-resolution masks. Silicon (Si) wafers covered in photoresist are exposed to ultraviolet light, which is filtered out in certain regions by the mask. Depending on whether the photoresist is negative or positive, either areas exposed (negative) or not (positive) crosslinks and the resist will polymerize. The unpolymerized resist is soluble in a developer solution and is subsequently washed away. By combining different photoresists and spin coating at different speeds, silicon wafers are patterned with a variety of different shapes and heights, defining various channels and chambers. The wafers are then used as molds to transfer the patterns to polydimethylsiloxane (PDMS). In one embodiment, prior to molding with PDMS and after defining photoresist layers, molds are parylene coated (chemical vapor deposited poly(p-xylylene) polymers barrier) to reduce sticking of PDMS during molding, enhance mold durability and enable replication of small features
[0410] In MSL, stacking different layers of PDMS cast from different molds on top of each other is used to create channels in overlapping flow and control layers. The two (or more) layers are bound together by mixing a potting prepolymer component and a hardener component at complementary stoichiometric ratios to achieve vulcanization. In order to create a simple microfluidic chip, a thick layer (e.g., between from about 200-2000 pins) is cast from the mold containing the flow layer, and the thin layer (e.g., between from about 25 to about 300 ms) is cast from the mold containing the control layer. After partial vulcanization of both layers, the flow layer is peeled off its mold, and aligned to the control layer (while still present on its mold, by visual inspection. The control and flow layers are allowed to bond, for example at 80 C. for about 15-60 minutes. The double slab is then peeled from the control mold, and inlet and outlet holes are punched and the double slab is bonded to a blank layer of PDMS (i.e., a flat layer of PDMS with no structural features). After allowing more time to bond, the completed device is mounted on a glass slide. Fluid flow in the device is controlled using off-chip computer programmable solenoids which actuate the pressure applied to fluid in the channels of the control layer. When pressure is applied to these control channels, the flexible membrane between the overlapping orthogonal control and flow lines deflects into the flow channel, effectively valving the flow. Different combinations of these valves can be used to create peristaltic pumps, multiplexer controls and isolate different regions of the chip
[0411] With respect to the flow layer, assay chambers and channels for controlling fluidic flow to and from the assay chambers are defined by the photoresist layers. As will be appreciated by one of skill in the art, the thickness of a photoresist layer can be controlled in part by the speed of spin coating and the particular photoresist selected for use. The bulk of the assay chambers, in one embodiment, are defined by an SU-8 100 feature which sits directly on the Si wafer. As known to those of skill in the art, SU-8 is a commonly used epoxy-based negative photoresist. Alternatively, other photoresists known to those of skill in the art can be used to define assay chambers with the heights described above. In some embodiments, the assay chambers have a height and width of 50-500 M and 50-500 M, respectively, as defined by the SU-8 features.
[0412] MSL fabrication techniques allow for a wide range of device densities, and chamber volumes to be fabricated. For the devices provided herein, in one embodiment, from about 2000 to about 10,000 effector cell analysis chambers are provided in a single integrated device. The effector cell analysis chambers, in one embodiment, have an average volume of from about 1 nL to about 4 nL, for example, from about 1 nL to about 3 nL, or from about 2 nL to about 4 nL. The effector cell analysis chambers, in one embodiment, are connected in a serial format, as depicted in
[0413] The devices provided herein harness a gravity-based immobilization of cells and/or particles. Gravity based immobilization allows for perfusion of non-adherent cell types, and in general, buffer and reagent exchange within chambers. Each chamber has a cubic geometry with an access channel passing over the top (
[0414] Importantly, the devices provided herein allow for the long term culture and maintenance of cells, whether effector, accessory or of the readout variety. Microfluidic arrays of chambers are fabricated within a thick membrane (e.g., from about 150 m to about 500 m thick, about 200 m thick, about 300 m thick, about 400 m thick or about 500 m thick) of PDMS elastomer that is overlaid a reservoir of medium, for example 1 mL of medium as described previously (Lecault et al. (2011). Nature Methods 8, pp. 581-586, incorporated by reference herein in its entirety for all purposes). The proximity of the medium reservoir (osmotic bath) to the cell chambers effectively blocks evaporation (through the gas-permeable PDMS material) and ensures robust cell viability and where cells are not fully differentiated, growth over several days, and is critical for achieving long-term culture in nL volumes with growth rates and cellular responses that are identical to L volume formats.
[0415] The membrane design of the devices provided herein also enables the selective recovery of cells from any chamber by piercing the upper membrane with a microcapillary.
[0416] The device architectures provided herein are designed so that the soluble secretion products of effector cells are not washed away from a chamber when additional components, e.g., accessory particles or cell signaling ligands are added to the chamber. Additionally, the devices provided herein allow for the addition of components to a chamber without the introduction of cross-contamination of secretion products (e.g., antibodies) between individual chambers of a device. In embodiments where chambers are connected in serial, medium exchange requires flushing the entire array. Flushing the entire array, in one embodiment, results in the loss of antibody from each chamber and introduces cross-contamination to downstream chambers. However, where secretion products bind to a surface of a chamber or a readout particle bound to a surface, cross-contamination and/or loss of secretion products is not a significant problem, as secretion products are immobilized.
[0417] In one embodiment, cross-contamination and/or loss of secretion product is minimized by using an inflatable chamber design as shown in
[0418] In one embodiment, the microfluidic devices provided herein are operated in flow conditions that suppress inertial effects and are dominated by viscosity. This fluid flow regime is characterized by a low Reynolds number Re=du/, where is the density of the fluid, d is the characteristic length scale of the channel, u is the characteristic velocity of the flow, and is the viscosity of the fluid. At low Re the fluid flow streamlines become predictable and can be designed for the desired effect. Referring to
[0419] Segregation of effector cells from readout particles in a particular chamber can also be achieved via the use of a structural element, by manipulating the flow within a flow channel or channels of the device, stochastic loading, a magnetic field, an electric field or dielectric field, a gravitational field, a modification to a surface of the microfluidic chamber that affects adhesion, and relative buoyancy of the effector cells and the readout particles, or a combination thereof.
[0420] In one embodiment, effector cells and/or readout cells are confined to a chamber or a portion of a chamber (e.g., an effector zone or readout zone) using a structural element within the chamber.
[0421] Effector zone as used herein, is a region of a microfluidic chamber in which an effector cell, a population of effector cells (or subpopulation thereof), is retained.
[0422] Readout zone as used herein, is a region of a microfluidic chamber in which a readout particle is kept segregated from effector cells, and in which a functionality of the effector cell(s) may be detected. For example, when an effector zone and a readout zone are three dimensional regions of a microfluidic device, they may be individual chambers (for example, a compound chamber), where the chambers are in fluid communication with one another.
[0423] As described herein, in one embodiment, one or more structural elements are used for the distribution of effector cells and/or readout particles within one or more chambers. In a further embodiment, the one or more structural elements are used for the retaining of effector cells and/or readout particles within defined regions of a chamber, e.g., an effector zone and/or readout zone. In some embodiments, the use of such structural elements is coupled with the use of a field (e.g., gravity, dielectric, magnetic, etc.) to achieve a retaining function. For example, in one embodiment, a cell fence is utilized to trap cells (effector or readout) at a certain chamber location. Cell fences have been described previously in PCT Application Publication No. 2012/162779, and the disclosure of which is incorporated by reference in its entirety for all purposes. Cell fence, as used herein, refers to any structure which functions to restrict the movement of cells and readout particles, but which may permit the movement of other cell products, within a microfluidic chamber.
[0424] In embodiments where cell fences are utilized, each fence is defined by a thinner SU-8 2010 feature which sits on top of the SU-8 100 feature. Such a structure is depicted schematically in
[0425] In alternative cell fence embodiments, the SU-8 100 layer is fully developed, and the wafer is coated with an additional layer of SU-8 100 which is higher than the first layer, the difference becoming the height of the fence.
[0426] Structural elements described herein may provide for the retention of effector cells and readout particles on different sides of a chamber by use of gravity; in this case gravity is directed towards the floor of the chamber and provides a force that impedes the cell from rising over the fence. It should be noted that microscopic particles may be subject to Brownian motion that may cause them to diffuse over a fence in a stochastic manner. However, the probability that a particle will spontaneously rise over the fence by Brownian motion is determined by the Boltzmann distribution and is proportional to the Boltzmann factor where E is the potential energy of rising the particle to a height equal to the height of the fence (E=volume of particlethe difference between the density of the particle and the density of the liquidgravitythe height of the fence), K is the Boltzmann constant, and T is the temperature of the liquid. Thus, one of skill in the art can design and fabricate the height of a fence such that the probability of a particle spontaneously diffusing over the fence is negligibly small. It will also be appreciated by one of skill in the art that a fence of a given height presents a barrier to some particles (e.g., beads or cells), depending on the potential energy required to pass over the fence, but will not present a barrier to particles having appropriately low apparent mass in the liquid. For example, a fence having a height of about 20 m does not allow for a cell to spontaneously pass by diffusion, but presents essentially no barrier to the diffusion of proteins. In one embodiment, gravity used in conjunction with a structural element for retaining cells. However, other forces such as magnetic gradient forces, dielectric forces, centrifugal forces, flow forces, or optical forces, may be similarly used.
[0427] Structural elements may also be effective in retaining effector cells or readout particles by providing a mechanical barrier to passage. For instance, the use of a fence that reaches to within a gap of the roof of a chamber, where d is smaller than the diameter of all effector cells or readout particles, acts as a barrier without the need for application of another force. Such a structure may also be designed to selectively partition effector cells or particles on different sides of a chamber by designing the gap to allow for one type of particle to pass but not the other. Referring to
[0428] Wells within a chamber can also be used to sequester assay reagents, effector cells and/or readout cells. For example, representative device geometries are shown in
[0429]
[0430] The operation of a bead trap (shown in
[0431] In one embodiment, effector cells and readout particles are positioned within a chamber into an effector zone and readout zone using micro-fabricated structures that are designed to retain one or more types of particles (e.g., cells). For example, in one embodiment, the flow of effector cells or readout particles may be designed to intersect with micro-fabricated cup structures that are designed to retain particles but which allow the flow to pass through. Such structures can be designed such that they can accommodate only a fixed number of particles or cells, or a defined size range of particles or cells, making the structures selective for different particle types. Such traps may be positioned substantially in the chamber or at the inlet and outlets of the chambers.
[0432] In another embodiment, referring to
[0433] According to one embodiment of the invention, one or more recesses (also referred to herein as cups) at the bottom of a chamber are provided to segregate effector cells from readout particles. Referring to
[0434] In one embodiment, structural elements are positioned in a flow channel or chamber to retain one or more particles or cells. Referring to
[0435] In an extension of the design described above (e.g.,
[0436] In addition to barriers such as fences between effector cells and readout particles, porous membranes may also function as a barrier and therefore, are amenable for use with the present invention. For example, referring to
[0437] In another embodiment, a porous membrane is fabricated between PDMS layers to provide a vertical arrangement. In this embodiment, an effector zone is provided in one PDMS layer and the readout zone is provided in the second PDMS layer. One advantage of a vertical arrangement is that the spacing between the effector zone and the readout zone is well-defined.
[0438] Porous membranes incorporated within PDMS devices have been reported previously, for example, by Aran et al. (2010). Lab Chip 10, pp. 548-552; Cheuh et al. (2007). Anal. Chem. 79, pp. 3504-3508, the disclosure of which is incorporated by reference in its entirety herein for all purposes. In one embodiment, a porous membrane is fabricated according to one of the following embodiments. In another embodiment, a PDMS layer is made porous by adding an immiscible fluid to the uncured components of the PDMS. During the baking step, the immiscible fluid evaporates. In yet another embodiment, a PDMS membrane is perforated following curing using laser ablation or another removal technique. In even another embodiment, a PDMS membrane is cast on one or more microstructures with a height exceeding the thickness of the membrane in order to make the PDMS membrane porous.
[0439] In one embodiment, a structure that retains one or more effector cells and/or readout particles is a temporary structure and/or removable. In one embodiment, as illustrated in
[0440] In addition to microfabricated retention methods or fields, hydrogels such as agarose are amenable for use in order to localize effector cells and/or readout particles. For example, in one embodiment, readout particles and/or effector cells can be loaded in liquid agarose, for example, photosensitive agaraose, which solidifies on-chip. As such, the movement of effector cells or readout particles is restricting, which simplifies the imaging process while still allowing diffusive transport. Upon re-melting of the agarose, in one embodiment, selective remelting, effector cells are recovered using microfluidic methods discussed herein. In another embodiment, immobilized cells are selectively recovered using a micromanipulator or a robotic method.
