GENOME EDITING USING CRISPR IN CORYNEBACTERIUM
20200362346 ยท 2020-11-19
Inventors
- Stephen BLASKOWSKI (Oakland, CA, US)
- Robert COATES (Oakland, CA, US)
- Kedar PATEL (Fremont, CA, US)
- Hendrik Marinus VAN ROSSUM (Oakland, CA, US)
- Shawn SZYJKA (Martinez, CA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
A CRISPR system is successfully used to modify the genomes of a gram-positive bacterium, such as a species of the Corynebacterium genus. Methods for modifying Corynebacterium species include single-nucleotide changes, creating gene deletions and/or insertions.
Claims
1. A method for genetically modifying a Corynebacterium host comprising transforming a Corynebacterium host with a first plasmid, wherein said Corynebacterium host has an RNA-guided DNA endonuclease integrated into its genome, wherein said RNA-guided DNA endonuclease is selected from the group consisting of Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12h, Cas13a, Cas13b, Cas13c, Cpf1, and MAD7, or homologs, orthologs, or paralogs thereof, and wherein said first plasmid comprises a first promoter operably linked to a sequence for expressing a first guide RNA, and a first donor polynucleotide having at least one mutation sequence flanked by a left homology arm sequence and a right homology arm sequence each homologous to a Corynebacterium target sequence; and expressing said first guide RNA in conjunction with said RNA-guided DNA endonuclease in said host.
2.-3. (canceled)
4. The method of claim 1, wherein the RNA-guided DNA endonuclease is Cas9.
5.-8. (canceled)
9. The method of claim 1, wherein said Corynebacterium host is Corynebacterium glutamicum.
10. The method of claim 9, wherein said Corynebacterium glutamicum is Corynebacterium glutamicum strain NRRL-B11474.
11. The method of claim 1, wherein the first plasmid comprises a replication origin selected from the group consisting of a pCASE1 replication origin and a pCG1 replication origin.
12. The method of claim 11, wherein the pCASE1 replication origin has the sequence shown in SEQ ID NO:1, or homologs, orthologs or paralogs thereof and the pCG1 replication origin has the sequence shown in SEQ ID NO:2, or homologs, orthologs, or paralogs thereof.
13.-17. (canceled)
18. The method of claim 1, wherein said first promoter is constitutive, inducible, differentially inducible, endogenous, heterologous, or synthetic.
19.-24. (canceled)
25. The method of claim 1 further comprising transforming said host with a second plasmid, wherein said second plasmid comprises one or more additional donor polynucleotide(s), said additional donor polynucleotide(s) each including at least one mutation sequence flanked by left and right homology arm sequences homologous to a Corynebacterium target sequence.
26. (canceled)
27. The method of claim 1, wherein said at least one mutation sequence comprises a mutation selected from the group consisting of: a. a single nucleotide insertion; b. an insertion of two or more nucleotides; c. an insertion of a nucleic acid sequence encoding one or more proteins; d. a single nucleotide deletion; e. a deletion of two or more nucleotides; f. a deletion of one or more coding sequences; g. a substitution of a single nucleotide; h. a substitution of two or more nucleotides; i. two or more non-contiguous insertions, deletions, and/or substitutions; and j. any combination thereof.
28.-29. (canceled)
30. The method of claim 27, wherein said at least one mutation sequence comprises a mutation of an RNA-guided DNA endonuclease protospacer-adjacent motif (PAM) or seed region.
31.-33. (canceled)
34. The method of claim 27, wherein said mutation is a single nucleotide insertion, deletion, or substitution, and wherein said homology arm sequences are between 25 base pairs and 125 base pairs; or an insertion, deletion, or substitution or two or more nucleotides, and wherein said homology arm sequences are between 125 base pairs and 2000 base pairs.
35. (canceled)
36. The method of claim 18, wherein said first promoter is Pcg2613.
37.-44. (canceled)
45. The method of claim 25, wherein the first plasmid further comprises a counterselection marker, and the method comprises selecting against the counterselection marker and thereby curing the Corynebacterium host of the first plasmid after genetically modifying the Corynebacterium host with the first guide RNA in conjunction with the RNA-guided DNA endonuclease in said host and before genetically modifying the Corynebacterium host with said second plasmid comprising one or more additional donor polynucleotides.
46.-48. (canceled)
49. The method of claim 1, wherein the method comprises expressing a set of proteins from a lambda red recombination system, a Rec ET recombination system, any homologs, orthologs or paralogs of proteins from a lambda red recombination system or a Rec ET recombination system, or any combination thereof.
50. A Corynebacterium host comprising: a first plasmid, wherein said first plasmid comprises a first promoter operably linked to a first guide RNA, and a first donor polynucleotide having at least one mutation sequence flanked by a right homology arm sequence and a left homology arm sequence, wherein each homology arm sequence is homologous to a target sequence in a Corynebacterium genome; and wherein said host has an RNA-guided DNA endonuclease integrated into its genome.
51.-52. (canceled)
53. The host of claim 50, wherein said Corynebacterium host is Corynebacterium glutamicum strain NRRL-B11474.
54. The host of claim 50, wherein the RNA-guided DNA endonuclease is selected from the group consisting of Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12h, Cas13a, Cas13b, Cas13c, Cpf1, and MAD7, or homologs, orthologs, or paralogs thereof.
55.-57. (canceled)
58. The host of claim 50, wherein the first plasmid comprises a replication origin selected from the group consisting of a pCASE1 replication origin and a pCG1 replication origin.
59.-67. (canceled)
68. The host of claim 50, wherein said at least one mutation sequence comprises a mutation of an RNA-guided DNA endonuclease protospacer-adjacent motif (PAM) or seed region.
69.-73. (canceled)
74. The host of claim 50, wherein said first promoter is Pcg2613.
75.-80. (canceled)
81. The host of claim 50, wherein the host comprises a set of proteins from a lambda red recombination system, a Rec ET recombination system, any homologs, orthologs or paralogs of proteins from a lambda red recombination system or a Rec ET recombination system, or any combination thereof.
82. A method for non-contiguous genome editing within one or more loci of a Corynebacterium host comprising transforming a Corynebacterium host with a plasmid, wherein said Corynebacterium host has an RNA-guided DNA endonuclease integrated into its genome, wherein said RNA-guided DNA endonuclease is selected from the group consisting of Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12h, Cas13a, Cas13b, Cas13c, Cpf1, and MAD7, or homologs, orthologs, or paralogs thereof, and wherein said plasmid comprises two or more guide RNAs and two or more donor polynucleotide sequences, wherein said guide RNAs are operably linked to one or more promoters, and wherein each of the two or more donor polynucleotide sequences has at least one mutation sequence flanked by a left homology arm sequence and a right homology arm sequence each homologous to a Corynebacterium target sequence; and expressing at least one of said two or more guide RNAs in conjunction with said RNA-guided DNA endonuclease in said host.
