CLICK BASED LIGATION

Abstract

The present invention relates to new methods and reagents for coupling molecules by a so-called click reaction in the presence of a suitable catalyst and a metal cation. Further, the invention relates to an activator composition for such click ligation reaction, a click ligation reagent kit, a device for performing such click ligation reaction, and the use of such method, composition, reagent kit and device to improve the efficiency of coupling of molecules via a click reaction, especially in the context of next generation nucleic acid sequencing methods.

Claims

1. A method for coupling a first molecule to a second molecule in a click ligation reaction, wherein the first molecule comprises a first click functional group which is an alkyne group, and the second molecule comprises a second click functional group, which is an azide group, the method comprising contacting the first and second molecules in a reaction mixture in the presence of a catalyst, characterized in that the click reaction is performed in the presence of additional metal cations in the reaction mixture.

2. A method according to claim 1, wherein as additional metal cations alkaline or earth alkaline metal cations, preferably Li.sup.+, K.sup.+, Mg.sup.2+, or Zn.sup.2+ are present in the click reaction mixture.

3. A method according to claim 1, wherein the metal cations are contained in the click reaction mixture in an amount of 1 to 200 mmol/l, preferably 5 to 25 mmol/l and most preferably 10 to 20 mmol/l.

4. A method according to anyone of claim 1, wherein the click reaction mixture comprises an organic solvent, preferably DMSO, and/or a Cu-stabilizing ligand, preferably selected from at least one of Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 2-(4-((bis((1-(tert-butyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)-1H-1,2,3-triazol-1-yl)acetic acid (BTTAA), Tris((1-benzyl-4-triazolyl)methyl)amine (TBTA), 2-(4-((bis((1-(tert-butyl)-1H-1,2,3,-triazol-4-yl)methyl)amino)methyl)-1H-1,2,3-triazolyl-1-yl) ethyl sulfate (BTTES) or analogs thereof, especially other trident polytriazoles.

5. A method according to claim 4, wherein the organic solvent is contained in the click reaction mixture in an amount of 2 to 10% (v/v), preferably 4 to 6% (v/v) and/or the Cu(I)-stabilizing ligand is contained in the click reaction mixture in an amount of 10 to 4000 mol/l, preferably 500 to 1000 mol/l.

6. A method according to anyone of claim 1, wherein the catalyst is a Cu catalyst, preferably a heterogeneous Cu catalyst.

7. A method according to anyone of claim 1, wherein at least one of the first and second molecules is a biomolecule, preferably selected from nucleosides, nucleotides, nucleic acids, amino acids, peptides, saccharides and lipids and wherein especially preferably both the first and the second molecules are oligonucleotides.

8. A method according to anyone of claim 1, wherein at least one of the first and second molecules carries a detectable label.

9. An activator composition for use in a click ligation reaction wherein a first molecule comprising a first click functional group, which is an alkyne group, and a second molecule comprising a second click functional group, which is an azide group, are coupled in the presence of a catalyst, preferably a heterogeneous Cu catalyst, said activator mixture comprising additional metal cations and further an organic solvent and/or a Cu-stabilizing ligand.

10. The activator composition according to claim 9, wherein the divalent metal cations are earth alkaline metal cations, preferably Mg.sup.2+, and/or the Cu-stabilizing ligand is selected from at least one of Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 2-(4-((bis((1-(tert-butyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)-1H-1,2,3-triazol-1-yl)acetic acid (BTTAA), Tris((1-benzyl-4-triazolyl)methyl)amine (TBTA), 2-(4-((bis((1-(tert-butyl)-1H-1,2,3,-triazol-4-yl)methyl)amino)methyl)-1H-1,2,3-triazolyl-1-yl) ethyl sulfate (BTTES) or analogs thereof, especially other trident polytriazoles, and/or the organic solvent is DMSO.

11. The activator composition according to claim 9, comprising the metal cation in an amount of 1 to 200 mmol/l, preferably 5 to 25 mmol/l, and/or the organic solvent in an amount of 2 to 10% (v/v), preferably 4 to 6% (v/v), and/or the Cu-stabilizing ligand in an amount of 10 to 4000 mol/l, preferably 500 to 1000 mol/l.