[0441] In one embodiment, segregation of effector cells and readout particles in a particular zone within a chamber, or a particular chamber, in one embodiment, is achieved by a specific flow profile, stochastic loading, a magnetic field, an electric field or dielectric field, a gravitational field, a modification to a surface of the microfluidic chamber, and selecting a particular relative buoyancy of the effector cells and the readout particles, or a combination thereof. For example, in one embodiment, either the cell population is labeled with magnetic particles or the readout particles are magnetic, such that provision of a magnetic field to the top surface of a particular chamber draws the cell population or readout particles upward, and away from either the readout particles, in the case that the cells are magnetically labeled, or the cell population, in the case where readout particles are magnetically labeled. In another embodiment, the specific gravity of the fluid in which the cell population and readout particles are incubated can be chosen to facilitate separation of the effector cells and readout particles based on their relative buoyancy. Certain particle and cell sequestration methods are discussed in greater detail below.
[0442] Effector cells and readout particles, in one embodiment, are distributed within a chamber by functionalizing one or more walls of the chamber. In one embodiment, the surface functionalization is performed by graft, covalently linking, adsorbing or otherwise attaching one or more molecules to the surface of the chamber, or modifying the surface of the chamber, such that the adherence of cells or particles to the chamber surface is altered. Nonexclusive examples of such functionalizations for use herein are the non-specific adsorption of proteins, the chemical coupling of proteins, the non-specific adsorption of polymers, the electrostatic adsorption of polymers, the chemical coupling of small molecules, the chemical coupling of nucleic acids, the oxidization of surfaces, etc. PDMS surface functionalization has been described previously, and these methods can be used herein to functionalize surfaces of the devices provided herein (see, e.g., Zhou et al. (2010). Electrophoresis 31, pp. 2-16, incorporated by reference herein for all purposes). Surface functionalizations described herein, in one embodiment, selectively bind one type of effector cell (e.g., an effector cell present in a cell population), or selectively bind one type of readout particle. In another embodiment, the surface functionalization is used to sequester all readout particles present in a chamber.
[0443] In yet another embodiment, a surface functionalization or a plurality of different surface functionalizations are spatially defined within a chamber of a device. Alternatively, a surface functionalization or plurality of surface functionalizations covers the entire chamber. Both of these embodiments are useful for the distribution of effector cells are readout particles into distinct locations within a microfluidic chamber. For instance, in embodiments where the entire chamber is functionalized with a molecule that binds all types of introduced readout particles, the particles are directed to different regions of the device, using the methods described above, where they become immobilized on the surface. In another embodiment, the entire chamber may be functionalized to bind only one specific type of readout particle. In this case, all particles, in one embodiment, are first directed to one region using one of the methods described herein, causing a subset of particles to adhere to the chamber surface in the functionalized region, followed by exerting a force towards a different region that displaces only the particles that do not bind the functionalized surface or surfaces. In yet another embodiment, regions of the device (e.g., different chambers or regions within a single chamber) are functionalized with different molecules that selectively bind different subsets of effector cells and/or readout particles, such that inducing the interaction of the effector cells and/or readout particles with substantially the entire chamber surface results in the partitioning of different particle or cell types in different regions. As described herein, it is intended that surface functionalization may be used in isolation or in combination with the other methods described herein for effector cell and readout particle manipulation. Multiple combinations of particle and cell sequestration methods, together with multiple fluidic geometries are possible.
[0444] In another embodiment, effector cells and/or readout particles are positioned within a chamber by the use of a magnetic field. It will be understood that to manipulate and position an effector cell(s) and/or a readout cell(s) magnetically, the effector cell(s) and/or a readout cell(s) are first functionalized with or exposed to magnetic particles that bind to them. In one embodiment, the magnetic field is externally created, i.e., by the use of a magnet outside of the microfluidic device, using a permanent magnetic, an electromagnet, a solenoid coil, or of other means. In another embodiment, referring to
[0445] It will be appreciated by those skilled in the art that commercially available beads or nanoparticles that are used in the separation and or purification of biological samples can be used in the devices and methods provided herein. For example, Dynabeads (Life Technologies) are superparamagnetic, monosized and spherical polymer particles, and in one embodiment, are used in the devices and methods provided herein as readout particles. Magnetic particles conjugated with molecules that specifically bind different target epitopes or cell types are well-known in the art, and are also amenable for use with the devices and methods provided herein. When in the presence of a magnetic field having a non-uniform property, such magnetic particles are subjected to a force that is directed towards the gradient of the magnetic field. This gradient force, in one embodiment, is applied to position particles within a chamber.
[0446] Referring to the embodiment depicted in
[0447] In addition to flow forces, a cell or particle (e.g., effector particle or readout particle) in the flow may be subject to body forces that are derived from the action of an external field. The orientation of the microfluidic devices provided herein, within a gravitational field may be used to direct effector cells and readout particles to a specific region of a device chamber. As illustrated in
[0448] A person skilled in the art will understand that the use of gravity to direct particles within a chamber can be accomplished in multiple steps. Referring to
U=V.sub.particle*(.sub.particle.sub.liquid)*g*.sup.1
Where V.sub.particle defines the volume of the particle, g is the acceleration of gravity, and is the drag coefficient of the particle. For a spherical particle, is well approximated by the Stokes drag equation as:
.sub.sphere=6r
[0449] In some embodiments of the invention where gravity is used to position particles within a chamber, the effective size and/or density of the particles are manipulated by using smaller particles that bind on the particles surface. For example, the effector cell may be exposed to ferromagnetic microbeads that are functionalized to bind the effector cell, thereby causing the effector cell to have a much higher effective density and to have a slightly larger drag coefficient, the net effect of which is to make the cell fall faster through the gravitational field.
[0450] Also within the scope of the invention, and related to the use of gravity for the positioning of particles, is the use of buoyancy of the particles within the fluid in order to direct fluid flow and effector cell and readout particle positioning. Referring to
[0451] Effector cells and/or readout particles, in one embodiment, are partitioned to different regions of a chamber by the use of an electrostatic field and/or dielectric field that impart a force to the particles. These fields, in one embodiment, are generated externally to the device. In another embodiment, the electrostatic and/or dielectric field is generated locally using one or more micro-fabricated electrodes within the microfluidic device. Such electrodes can be defined in a metal film on the substrate the device is mounted on, integrated into a separate layer of the device, or defined by filling microfluidic channels with a conducting liquid. There are many examples of the integration of electrodes within microfluidic devices and various geometries and methods for integration will be apparent to those skilled in the art. For example, the electrodes disclosed by Li et al. (2006). Nano Letters 6, pp. 815-819, incorporated by reference herein in its entirety), are amenable for use with the present invention.
[0452] In one embodiment, a dielectric field is applied to one of the devices described herein, and the dielectric field is designed with a frequency that results in a differential force on particles having differential properties, which results in the separation of the particles by differential properties. An example of using dielectric fields to position effector cells and readout particles within a chamber using a dielectric field produced by an integrated electrode is shown in
[0453] In yet another embodiment, acoustic waves, such as acoustic standing waves, are used to trap, position and/or retain effector cells and/or readout particles.
[0454] In yet another embodiment, effector cells and/or readout particles are stochastically loaded into the effector and readout zones of a microfluidic chamber with high efficiency by appropriate design of the chamber geometry and the loading density. For example,
[0455] The number of effector cells and readout particles per chamber can be selected such that the probability of having a chamber without both a readout particle and an effector cell is very low. As an example, in one embodiment, the concentrations of effector cells and readout particles are chosen such that there is an average of three of each type per chamber. Assuming a random distribution of particles within the microwells the chance of having k particles of either type in a given microwell of a chamber is given by Poisson statistics as:
P(more than one in a microwell)=.sup.ke.sup./k!
where =the average number of particles per micro-well of the microfluidic chamber, which in this example is (3+3)/45=0.133. Thus, the probability of having 0 or 1 particles in a microwell in this embodiment is:
P(k=0)=e.sup.0.133=87.5%, and P(k=1)=11.7%.
[0456] Thus, in this embodiment, the chance of having more than one particle is given by P(k>1)=100%87.5%11.7%=0.83%. The chance of having zero micro-wells within a given chamber containing more than one particle may then be calculated according to binomial statistics as:
P(no wells with more than one particle)=(10.0083).sup.45=69%.
[0457] Thus, in this example approximately 70% of the chambers will have no microwell with more than one particle. It will be appreciated that this analysis represents a lower bound to the fraction of useful chambers since in chambers where some micro-wells have more that one particle in at least one micro-well a useful measurement will still be possible using the other chambers.
[0458] It is further considered that the micro-wells may be designed with a size such that they will not accommodate more than one particle. In this case the tipping of the device after loading may be used to ensure all particles are contained within a micro-well of the device and that no micro-wells have more than one particle. It is also understood that different types of particles, including different effector or readout particles, may be loaded in a sequential fashion or together depending on the design of the assay. Finally, it is understood that this geometry, while using microwells, maintains the advantages of chamber isolation since the array of micro-wells is contained within a small chamber that may have the capability for being isolated from other chambers.
[0459] As noted above, the one or more of the methods described above, in one embodiment, are combined are used to achieve segregation of a population of cells optionally comprising one or more effector cells from a population of readout particles, in an effector zone and readout zone of a microfluidic chamber, respectively. Additionally, one or more of the methods described above, in one embodiment, are used to achieve segregation of a cell subpopulation from an original cell population, or to segregate a subpopulation of readout particles from a population of readout zones, for example, in specific regions of an effector zone or readout zone of a microfluidic chamber.
[0460] Effector cells and readout particles, in one embodiment, are delivered to a chamber using a common inlet and segregated upon entry into the chamber. Alternatively, effector cells and readout particles are introduced to the chamber via separate inlets specific for the effector zone and readout zone. Referring to
[0461] In another embodiment, a compound chamber (i.e., a chamber comprising a plurality of subchambers) is used to provide an effector zone and readout zone. One embodiment of a compound chamber 300 is shown at
[0462] In one embodiment, adherence is used to separate effector cells from readout particles in some embodiments. For example, the skilled artisan is directed to the embodiment shown at
[0463] In the embodiment depicted in
[0464] Referring to the embodiment depicted in
[0465] Once a chamber is loaded with a cell population and a readout particle or readout particle population, and optionally additional reagent(s) for carrying out an assay on the cell population, the chamber, in one embodiment, is fluidically isolated from one or more remaining chambers of the microfluidic device. In one embodiment, isolation of the chamber is achieved by physically sealing it, e.g., using one or more valves to fluidically isolate the chamber from its surrounding environment. As will be understood by one of skill in the art, a valve as described herein is controlled via a control channel, and by applying sufficient pressure to the control channel, a particular valve can be actuated. In one embodiment, subsections (e.g., an effector zone and a readout zone) of a given chamber, or one subchamber of a compound chamber (i.e., a chamber comprising a plurality of subchambers or wells), are isolated from one another by physically sealing the subsections or subchambers, to fluidically isolate the subsections and/or subchambers, e.g., by using one or more valves.
[0466] In another embodiment, isolation of a chamber from its surrounding environment is achieved without physically sealing the chamber. Rather, isolation is achieved by limiting the fluid communication between chambers to preclude significant contamination between one chamber and another chamber of the microfluidic device. For example, instead of using a one or more valves, adjacent chambers are separated by the use of an immiscible fluid phase, such as an oil, to block chamber inlets and/or outlets. Alternatively, chambers are designed with inlets and outlets such that the diffusion of molecules in and out of chambers is sufficiently slow that it does not significantly impede the analysis of effect of secreted products within particular chambers.
[0467] Various chamber arrangements are described throughout.
[0468]
[0469] Importantly, the microfluidic devices of the invention are not limited to serially arranged chambers addressed in a flow-through mode where chambers are arranged in columns in which the outlet of one chamber connects to the inlet of an adjacent downstream chamber. Rather, a number of different chamber arrangements and filling modes are provided herein and encompassed by the invention. For example, in one embodiment, chambers are arranged in parallel such that multiple chambers are addressed simultaneously through the same feed channel. In a further embodiment, parallel chamber arrays are used in dead-end filling mode (i.e., where the chambers do not comprise an outlet).