83. The method of claim 82, wherein the RNA-guided DNA endonuclease is Cas9.
84. The method of claim 82, wherein said Corynebacterium host is Corynebacterium glutamicum.
85. The method of claim 82, wherein said Corynebacterium glutamicum is Corynebacterium glutamicum strain NRRL-B11474.
86. The method of claim 82, wherein the first plasmid comprises a replication origin selected from the group consisting of a pCASE1 replication origin and a pCG1 replication origin.
87. The method of claim 82, wherein said one or more promoters is selected from the group consisting of constitutive, inducible, differentially inducible, endogenous, heterologous, and synthetic.
88. The method of claim 87, wherein said one or more promoters is inducible or differentially inducible, and wherein expression of said two or more guide RNAs are induced serially.
89. The method of claim 82, wherein the host comprises a set of proteins from a lambda red recombination system, a Rec ET recombination system, any homologs, orthologs or paralogs of proteins from a lambda red recombination system or a Rec ET recombination system, or any combination thereof.
90. A method for non-contiguous genome editing within one or more loci of a Corynebacterium host comprising transforming a Corynebacterium host with a first plasmid, wherein said Corynebacterium host has an RNA-guided DNA endonuclease integrated into its genome, wherein said RNA-guided DNA endonuclease is selected from the group consisting of Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12h, Cas13a, Cas13b, Cas13c, Cpf1, and MAD7, or homologs, orthologs, or paralogs thereof, and wherein said first plasmid comprises one or more donor polynucleotide sequences, wherein each of said one or more donor polynucleotide sequences has at least one mutation sequence flanked by a left homology arm sequence and a right homology arm sequence each homologous to a Corynebacterium target sequence; transforming said Corynebacterium host with a second plasmid, wherein said second plasmid comprises one or more guide RNAs, wherein said guide RNAs are operably linked to one or more promoters; and expressing at least one of said one or more guide RNAs in conjunction with said RNA-guided DNA endonuclease in said host.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0059] While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter.
[0060] The term a or an refers to one or more of that entity, i.e., can refer to a plural referents. As such, the terms a or an, one or more and at least one are used interchangeably herein. In addition, reference to an element by the indefinite article a or an does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there is one and only one of the elements.
[0061] Unless otherwise indicated, the term about refers to a variation in the indicated parameter of 10%.
[0062] The terms genetically modified host cell, recombinant host cell, and recombinant strain are used interchangeably herein and refer to host cells that have been genetically modified by the CRISPR-mediated methods of the present disclosure. Thus, the terms include a host Corynebacterium cell that has been genetically altered, modified, or engineered, such that it exhibits an altered, modified, or different genotype and/or phenotype (e.g., when the genetic modification affects coding nucleic acid sequences of the microorganism), as compared to the naturally-occurring microorganism from which it was derived. It is understood that the terms refer not only to the particular recombinant microorganism in question, but also to the progeny or potential progeny of such a microorganism.
[0063] The term genetically engineered may refer to any manipulation of a host Corynebacterium cell's genome (e.g., by insertion, deletion or substitution of nucleic acids).
[0064] The terms polynucleotide and nucleic acid are used interchangeably herein and refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. These terms refer to the primary structure of the molecule, and thus include double- and single-stranded DNA, as well as double- and single-stranded RNA. They also include modified nucleic acids such as methylated and/or capped nucleic acids, nucleic acids containing modified bases, backbone modifications, and the like.
[0065] As used herein, the term gene refers to any segment of DNA associated with a biological function. Thus, genes include, but are not limited to, coding sequences and/or the regulatory sequences required for their expression. Genes can also include non-expressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
[0066] As used herein, the term homologous or homolog or ortholog is known in the art and refers to related sequences that share a common ancestor or family member and are determined based on the degree of sequence identity. The terms substantially similar and corresponding substantially are used interchangeably herein. They refer to nucleic acid fragments wherein differences in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid fragments of the instant disclosure such as deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. It is therefore understood, as those skilled in the art will appreciate, that the disclosure encompasses more than the specific exemplary sequences. These terms homologous or homolog or ortholog or substantially similar or corresponding substantially can describe the relationship between a gene found in one species, subspecies, variety, cultivar or strain and the corresponding or equivalent gene in another species, subspecies, variety, cultivar or strain.
[0067] For purposes of this disclosure homologous sequences are compared. Homologous sequences or homologs or orthologs are thought, believed, or known to be functionally related. A functional relationship may be indicated in any one of a number of ways, including, but not limited to: (a) degree of sequence identity and/or (b) the same or similar biological function. Preferably, both (a) and (b) are indicated. Homology can be determined using software programs readily available in the art, such as NCBI BLAST (Basic Local Alignment Search Tool), using default parameters.
[0068] As used herein, the term nucleotide change refers to, e.g., nucleotide substitution, deletion, and/or insertion, as is well understood in the art. For example, mutations contain alterations that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded protein or how the proteins are made.
[0069] As used herein, the term protein modification refers to, e.g., amino acid substitution, amino acid modification, deletion, and/or insertion, as is well understood in the art.
[0070] As used herein, the term at least a portion or fragment of a nucleic acid or polypeptide means a portion having the minimal size characteristics of such sequences, or any larger fragment of the full length molecule, up to and including the full length molecule. A fragment of a polynucleotide of the disclosure may encode a biologically active portion of a genetic regulatory element. A biologically active portion of a genetic regulatory element can be prepared by isolating a portion of one of the polynucleotides of the disclosure that comprises the genetic regulatory element and assessing activity as described herein. Similarly, a portion of a polypeptide may be 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, and so on, going up to the full length polypeptide. The length of the portion to be used will depend on the particular application. A portion of a nucleic acid useful as a hybridization probe or targeting region of a guide RNA may be as short as 12 nucleotides; in some aspects, it is or is about 15, 20, or 25 nucleotides. A portion of a polypeptide useful as an epitope may be as short as 4 amino acids. A portion of a polypeptide that performs the function of the full-length polypeptide would generally be longer than 4 amino acids. In some cases, a portion of a polypeptide that performs the function of the full-length polypeptide contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids deleted from the N and/or C-terminus.
[0071] As used herein, promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. The promoter sequence may consist of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an enhancer is a DNA sequence that can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. Non-limiting promoter sequences suitable for use in the methods of the present specification are provided below at Table 1: Exemplary Promoters to drive guide RNA expression.