12. Click ligation reagent kit, comprising as one component a heterogenous Cu catalyst and as a second component an activator composition according to any one of claim 9.

13. Click ligation reagent kit according to claim 12, comprising one or more further components of a click reaction, preferably selected from the group consisting of a first molecule comprising a first Click functional group, which is an alkyne group, a second molecule comprising a second Click functional group, which is an azide group, buffers, solvents, enzymes, modified and/or non-modified nucleotides, (index) primer(s) and/or adapters optionally including a double-stranded loop at the 5 end, and optionally chromatographic materials.

14. A device having at least one reaction chamber comprising a heterogeneous Cu catalyst for a click ligation reaction for coupling a first molecule to a second molecule, wherein the first molecule comprises a first click functional group which is an alkyne group, and the second molecule comprises a second click functional group, which is an azide group, and optionally a further solid carrier material, wherein at least in one reaction chamber of the device metal cations or an activator composition according to claim 9 are present.

15. Use of the method according to claim 1, further including subsequent reactions selected from RNA or DNA amplification, RNA or DNA labelling methods and RNA or DNA sequencing methods.

Description

DESCRIPTION OF THE FIGURES

[0057] FIG. 1 shows the structure of some triazole backbone mimics generated by click chemistry (B-D) compared to the natural phosphodiester (A). Subsequent experimental examples in the context of PCR amplification are shown for the triazole backbone mimic (B) only;

[0058] FIG. 2a) shows a schematic ClickAdapt RNA library preparation which is one of the methods of interest in the present invention. It involves a combined cDNA synthesis, fragmentation and adapter click ligation. Second strand synthesis is obsolete since ssDNA can be efficiently click ligated;

[0059] FIG. 2b) shows the same ClickAdapt RNA library preparation as FIG. 2a) for which, however, a 1.sup.st adapter comprising a double-stranded loop at the 5 end is included.

[0060] FIG. 3 shows a schematic ClickAdapt DNA library preparation workflow which is a further method of interest in the present invention. A sample double-stranded (ds) DNA is fragmented and the fragments are manipulated by blunting and dA tailing like in a standard DNA library preparation. By using e.g. 3-azido-2,3-dideoxynucleotides instead of natural dNTPs, 3azide terminated dsDNA is obtained. After removal of excess nucleotides by fragment purification (including size selection), the first adapter is clicked to the fragment via its 5-alkyne group. The second adapter is introduced during PCR amplification via a short (about 12 bp) 3-sequence which is the reverse complement of the 5-end of the first adapter and acts as the first primer for amplification;

[0061] FIG. 4 shows the influence of various cations on the click reaction efficiency and yield;

[0062] FIG. 5 shows PCR products of cDNA produced from a 3-azide terminated cDNA and a 5-alkyne adapter using different DNA polymerases; and FIG. 6 shows the result of Sanger sequencing of the amplified click ligated product of FIG. 5;

[0063] FIG. 7 shows exemplary structures of azide and alkyne modified nucleotides for enzymatic incorporation and subsequent use in click ligation;

[0064] FIG. 8 shows structures of exemplary 5-ends of adapter oligonucleotides for click ligation (A-C). 5-alkyne modified oligonucleotide (with the base B=thymine of structure A) was used for the examples 1, 2 and 4 (in FIGS. 4, 5 and 9). Structure B was used in the subsequent examples 1 and 4 (in FIGS. 4 and 9).

[0065] FIG. 9 shows the oligo-oligo click reaction yield for a low oligo concentration.

[0066] FIG. 10 shows an ethidium bromide stained agarose gel (3% in TAE) of PCR samples with template from click library preparation of eGFP mRNA. The template cDNA was generated using different nucleotide mixtures (dNTP constant 500 M, various AzddNTP) during reverse transcription (rt). M=low molecular weight DNA marker (NEB), 1=dNTP only, 2=100 M AzddNTP, 3=50 M AzddNTP, 4=25 M AzddNTP, 5=10 M AzddNTP.

[0067] FIG. 11 shows an analytical HPL chromatogram of an oligo-dye CuAAC reaction using MgSO.sub.4 as an additive.