[0470]
[0471] In some embodiments, for example, as illustrated in
[0472] Once the chamber 341 is filled, flow can still be directed into (
[0473] In a further embodiment, pressure of the feed channel 342 is then reduced, causing the chamber 341 to relax back to its original volume with the flow to be directed out of the chamber. Since the particles 345 (e.g., effector cells and/or readout particles), are at the bottom of the chamber 341, they are substantially removed from the flow and remain in the chamber when the pressure is reduced. Feed channel 342 pressure modulations may also be used to periodically add fresh medium to the chamber 341 in order to maintain the viability and growth of cells, whether effector cells or readout cells. In this embodiment, the chamber 341 is inflated with fresh medium which mixes with the medium already in the chamber by diffusion. Once mixed, a portion of the fluid inside the chamber 341 is removed and the process repeated as desired by the user. Importantly, by flushing the feed channel 342 with the chamber 341 closed to the feed channel between subsequent steps of medium addition (e.g., by actuation of valve 344), the contents of a chamber within an array do not contaminate other chambers in the chamber array.
[0474] This same approach of feed channel pressure modulations, in one embodiment, is used to add reagents to a chamber that are required or sufficient to observe and measure the effect of one or more effector cells on one or more readout particles within the chamber. For instance, and described in detail below, a cell population comprising one or more effector cells is assayed in one embodiment, for the ability of the one or more of the effector cells to neutralize a cytokine. In this case, a chamber may be first loaded with the cell population, for example a cell population comprising one or more effector cells that secrete antibodies. The antibodies are tested within the chamber for their ability to neutralize a cytokine. For example, in one embodiment, the cytokine neutralization effect is measured by providing readout particles to the chamber, whereby the readout particles comprise cells that are responsive to the cytokine, for instance by expression of a fluorescent protein. In one embodiment, individual chambers are first isolated and incubated to allow for the accumulation of a sufficient amount of the antibody. A volume of medium containing the cytokine is then added to the chambers by inflating them, thereby maintaining the antibodies in the chambers and not allowing for cross-contamination between chambers. The chambers, in a further embodiment, are then incubated with additional volume exchanges as required to determine if the chamber contains an effector cell that secretes an antibody that is capable of neutralizing the cytokine.
[0475] The above strategy may also be achieved without the use of mechanisms to modulate the volume of chambers. For example, a chamber, in one embodiment, is constructed to have two separate compartments (e.g., separate chambers, or subchambers or wells within an individual chamber) that are independently flushed with reagents, and which may also be isolated from other chambers on the device. The exchange of medium with fresh medium, or medium containing other components/reagents needed for a particular assay, in one embodiment, is implemented by isolating one compartment of a chamber, e.g., a reagent compartment, from the other compartment, where the other compartment contains the effector cells and readout particles, flushing the reagent compartment, and then reconnecting the compartments to allow for mixing by diffusion or by another means such as pumping between the two compartments.
[0476] As discussed herein, an effector zone and readout zone of a chamber, in one embodiment, are fluidically isolated from one another via one or more valves. This architecture can be further extended to chambers that are dead-end filled and in communication with each other. As illustrated in
[0477] As provided throughout, in one aspect, the present invention relates to a method of identifying a cell population comprising an effector cell having an extracellular effect and in another aspect, methods are provided for identifying a cell population having a variation in an extracellular effect. Once it is determined that the cell population demonstrates the extracellular effect, or a variation of an extracellular effect, the cell population or portion thereof is recovered to obtain a recovered cell population. Recovery, in one embodiment, comprises piercing the microfluidic chamber comprising the cell population comprising the one or more cells that exhibit the extracellular effect, with a microcapillary and aspirating the chamber's contents or a portion thereof to obtain a recovered aspirated cell population.
[0478] The recovered cell population(s), once recovered, in one embodiment, are subjected to further analysis, for example to identify a single effector cell or a subpopulation of effector cells from the recovered cell population that is responsible for the variation in the extracellular effect. The recovered cell population(s) can be analyzed in limiting dilution, as subpopulations for a second extracellular effect, which can be the same or different from the first extracellular effect. Cell subpopulations having the second extracellular effect can then be recovered for further analysis, for example for a third extracellular effect on a microfluidic device, or by a benchtop method, for example RT-PCR and/or next generation sequencing.
[0479] Various methods for the recovery of one or more cells from a specific chamber(s) are amenable for use herein.
[0480] The PDMS membrane design of the devices provided herein enables the selective recovery of cells from any chamber by piercing the upper membrane with a microcapillary. In one embodiment, cell recovery from a chamber is carried out based in part on the methods set forth by Lecault et al. (2011). Nature Methods 8, pp. 581-586, incorporated by reference herein in its entirety for all purposes. The membrane above a particular chamber is pierced with the microcapillary and cells are aspirated (
[0481] In one embodiment, once effector cells from identified chambers are recovered, they are reintroduced into the same device at a different region, at limiting dilution (e.g., either a single cell per chamber or smaller populations than the initial assay) to determine which effector cell(s) is responsible for the variation in the extracellular effect, i.e., by performing another extracellular assay on the recovered cells (see, e.g.,
[0482] In one embodiment, one or more cell population are recovered with a microcapillary by aspirating the contents of the chamber containing the cell population to provide a recovered aspirated cell population. In a further embodiment, recovered aspirated cell population is reinjected into a microfluidic device with the microcapillary, wherein the microcapillary pierces one wall of the microfluidic device. Pressure is then applied to the microcapillary to flow the recovered aspirated cell population into separate chambers of the microfluidic device, and the microcapillary is retracted to cause the wall of the microfluidic structure to substantially re-seal.
[0483] Recovery, in one embodiment is automated and using a robotic microcapillary instrument (
[0484] A microcapillary, as stated above in one embodiment, is used to recover one or more cell populations (or subpopulations, depending on whether a microfluidic enrichment has taken place) from a microfluidic chamber. and aspirating the chamber's contents or a portion thereof to obtain a recovered aspirated cell population. The cells in the one or more cell populations (or subpopulations) are substantially recovered by aspirating the chamber contents into the microcapillary, to provide a recovered aspirated cell population (or subpopulation). The microcapillary in one embodiment, has a diameter of from about 5 m to about 200 m. In a further embodiment, the microcapillary has a diameter of from about 5 m to about 200 m, or from about 5 m to about 150 m, or from about 5 m to about 100 m, or from about 5 m to about 75 m, or from about 5 m to about 50 m, or from about 50 m to about 200 m, or from about 100 m to about 200 m, or from about 150 m to about 200 m.
[0485] In some embodiments, the microcapillary has a beveled tip. In some embodiments, the microcapillary has an oval, square or circular cross section. Additionally, as shown in
[0486] In one embodiment, the microcapillary provided herein has a single barrel. However, the microcappilary in other embodiments has multiple barrels, for example a double barrel, a triple barrel, or more than three barrels.
[0487] A cell or cells can also be selectively recovered by using microfluidic valves to uniquely address the specified chamber and to direct flow to flush the single cell or multiple cells from the chamber to an outlet port for recovery. Cell adherence to the device substrate, in one embodiment, can be minimized by methods known to those of skill in the art, for example, purging or coating the microfluidic substrate with Trypsin. In another embodiment, a plurality of chambers comprising cells of interest are simultaneously recovered through a single port, e.g., via the use of addressable valve arrays to control fluid flow. In another embodiment, cells from chambers that are not of interest are first removed from the device, either by washing or lysis. The remaining contents of the device including the cells of interest are then recovered by flushing to a desired port.
[0488] In one embodiment, the contents of a chamber comprising an effector cell displaying a variation in an extracellular effect are recovered from the device by aspiration, for example, by using a microcapillary fabricated to have an appropriate size and shape. In some embodiments, the recovery method comprises piercing the top of the chamber comprising the cell(s) of interest with the microcapillary and aspirating the cell(s) of interest. In one embodiment, the membrane reseals or substantially reseals after piercing is complete. In another embodiment, recovery of the contents of a chamber comprising an effector cell displaying a variation in an extracellular effect (e.g., one or more ASCs) is performed by first cutting a wall of the chamber to create an access point and then extracting cells by aspiration using a microcapillary. In yet another embodiment, the microfluidic device used to assay the extracellular effect is fabricated such that the chambers are exposed by peeling away the material on one wall, thereby leaving an open micro-well array. Identified chambers (i.e., chamber(s) comprising an effector cell displaying a variation in an extracellular effect) are then aspirated from their respective chambers. In order to facilitate the precise extraction of microfluidic well contents, aspiration tools such as microcapillary tubes, in one embodiment, are mounted on a robotic micromanipulator, or a manual micromanipulator (
[0489] In some cases, it is desirable to extract a subset of cells from a given chamber. For instance, methods provided herein allow for the removal of cells from a specific region of a microfluidic chamber, for example, a readout zone or an effector zone. In one embodiment, the recovery method provided herein comprises aspiration of individual single cells in a serial manner.
[0490] Recovery of one or more cells from one or more microfluidic chambers, in one embodiment, comprises magnetic isolation/recovery. For example, in one embodiment, a microfluidic chamber is exposed to a magnetic particle (or plurality of magnetic particles) that adheres to the one or more cells within the chamber. Adherence can be either selective for a single cell, a subpopulation of the population of cells in the well(s), or non-selective, i.e., the magnet can adhere to all cells. In this case, instead of aspirating cells into a microcapillary, cells labeled with magnetic particles are drawn to a magnetic probe that creates a magnetic field gradient. The probe, in one embodiment, is designed to enable the magnetic field to be turned on and off, causing cells to adhere to it for removal and then be released during deposition. (EasySep Selection Kit, StemCell Technologies).
[0491] Single cells or a plurality of cells harvested from chambers, in one embodiment, are deposited into one or more receptacles for further analysis, for example, open micro-wells, micro-droplets, tubes, culture dishes, plates, petri dishes, enzyme-linked immunosorbent spot (ELISPOT) plates, a second microfluidic device, the same microfluidic device (in a different region), etc. The choice of receptacle is determined by one of skill in the art, and is based on the nature of the downstream analysis and/or storage.
[0492] In some embodiments, cell-derived products or intracellular materials are recovered from microfluidic chambers of interest, alternatively or in addition to the recovery of a single cell or plurality cells. For example, if a microfluidic chamber is identified as having a cell that demonstrates a variation in an extracellular effect, in one embodiment, the secretion products from the chamber are is recovered for downstream analysis (e.g., sequence analysis). In another embodiment, the cell or plurality of cells is lysed on the microfluidic device, e.g., within the chamber that the first assay is performed, and the lysate is recovered. In one embodiment, the lysate is subjected to further on chip processing, for example, to isolate protein, mRNA or DNA from the cell or plurality of cells. The RNA of the cell or plurality of cells within a single chamber, in one embodiment, is selectively recovered by using microfluidic valves to flush through a specified chamber using a reagent that causes the release of the RNA from the cells. This material is then collected at the outlet port. In another embodiment, the cells in all wells or a subset of wells are lysed using a lysis reagent, and then the contents of a given chamber or subset of chambers are recovered. In another embodiment, the cells within a chamber of interest or chambers of interest are lysed in the presence of beads that capture the RNA released from the cells followed by recovery of the beads, for example, by using the techniques described above for cell recovery. In this case the RNA may also be converted to cDNA using a reverse transcriptase enzyme prior to or subsequent recovery. One example of how to accomplish on chip mRNA isolation, cDNA synthesis and recovery can be found in Anal. Chem 78 (2006), pp. 3084-3089, the contents of which are incorporated by reference in their entirety for all purposes.
[0493] Following the recovery of cells or cell-derived materials from a chamber or chambers of interest, these materials or cells are analyzed to identify or characterize the isolate or the single cell or plurality of cells. As mentioned above, further analysis can be via a microfluidic assay (see, e.g.,
[0494] In one embodiment, one or more cell populations exhibiting the extracellular effect or variation in the extracellular effect are recovered to obtain one or more recovered cell populations. Once one or more individual cell populations are identified and recovered, the one or more individual cell populations are further analyzed to determine the cell or cells responsible for the observed extracellular effect. In one embodiment, the method comprises retaining a plurality of cell subpopulations originating from the one or more recovered cell populations in separate chambers of a microfluidic device. Each of the separate chambers comprises a readout particle population comprising one or more readout particles. The individual cell subpopulations are incubated with the readout particle population within the chambers. The individual cell subpopulations are assayed for a variation of a second extracellular effect, wherein the readout particle population or subpopulation thereof provides a readout of the second extracellular effect. The second extracellular effect is the same extracellular effect or a different extracellular effect as the extracellular effect measured on the recovered cell population. Based on the second extracellular effect assay, one or more individual cell subpopulations are identified that exhibit a variation in the second extracellular effect. The one or more individual cell subpopulations in one embodiment, are then recovered for further analysis. The second extracellular effect assay is one of the extracellular effect assays described herein.