TABLE-US-00001 TABLE1 ExemplaryPromoterstodriveguideRNAorRNA- guidedendonuclease(e.g.,Cas9)expression SEQ ID Promoter SEQUENCE NO: Pcg2613 CGTCAAGATCACCCAAAACTGGTGG 4 CTGTTCTCTTTTAAGCGGGATAGCA TGGGTTCTT Pcg0007 TGCCGTTTCTCGCGTTGTGTGTGGT 5 ACTACGTGGGGACCTAAGCGTGTAA GATGGAAACGTCTGTATCGGATAAG TAGCGAGGAGTGTTCGTTAAAA Pcg0047 TAACTACATTGAGCGAAATGCCAAC 6 CACATGTCCCATGCTTTTACTAATG TGGGGTCTTAGAAGAAAGCGACCAA TTTAAGGAGAGTTGAAT Pcg1133 AGTGAACCCATACTTTTATATATGG 7 GTATCGGCGGTCTATGCTTGTGGG PTet1 TCCCTATCAGTGATAGAGATTGACA 8 TCCCTATCAGTGATAGAGATACTGA GCACATCAGCAGGACGCACTGACC PTet3 TCGTCAAGATCACCCAAAACTGGTG 9 GCTGTTCTCTTTTAAGCGGGATAGC ATGGGTTCTTATCCCTATCAGTGAT AGAGA PLac1 TTGACAATTAATCATCGGCTCGTAT 10 AATGTGTGGAATTGTGAGCGGATAA CAATTTCACACA PLac2 CTCGAGGGTAAATGTGAGCACTCAC 11 AATTCATTTTGCAAAAGTTGTTGAC TTTATCTACAAGGTGTGGCATAATG TGTGTAATTGTGAGCGGATAACAAT T PAra1 ACTTTTCATACTCCCGCCATTCAGA 12 GAAGAAACCAATTGTCCATATTGCA TCAGACATTGCCGTCACTGCGTCTT TTACTGGCTCTTCTCGCTAACCAAA CCGGTAACCCCGCTTATTAAAAGCA TTCTGTAACAAAGCGGGACCAAAGC CATGACAAAAACGCGTAACAAAAGT GTCTATAATCACGGCAGAAAAGTCC ACATTGATTATTTGCACGGCGTCAC ACTTTGCTATGCCATAGCATTTTTA TCCATAAGATTAGCGGATCCTACCT GACGCTTTTTATCGCAACTCTCTAC TGTTTCTCCATACCCGTTTTTTTGG GATTCGAGCTCTAAGGAGGTTATA AAAA PTrc GAGCTGTTGACAATTAATCATCCGG 13 CTCGTATAATGTGTGGAATTGTGAG CGGATAACAATTTCACACAGGAAAC AGCGCCGCTGAGAAAAAGCGAAGCG GCACTGCTCTTTAACAATTTATCAG ACAATCTGTGTGGGCACTCGACCGG AATTATCGATTAACTTTATTATTAA AAATTAAAGAGGTATATATTAATGT ATCGATTAAATAAGGAGGAATAAAC C
[0072] As used herein, the terms endogenous, and native refer to the naturally occurring copy of a gene or promoter.
[0073] As used herein, the term naturally occurring refers to a gene derived from a naturally occurring source. In some aspects a naturally occurring gene refers to a gene of a wild type (non-transgene) gene, whether located in its endogenous setting within the source organism, or if placed in a heterologous setting, when introduced in a different organism. Thus, for the purposes of this disclosure, a non-naturally occurring gene is a gene that has been mutated or otherwise modified, or synthesized, to have a different sequence from known natural genes. In some aspects, the modification may be at the protein level (e.g., amino acid substitutions). In other aspects, the modification may be at the DNA level, without any effect on protein sequence (e.g., codon optimization).
[0074] As used herein, the term heterologous refers to an amino acid or a nucleic acid sequence (e.g., gene or promoter), which is not naturally found in the particular organism or is not naturally found in a particular context (e.g., genomic or plasmid location) in the particular organism. For example, a native promoter or other nucleic acid sequence of C. glutamicum can be heterologous when operably linked to a nucleic acid sequence it is not operably linked to in a wild-type C. glutamicum, or when it is delivered in a non-native form such as in a heterologous plasmid or a heterologous nucleic acid fragment.
[0075] As used herein, the term exogenous is used interchangeably with the term heterologous, and refers to a substance coming from some source other than its native source. For example, the terms exogenous protein, or exogenous gene refer to a protein or gene from a non-native source or location, and that have been artificially supplied to a biological system. Artificially mutated variants of endogenous genes are considered exogenous for the purposes of this disclosure.
[0076] As used herein, the phrases recombinant construct, expression construct, chimeric construct, construct, and recombinant DNA construct are used interchangeably herein. A recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not found together in nature. For example, a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. Such construct may be used by itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. For example, a plasmid vector can be used.
[0077] The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the disclosure. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., (1985) EMBO J. 4:2411-2418; De Almeida et al., (1989) Mol. Gen. Genetics 218:78-86), and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by Southern blot analysis of DNA, Northern blot analysis of mRNA expression, immunoblotting analysis of protein expression, or phenotypic analysis, among others. Vectors can be plasmids, viruses, bacteriophages, pro-viruses, phagemids, transposons, artificial chromosomes, and the like, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that is not autonomously replicating. As used herein, the term expression refers to the production of a functional end-product e.g., an mRNA or a protein (precursor or mature).
[0078] The term operably linked means in this context the sequential arrangement of the promoter polynucleotide according to the disclosure with a further oligo- or polynucleotide, resulting in transcription of said further polynucleotide. In some aspects, the promoter sequences of the present disclosure are inserted just prior to a gene's 5UTR, or open reading frame. In other aspects, the operably linked promoter sequences and gene sequences of the present disclosure are separated by one or more linker nucleotides.
[0079] A cell has been genetically modified or transformed or transfected by exogenous DNA, e.g. a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that comprise a population of daughter cells containing the transforming DNA. A clone is a population of cells derived from a single cell or common ancestor by mitosis. A cell line is a clone of a primary cell that is capable of stable growth in vitro for many generations.
[0080] A target nucleic acid as used herein is a polynucleotide (e.g., RNA, DNA) that includes a target site or target sequence. The terms target site or target sequence are used interchangeably herein to refer to a nucleic acid sequence present in a target nucleic acid to which a targeting segment of a subject guide nucleic acid will bind, provided sufficient conditions for binding exist. Suitable hybridization conditions include physiological conditions normally present in a cell. For a double stranded target nucleic acid, the strand of the target nucleic acid that is complementary to and hybridizes with the guide nucleic acid is referred to as the complementary strand; while the strand of the target nucleic acid that is complementary to the complementary strand (and is therefore not complementary to the guide nucleic acid) is referred to as the noncomplementary strand or non-complementary strand. In embodiments where the target nucleic acid is a single stranded target nucleic acid (e.g., single stranded DNA (ssDNA), single stranded RNA (ssRNA)), the guide nucleic acid is complementary to and hybridizes with single stranded target nucleic acid.