[0068] FIG. 12 shows an analytical HPLC result from an oligo-oligo click crude reaction mix at 260 nm detection. The peak at 5.6 min corresponds to the alkyne modified oligo, the peak at 7.6 min corresponds to the azide modified oligo. The two peaks that are new after the click reaction (6.1 and 6.4 min) have the correct mass of the click product. About 80% of the integrated peaks had the ESI-MS confirmed mass of the click product.

[0069] The following examples are provided for illustration purposes.

EXAMPLE 1

Preparation of Click Products

[0070] In a 200 L reaction vial a single reactor pellet (600-800 m, containing elemental copper) was combined with 12.5 L reaction mix and incubated at 45 C. for 60 min. The reaction mix consisted of 4 mM THPTA, 55 M of an alkyne oligol, 55 M of an azide oligo1 and, when cation influence was studied 16 mM monovalent cations (or 8 mM divalent cation). dH.sub.2O was used to adjust the volume to a final 12.5 L if necessary.

[0071] After the incubation the sample was briefly spinned down and the supernatant was transferred to a new vial to stop the reaction. Samples were analyzed on 2.5% agarose gels (1015 cm) prepared in TAE buffer (20 mM TRIS, 10 mM acetic acid, 0.5 mM EDTA).

[0072] Samples were prepared with 20% purple loading dye (NEB, New England BioLabs Inc.), and low molecular weight DNA ladder (25-766 bp, NEB, N3233) was prepared accordingly; usually 0.5 L marker were used in 5 L loading volume. Gels were run in TAE buffer applying constant power (10 W, max. 500 V, max. 100 mA) for 60 min. Then, gels were incubated in a freshly prepared 1:10000 ethidium bromide dilution for 15 min and then destained in dH.sub.2O for 15 min. For visualization a Gel Doc EZ Imager (Bio Rad) was used.

Oligonucleotides

[0073] Alkyne oligo1:

TABLE-US-00001 5-TAATGATACGGCGACCACCGAGATCTACACTCTTTC CCTACACGACGCTCTTCCGATCT-3 T=5-alkynedT

##STR00003##

[0074] Azide oligo1:

TABLE-US-00002 5-N.sub.3-TGGAGTTCGTGACCGCCGCCGGGATCACTCTCG GCATGGACGAGCTGTACAAGTAAAGC-3

##STR00004##

[0075] Due to the non-ideal click conditions used in this experiment (too much THPTA, not enough copper source), the influence of cation addition of (earth) alkaline metal addition becomes apparent. FIG. 4 shows the 2.5% gel of the oligonucleotide click reaction and the influence of different cations on the click efficiency and product yield. In the absence of an additional cation (slot 1) a yield of less than 5% of the click product was observed under the conditions described above. Through addition of Mg.sup.2+ ions (8 mM) the yield is improved to about 30%. As a comparison, a concentration of 16 mM of monovalent cations was also analyzed, however only a slight improvement of the yield was observed (slots 3-5, yields of 5 to 10%).

EXAMPLE 2

PCR Amplification of the Click Product

[0076] The feasibility of the ClickAdapt protocol is exemplified for a model RNA sequence. The RNA was hybridized to primer1 and then reverse transcribed in the presence of 200 M dTTP, dGTP, dCTP and 3-azido-ddATP using MuLV reverse transcriptase. Nucleotides and enzyme were removed by purification of the cDNA using the nucleotide removal kit (Qiagen) according to manufacturers' instructions.

[0077] Alkyne oligo1 was clicked to the purified cDNA in a 200 L reaction vial with a single reactor pellet (600-800 m, containing elemental copper) in a total 12.5 L reaction mix and incubated at 45 C. for 60 min.

[0078] The reaction mix consisted of 800 M THPTA, 20 mM MgCl.sub.2, 5% (v/v) DMSO, 7 M of alkyne oligol and about 4 M purified cDNA. dH.sub.2O was used to adjust the volume to a final 12.5 L if necessary.

[0079] After the incubation the sample was briefly spinned down and the supernatant was transferred to a new vial to stop the reaction. The crude click reaction was diluted 1:1000, 1:5000 and 1:10000 (max. 4 nM, 0.8 nM and 0.4 nM) for PCR amplification without further purification.