[0495] One or more individual cell subpopulations are recovered, for example, with a microcapillary, as described in detail above. The microcapillary, in one embodiment, is used to reinject recovered cell subpopulations into the same microfluidic device, or a different microfluidic device, to further enrich for a population of cells displaying an extracellular effect. For example, a plurality of cell subpopulations originating from the recovered cell subpopulation, in one embodiment, are retained in separate chambers of a microfluidic device, wherein each of the separate chambers comprises a readout particle population comprising one or more readout particles. The cell subpopulations are incubated with the readout particle populations within the microfluidic chambers and the cell subpopulations are assayed for the presence of a third extracellular effect. The readout particle population or subpopulation thereof provides a readout of the third extracellular effect. Based on the results of the assaying step, it is determined whether one or more cells within one or more of the cell subpopulations exhibits the third extracellular effect. The one or more cell subpopulations can then be recovered as described herein.
[0496] In one embodiment, cells from a recovered cell population or recovered cell subpopulation or plurality of cell populations or subpopulations are retained in a plurality of vessels as cell subpopulations. The term cell sub-subpopulation is meant to refer to a subpopulation of an already recovered cell subpopulation. However, one of skill in the art will recognize that a cell subpopulation can be partitioned into further subpopulations, and the use of the term sub-subpopulation is not necessary to make this distinction. Each cell subpopulation is present in an individual vessel. The individual subpopulations or sub-subpopulations are lysed to provide and one or more nucleic acids within each lysed cell subpopulation or lysed cell sub-subpopulation are amplified. In a further embodiment, the one or more nucleic acids comprise an antibody gene.
[0497] Several approaches including microfluidic analysis may be used for this downstream analysis, depending on the nature of the cells, the number of cells in the original screen, and the intent of the analysis. In one embodiment, where a population effector cells is recovered from a chamber, or a plurality of populations are recovered from multiple chambers, each cell of the plurality is isolated into an individual vessel (e.g. individual microfluidic chamber) and analysis is performed on each effector cell individually. The individual cell analysis can be a microfluidic analysis (
[0498] In one embodiment, individual recovered effector cells are expanded in culture by distributing the plurality of cells at limiting dilution into a plurality of cell culture chambers in order to obtain clones from the recovered cells. For example, in an embodiment where a plurality of effector cells of a cell line engineered to express a library of antibodies are present in a chamber or chambers of interest, the cells from the chamber or chambers are subjected to limiting dilution in order to isolate single effector cells that were present in the chamber. The single effector cells are then used to obtain clonal populations of each respective effector cell. One or more of the clonal populations can then be analyzed to asses which effector cell produces the antibody of interest by measuring the properties of the antibodies secreted (e.g., by ELISA or a functional assay).
[0499] Alternatively or additionally, cells are recovered from a microfluidic chamber, isolated, e.g., by limiting dilution, and expanded to obtain sufficient material for the sequencing or amplification and purification of one or more genes of interest, e.g., a gene that encodes an antibody of interest. In yet another embodiment, cells are recovered from a microfluidic chamber, isolated, e.g., by limiting dilution, and used for single-cell DNA or mRNA amplification, e.g., by the polymerase chain reaction (PCR) or reverse transcriptase (RT)-PCR, followed by sequencing, to determine the sequence of one or more genes of interest. In even another embodiment, cells of interest are recovered from one or more microfluidic chambers, isolated, e.g., by limiting dilution, and subsequently used for single-cell DNA or mRNA amplification of the genes of interest, followed by the cloning of these genes into another cell type for subsequent expression and analysis.
[0500] In one embodiment, the recovered cell population(s) or subpopulation(s) may be isolated and used for an in vivo analysis, for example by injecting them into an animal, or exapanded in culture followed by subjecting the cells to one or more functional assays previously carried out on the microfluidic device.
[0501] In one embodiment, a cell population or subpopulation is recovered that displays a variation in an extracellular effect (e.g., after a first or second microfluidic extracellular effect assay) and one or more nucleic acids of the cells are subjected to amplification. Amplification, in one embodiment, is carried out by the polymerase chain reaction (PCR), 5-Rapid amplification of cDNA ends (RACE), in vitro transcription or whole transcriptome amplification (WTA). In a further embodiment, amplification is carried out by reverse transcription (RT)-PCR. RT-PCR can be on single cells, or a plurality of cells of the population. Although single cell RT-PCR is becoming common place as an analytical method, the amplification of antibody genes presents a nontrivial challenge due to multiple gene usage and variability. Two main approaches for recovery of antibody genes from single cells include RT-PCR using degenerate primers and 5 rapid amplification of cDNA ends (RACE) PCR. In one embodiment, the RT-PCR method is based on gene-specific template-switching RT, followed by semi-nested PCR and next-generation amplicon sequencing.
[0502] One embodiment of an RT-PCR method for use with identified effector cells having a variation in an extracellular effect is shown at
[0503] In some cases, a recovered cell population, following recovery from the microfluidic device, is not further isolated into single cells. For example, if the plurality of cells isolated from a chamber contain a cell that secretes an antibody of interest (e.g., present in a population of one or more additional cells that secrete other antibody(ies)), the plurality of cells, in one embodiment, is expanded in culture to generate clonal populations of the cells of the plurality, some of which make the desired product (i.e., the antibody of interest). In another embodiment, a plurality of cells isolated from a microfluidic well is lysed (either on the microfluidic device or subsequent to recovery), followed by amplification of the pooled nucleic acid population and analysis by sequencing. In this case, a bioinformatics analysis of the sequences obtained may be used to infer, possibly using information from other sources, which of the sequences is likely to encode for the protein of interest (for example, an antibody). Importantly, the analysis method afforded by the present invention is greatly simplified, as compared to bulk analysis of a large numbers of cells, due to the limited number of cells that are recovered. This limited number of cells provides a reduced complexity of the genomic information within the population of cells.
[0504] In one embodiment, the amplified DNA sequences of the plurality of cells are used to create libraries of sequences that are recombinantly expressed in an immortalized cell line, according to methods known to those of skill in the art. This cell line may then be analyzed, possibly by first isolating clones, to identify the genes of interest. In some instances these libraries are used to screen for combinations of genes that result in a protein complex of interest. For example, in one embodiment, genes expressed in cells of interest include both heavy and light chains of antibody genes in order to identify gene pairings that have the desired properties. The complexity of such analyses is greatly reduced by the fact that the number of cells analyzed in the original screen is small. For example, if there are 10 cells in the original screen there are only 100 possible antibody heavy and light chain pairings. By comparison, bulk samples typically have thousands of different antibody sequences, corresponding to millions of possible pairings.
[0505] In some instances, recovered cells may contain different cell types that can be isolated using methods known to those of skill in the art. For instance, if the microfluidic chamber comprises both antibody secreting cells and fibroblasts, used to maintain the antibody secreting cells, the antibody secreting cells in one embodiment, are separated from the fibroblasts after recovery using affinity capture methods.
EXAMPLES
[0506] The present invention is further illustrated by reference to the following Examples. However, it should be noted that these Examples, like the embodiments described above, are illustrative and are not to be construed as restricting the scope of the invention in any way.
Example 1Fabrication of Microfluidic Devices
[0507] Microfluidic devices were fabricated using the protocol described in Lecault et al. (2011). Nature Methods 8, pp. 581-586 or an adapted version of this protocol (e.g., modified baking times or curing protocols) to obtain multiple layers including, from the bottom glass slide to the top: a flow chambers, a control layer, a membrane, and bath layer (
Example 2Microfluidic Device for Cell Enrichment by Selection and Reinjection
[0508] The microfluidic device shown in
Example 3Microfluidic Device for Segregation of Effector and Readout Cells
[0509] A microfluidic device was designed to permit readout cells to be kept in separate, isolated chambers from effector cells and to allow the contents of these chambers to be mixed on demand when needed. This configuration is used to implement effector cell assays, for example, cytokine neutralization assays. The architecture is particularly useful to prevent an effector cell's secretion product (e.g., antibody) from being completely washed away when the chamber comprising the effector cell(s) is perfused with a fluid, for example, when provided with fresh culture medium to maintain viability over extended periods of time. This configuration is also amenable if it is useful to limit the time during which the effector cell(s) is exposed to the medium conditions required for the extracellular effect assay (e.g., when a toxic cytokine is used as an accessory particle).
[0510] As shown in
[0511] An example of how a cytokine neutralization functional assay which can be implemented with the device is shown in
Example 4Integration of Cell Fence Chambers
[0512] Devices having cell fences for capture of a single effector cell or a heterogeneous population of cells comprising one or more effector cells were fabricated as follows.
[0513] PDMS devices with cell fences were fabricated by molding from a reusable flow channel mold and reusable control channel. The flow channel mold comprised multiple layers of photoresist on a silicon wafer substrate. The bulk of the chambers in the devices utilized herein were defined by an SU-8 100 feature which sits directly on the Si wafer. Cell fences, when fabricated, were defined by a thinner SU-8 2010 feature which sat on top of the SU-8 100 feature. This is depicted schematically in
[0514] The majority of microfluidic chambers were fabricated using SU-8 100 negative photoresist (typically 160 m in height) following standard protocols, except that the final step, development, was omitted. The wafers were cooled after the post-exposure bake, and then SU-8 2010 was spun on top of the undeveloped SU-8 100, typically at a height 10-20 m. The thickness of the SU-8 2010 determined the height of the fence. The depth of each chamber was the combined height of both photoresist layers.
[0515] In alternative fabrication procedures, the SU-8 100 layer is fully developed, and then the wafer is coated with an additional layer of SU-8 100 which is higher than the first layer, the difference in height becoming the height of the fence.
[0516] The molds were then parylene coated (chemical vapor deposited poly(p-xylylene) polymers barrier) to reduce sticking of PDMS during molding, enhance mold durability and enable replication of small features that could not be produced with the aforementioned parylene coating.
[0517] A number of prototype devices were fabricated to determine feasible fence width-height combinations. A prototype flow layer mold was fabricated in order to determine dimensions which could successfully be fabricated. This mold consisted of multiple chambers with fences, with the width of the fences being varied across the same mold. Also, the height of the fence and of the chamber could be varied during fabrication (by adjusting spin speeds). The prototype molds contained only chambers for fabrication testing.
[0518] Two photolithographic masks were required, one to define the bulk of the chambers (SU-8 100) and the other to define the fences (SU-8 2010). However, one physical mask could be used, containing both sets of features.
[0519] A prototype fence chamber was fabricated where the full width W of the chamber and was fixed at 300 m. The typical width of chambers on most existing devices is 160 m. Initially, each half of these chambers was made a similar size to allow a separate inlet and outlet for each of the effector and readout zones. L is the length of the chamber. For each unique value of X, there were three chambers with L=160 m (length) and one more with L=2000 m. The chamber with extended length was included in order to allow the final PDMS mold to be easily cut perpendicular to the fence, so that the cross-section could be imaged.
[0520] Initially a single mold was fabricated, providing data on a single set of chamber and fence heights. Table 5 summarizes the dimensions of the prototype mold:
TABLE-US-00006 TABLE 5 Prototype mold dimension summary W (design value) 300 m L (design value) 160 / 2000 m SU-8 100 Height (measured) 160 5 m SU-8 2010 Height (measured) 17 1 m
[0521] Table 6 lists the fence widths which were on the mold and which ones were successfully fabricated:
TABLE-US-00007 TABLE 6 X (fence X (fence width) width) [m] [m] Successful Design Measured PDMS Value Values Fabrication? 5.0 can't measure No 7.5 can't measure No 10 18 2 No 12.5 21 2 No 15 25 2 No 17.5 29 2 Yes 20 31 2 Yes 25 37 2 Yes 30 42 2 Yes 35 48 2 Yes
[0522] The table above shows that the actual fence widths turned out larger than the design values.
[0523] Fabrication failures were not obvious until after PDMS molding. For the smaller fence widths, it was difficult to determine the quality of the photoresist mold by viewing it under the microscope. Fences failed because the PDMS making up the fences either stayed in the mold completely or partially ripped away from the bottom of the chambers. For example, a fence having a width of 15 m failed. The minimum width which could be fabricated using this particular design and the above described methods was 17.5 m.