[0081] A nucleic acid molecule that binds to an RNA-guided endonuclease (e.g., the Cas9 Polypeptide) and targets the polypeptide to a specific location within the target nucleic acid is referred to herein as a guide nucleic acid. When the guide nucleic acid is an RNA molecule, it can be referred to as a guide RNA or a gRNA. A guide nucleic acid comprises two segments, a first segment (referred to herein as a targeting segment); and a second segment (referred to herein as a protein-binding segment). By segment it is meant a segment/section/region of a molecule, e.g., a contiguous stretch of nucleotides in a nucleic acid molecule. A segment can also mean a region/section of a complex such that a segment may comprise regions of more than one molecule. For example, in some embodiments the protein-binding segment (described below) of a guide nucleic acid is one nucleic acid molecule (e.g., one RNA molecule) and the protein-binding segment therefore comprises a region of that one molecule. In other embodiments, the protein-binding segment (described below) of a guide nucleic acid comprises two separate molecules that are hybridized along a region of complementarity. As an illustrative, non-limiting example, a protein-binding segment of a guide nucleic acid that comprises two separate molecules can comprise (i) base pairs 40-75 of a first molecule (e.g., RNA molecule, DNA/RNA hybrid molecule) that is 100 base pairs in length; and (ii) base pairs 10-25 of a second molecule (e.g., RNA molecule) that is 50 base pairs in length. The definition of segment, unless otherwise specifically defined in a particular context, is not limited to a specific number of total base pairs, is not limited to any particular number of base pairs from a given nucleic acid molecule, is not limited to a particular number of separate molecules within a complex, and may include regions of nucleic acid molecules that are of any total length and may or may not include regions with complementarity to other molecules.
[0082] The first segment (targeting segment) of a guide nucleic acid (e.g., guide RNA or gRNA) comprises a nucleotide sequence that is complementary to a specific sequence (a target site) within a target nucleic acid (e.g., a target ssRNA, a target ssDNA, the complementary strand of a double stranded target DNA, etc.). The protein-binding segment (or protein-binding sequence) interacts with an RNA-guided endonuclease (e.g., Cas9) polypeptide. Site-specific binding and/or cleavage of the target nucleic acid can occur at locations determined by base-pairing complementarity between the guide nucleic acid (e.g., guide RNA) and the target nucleic acid.
[0083] The protein-binding segment of a subject guide nucleic acid comprises two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex (dsRNA duplex).
[0084] A subject guide nucleic acid (e.g., guide RNA) linked to a donor polynucleotide forms a complex with a subject RNA-guided endonuclease (e.g., Cas9) (i.e., binds via non-covalent interactions). The guide nucleic acid (e.g., guide RNA) provides target specificity to the complex by comprising a nucleotide sequence that is complementary to a sequence of a target nucleic acid. Thus, the RNA-guided endonuclease (e.g., Cas9) of the complex provides site-specific or targeted activity by virtue of its association with the protein-binding segment of the guide nucleic acid.
[0085] In some embodiments, a subject guide nucleic acid (e.g., guide RNA) comprises two separate nucleic acid molecules and is referred to herein as a dual guide nucleic acid. In some embodiments, the subject guide nucleic acid is a single nucleic acid molecule (single polynucleotide) and is referred to herein as a single guide nucleic acid. The term guide nucleic acid is inclusive, referring to both dual guide nucleic acids and to single guide nucleic acids and the term guide RNA is also inclusive, referring to both dual guide RNA (dgRNA) and single guide RNA (sgRNA).
[0086] In some embodiments, a guide nucleic acid is a DNA/RNA hybrid molecule. In such embodiments, the protein-binding segment of the guide nucleic acid is RNA and forms an RNA duplex. However, the targeting segment of a guide nucleic acid can be DNA. Thus, if a DNA/RNA hybrid guide nucleic acid is a dual guide nucleic acid, the targeting segment can be DNA and the duplex-forming segment can be RNA. In such embodiments, the duplex-forming segment of the activator molecule can be RNA (e.g., in order to form an RNA-duplex with the duplex-forming segment of the targeting segment), while nucleotides of the activator molecule that are outside of the duplex-forming segment can be DNA (in which case the activator molecule is a hybrid DNA/RNA molecule) or can be RNA (in which case the activator molecule is RNA). If a DNA/RNA hybrid guide nucleic acid is a single guide nucleic acid, then the targeting segment can be DNA, the duplex-forming segments (which make up the protein-binding segment) can be RNA, and nucleotides outside of the targeting and duplex-forming segments can be RNA or DNA.
[0087] An exemplary dual guide nucleic acid comprises a CRISPR-RNA (crRNA) molecule and a corresponding trans-activating crRNA (tracrRNA) molecule. The crRNA molecule comprises both the targeting segment (single stranded) of the guide nucleic acid and a stretch (duplex-forming segment) of nucleotides that forms one half of the dsRNA duplex of the protein-binding segment of the guide nucleic acid. The corresponding tracrRNA molecule comprises a stretch of nucleotides (duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the guide nucleic acid. In other words, a stretch of nucleotides of a crRNA molecule are complementary to and hybridize with a stretch of nucleotides of a tracrRNA molecule to form the dsRNA duplex of the protein-binding domain of the guide nucleic acid. The crRNA-like molecule additionally provides the single stranded targeting segment. Thus, the crRNA and the tracrRNA (as a corresponding pair) hybridize to form a dual guide nucleic acid. The exact sequence of a given crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecules are found.
[0088] The term protospacer refers to the DNA sequence targeted by a crRNA guide strand. In some aspects the protospacer sequence hybridizes with the crRNA guide sequence of a CRISPR complex.
[0089] The protospacer-adjacent motif or PAM sequence is a 2-6 base pair DNA sequence immediately following the DNA sequence targeted by an RNA-guided endonuclease (e.g., Cas9). The PAM sequences is required for cleavage of the target nucleic acid and varies depending on the source of the RNA-guided endonuclease (e.g., Cas9). For example, in case of the Streptococcus pyogenes Cas9 the PAM sequence is NGG. In aspects of the present disclosure, the PAM sequences is mutated by the donor polynucleotide such that further cleavage of the target site is prevented.
[0090] In some instances, a component, e.g., a nucleic acid component (e.g., a guide nucleic acid, etc.); a protein component (e.g., an RNA-guided endonuclease, a Cas9 polypeptide, a variant RNA-guided endonuclease, a variant Cas9 polypeptide); and the like) includes a label moiety. The terms label, detectable label, or label moiety as used herein refer to any moiety that provides for signal detection and may vary widely depending on the particular nature of the assay. Label moieties of interest include both directly detectable labels (e.g., a fluorescent label) and indirectly detectable labels (indirect labels, e.g., a binding pair member). A fluorescent label can be any fluorescent label, e.g., a fluorescent dye (e.g., fluorescein, Texas red, rhodamine, ALEXAFLUOR labels, and the like), a fluorescent protein (e.g., green fluorescent protein (GFP), enhanced GFP (EGFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), cyan fluorescent protein (CFP), mCherry, mTomato, mTangerine, and any fluorescent derivative thereof, etc.).