[0080] In a 200 L reaction vial, PCR amplifications were prepared in a total volume of 20 L. Click reaction dilutions were combined with 200 M dNTPs, 10 pmol of primer2 and primer3 and one unit polymerase. For the various polymerases, Pfu, Phusion, Q5, One Taq and Dream Taq buffers were used according to manufacturers' recommendations. The samples were subjected to a thermal cycling program in a thermocycler (BioRad).

[0081] As a standard cycling condition following conditions were used:

TABLE-US-00003 step temperature duration 1 95 C. 2 min 2 95 C. 15 s 3 51 C. 20 s {close oversize bracket} 25 x 4 72 C. 30 s 5 72 C. 2 min

[0082] For the Pfu polymerase different template dilutions and an alternative cycling condition were studied:

TABLE-US-00004 step temperature duration 1 95 C. 2 min 2 95 C. 15 s 3 52 C. 5 s {close oversize bracket} 25 x 4 72 C. 20 s 5 72 C. 2 min

[0083] After the incubation the sample was briefly spinned down and an aliquot was analyzed on 3% agarose gels (1015 cm) prepared in TAE buffer (20 mM TRIS, 10 mM acetic acid, 0.5 mM EDTA).

[0084] Samples were prepared with 20% purple loading dye (NEB), and low molecular weight DNA ladder (25-766 bp, NEB, N3233) was prepared accordingly; usually 0.5 L marker were used in 5 L loading volume. Gels were run in TAE buffer applying constant power (10 W, max. 500 V, max. 100 mA) for 60 min. Then, gels were incubated in a freshly prepared 1:10000 ethidium bromide dilution for 15 min and then destained in dH.sub.2O for 15 min. For visualization a Gel Doc EZ Imager (Bio Rad) was used.

[0085] FIG. 5A illustrates the ClickAdapt workflow (described above) which was done for the shown model RNA. The workflow involves reverse transcription of the RNA into cDNA. By replacing natural dATP by 3-AzddATP the cDNA is terminated with a 3-azide. After removal of excess nucleotides by purification of the cDNA, a 5-alkyne adapter is click ligated to the 3-azide and the crude reaction mix is used as template for PCR.

[0086] FIG. 5B is an ethidium bromide stained agarose gel of PCR samples treated according to the ClickAdapt workflow for the model RNA in 5A. Since the triazole-containing template is amplified by various polymerases under different conditions, this illustrates the biocompatibility of the unnatural backbone mimic.

Oligonucleotides

[0087] Alkyne oligo1 (see example 1)

TABLE-US-00005 ModelRNA: 5-UUCGACAAACGAAAACACAAACACAAACCAAACAGA AAACAGUACAUGUAAUCGACCA-3 Primer1(forreversetranscription) 5-FAM-TGGTCGATTACATGTAC-3;FAMfluorescein Primer2 5-TGGTCGATTACATGTACTGTTTT-3 Primer3 5-AGATCGGAAGAGCGTCG-3

[0088] Resulting cDNA after reverse transcription:

TABLE-US-00006 5-FAM-TGGTCGATTACATGTACTGTTTTCTGTTTGGTT TGTGTTTGTGTTTTCGTTTGTCGA-N.sub.3

[0089] Resulting click product:

TABLE-US-00007 5-FAM-TGGTCGATTACATGTACTGTTTTCTGTTTG GTTTGTGTTTGTGTTTTCGTTTGTCGATAATGATAC GGCGACCACCGAGATCTACACTCTTTCCCTACACGA CGCTCTTCCGATCT-3 AT=AandTjoinedviabackbonemimicB

[0090] Resulting PCR product:

TABLE-US-00008 5-TGGTCGATTACATGTACTGTTTTCTGTTTGGTT TGTGTTTGTGTTTTCGTTTGTCGATAATGATACGGC GACCACCGAGATCTACACTCTTTCCCTACACGACGC TCTTCCGATCT-3

EXAMPLE 3

Sequence Determination of the Amplification Product

[0091] The amplification product was analyzed by a process which determines the sequence of nucleobases in a nucleic acid. Adapter sequences that have been included allow for a hybridization of a complementary oligonucleotide, for immobilization, sequence determination or further amplification.