[0524] It was observed during PDMS molding of the prototype devices that the fence often tore apart from the chamber bottom. This tearing appeared to begin at the 90 degree corner where the fence met the wall of the chamber. This 90 degree corner is a stress concentration. The design was modified to include 45 degree chambers in order to reduce these stress concentrations and thereby improve PMDS molding capability. This design change allowed the fence width to be reduced below the 17.5 m width, which was the largest size possible on the testing mold. The width of the fence was reduced to a design value of 10 m. The actual measured value, 12 m, was much closer to the design value than was achieved on the prototype mold.
[0525] Fences in this example run parallel to the flow. However, there is no inherent reason that fences cannot be fabricated to be perpendicular to the flow or diagonal relative to the flow. Similarly, chambers in this example are symmetric. However, the invention is not limited thereto.
[0526] Individual microfluidic chambers having a cell fence, an effector zone and a readout zone were loaded with a cell population and readout particles using a tilting method to direct the effector cells to the effector zone or the readout particles to the readout zone.
[0527]
Example 5Robust Microfluidic Growth of Antibody-Secreting Effector Cells
[0528] A plurality of recombinant Chinese Hamster Ovary (CHO) cells (effector cells) producing a human IgG antibody was loaded in the microfluidic device at a concentration of 2 M cells/mL. Secreted antibodies were captured on protein A-coated beads (average diameter: 4.9 m) during a 2 hour incubation followed by the addition of Dylight 594-conjugated F(ab).sub.2 fragment of rabbit anti-human IgG (H+L) and washing (
[0529]
Example 6Sensitivity of Single ASC Detection in the Presence of a Heterogeneous Population of ASCs
[0530] Mathematical modeling was used to determine the total efficiency of antibody capture on beads within a chamber having a volume of 4.1 nL (160 M160 M160 M) as a function of time and as a function of the number of beads. The average secretion rate for this line of CHO cells was measured on bulk samples to be approximately 300 proteins per second. This secretion rate is comparable to the expected secretion rate from primary antibody secreting cells which are estimated to secrete between 100 and 2000 antibodies per second. Thus, based on these measurements it was determined that the beads furthest away from the cell are expected to capture approximately 4000 antibodies during a two hour incubation, and is detected via fluorescence.
[0531] In the example shown in
[0532] The device chambers were then washed and beads functionalized with rabbit polyclonal anti-mouse IgG antibodies (readout particles) were loaded into the chambers. The chambers were then isolated and incubated, resulting in the capture of the antibodies generated by the cells in each chamber on the beads in that chamber. Referring to
[0533] In a different example, a population of HyHEL5 hybridoma cells secreting antibodies against hen-egg lysozyme (HEL) was loaded in the microfluidic device at limiting dilution. The device was imaged to determine the presence of HyHEL5 cells in each of the chambers. DMS-1 hybridoma cells secreting antibodies that do not bind HEL were subsequently loaded at an average concentration of approximately 5 cells per chamber in the same array. Cells were incubated in the presence of readout antibody-capture beads (Protein A beads coated with rabbit anti-mouse antibody) and the secretion of lysozyme-specific antibodies was measured by washing with a 1 nM solution of lysozyme labeled with Alexa-488. Bright field images obtained after loading HyHeL5 cells (top), bright field images taken after incubation with DMS-1 cells and beads (middle), and corresponding fluorescent images (bottom) are shown for three representative chambers containing DMS-1 cells only (
Example 7Selection of mAbs from Single Cells Using Bead- and Cell-Based Binding Assays
[0534] Single hybridoma effector cells (4B2) were loaded into individual chambers of a microfluidic device and binding of secreted antibodies (IgG against anti-human CD45) was measured using both a bead-based and cell-based readout binding assays. Readout cells in this experiment were K562 cells endogenously expressing the human CD45 membrane receptor and stained with carboxyfluorescein succinimidyl ester (CFSE) prior to fixation so as to distinguish them from the effector cells. Single effector cells were provided to individual chambers of the device and incubated with a plurality of readout K562 cells overnight. Next, the effector cells were incubated with readout Protein A beads for an additional 2 hours and then stained with a detection antibody (fluorescently labeled anti-mouse IgG), which binds the secreted IgG anti-human CD45 antibody. Fluorescence of individual chambers was then measured. A schematic of the experiment is provided in
[0535]
Example 8Cell-Based Immunization and Cell Binding Assays
[0536] Mice were immunized with fixed cells from a human ovarian cancer cell line (TOV21G) (
Example 9Maintenance of Cellular Viability and Secretion
[0537] Conditions were optimized for maintaining cellular viability and secretion of ASC effector cells for 5-8 days.
[0538] For immunization procedures, mice were subcutaneously injected with hen egg-white lysozyme and Alhydrogel adjuvant (Accurate Chemical & Scientific Corporation) 3 times at 2 week intervals. Humans were immunized with influenza vaccine 1 week prior to blood collection. Immunization procedures were performed in accordance with approved protocols by the University of British Columbia. Mouse spleen cells were isolated and stained with PE anti-mouse CD138 (BD Pharmingen) and sorted by FACS for CD138+ cell population (see Example 10 for a further description). Human peripheral blood mononuclear cells (PBMCs) were isolated and stained with markers as described in Wrammert et al. (2008), Nature Letters 453, pp. 667-671, the disclosure of which is incorporated by reference in its entirety for all purposes.
[0539] Enzyme-Linked-Immunospot (ELISPOT) assay was performed in polyvinylidene fluoride (PVDF) membrane-lined 96-well microplates (Millipore). The PVDF membrane was pre-wet with 70% ethanol and washed with PBS. Plates were coated overnight with goat anti-mouse IgG (H+L) (Jackson Immunoresearch) or rabbit anti-human IgG (H+L) (Jackson Immunoresearch antibody (1:1000/100 pt/well) and washed 3-4 times with PBS. Cells were then added and incubated for 20 h at 37 C. Cells were removed by washing 3-4 times with PBS containing 0.1% Tween (PBS-Tween), and plates were incubated with alkaline phosphatase-goat anti-mouse IgG (H+L) (Jackson Immunoresearch) (1:1000/100 uL/well). After washing 3-4 times with PBS-Tween, plates were incubated with BCIP/NBT chromogenic agent (Sigma-Aldrich B6404-100ML). Spots were counted with the aid of an upright microscope and CCD camera.
Example 10Methods for Enriching Plasma Cells
[0540] Antibody-secreting cells were enriched in species with known markers, specifically CD138 plasma cell marker in mice (
[0541] Antibody-secreting cells were also enriched from species lacking established markers for plasma cells by using the ER-Tracker (Life Technologies) in rabbits (
Example 11Enrichment Using Influenza Human Systems
[0542] Peripheral blood mononuclear cells (PBMCs) were isolated from the blood of a human patient 7 days following immunization with the influenza trivalent vaccine. Cells were enriched based on CD138 expression using a commercially available bead separation kit (Stem Cell Technologies) and loaded in a microfluidic device at an average density of 11 cells per chamber (i.e., heterogeneous cell populations comprised on average 11 cells) for a total of approximately 44,000 cells. Cells were incubated with Protein A beads for 2 hours, and with fluorescently labeled H1N1 and H3N2 in different colors. A total of 171 H1N1-positive chambers and 199 H3N2-positive chambers (e.g.,
Example 12Bead Aggregation as an Indicator of Antibody Secretion
[0543] Chambers of a microfluidic device were loaded with a mixture of cells secreting human antibodies and non-antibody secreting cells. Cells were incubated for 2 hours in the presence of protein-A beads and then stained using secondary labelled antibodies. The beads in chambers that contained antibody-secreting cells formed aggregates (
Example 13Affinity Measurements for HEL-Specific Hybridomas
[0544] A population of hybridoma effector cells (HyHEL5) producing an antibody with high affinity for hen-egg lysozyme (HEL) was first introduced in a microfluidic device at limiting dilution. A picture set was taken to identify chambers containing HyHEL 5 cells, and then a second population of hybridoma cells (D1.3) secreting an antibody with low affinity for HEL was loaded in the same device. A second picture set was taken and chambers containing either one HyHEL5 cell or one D1.3 cell were identified. Protein A beads coated with a rabbit anti-mouse antibody were introduced in the chambers and incubated with the cells for 2 hours. At the end of the incubation period, labeled antigen was introduced in the device at increasing concentrations between 100 fM and 10 nM in a step-wise fashion.
Example 14Identification of Antigen-Specific Cells with or without Chamber Isolation
[0545] Human plasma cells were enriched from PBMCs obtained from the blood of human patients one week after immunization with the trivalent influenza vaccine. Cells were introduced in two different microfluidic devices and incubated in the presence of Protein A beads (readout beads) for 2 hours. In one device (
Example 15Selection of Novel Mouse Antibody Secreting Cells Based on Affinity Measurements
[0546] Plasma cells were isolated from the bone marrow of a mouse immunized with hen-egg lysozyme. Approximately 23,800 cells were distributed across 3 sub-arrays containing 6,144 chambers in a microfluidic device (average density: 4 cells/chamber). Cells were incubated with Protein A beads coated with a rabbit anti-mouse capture antibody for 2 hours, washed with 10 nM of labeled hen-egg lysozyme and imaged. 117 antigen-specific chambers were identified, the contents of which were recovered with a microcapillary and reinjected at limiting dilution in a fourth sub-array containing 2,048 chambers. The reinjected cells were incubated with Protein A beads coated with a rabbit anti-mouse capture antibody for 2 hours, and then exposed to increasing concentrations of labeled antigen. Images were taken at each step and the bead fluorescence intensity was measured.
[0547] 117 chambers containing a total of 882 cells were identified as containing at least one antibody-secreting cell. The contents of all 117 chambers were recovered with a microcapillary, pooled and immediately re-injected into the remaining 2,048 empty chambers of the original device using the recovery robot shown in
[0548] The re-injected cells were immediately assayed again for the presence of one or more antibody secreting cells. 38 chambers were identified as containing at least one antibody-secreting cell (38/117=32%). Of these, 38 chambers, 19 contained single cells (16% of 117). The contents of all 38 chambers, along with 10 control chambers (5 no-cell and 5 non-secreting controls) were recovered for RT-PCR. The recovery process took a total of 2 hours and 15 minutes, or 170 seconds per chamber. In 43 of 48 samples (90%), all cells in the chambers were visually verified to have been recovered by the capillary. In 5 of 48 samples, at least one cell was seen to stick to the chamber bottom and was not recovered.
[0549] The following sequences were retrieved.