[0091] Suitable detectable (directly or indirectly) label moieties for use in the methods include any moiety that is detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, chemical, or other means. For example, suitable indirect labels include biotin (a binding pair member), which can be bound by streptavidin (which can itself be directly or indirectly labeled). Labels can also include: a radiolabel (a direct label) (e.g., 3H, 125I, 35S, 14C, or 32P); an enzyme (an indirect label) (e.g., peroxidase, alkaline phosphatase, galactosidase, luciferase, glucose oxidase, and the like); a fluorescent protein (a direct label) (e.g., green fluorescent protein, red fluorescent protein, yellow fluorescent protein, and any convenient derivatives thereof); a metal label (a direct label); a colorimetric label; a binding pair member; and the like. By binding pair member is meant one of a first and a second moiety, wherein the first and the second moiety have a specific binding affinity for each other. Suitable binding pairs include, but are not limited to: antigen/antibodies (for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X-anti-dansyl, fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer yellow, and rhodamine anti-rhodamine), biotin/avidin (or biotin/streptavidin) and calmodulin binding protein (CBP)/calmodulin. Any binding pair member can be suitable for use as an indirectly detectable label moiety.
[0092] Any given component, or combination of components can be unlabeled, or can be detectably labeled with a label moiety. In some embodiments, when two or more components are labeled, they can be labeled with label moieties that are distinguishable from one another.
[0093] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998); and Current Protocols in Molecular Biology (Ausubel et al. eds., John Wiley & Sons 2003), including supplements 1-117, the disclosures of which are incorporated herein by reference.
RNA-Guided Endonuclease Polypeptides
[0094] There are at least five main CRISPR system types (Type I, II, III, IV and V) and at least 16 distinct subtypes (Makarova, K. S., et al., Nat Rev Microbiol. 2015. Nat. Rev. Microbiol. 13, 722-736). CRISPR systems are also classified based on their effector proteins. Class 1 systems possess multi-subunit crRNA-effector complexes, whereas in class 2 systems all functions of the effector complex are carried out by a RNA-guided endonuclease (e.g., Cas9). As described in the Examples, the present disclosure advantageously employs Type II CRISPR RNA-guided endonucleases, such as Cas9 polypeptides, a variant thereof, and/or an ortholog thereof. Persons having skill in the art will appreciate that aspects of the disclosure are applicable to other CRISPR/Cas systems besides those comprising Cas9 (e.g., Cpf1). Therefore, a suitable RNA-guided DNA endonuclease may be selected from, for example, Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12h, Cas13a, Cas13b, Cas13c, Cpf1, and MAD7, or homologs, orthologs, or paralogs thereof.
[0095] Suitable RNA-guided endonuclease polypeptides (e.g., Cas9 polypeptides) for use in the subject invention include naturally-occurring RNA-guided endonuclease polypeptides, e.g., Cas9 polypeptides (e.g., naturally occurs in bacterial and/or archaeal cells), or variant Cas9 polypeptides as discussed below. In one preferred embodiment, the Cas9 polypeptide is from Streptococcus pyogenes. In a particularly preferred embodiment, the RNA-guided endonuclease polypeptides (e.g., Cas9 polypeptide) has been codon optimized for Streptomyces as described in Cobb et al. ACS Synth. Biol. 4, 723-728 (2015).
[0096] As detailed herein, naturally occurring RNA-guided endonuclease polypeptides (e.g., Cas9 polypeptides) bind a guide nucleic acid, are thereby directed to a specific sequence within a target nucleic acid (a target site), and cleave the target nucleic acid (e.g., cleave dsDNA to generate a double strand break, cleave ssDNA, cleave ssRNA, etc.). A suitable RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) will therefore comprise two portions, an RNA-binding portion and an activity portion. The RNA-binding portion interacts with a subject guide nucleic acid, and an activity portion exhibits site-directed enzymatic activity (e.g., nuclease activity, activity for DNA and/or RNA methylation, activity for DNA and/or RNA cleavage, activity for histone acetylation, activity for histone methylation, activity for RNA modification, activity for RNA-binding, activity for RNA splicing etc. In some embodiments the activity portion can exhibit reduced nuclease activity relative to the corresponding activity portion of a wild type RNA-guided endonuclease polypeptides (e.g., Cas9 polypeptide).
[0097] Assays to determine whether a protein has an RNA-binding portion that interacts with a subject guide nucleic acid can be any convenient binding assay that tests for binding between a protein and a nucleic acid. Exemplary binding assays include binding assays (e.g., gel shift assays) that involve adding a guide nucleic acid and a RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) to a target nucleic acid.
[0098] Assays to determine whether a protein has an activity portion (e.g., to determine if the polypeptide has nuclease activity that cleave a target nucleic acid) can be any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage. Exemplary cleavage assays include, but are not limited to, adding a guide nucleic acid and a RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) to a target nucleic acid and examining whether or not cleavage of the target nucleic acid has occurred via any suitable analytical technique, such as sequencing or PCR amplification.
[0099] RNA-guided endonuclease polypeptides (e.g., Cas9 polypeptides) suitable for use in the present invention include variant RNA-guided endonuclease polypeptides (e.g., Cas9 polypeptides). A variant RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) has an amino acid sequence that differs by at least one amino acid (e.g., has a deletion, insertion, or substitution) when compared to the amino acid sequence of a wild type RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide), resulting in a modification of nuclease activity.
[0100] In some embodiments, the variant RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) can cleave the complementary strand of a target nucleic acid but has reduced ability to cleave the non-complementary strand of a double stranded target nucleic acid. For example, the variant RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) can have a mutation (amino acid substitution) that reduces the function of the RuvC domain. As a non-limiting example, in some embodiments, a variant Cas9 polypeptide has a D10A mutation (e.g., aspartate to alanine at an amino acid position corresponding to position 10 of the Cas9 polypeptide encoded by the nucleic acid sequence of SEQ ID NO:3) and can therefore cleave the complementary strand of a double stranded target nucleic acid but has reduced ability to cleave the non-complementary strand of a double stranded target nucleic acid (thus resulting in a single strand break (SSB) instead of a double strand break (DSB) when the variant Cas9 polypeptide cleaves a double stranded target nucleic acid) (see, for example, Jinek et al., Science. 2012 Aug. 17; 337(6096):816-21).
[0101] In some embodiments, the variant RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) can cleave the non-complementary strand of a double stranded target nucleic acid but has reduced ability to cleave the complementary strand of the target nucleic acid. For example, the variant RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) can have a mutation (amino acid substitution) that reduces the function of the HNH domain. As a non-limiting example, in some embodiments, the variant Cas9 polypeptide can have an H840A mutation (e.g., histidine to alanine at an amino acid position corresponding to position 840 of Streptococcus pyogenes and can therefore cleave the non-complementary strand of the target nucleic acid but has reduced ability to cleave the complementary strand of the target nucleic acid (thus resulting in a SSB instead of a DSB when the variant Cas9 polypeptide cleaves a double stranded target nucleic acid).