[0092] FIG. 6 shows the results of Sanger sequencing of one of the amplification products of example 2. It was determined that using the Phusion DNA polymerase, no mutations could be observed at or close by the position of the triazole backbone modification. The result indicates that the click reaction product can be successfully included in a PCR reaction to provide high amounts of PCR products in high efficiency and accuracy.

EXAMPLE 4

Low Concentration Click Ligation in the Presence and Absence of Reactor (Copper Source)

[0093] In a 200 L reaction vial two reactor pellets (600-800 m, containing elemental copper; sample 1) or no reactor pellets (sample 2) were combined with 12.5 L reaction mix and incubated at 45 C. for 60 min.

[0094] The reaction mix consisted of 800 M THPTA, 20 mM MgCl.sub.2, 7 M of alkyne oligol and 7 M of azide oligol in dH.sub.2O.

[0095] After the incubation the sample was briefly spinned down and the supernatant was transferred to a new vial to stop the reaction. Samples were analyzed on 3% agarose gels (1015 cm) prepared in TAE buffer (20 mM TRIS, 10 mM acetic acid, 0.5 mM EDTA).

[0096] Samples were prepared with 20% purple loading dye (NEB), and low molecular weight DNA ladder (25-766 bp, NEB, N3233) was prepared accordingly; usually 0.5 L marker were used in 5 L loading volume. Gels were run in TAE buffer applying constant power (10 W, max. 500 V, max. 100 mA) for 60 min. Then, gels were incubated in a freshly prepared 1:10000 ethidium bromide dilution for 15 min and then destained in dH.sub.2O for 15 min. For visualization a Gel Doc EZ Imager (Bio Rad) was used.

Oligonucleotides

[0097] Alkyne oligo1:

TABLE-US-00009 5-TAATGATACGGCGACCACCGAGATCTACACTCT TTCCCTACACGACGCTCTTCCGATCT-3 T=5'-alkynedT

##STR00005##

[0098] Azide oligo1:

TABLE-US-00010 5-N.sub.3-TGGAGTTCGTGACCGCCGCCGGGATCACTCTCG GCATGGACGAGCTGTACAAGTAAAGC-3

##STR00006##

[0099] The results of this example are shown in FIG. 9. A yield of 36% was obtained after 60 min using the click condition of this example when the reactor was present. When the reactor was omitted, no product was observed.

EXAMPLE 5

RNA Library Preparation Protocol Using IVT mRNA

[0100] Here we describe detailed experimental conditions of library preparation protocols which have been obtained during protocol development using purified in vitro transcribed (IVT) mRNA coding for the eGFP gene.

Reverse Transcription

[0101] In 200 L RNase free tubes 250 ng IVT mRNA was combined with 100 pmol partly randomized primer, 1 reaction buffer, 10 mM DTT (dithiothreitol), 500 M dNTP, 0-100 M AzddNTP and 200 units reverse transcriptase.

[0102] A) Primer Hybridization Pipetting Scheme:

TABLE-US-00011 Setup Component 1 2 3 4 5 H.sub.2O 7.35 L 6.95 L 6.55 L 5.35 L 6.35 L Illumina_N6 1 L 1 L 1 L 1 L 1 L primer (100 M) eGFP 0.65 L 0.65 L 0.65 L 0.65 L 0.65 L mRNA (382 ng/L) dNTP 1 L 1 L 1 L 1 L 1 L (10 mM) AzddNTP 1.0 L (2 mM) AzddNTP 0.4 L 0.8 L 2.0 L (500 M)

[0103] The components were mixed by gently pipetting and then heated in thermocycler to 65 C. for 3 min and then cooled to 4 C. For addition of the remaining components a master mix (for 6 setups) was prepared:

TABLE-US-00012 Component Volume H.sub.2O 18 L Reverse transcription buffer.sup.1 (5x) 24 L DTT.sup.1 (100 mM = 10x) 12 L Protoscript II reverse transcriptase.sup.1 (200 U/L) 6 L .sup.1= from NEB (product number M0368L)

[0104] To each hybridized setup (1-5) were added 10 L master mix at room temperature (23 C.) and after mixing by pipetting the reverse transcriptions were incubated in a thermocycler at 25 C. for 10 min, 42 C. (optimum temperature for protoscript II rt enzyme) for 50 min and 65 C. (denaturation) for 20 min. After cooling to 4 C., 5 L NaOH.sub.(aq) (1 M) was added to each setup and then incubated at 95 C. for 15 min, then 4 C. The mixtures were neutralized by addition of 5 L HCl(.sub.aq) (1 M) and then purified using the Qiagen PCR purification kit (addition of 150 L PB buffer, final elution step using 30 L H.sub.2O) according to manufacturer's recommendations.