TABLE-US-00008 Mm20(IGHV1-9*01)IGHD2-4*01,IGHD2-4*01, IGHD2-9*02IGHJ2*01heavychainnucleic acidsequence(SEQIDNO:1): ATGGAATGGACCTGGGTCTTTCTCTTCCTCCTGTCAGTAACTGCAGGTGT CCACTCCCAGGTTCAGCTGCAGCAGTCTGGACCTGAGCTGATGAAGCCTG GGGCCTCAGTGAAGATATCCTGCAAGGCAACTGGCTACACATTCAGAAAC TACTGGATAGAGTGGATAAAGCAGAGGCCTGGACATGGCCTTGAGTGGAT TGGAGAGATTTTACCTGAAAGTGGTAGTATTAATTACAATGAGAAATTCA AGGGCAAGGCCACATTCACTGCAGATACATCCTCCAACACAGCCTACTTG CAACTCCGCAGCCTGACATCTGAGGACTCTGCCGTCTATTATTGTTTTTA TGATAATTACGTTTTTGACTACTGGGGCCAaggcacCACTctcAC Mm20lightchainaminoacidsequence (SEQIDNO:2): MEWTWVFLFLLSVTAGVHSQVQLQQ SGPELMKPGASVKISCKATGYTFRN YWIEWIKQRPGHGLEWIGEILPESG SINYNEKFKGKATFTADTSSNTAYL QLRSLTSEDSAVYYCFYDNYVFDYW GQGTTL Mm20(IGKV4-59*01)IGKJ5*01lightchainnucleic acidsequence(SEQIDNO:3): ATGGATTCTCAAGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCGGT CATACTATCCAGTGGACAAATTGTTCTCATCCAGTCTCCAACAATCATGT CTGCATCTCCAGGGGAGAAGGTCACCATGACCTGCAGTGCCAACTCAAGT TTCAGTTACATGCACTGGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAG ATGGATTTATGACACATCCAAACTGGCTTCTGGAGTCCCTGCTCGCTTCA GTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATTAGCAGCATGGAG GCTGAAGATGCTGCCACTTATTACTGTCAGCAGTGGAGTAGAAACCCCAC GTTCGGTGCtggacCaAGCtGa Mm20lightchainaminoacidsequence (SEQIDNO:4): MDSQVQIFSFLLISASVILSSGQIV LIQSPTIMSASPGEKVTMTCSANSS FSYMHWYQQKSGTSPKRWIYDTSKL ASGVPARFSGSGSGTSYSLTISSME AEDAATYYCQQWSRNPTFGAGTKL >Mm25(IGHV2-9-1*01)IGHD2-3*01IGHJ3*01 heavychainnucleicacidsequence (SEQIDNO:5): ATGCAAGCAGTGGTATCAACGCAGAGTACGGGGAAGGAGTCAGGACCTGG CTTGGTGGCGCCCTCACAGAGCATGTCCATCATGTGCACTGTCTCTGGGT TTTCATTAAGCAACTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAG GGTCTGGAGTGGCTGGGAGTAATTTGGGCTGGTGGAAACACAAATTATAA TTCGGCTCTCATGTCCAGACTGAGCATCAGCAAAGACAAGTCCAAGAGTC AAGTTTTCTTAAAAATGAACCGTCTGGAAACTGATGACACAGCCATGTAC TATCTGTGCCAGTGTAGGATGGTTACCCCTTGCTTACTGGGCCAAGG Mm25heavychainaminoacidsequence (SEQIDNO:6): MQAVVSTQSTGKESGPGLVAPSQSM SIMCTVSGFSLSNYGVHWVRQPPGK GLEWLGVIWAGGNTNYNSALMSRLS ISKDKSKSQVFLKMNRLETDDTAMY YLCQCRMVTPCLLGQ >Mm25(IGKV6-17*01)IGKJ4*01lightchain nucleicacidsequence(SEQIDNO:7): ATGGAGTCACAGATTCAGGTCTTTGTATTCGTGTTTCTCTGGTTGTCTGG TGTTGACGGAGACATTGTGATGACCCAGTCTCACAAATTCATGTCCACAT CAGTAGGAGACAGGGTCAGCATCACCTGCAAGGCCAGTCAGGATGTGAGT ATTTCTGTAGCCTGGTATCAACAGAAACCAGGACAATCTCCTAAACTACT GATTTACTCGGCATCCTACCGGTACACTGGAGTCCCTGATCGCTTCACTG GCAGTGGATCTGGGACGGATTTCACTTTCACCATCCGCAGTGTGCAGGCT GAAGACCTGGCAGTTTATTACTGTCAGCAACATTATAGTACTCCIITCAC GTCGGCTcggGaCAAagTG Mm25lightchainaminoacidsequence (SEQIDNO:8): MESQIQVFVFVFLWLSGVDGDIVMT QSHKFMSTSVGDRVSITCKASQDVS ISVAWYQQKPGQSPKLLIYSASYRY TGVPDRFTGSGSGTDFTFTIRSVQA EDLAVYYCQQHYSTPFTSARDKV
Example 16K.SUB.off .Values for HyHEL5 Hybridoma Cells
[0550] A mixture of HyHEL5 hybridoma (low K.sub.off) and a background of D1.3 hybridoma (high K.sub.off) cells were screened in a microfluidic device according to an embodiment of the invention. Chambers in which HyHEL5 hybridoma were present were detected by fluorescence intensity associated with Ab secretion (i.e., fluorescence accumulation on beads) before and antigen release (for K.sub.off measurements) following a wash step for each chamber.
Example 17Detection of Rare Circulating Antibody-Secreting Cells in Humans Against Specific Antigens
[0551] In one embodiment, the invention is used to screen for extremely rare cells, for instance antigen-specific plasma B cells that occur at basal level, i.e., without recent immunization or infection with the antigen.
[0552] This assay can also be performed to find more abundant cells, for instance after a natural infection or about one week post-immunization with an antigen.
Example 18Simultaneous Analysis of Extracellular and Intracellular Biomolecules
[0553] The analysis of extracellular and intracellular components was assessed in the context of a cell signaling readout assay. CHO cells engineered to overexpress the GPCR CXCR4 with beta-galactosidase fragment complementation (DiscoverX) were used to quantify the binding of the ligand CCL22 to the receptor. Activation of the receptor by the ligand caused intracellular beta-galactosidate complementation, which was then measured by lysing the cells in the presence of a beta-galactosidate substrate that yields a chemiluminescent signal. An example of this assay performed in multiwell plate is shown in
[0554] This assay can be used in conjunction with a cell binding assay (e.g., the experiment shown at
Example 19Antibody Screening and Sequence Recovery from Human Cells
[0555] Blood was collected 7 days after immunization from patients that had received the seasonal flu vaccine (
[0556] Referring to
[0557] Referring to
TABLE-US-00009 Hs7(IGHV4-39*01)IGHD3-3*02IGHJ3*02Heavy chainnucleicacidsequence(SEQIDNO:9): ATGAAGCACCTGTGGTTCTTCCTCCTGCTGGTGGCGGCTCCCAGATGGGT CCTGTCTCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGTCTT CGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGACTCCATCACCAGC AGTACTTACGACTGGGGCTGGATCCGTCAGCCCCCCGGGAAGGGCCTGGA GTGGATTGGCAATGTCTATTATAGAGGGAGCACCTACTACAACCCGTCCC TCAAGAGTCGAGTCACCATATCCGTAGACAGGTCCAGGACCCAGATCTCC CTGAGGCTGAGCTCTGTGACCGCCGCTGACACGGCTCTGTATTTCTGTGC GAGACACCCGAAACGTCTAACGGTTTTTGAAGTGGTCAACGCTTTTGATA TCTGGGGCCAAGGGACAATGGTCACCGTCTTTTCAGCCTCCACCAAGGGC CCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCAC AGCGGCCCTGGGCTGCCTGGTCTGCTGACGAGGCACTGAGGACTG Hs7Heavychainaminoacidsequence (SEQIDNO:10): MKHLWFFLLLVAAPRWVLSQVQLQE SGPGLVKSSETLSLTCTVSGDSITS STYDWGWIRQPPGKGLEWIGNVYYR GSTYYNPSLKSRVTISVDRSRTQIS LRLSSVTAADTALYFCARHPKRLTV FEVVNAFDIWGQGQTMVTVFSASTK GPSVFPLAPSSKSTSGGTA Hs7(IGLV2-14*01)IGLJ3*02Lightchain nucleicacidsequence(SEQIDNO:11): ATGGCCTGGGCTCTGCTACTCCTCACCCTCCTCACTCAGGGCACAGGGTC CTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGCATCTCCTG GACAGTCGATCACCATCTCCTGCACTGGAATCAGCAGTGACATTGGTGGT TATAGCTCTGTCTCCTGGTACCAAGCGCACCCAGGCAAAGCCCCCAAACT CATGATCTATGATGTCAATAATCGGCCCTCAGGCATTTCTAATCGCTTCT CTGGTTCCAAGTCTGGCAACACGGCCTCCCTGGCCATCTCTGGGCTCCAG gctgaGGACGAGGCAGATTATTACTGCAGCTTATATACAAGTATCAACGC TTCCATAGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCA AGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAA GCCAACAAGGCCACA Hs7Lightchainaminoacidsequence (SEQIDNO:12): MAWALLLLTLLTQGTGSWAQSALTQ PASVSASPGQSITISCTGISSDIGG YSSVSWYQAHPGKAPKLMIYDVNNR PSGISNRFSGSKSGNTASLAISGLQ AEDEADYYCSLYTSINASIVFGGGT KLTVLGQPKAAPSVTLFPPSS Hs15(IGHV4-39*01)IGHD3-3*01IGHJ3*02Heavy chainnucleicacidsequence(SEQIDNO:13): ATGAAGCACCTGTGGTTCTTCCTTCTGCTGGTGGCGGCTCCCAGATGGGT CCTGTCCCAGCTGCAACTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTT CGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGACTCCATCAGCAGT AGTACTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGAAAGGGGCTGGA GTGGATTGCCTTTATCTTTTATAGCGGGAGCACCTTCTACAACCCGTCCC TCAAGAGTCGAGTCACCGTCTCCGTAGACAGGTCCACGAACCAGTTCTCC CTGAGGCTGAAGTCTGTGACCGCCGCAGACACGTCCAGATATTACTGTGC GAGACACCCAAAACGTATCTCGATTTTTGAAGTGGTCAACGCTTTTGATA TCtGGGGCCAGGGGACAATGGTCACCGTCTCTTCAGCCTCCACCAAGGGC CCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCAC AGCGGCCCTGGGCTGCCTGGTCTGCTGACGAGGCACTGAGGACTG Hs15Heavychainaminoacidsequence (SEQIDNO:14): MKHLWFFLLLVAAPRWVLSQLQLQE SGPGLVKPSETLSLTCTVSGDSISS STYYWGWIRQPPGKGLEWIAFIFYS GSTFYNPSLKSRVTVSVDRSTNQFS LRLKSVTAADTSRYYCARHPKRISI FEVVNAFDIWGQGTMVTVSSASTKG PSVFPLAPSSKSTSGGTA >Hs15(IGLV2-14*01)IGLJ2*01IGLJ3*01Light chainnucleicacidsequence(SEQIDNO:15): ATGGCCTGGACTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAGGGTC CTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTG GACAGTCGATCACCATCACCTGCACTGGAATCAGCAGTGACGTTGGTGCT TATAATTCTGTCTCCTGGTACCAGCAGTACCCAGGCAAATCCCCCAAGCT CATGATTTATGATGTCAGTAATCGGTCCTCAGGGGTTTCTAATCGCTTCT CTGGCTCCAAGTCTGACAACACGGCCTCCCTGACCATCTCTGGGCTCCAG GCTGAGGACGAGGCTTCTTATTTCTGCAGCTTATATAGAAGCAGCACCAC TTCCGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTACGTCAGCCCA AGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAA GCCAACAAGGCCACA Hs15Lightchainnucleicacidsequence (SEQIDNO:16): MAWTLLFLTLLTQGTGSWAQSALTQ PASVSGSPGQSITITCTGISSDVGA YNSVSWYQQYPGKSPKLMIYDVSNR SSGVSNRFSGSKSDNTASLTISGLQ AEDEASYFCSLYRSSTTSVVFGGGT KLTVLRQPKAAPSVTLFPPSS
Example 20Antibody Screening and Sequence Recovery from a Heterogeneous Population of Rabbit Cells
[0558] Rabbits were immunized with the seasonal flu vaccine. Peripheral blood mononuclear cells (PBMCs) were recovered and either screened directly or sorted with flow cytometry to enrich for plasma cells. The cells were injected in the microfluidic device and assayed for H1N1 and H3N2 specificity. Protein A-coated beads used for fluorescence-based detection were also visible. Cells were incubated with beads for 2 hours, then fluorescently labeled antigen was introduced for 15 minutes and unbound antigen was washed away with media.