[0102] In other embodiments, the RNA-guided endonuclease polypeptide (e.g., Cas9 peptide) of the present disclosure can include one or more of the mutations described in the literature, including but not limited to the functional mutations described in: Fonfara et al. Nucleic Acids Res. 2014 February; 42(4):2577-90; Nishimasu H. et al. Cell. 2014 Feb. 27; 156(5):935-49; Jinek M. et al. Science. 2012 337:816-21; Jinek M. et al. Science. 2014 Mar. 14; 343(6176); and Chen et al. Nature. 2017 Oct. 19; 550(7676):407-410; see also U.S. Pat. Pub. No. 2014/0068797; and 2016/0168592; see also PCT Pat. Pub. No. WO 2017/155717; WO 2017/147056; WO 2017/066175; WO 2017/040348; WO 2017/035416; WO 2017/015101; WO 2016/186953; and WO 2016/186745; further, see U.S. Pat. Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233; 8,999,641; 9,840,713; 9,840,699; and 9,771,600. Each of the foregoing patents and publications are hereby incorporated by reference in the entirety for all purposes, which purposes include but are not limited to methods and compositions for targeting, cleaving, editing, modifying, or modulating expression of one or more nucleic acids with an RNA-guided nuclease, guide RNA, CRISPR associated protein, donor nucleic acid, and/or component of a CRISPR system.
[0103] Thus, in some embodiments, the systems and methods disclosed herein can be used with the wild type RNA-guided endonuclease polypeptides (e.g., Cas9 polypeptide) having double-stranded nuclease activity, RNA-guided endonuclease polypeptides (e.g., Cas9 variants) that act as single-stranded nickases, or other mutants with modified nuclease activity. As such, a RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) that is suitable for use in the subject invention can be an enzymatically active RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide), e.g., can make single- or double-stranded breaks in a target nucleic acid, or alternatively can have reduced enzymatic activity compared to a wild-type RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide).
[0104] The RNA-guided endonuclease polypeptide (e.g., Cas9 polypeptide) can be provided to, or in, a cell in a variety of suitable formats. In some embodiments, the RNA-guided endonuclease is encoded by a plasmid. The plasmid can be replication-competent or replication-incompetent, and is preferably replication-competent. The plasmid can be the same plasmid or a different plasmid than a plasmid encoding a guide RNA and/or a plasmid encoding a donor polynucleotide. In some cases, the RNA-guided endonuclease is encoded by a first plasmid and the guide RNA is encoded by a second plasmid. In some cases, a donor fragment is encoded by the first plasmid. In some cases, a donor fragment is encoded by the second plasmid. In some cases, the donor fragment is encoded by a third plasmid.
[0105] Plasmids of the invention can comprise a C. glutamicum and/or E. coli compatible origin of replication. In some cases, the plasmid comprises a CG1 or CASE1 origin. In some cases, the plasmid comprises a colE1, p15a, or R6k origin. In some cases, the plasmid comprises an origin selected from CG1 and CASE1 and an origin selected from colE1, p15a, and R6k.
[0106] As described herein, in some cases one or more of donor fragment, RNA-guided endonuclease, and/or guide RNA is encoded in a linear or circular, non-plasmid, nucleic acid fragment. The one or more fragments can be integrated into the genome. Thus, in some embodiments, the RNA-guided endonuclease can be encoded in a nucleic acid fragment that is integrated into the genome of the cell to be edited. In some cases, the plasmid or integrated fragment further contains a sequence for negative selection (e.g., mazF, ccdB, gata-1, lacY, thyA, pheS, tetAR, rpsL, sacB, a temperature sensitive replication origin and the like) and/or flanking recombination sequences such as FLPs, loxP sequences, or the like, that can be activated at a later time for removal of the RNA-guided endonuclease encoding sequence.
[0107] The nucleic acid (e.g., linear or circular fragment or plasmid) encoding the RNA-guided endonuclease can contain a selection marker. Suitable selection markers include, but are not limited to, antibiotic resistance genes such as a chloramphenicol resistance gene, an ampicillin resistance gene, a tetracycline resistance gene, a Zeocin resistance gene, a spectinomycin resistance gene and a Km (Kanamycin resistance gene), tetA (tetracycline resistance gene), G418 (neomycin resistance gene), van (vancomycin resistance gene), tet (tetracycline resistance gene), ampicillin (ampicillin resistance gene), methicillin (methicillin resistance gene), penicillin (penicillin resistance gene), oxacillin (oxacillin resistance gene), erythromycin (erythromycin resistance gene), linezolid (linezolid resistance gene), puromycin (puromycin resistance gene) or a hygromycin (hygromycin resistance gene).
[0108] In some cases, the selection marker in the RNA-guided endonuclease encoding nucleic acid (e.g., linear or circular fragment or plasmid) is the same selection marker as used in different nucleic acid encoding a guide RNA and/or donor polynucleotide. In some cases, the selection marker in the RNA-guided endonuclease encoding plasmid is a different selection marker as compared to a selection marker in a different nucleic acid encoding a guide RNA and/or donor polynucleotide. The use of one or more positive and/or negative selection markers can allow specific and differential selection for the individual CRISPR components. For example, a cell can be edited by providing in the cell an RNA-guided endonuclease polypeptide, a first guide RNA, and optionally a first donor fragment; and then a second edit can be made by curing the cell of the first guide RNA and donor fragment; and providing into the cell a second guide RNA and/or donor fragment. The RNA-guided endonuclease, guide RNA, and/or donor fragment can be provided into the cell by introducing a nucleic acid encoding the CRISPR component(s), introducing a nucleoprotein complex of one or more CRISPR component(s), inducing expression of one or more CRISPR component(s), or a combination thereof.
[0109] In some embodiments, the RNA-guided endonuclease sequence is operably linked to a constitutive promoter. In some embodiments, the RNA-guided endonuclease sequence is operably linked to an inducible promoter. In some embodiments, the RNA-guided endonuclease sequence is operably linked to a native promoter. In some embodiments, the RNA-guided endonuclease sequence is operably linked to an exogenous promoter. In some embodiments, the RNA-guided endonuclease sequence is operably linked to a synthetic promoter.
Donor Polynucleotides
[0110] By a donor polynucleotide or repair fragment is meant a nucleic acid sequence to be inserted at the cleavage site induced by the RNA-guided endonuclease (e.g., a Cas9 polypeptide). A suitable donor polynucleotide sequence will generally comprise a left homology arm sequence and a right homology arm sequence each homologous to a Corynebacterium target sequence, and will further comprise at least one mutation sequence flanked by the left and right homology arm sequences. In some cases, the donor polynucleotide comprises two or more mutation sequences, wherein at least two, or all, of the two or more mutation sequences are either both flanked by the same left and right homology arm sequences, or at least two, or all, of the two or more mutation sequences are flanked by different left and right homology arm sequences. Generally, where two or more mutation sequences are in the same donor polynucleotide, the mutation sequences are mutations of target genome loci in close proximity to each other. Typically, the two or more mutation sequences on a donor polynucleotide encode genome modifications that are within, or within about, 150 base pairs, 125 base pairs, 100 base pairs, 75 base pairs, 70 base pairs, 65 base pairs, 60 base pairs, 55 base pairs, 50 base pairs, 45 base pairs, 40 base pairs, 35 base pairs, 30 base pairs, 25 base pairs, 20 base pairs, or 10 or 5 base pairs. In some cases, the two or more mutation sequences encode genome modifications that are in close proximity to one another in the genome are at a distance from each other in the genome of from about 10 to about 100 base pairs, or from about 25 to about 75 base pairs.