NanoDrop Measurement

[0105]

TABLE-US-00013 total estimated Setup A.sub.260 [ng/L] comment volume cDNA amount 1 0.058 21.1 intense DNA spectrum 29 L 610 ng 2 0.054 19.6 intense DNA spectrum 28 L 540 ng 3 0.044 15.9 typical DNA spectrum 29 L 460 ng 4 0.033 11.1 typical DNA spectrum 29 L 320 ng 5 0.037 13.3 typical DNA spectrum 28 L 370 ng

[0106] An increased AzddNTP concentration during reverse transcription decreases cDNA yield. We assume that an increased AzddNTP amount decreases the fragment size and fragments<100 mer are removed during cDNA purification.

Click Ligation

[0107] In a 200 L reaction tube two reactor pellets were combined with 1.25 L of activator (200 mM MgCl.sub.2, 8 mM THPTA in 50% (v/v) aqueous DMSO) (10), 1 L of alkyne adapter oligo (100 M) and 10.25 L of purified cDNA for each setup (1-5). The mixture was incubated in a thermomixer at 45 C., 600 rpm for 60 min. Then each sample was briefly spinned down and the supernatant was transferred to a fresh vial.

PCR

[0108] In a 200 L reaction tube 20 L PCRs were prepared by combining 0.5 L click reaction, 10 pmol primer, 0.5 units Phusion DNA polymerase in Phusion buffer and 200 M dNTPs.

[0109] A master mix was prepared for 6 setups:

TABLE-US-00014 Component Volume H.sub.2O 75.6 L Phusion HF buffer.sup.3 (5x) 24 L P17-006_forw2 primer (10 M) 6 L P17-006_rev3 primer (10 M) 6 L dNTPs (10 mM) 2.4 L Phusion Polymerase.sup.3 (1 U/L) 3 L .sup.3= from THERMO FISHER SCIENTIFIC, product number F530L

[0110] The components were mixed by gently pipetting and 19.5 L master mix was added to 0.5 L of finished click reaction (without pellet!) and mixed. The resulting mixtures were incubated in a thermocycler applying following temperature program:

TABLE-US-00015 T [ C.] t [s] 98 30 98 10 52 10 {close oversize bracket} 30x 72 40 72 120

[0111] 5 L of each PCR sample were analyzed by agarose gel electrophoresis. Samples were loaded starting with dNTPs only (setup 1, lane 1) during initial reverse transcription, which provided a weak single band at 180 bp and the primers (around 35 bp). PCR samples from cDNA, which were generated from AzddNTP incorporation during reverse transcription resulted in a smear (lane 2-5, setup 5-2) from 100 bp (size cut-off of purification method) to 700 bp (lane 5). Fragment size distribution seemed to increase from lane 3-5, as the AzddNTP amount was decreased during reverse transcription from 50 M to 10 M (lane 3 to 5). The ethidium bromide stained agarose gel is shown in FIG. 10.

Oligonucleotides

[0112]

TABLE-US-00016 Oligonucleotide Sequence(5to3) Illumina_N6primer GTGACTGGAGTTCAGACGTGTGCTCTTCC (100M) GATCTNNNNNN alkyneadapteroligo TAATGATACGGCGACCACCGAGATCTACA CTCTTTCCCTACACGACGCTCTTCCGATC T P17-006_forw2primer GTGACTGGAGTTCAGACGTG (10M) P17-006_rev3primer GTCGTGTAGGGAAAGAGTGTA (10M) T =5-alkyne dT

##STR00007##

EXAMPLE 6

Oligo-Dye Click Reaction Using Metal Cations

[0113] In a 1500 L reaction vial four reactor pellets were combined with 27.9 L reaction mix and were incubated at 45 C. for 60 min.