[0559]
TABLE-US-00010 Heavy1(SEQIDNO:17): GCTAGCCACCATGGAGACTGGGCTGCGCTGGCTTCTCCTGGTCGCTGTGC TCAAAGGTGTCCAGTGTCAGTCGGTGGAGGAGTCCGGGGGTCGCCTGGTC ACGCCTGGGACACCCCTGACACTCACCTGCATAGTCTCTGGAATCGACCT CAGTAGCTATGCAATGGGCTGGGTCCGCCAGGCTCCAGGAAAGGGGCTGG AATACATCGGAATCATTAGTAGCAGTGGTATCACATACTACGCGAGCTGG GCGAAAGGCCGATTCACCATCTCCAAAACCTCGTCGACCACGGTGACTCT GACAATCACCGATCTGCAACCTTCAGACACGGGCACCTATTTCTGTGCCA GAGGGTCTCGTTATAGTGCTTTTGGTGCTTTTGATACCTGGGGCCCAGGC ACCCTGGTCACCGTCTCCTCAGCAAGCTTNAN Heavy3(SEQIDNO:18): TTTGGCTAGCCACCATGGAGACTGGGCTGCGCTGGCTTCTCCTGGTCGCT GTGCTCAAAGGTGTCCAGTGTCAGTCGGTGGAGGAGTCCGGGGGTCGCCT GGTCACGCCTGGGACACCCCTGACACTCACCTGCACAGTCTCTGGATTCT CCCTCAGTAGCTATGCAATGGGCTGGGTCCGCCAGGCTCCAGGGAAGGGG CTGGAATGGATCGGAGTCATTAATAATAATGGTGACACATACTACGCGAG CTGGCCGAAAGGCCGATTCACCATCTCCAAAACCTCGACCACGGTGGATC TGAAAATCACCAGTCCGACAACCGAGGACACGGCCACCTATTTCTGTGCC AGAGATCGTGGTAATAGTTATTACTTTGGATTGGACTACTTTAACTTGTG GGGCCCAGGCACCCTGGTCACCGTCTCCTCAGCAAGCTTTATAN Light1(SEQIDNO:19): CTCTGCTGCTCTGGCTCCCAGGTGCCAGATGTGCCTTCGAATTGACCCAG ACTCCATCCTCCGTGGAGGCAGCTGTGGGAGGCACAGTCACCATCAAGTG CCAGGCCAGTCAGAGTATTAATAGTTGGTTATCCTGGTATCAGCAGAAAC CAGGGCAGCCTCCCAAGCTCCTGATCTACAAGGCATCCAATCTGGCATCT GGGGTCCCATCGCGGTTCAGAGGCAGTGGATCTGGGACAGAGTTCACTCT CACCATCAGCGACCTGGAGTGTGNCGATGCTGCCACTTACTACTGTCAAA GCNATTATGCTACTAGTAGTGTTGATTATNATGCTTTCGGCGGAAGGACC GAGGTGGTGGTCAANACTGCGGCNGTANTANTNNN Light3(SEQIDNO:20): TGCAGCTAGCCACCATGGACACGAGGGCCCCCATCAGCTGCTGGGGCTCC TGCTGCTCTGGCTCCCAGGTGCCAGGTGTGCCCTTGTGATGACCCAGACT CCAGCCTCTGTGGAGGTAGCTGTGGGAGGCACAGTCACCATCAAGTGCCA GGCCAGTCAGAGCATTGATAGTTGGTTATCCTGGTATCAGCAGAAACCAG GGCAGCGTCCCAGGCTCCTGATCTATTATGCATCCAATCTGGCATCTGGG GTCTCATCGCGGTTCAAAGGCAGTGGATCTGGGACAGAATACACTCTCAC CATCAGCGGCGTGGAGTGTGCCGATGCTGCCACTTACTACTGTCAAGAGG GTTATAGTAGTGGTAATGTTGATAATGTTTTCGGCGGAGGGACCGAGGTG GTGGTCAAAACTGCGNCCGCTATAN
Example 21Expression and Validation of Antibodies from Human Sequences
[0560] The expression of a human anti-MCP1 antibody was carried out in HEK293 cells using liposome-based transfection. Expressed antibody was precipitated from growth media on Protein A-coated beads and tested with fluorescently labeled MCP-1 antigen. The affinity of recombinant antibody was compared to the antibody of the same amino-acid sequence produced by the commercially available stable CHO cell line (ATCC PTA-5308.sup.M) (
[0561] Clone Hu-11K2-3f2-H2. Heavy and light chain variable sequences were synthesized and cloned into pFUSEss-CHIg-hG1 and pFUSE2-CLIg-hk expression vectors respectively.
TABLE-US-00011 aMCP1-Heavy(SEQIDNO:21): GAATTCCATGCAGGTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAAC CCGGCAGCAGCGTGAAGGTGTCCTGCAAGGCCAGCGGCCTGACCATCAGC GACACCTACATGCACTGGGTGCGCCAGGCTCCAGGCCAGGGACTGGAATG GATGGGCAGAATCGACCCCGCCAACGGCAACACCAAGTTCGACCCCAAGT TCCAGGGCAGAGTGACCATCACCGCCGACACCAGCACCTCCACCGCCTAC ATGGAACTGAGCAGCCTGCGGAGCGAGGACACCGCCGTGTACTATTGTGC CAGAGGCGTGTTCGGCTTCTTCGACTACTGGGGCCAGGGCACCACCGTGA CCGTGTCATCTGCTAGC aMCP1-Light(SEQIDNO:22): ACCGGTGCCACCATGTACCGGATGCAGCTGCTGAGCTGTATCGCCCTGTC TCTGGCCCTCGTGACGAATTCAGCCATGGACATCCAGATGACCCAGAGCC CCAGCAGCCTGTCTGCCAGCGTGGGCGACAGAGTGACCATCACATGCAAG GCCACCGAGGACATCTACAACCGGCTGGCCTGGTATCAGCAGAAGCCCGG CAAGGCCCCCAAGCTGCTGATTAGCGGAGCCACCAGCCTGGAAACCGGCG TGCCAAGCAGATTTTCCGGCAGCGGCTCCGGCAAGGACTACACCCTGACC ATCAGCTCCCTGCAGCCCGAGGACTTCGCCACCTACTACTGCCAGCAGTT TTGGAGCGCCCCCTACACCTTTGGCGGAGGCACCAAGGTGGAAATCAAGC GTACG
Example 22Mouse Sequence Recovery from Single Cells Followed by Cloning and Expression of Antibodies for Validation
[0562] D1.3 and HyHEL5 were loaded sequentially at limiting dilution in a microfluidic device. A picture set was taken after introducing each cell type in the device to record the position of D1.3 and HyHEL5 cells. Cells were incubated with Protein-A beads coated with rabbit anti-mouse capture antibodies and 10 nM of labeled hen-egg lysozyme for 2 hours. Single antibody-secreting cells were recovered with a microcapillary controlled by a robot, transferred into a tube for RT-PCR, and then the antibody sequences were recovered. Control chambers were recovered between each single cell as negative control.
TABLE-US-00012 D1.3-Heavy(SEQIDNO:23): ATGCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACA GAGCCTGTCCATCACATGCACCGTCTCAGGGTTCTCATTAACCGGCTATG GTGTAAACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGA ATGATTTGGGGTGATGGAAACACAGACTATAATTCAGCTCTCAAATCCAG ACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGA ACAGTCTGCACACTGATGACACAGCCAGGTACTACTGTGCCAGAGAGAGA GATTATAGGCTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTC AGCTAGC D1.3-Light(SEQIDNO:24): ATGGACATCCAGATGACTCAGTCTCCAGCCTCCCTTTCTGCGTCTGTGGG AGAAACTGTCACCATCACATGTCGAGCAAGTGGGAATATTCACAATTATT TAGCATGGTATCAGCAGAAACAGGGAAAATCTCCTCAGCTCCTGGTCTAT TATACAACAACCTTAGCAGATGGTGTGCCATCAAGGTTCAGTGGCAGTGG ATCAGGAACACAATATTCTCTCAAGATCAACAGCCTGCAGCCTGAAGATT TTGGGAGTTATTACTGTCAACATTTTTGGAGTACTCCTCGGACGTTCGGT GGAGGCACCAAGCTCGAG HyHEL5-Heavy(SEQIDNO:25): ATGGAGGTCCAGCTGCAGCAGTCTGGAGCTGAGCTGATGAAGCCAGGGGC CTCAGTGAAGATATCCTGCAAAGCTTCTGGCTACACATTCAGTGACTACT GGATAGAGTGGGTAAAGCAGAGGCCTGGACATGGCCTTGAGTGGATTGGA GAGATTTTACCTGGAAGTGGTAGCACTAATTACCATGAGAGATTCAAGGG CAAGGCCACATTCACTGCAGATACATCCTCCAGCACAGCCTACATGCAAC TCAACAGCCTGACATCTGAAGACTCTGGCGTCTATTACTGCCTCCATGGT AACTACGACTTTGACGGCTGGGGCCAAGGCACCACTCTCACAGTCTCCTC AGCTAGC HyHEL5-Light(SEQIDNO:26): ATGGATATCGTTCTCACACAGTCTCCAGCAATCATGTCTGCATCTCCAGG GGAGAAGGTCACCATGACCTGCAGTGCCAGTTCAAGTGTAAATTACATGT ACTGGTACCAGCAGAAGTCAGGCACTTCCCCCAAAAGATGGATTTATGAC ACATCCAAACTGGCTTCTGGAGTCCCTGTTCGCTTCAGTGGCAGTGGGTC TGGGACCTCTTACTCTCTCACAATCAGCAGCATGGAGACTGAAGATGCTG CCACTTATTACTGCCAACAGTGGGGTCGTAACCCCACGTTCGGAGGGGGG ACCAAGCTCGAG
Example 23Validation of Novel Mouse Antibody Sequences Obtained from Microfluidic Screening
[0563] Splenocytes were isolated from a mouse immunized with hen-egg lysozyme and screened for their antibody secretion in a microfluidic device. The sequence from the antigen-specific cell R05C14 was recovered, cloned and expressed in HEK293 cells. Antigen binding was confirmed by capturing the antibody on Protein A beads coated with rabbit anti-mouse antibody, incubating with 10 nM labeled hen-egg lysozyme and measuring the fluorescence intensity (
TABLE-US-00013 R05C14-Heavyvariable(SEQIDNO:27): TGGAAGGTGGTGCACACTGCTGGACAGGGATCCAGAGTTCCAGGTCACTG TCACTGGCTCAGGGAAATAGCCCTTGACCAGGCATCCCAGGGTCACCATG GAGTTAGTTTGGGCAGCAGATCCAGGGGCCAGTGGATAGACAGATGGGGG TGTCGTTTTGGCTGAGGAGACTGTGAGAGTGGTGCCTTGGCCCCAGCAGT CCCCGTCCCAGTTTGCACAGTAATATGTGGCTGTGTCCTCAGGAGTCACA GAAATCAACTGCAGGTAGCACTGGTTCTTGGATGTGTCTCGAGTGATAGA GATTCGACCTTTGAGAGATGGATTGTAGTAAGTGCTACCACTGTAGCTTA TGTACCCCATATACTCAAGTTTGTTCCCTGGGAATTTCCGGATCCAGCTC CAGTAATCATTGGTGATGGAGTCGCCAGTGACAGAACAGGTGAGGGACAG AGTCTGAGAAGGTTTCACGAGGCTAGGTCCAGACTCCTGCAGCTGCACCT CGAATTCCCA R05C14-Lightvariable(SEQIDNO:28): TTGGTCCCCCCTCCGAACGTGTACGGCCAGTTGTTACTCTGTTGACAGAA ATACATTCCAAAATCTTCAGTCTCCACACTGATGATACTGAGAGTGAAAT CCGTCCCTGATCCACTGCCACTGAACCTGGAGGGGATCCCAGAGATGGAC TGGGAAGCATACTTGATGAGAAGCCTTGGAGACTCATGTGATTTTTGTTG ATACCAGTGTAGGTTGTTGCTAATACTTTGGCTGGCCCTGCAGGAAAGAC TGACGCTATCTCCTGGAGTCACAGACAGGGTGTCTGGAGACTGAGTTAGC ACAATATCACCTCTGGAGGCTGAAATCCAGAAAAGCAAAAAA
Example 24Sequence Recovery for Amplification of Effector Cell Antibodies
[0564] The following protocol and primers was used to recover antibody sequences from mouse, humans or rabbits.
[0565] Reagents for reverse transcription (RT) and polymerase chain reaction (PCR) are provided in Table 7.
TABLE-US-00014 TABLE 7 Reverse transcription (RT) reaction PCR reaction RNAseIn 2 U/L PCR buffer 1 RNAse inhibitor Betaine 1M dNTPs 200 nM each First strand 1 MgCl.sub.2 1 mM RT buffer DTT 2.5 mM Enzyme (KOD) 0.008 U/uL MgCl 2.9 mM Universal 600 nM TS primer RT enzyme 1 U/L Universal 500 nM (M-MLV) RT primer Template 1.2 M Long gene- 100 nM Switching specific primer primers RT primers 40 nM each
[0566] The following RT-PCR thermal cycling protocol was followed:
[0567] RT: 3 min. at 72 C., 90 min. at 42 C., 10 min at 85 C.
[0568] Hot start: 2 min. at 95 C.; Denaturation: 15 sec. at 95 C.; Elongation: 15 sec. at 72 C.; Annealing: 15 sec. at the following temperatures: 72 C. 3 cycles; 70 C. 3 cycles; 68 C. 3 cycles; 66 C. 3 cycles; 64 C. 3 cycles; 62 C. 6 cycles; 60 C. 20-30 cycles.