[0111] As demonstrated herein, the editing efficiency of the CRISPR/Cas9 complex in Corynebacterium increases significantly with increasing homology arm length. Accordingly, in some embodiments, the right and left homology arm sequences used in combination with an RNA-guided endonuclease polypeptide as described herein each independently comprises, comprises about, comprises at least, or comprises at least about, 25; 45, 50; 75; 100; 125; 150; 175; 200; 225; 250; 275; 300; 325; 350; 375; 400; 425; 450; 475; 500; 525; 550; 575; 600; 625; 650; 675; 700; 725; 750; 775; 800; 825; 850; 875; 900; 925; 950; 975; 1,000; 1,025; 1,050; 1,075; 1,100; 1,125; 1,150; 1,175; 1,200; 1,225; 1,250; 1,275; 1,300; 1,325; 1,350; 1,375; 1,400; 1,425; 1,450; 1,475; 1,500; 1;525; 1,550; 1,575; 1,600; 1,625; 1,650; 1,675; 1,700; 1,725; 1,750; 1,775; 1,800; 1,825; 1,850; 1,875; 1,900; 1,925; 1,950; or 2,000 base pairs. In some embodiments, the left and right homology arm sequences used in combination with an RNA-guided endonuclease polypeptide as described herein each independently comprises no more than, or no more than about, 25; 50; 75; 100; 125; 150; 175; 200; 225; 250; 275; 300; 325; 350; 375; 400; 425; 450; 475; 500; 525; 550; 575; 600; 625; 650; 675; 700; 725; 750; 775; 800; 825; 850; 875; 900; 925; 950; 975; 1,000; 1,025; 1,050; 1,075; 1,100; 1,125; 1,150; 1,175; 1,200; 1,225; 1,250; 1,275; 1,300; 1,325; 1,350; 1,375; 1,400; 1,425; 1,450; 1,475; 1,500; 1;525; 1,550; 1,575; 1,600; 1,625; 1,650; 1,675; 1,700; 1,725; 1,750; 1,775; 1,800; 1,825; 1,850; 1,875; 1,900; 1,925; 1,950; or 2,000 base pairs.
[0112] In certain embodiments, the right and left homology arm sequences used in combination with an RNA-guided endonuclease polypeptide as described herein each independently comprise between about 45 and about 125 base pairs, between about 25 and about 2000 base pairs, between about 25 and about 1000 base pairs, between about 25 and about 600 base pairs, between about 25 and about 500 base pairs, between about 25 and about 250 base pairs, between about 25 and about 200 base pairs, between about 25 and about 100 base pairs, or between about 25 and about 50 base pairs. In certain embodiments, the right and left homology arm sequences used in combination with an RNA-guided endonuclease polypeptide as described herein each independently comprise between about 100 and about 2000 base pairs, between about 100 and about 1000 base pairs, between about 100 and about 600 base pairs, between about 100 and about 500 base pairs, between about 100 and about 250 base pairs, between about 100 and about 200 base pairs, or between about 100 and about 150 base pairs. In certain embodiments, the right and left homology arm sequences used in combination with an RNA-guided endonuclease polypeptide as described herein each independently comprise between about 0 and about 2000 base pairs, between about 0 and about 1000 base pairs, between about 0 and about 600 base pairs, between about 0 and about 500 base pairs, between about 0 and about 250 base pairs, between about 0 and about 200 base pairs, between about 0 and about 100 base pairs, between about 0 and about 50 base pairs, or between about 0 and about 25 base pairs.
[0113] In some cases, the right homology arm used in combination with an RNA-guided endonuclease polypeptide as described herein has a length of 0 base pairs, while the left homology arm has a length of, of at least, of about, or of at least about 25, 45, 50, 75, 100, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1025, 1050, 1075, 1100, 1125, 1150, 1175, 1200, 1225, 1250, 1275, 1300, 1325, 1350, 1375, 1400, 1425, 1450, 1475, 1500, 1525, 1550, 1575, 1600, 1625, 1650, 1675, 1700, 1725, 1750, 1775, 1800, 1825, 1850, 1875, 1900, 1925, 1950, or 2000 base pairs. In some cases, the left homology arm used in combination with an RNA-guided endonuclease polypeptide as described herein has a length of 0 base pairs, while the right homology arm has a length of, of at least, of about, or of at least about 25, 45, 50, 75, 100, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1025, 1050, 1075, 1100, 1125, 1150, 1175, 1200, 1225, 1250, 1275, 1300, 1325, 1350, 1375, 1400, 1425, 1450, 1475, 1500, 1525, 1550, 1575, 1600, 1625, 1650, 1675, 1700, 1725, 1750, 1775, 1800, 1825, 1850, 1875, 1900, 1925, 1950, or 2000 base pairs.
[0114] The donor polynucleotide is typically not identical to the genomic sequence that it replaces. Rather, the donor polynucleotide generally comprises at least one mutation sequence, e.g., one or more single base changes, insertions, deletions, inversions or rearrangements with respect to the genomic sequence, so long as sufficient homology is present to support homology-directed repair. Exemplary mutation sequences include: a single nucleotide insertion; an insertion of two or more nucleotides; an insertion of a nucleic acid sequence encoding one or more proteins; a single nucleotide deletion; a deletion of two or more nucleotides; a deletion of one or more coding sequences; a substitution of a single nucleotide; a substitution of two or more nucleotides; two or more non-contiguous insertions, deletions, and/or substitutions; or any combination thereof. In a specific embodiment, the at least one mutation sequence comprises a mutation of a Cas9 PAM.
[0115] In some embodiments, the donor polynucleotide comprises a mutation sequence having two or more non-contiguous mutations. For example, the donor polynucleotide can comprise a mutation in an RNA-guided endonuclease polypeptide PAM region (e.g., Cas9 PAM region), optionally or alternatively a mutation in an RNA-guided endonuclease polypeptide seed region (e.g., Cas9 seed region), and a mutation at least 5, 10, 15, 20, 25, 30, 45, 50, 60, 90, or 100 nucleotides away. In some cases, the non-contiguous modifications that are in close proximity to one another in the genome are within, or within about, 200 base pairs, 175 base pairs, 150 base pairs, 125 base pairs, 100 base pairs, 75 base pairs, 70 base pairs, 65 base pairs, 60 base pairs, 55 base pairs, 50 base pairs, 45 base pairs, 40 base pairs, 35 base pairs, 30 base pairs, 25 base pairs, 20 base pairs, or 10 base pairs, or 5 base pairs. In some cases, the non-contiguous modifications that are in close proximity to one another in the genome are at a distance from each other in the genome of from about 10 to about 100 base pairs, or from about 25 to about 75 base pairs.