[0114] The reaction mix consisted of 17.9 mM MgSO.sub.4, 71.7 M SP2-Oligo, 1.8 mM THPTA, 144 M Eterneon-Red 645 Azide in 2.9 L DMSO and 25 L H.sub.2O.

[0115] After the incubation the sample was briefly spinned down and the supernatant was transferred to a new vial. An aliquot of the sample was diluted in dH.sub.2O and then analyzed by analytical HPLC. Analytical RP-HPLC was performed on an analytical HPLC WATERS Alliance (e2695 Separation Module, 2998 Photodiode Array Detector) equipped with the column XBridge OST C18 (2.5 m, 4.650 mm) from WATERS. Using a flow of 1.5 mL/min and a column temperature of 40 C. following gradient was used for separation of click reactions: 0-30% B in 8 min, 85% B after 10 min, 100% B in 11 min. Buffer A: 0.1 M triethylammonium acetate in water, pH=7, buffer B: 0.1 M triethylammonium acetate in 80% (v/v) acetonitrile, pH=7. A detection range from 220-680 nm was used for the runs.

[0116] An alkyne-modified oligonucleotide was reacted with Eterneon Red 645 Azide using MgSO.sub.4 as an additive in addition to copper from the reactor pellet and the ligand. In the presence of MgSO.sub.4 a click product conversion yield of 85% was obtained for the crude reaction after 60 min incubation (FIG. 11).

EXAMPLE 7

HPL Chromatogram of an Oligo-Oligo Click

[0117] In a 200 L reaction vial one reactor pellet (600-800 m, containing elemental copper) was combined with 6.7 L reaction mix and incubated at 45 C. for 60 min. The reaction mix consisted of 800 M THPTA, 20 mM MgCl.sub.2, 455 M alkyne oligo biotin and 450 M azide oligo biotin in dH.sub.2O with 5% DMSO (v/v).

[0118] After the incubation the sample was briefly spinned down and the supernatant was transferred to a new vial. An aliquot of the sample was diluted in dH.sub.2O and then analyzed by analytical HPLC. Analytical RP-HPLC was performed on an analytical HPLC WATERS Alliance (e2695 Separation Module, 2998 Photodiode Array Detector) equipped with the column XBridge OST C18 (2.5 m, 4.650 mm) from WATERS. Using a flow of 1.5 mL/min and a column temperature of 40 C. following gradient was used for separation of click reactions: 0-30% B in 8 min, 85% B after 10 min, 100% B in 11 min. Buffer A: 0.1 M triethylammonium acetate in water, pH=7, buffer B: 0.1 M triethylammonium acetate in 80% (v/v) acetonitrile, pH=7. A detection range from 220-680 nm was used for the runs.

[0119] A reaction between a singly alkyne and singly azide modified oligonucleotide was studied by analytical HPLC, since the retention time of the alkyne-modified oligonucleotide (R.sub.t=5.62 min) was very different from the azide-modified oligonucleotide (R.sub.t=7.64 min). After 60 min at 45 C., almost the complete amount of azide-modified oligonucleotide was consumed. Two major new peaks were observed at 6.10 and 6.38 min, which had the mass of the desired click product in subsequent ESI-MS. Due to a slight excess of the alkyne-modified oligonucleotide, a distinct peak of the alkyne oligo was observed at the end of the reaction (5.618 min).

[0120] Peak table of the integrated peaks shown in FIG. 12.

TABLE-US-00017 Entry R.sub.t [min] Area Height % Area 1 5.618 337824 86604 13.25 2 5.790 102820 11520 4.03 3 6.102 627408 81837 24.60 4 6.379 1434201 262451 56.24 5 7.642 47989 9893 1.88

Oligonucleotides

[0121]

TABLE-US-00018 Oligo- nucleotide Sequence(5to3) Modification Alkyneoligo Biotin-TEG-GTTCTA X=C8-alkyne biotin GAACCCTAAGAAAAA dU TCTCXACCA Azideoligo Biotin-TEG-GTTCTA Y=PEG12 biotin GAACCCTAAGAAAAA azideamino TCTCYACCA dT

##STR00008##