[0569] The primers used in the RT-PCR experiments are provided in Table 8, as follows:
TABLE-US-00015 TABLE8 ListofPrimers Name Sequence SEQIDNO: Templateswitchingprimer GCAGTGGTATCAACGCAGAGTACG(r)G(r) SEQIDNO:29 G(r) UniversalprimerTS GCAGTGGTATCAACGCAGAGTACG SEQIDNO:30 UniversalprimerRT AGACAGTCCTCAGTGCCTCGTCAGCAG SEQIDNO:31 HumanRTprimerHsRT-01 gtcctgaggactg SEQIDNO:32 HumanRTprimerHsRT-02 tgctctgtgacac SEQIDNO:33 HumanRTprimerHsRT-03 ggtgtacaggtcc SEQIDNO:34 HumanRTprimerHsRT-04 cagagagcgtgag SEQIDNO:35 HumanRTprimerHsRT-05 tcatgtagtagctgtc SEQIDNO:36 HumanRTprimerHsRT-06 ctcaggactgatgg SEQIDNO:37 HumanRTprimerHsRT-07 gagtcctgagtactg SEQIDNO:38 HumanRTprimerHsRT-08 gttgttgctttgtttg SEQIDNO:39 HumanRTprimerHsRT-09 ttgttgctctgtttg SEQIDNO:40 Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGACCA SEQIDNO:41 HsN2U_01 GGCAGCCCAGGGC Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGCAGT SEQIDNO:42 HsN2U_02 GTGGCCTTGTTGGCTTGAAGCTCC Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGAGCA SEQIDNO:43 HsN2U_03 GGCACACAACAGAGGCAGTTCC Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGGCCC SEQIDNO:44 HsN2U_04 AGAGTCACGGAGGTGGCATTG Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGGCAT SEQIDNO:45 HsN2U_05 GCGACGACCACGTTCCCATCTTG Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGGCAG SEQIDNO:46 HsN2U_06 CCAACGGCCACGCTG Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGATGC SEQIDNO:47 HsN2U_07 CAGGACCACAGGGCTGTTATCCTTTG Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGAGTG SEQIDNO:48 HsN2U_08 TGGCCTTGTTGGCTTGGAGCTC Longgene-specificprimer AGACAGTCCTCAGTGCCTCGTCAGCAGACCA SEQIDNO:49 HsN2U_09 CGTTCCCATCTGGCTGGGTG RTmouseprimerMmRT_01 acagtcactgagct SEQIDNO:50 RTmouseprimerMmRT_02 ctttgacaaggcatc SEQIDNO:51 RTmouseprimerMmRT_03 ccacttgacattgatg SEQIDNO:52 RTmouseprimerMmRT_04 ctcttctccacagtg SEQIDNO:53 Longgene-specificmouse AGACAGTCCTCAGTGCCTCGTCAGCagactg SEQIDNO:54 primerMmn2_01 caggagagctgggaaggtgtg Longgene-specificmouse AGACAGTCCTCAGTGCCTCGTCAGCaggaca SEQIDNO:55 primerMmn2_02 gctgggaaggtgtgcacac Longgene-specificmouse AGACAGTCCTCAGTGCCTCGTCAGCtcaaga SEQIDNO:56 primerMmn2_03 agcacacgactgaggcacctcc Longgene-specificmouse AGACAGTCCTCAGTGCCTCGTCAGCttgcct SEQIDNO:57 primerMmn2_04 tccaggccactgtcacacc Longgene-specificmouse AGACAGTCCTCAGTGCCTCGTCAGCatccag SEQIDNO:58 primerMmn2_05 atgtgtcactgcagccagggac Longgene-specificmouse AGACAGTCCTCAGTGCCTCGTCAGCAccttc SEQIDNO:59 primerMmn2_06 cagtccactgtcaccacacctg RTrabbitprimerOcRT_01 TGAAGCTCTGGAC SEQIDNO:60 RTrabbitprimerOcRT_02 CACACTCAGAGGG SEQIDNO:61 RTrabbitprimerOcRT_03 TTCCAGCTCACAC SEQIDNO:62 RTrabbitprimerOcRT_04 AGGAAGCTGCTG SEQIDNO:63 RTrabbitprimerOcRT_05 ACACTGCTCAGC SEQIDNO:64 RTrabbitprimerOcRT_06 TCACATTCAGAGGG SEQIDNO:65 RTrabbitprimerOcRT_07 GTCTTGTCCACTTTG SEQIDNO:66 RTrabbitprimerOcRT_08 CTCTGTTGCTGTTG SEQIDNO:67 Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGgatcagg SEQIDNO:68 primerOc-PCR-IgHA1A7-12 cagccgacgacc Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGgtgggaa SEQIDNO:69 primerOc-PCR-IgKC1 gatgaggacagtaggtgc Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGagatggt SEQIDNO:70 primerOc-PCR-IgKC1KC2 gggaagaggaggacag Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGccttgtt SEQIDNO:71 primerOc-PCR-IgLC4L5L6 gtccttgagttcctcagagg Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGcggatca SEQIDNO:72 primerOc-PCR-IgA2A6 ggcagccgatgac Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGcaggtca SEQIDNO:73 primerOc-PCR-IgA4A5 gcgggaagatgatcg Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGcactgat SEQIDNO:74 primerOc-PCR-IgLC1C2C3 cagacacaccagggtgg Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGcaccgtg SEQIDNO:75 primerOc-PCR-IgG gagctgggtgtg Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGgatcagg SEQIDNO:76 primerOc-PCR-IgA3A5 cagccggcgatc Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGggagacg SEQIDNO:77 primerOc-PCR-IgM agcgggtacagagttg Longrabbitgene-specific AGACAGTCCTCAGTGCCTCGTCAGictgcag SEQIDNO:78 primerOc-PCR-IgE caggaggccaag
[0570]
Example 25NGS Sequencing of Single Cells Recovered from Device
[0571] A different approach to retrieve antibody sequences combines template-switching and next-generation sequencing. Referring to
[0572] Another approach to recover sequences from heterogeneous populations of cells couples microfluidic single cell antibody analysis with Ig-Seq (
Example 26Multiplexed Bead Assay Using Optically Encoded Beads
[0573] The multiplexed bead based assay in this example allows the measurement of several different antigen specific antibodies in the same chamber from antibody secreting cells. Fluorescence intensity coded beads (e.g., Starfire Red dye beads, Bangs laboratories) can be used to track different antigen specific antibodies by labeling each subset of beads with a different antigen using a traditional sulfo-NHS (N-hydroxysulfosuccinimide)/1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) protein coupling strategy (Pierce). Starfire Red (excitation from UV to red, emission max at 675 nm) and antigen specific fluorescence signal can then be measured and quantified.
[0574] Starfire Red dye beads (5.5 m diameter) containing 3 subsets of fluorescently coded beads were coated with different 2012-2013 seasonal flu specific antigens (
[0575] Beads were mixed in a 1:1:1 ratio and were injected in a microfluidic device (
Example 27Microfluidic Apoptosis Effector Assay
[0576] A functional extracellular effect assay was implemented to find antibodies and effector cells that produce such antibodies, that neutralize TNF- or that block its receptor. To quantify the effect of TNF- on target L929 cells (readout cells), the readout cells were stained with DiOC.sub.18 and incubated in the presence of 1 g/mL of actinomycin-D and different concentrations of TNF- in multiwell plates. After 24 hours, cells were counterstained with propidium iodide (PI) and cell viability was measured by counting the fraction of PI-stained cells from DiOC18-stained cells under a microscope. The dose response of TNF- on L929 cells is shown in
[0577] In a second experiment, L929 cells were stained with CFSE, loaded in a microfluidic device and incubated in the presence of 10 g/mL of actinomycin-D and 10 ng/mL of TNF- and tracked by time-lapse imaging. Cells underwent rapid apoptosis, which was confirmed by PI labeling at 24 hours (
Example 28Microfluidic Cell Signaling Effector Assay
[0578] A TNF functional assay based on nuclear or cytoplasmic fluorescence localization was developed for the function-based selection of antibodies against TNF. The readout cell line used was previously described in Tay et al. (2010). Nature 466, pp. 267-71, incorporated by reference herein in its entirety. Upon TNF-induced activation, a fluorescently-labeled NF-B transcription factor subunit is transported from the cytoplasm to the nucleus.
Example 29Microfluidic Proliferation and Autophagy Effector Cell Assay
[0579] A human breast cancer cell line (SKBR3) overexpressing HER2 and engineered with an LC3-GFP autophagy reporter was loaded in a microfluidic device and cultured for 3 days to determine the feasibility of using this cell line as readout cells. (
Example 30Detection and Recovery of Antigen Specific T Cells
[0580] Referring to
Example 31BAF3 PDGFR Assay for Signaling
[0581] A cell survival assay was generated for the function-based selection of antibodies against PDGFR. A BaF3 suspension cell line, dependent on the cytokine IL-3 for survival and growth, was electroporated with human PDGFR driven by a CMV promoter (Origene) and stably expressing clones were generated. The PDGFR overexpressed in Ba/F3 cells substitutes for the requirement of IL-3 signaling; in the absence of IL-3 BaF3 cells arrest and die, but in the presence of PDGF ligand PDGFR signaling rescues these cells, giving a cell survival and mitogenic response that is easily detected by microscopy, including proliferation, morphological changes, and increased motility/chemotaxis. As a fluorescence readout, BaF3 cells were also stably expressing histone 2B fused to a yellow fluorescent protein (YFP) to label cell nuclei.
[0582] To test whether antibody-secreting cells could be kept viable for the length of such an assay, mouse splenocytes were enriched for plasma cells and co-incubated with BaF3 cells overexpressing PDFGR in a microfluidic device. Bright field and fluorescent images were taken at the beginning of the experiment to distinguish the effector cell population from the readout cell population (containing H2B-YFP). Cells were cultured in the presence of IL-3 and tracked by time-lapse imaging for 48 hours, at which point anti-mouse antibody capture beads were introduced in the device for a 2-hour incubation. Chambers containing antibody-secreting cells were identified using a Dylight-594 labeled antibody.
Example 32GPCR Response to Ligand Using DiscoveRx Cells
[0583] In the PathHunter -Arrestin system from DiscoveRx (www.discoverx.com), a small peptide is fused to the intracellular sequence of a GPCR target of interest, and a complementing peptide fragment is fused to another intracellular protein (-arrestin). After binding to its specific ligand, the GPCR recruits 0-arrestin, forcing the complementation of the two peptides to produce a functional -galactosidase enzyme. In the conventional non-microfluidic assay, the enzyme activity, and thus the amount of ligand bound to the GPCR, is detected with a single addition of a reagent cocktail to lyse the cells and produce a chemiluminescent before being analyzed using a traditional plate reader.
[0584] This assay was modified to adapt it to the microfluidic format described herein by using a fluorescent based substrate. 5-Dodecanoylaminofluorescein Galactopyranoside (C.sub.12FDG) is a chemically modified and non-fluorescent -galactosidase substrate that becomes fluorescent after enzyme cleavage. It also includes a lipophilic tail that allows the substrate to diffuse inside the cell membrane and also promotes the retention inside the cells after cleavage.
[0585] The CCR4/CCL22 GPCR-agonist pair (PathHunter eXpress CCR4 CHO-K1 -Arrestin GPCR Assay) was used as an example to adapt the assay with the C12FDG substrate. Cells were incubated with various concentrations of substrate and ligand before being imaged using fluorescence.
[0586] The adapted assay was first tested in multiwell plates. Cells were incubated in media for 90 minutes with various concentrations of C.sub.12FDG substrate. The substrate diffused in the cells and remained non fluorescent until it was cleaved. Then, the ligand/agonist CCL22 was added at different concentrations and incubated for 60 minutes for the complementation to occur inside the cells, leading to the formation of -galactosidase and cleavage of the substrate, producing a fluorescent product inside the cells. Fluorescence-based microscopy was then used to image each well corresponding to a particular condition (
[0587] Cells were then loaded in a microfluidic device and incubated with 33 M C.sub.12FDG substrate in cell culture media. The substrate and the cells were incubated for 90 minutes in order to allow diffusion and accumulation of the non-fluorescent substrate inside the cells. Cells were washed with media for 10 minutes at the end of the incubation. CCL22 agonist/ligand was then loaded at 4 different concentrations in 4 different sub-arrays of the device (sub-array 1: 0.01 nM, sub-array 2: 1 nM, sub-array 3: 100 nM, sub array 4: no agonist). Fluorescence-based microscopy was then used to image each chamber corresponding to a particular condition (
[0588] All, documents, patents, patent applications, publications, product descriptions, and protocols which are cited throughout this application are incorporated herein by reference in their entireties for all purposes.
[0589] The embodiments illustrated and discussed in this specification are intended only to teach those skilled in the art the best way known to the inventors to make and use the invention. Modifications and variation of the above-described embodiments of the invention are possible without departing from the invention, as appreciated by those skilled in the art in light of the above teachings. It is therefore understood that, within the scope of the claims and their equivalents, the invention may be practiced otherwise than as specifically described.