[0116] In some cases one donor polynucleotide comprises two or more non-contiguous mutations and a second or other donor polynucleotide comprises a mutation at a different locus. In some cases one donor polynucleotide comprises two or more non-contiguous sequences and a second or other donor polynucleotide comprises two or more non-contiguous mutations at a different locus.
[0117] The mutation sequence may comprise certain sequence differences as compared to the genomic sequence, e.g. restriction sites, nucleotide polymorphisms, selectable markers (e.g., drug resistance genes, fluorescent proteins, enzymes etc.), etc., which may be used to assess for successful insertion of the donor sequence at the cleavage site or in some embodiments may be used for other purposes (e.g., to signify expression at the targeted genomic locus). In some embodiments, if located in a coding region, such nucleotide sequence differences will not change the amino acid sequence, or will make silent amino acid changes (i.e., changes which do not affect the structure or function of the protein). Alternatively, these sequences differences may include flanking recombination sequences such as FLPs, loxP sequences, or the like, that can be activated at a later time for removal of the marker sequence.
[0118] The donor polynucleotide may be provided as a single-stranded DNA, or double-stranded DNA. The ends of the donor polynucleotide may be protected (e.g., from exonucleolytic degradation) by methods known to those of skill in the art. For example, one or more dideoxynucleotide residues can be added to the 3 terminus of a linear molecule and/or self-complementary oligonucleotides can be ligated to one or both ends. See, for example, Chang et al. (1987) Proc. Natl. Acad Sci USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s), phosphate groups, methyl groups, and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.
[0119] In some embodiments, the donor polynucleotide is provided, e.g., introduced into a cell, as part of a plasmid having additional sequences such as, for example, a replication origin, one or more promoters, and/or positive or negative selection markers, or a combination of two thereof, three thereof, or all thereof. In some embodiments, the donor polynucleotide is provided as part of a replication-competent plasmid. In some embodiments, the donor polynucleotide is introduced into a cell as part of a replication-incompetent plasmid. Alternatively, donor polynucleotides can be introduced as naked nucleic acid (e.g., as a linear or circular fragment), as nucleic acid complexed with an agent such as a liposome or polymer, or can be delivered by viruses (e.g., adenovirus, AAV).
[0120] In some embodiments, incorporation of the donor polynucleotide can be aided by the simultaneous or sequential introduction of recombination proteins such as RecE/T, or one or more components of the phage lambda-derived Red recombination system lambda exonuclease, beta-protein, and/or gamma-protein (See, GENETICS Nov. 1, 2010 vol. 186 no. 3 791-799).
[0121] In certain embodiments, two or more donor fragment-encoding nucleic acids are operably linked to differentially inducible promoters for selective induction, such as for serial editing of a host cell genome.
[0122] Without wishing to be bound by theory, the present inventors hypothesize that multiplexed genome editing with plasmid-based presentation of donor polynucleotides can proceed via one or more of the mechanisms (1), (2), (3), (4), or (5) detailed below.
[0123] Mechanism (1), single crossover loop-in followed by RNA-guided endonuclease polypeptide (e.g., Cas9)/sgRNA-mediated cut, and repair. Within the cell RNA-guided endonuclease polypeptide (e.g., Cas9) is constitutively expressed. Upon transformation of the sgRNA/repair fragment construct, there is a loop-in event at the repair fragment loci (i.e., two separate integration events), thereby duplicating the loci (i.e., one mutant copy, one wild-type copy). In parallel, the sgRNA(s) on the construct are expressed, fold, and bind to RNA-guided endonuclease polypeptide (e.g., Cas9)-priming it for target recognition and cutting. At this point, primed RNA-guided endonuclease polypeptide (e.g., Cas9) recognizes and cleaves the wild-type locus. The cell must repair this break in order to survive. The mutant locus, already integrated into the genome, is adjacent to the cut site and serves as a recombination template for repair. The mutation then becomes fixed in the genomic DNA and persist to daughter cells.
[0124] Mechanism (2), double crossover loop-in/loop-out followed by RNA-guided endonuclease polypeptide (e.g., Cas9)/sgRNA-mediated cleavage. Within the cell RNA-guided endonuclease polypeptide (e.g., Cas9) is constitutively expressed. Upon transformation of the sgRNA/repair fragment construct, there is a loop-in event at the repair fragment loci (i.e., two separate integration events), thereby duplicating the loci (i.e., one mutant copy, one wild-type copy). Following loop-in of the sgRNA/repair fragment construct, there is a loop-out event mediated by the repair fragment homology arms. (In theory, 50% of the cells should loop-out to the wild-type version of the locus, the other 50% will loop-out to the mutant version of the locus.) In parallel, the sgRNA(s) on the construct are expressed, fold, and bind to RNA-guided endonuclease polypeptide (e.g., Cas9)-priming it for target recognition and cutting. At this point, primed RNA-guided endonuclease polypeptide (e.g., Cas9) recognizes and cleaves cells that have looped-out to wild-type, clearing them from the population. Cells containing the mutant locus are not cleaved by primed RNA-guided endonuclease polypeptide (e.g., Cas9); the mutation then becomes fixed in the genomic DNA and persist to daughter cells.
[0125] Mechanism (3), RNA-guided endonuclease polypeptide (e.g., Cas9)/sgRNA-mediated cut followed by double crossover repair with plasmid donors. Within the cell Cas9 is constitutively expressed. Upon transformation of the sgRNA/repair fragment construct, the sgRNA(s) on the construct are expressed, fold, and bind to RNA-guided endonuclease polypeptide (e.g., Cas9)-priming it for target recognition and cutting. At this point, primed RNA-guided endonuclease polypeptide (e.g., Cas9) recognizes and cleaves the wild-type loci (i.e., two double-stranded breaks in the chromosomal DNA). The cell must repair these breaks in order to survive. The sgRNA/repair fragment construct serves as a recombinational template to fix the breaks in the DNA (i.e., two double crossover repair events). The cell performs the double crossover events and repairs the breaks. The mutations become fixed in the genomic DNA and persist to daughter cells.
[0126] Mechanism (4), RNA-guided endonuclease polypeptide (e.g., Cas9)/sgRNA-mediated cut followed by double crossover repair with double-stranded linear donors: Within the cell RNA-guided endonuclease polypeptide (e.g., Cas9) is constitutively expressed along with heterologous recombination proteins (e.g., beta, gam, and exo from lambda red recombination system or RecE/RecT from the rac prophage). Upon transformation of the sgRNA construct and linear double-stranded repair fragment(s), the sgRNA(s) on the construct are expressed, fold, and bind to RNA-guided endonuclease polypeptide (e.g., Cas9)-priming it for target recognition and cutting. At this point, primed Cas9 recognizes and cleaves the wild-type loci (i.e., two double-stranded breaks in the chromosomal DNA). The cell must repair these breaks in order to survive. The repair fragments are processed by the heterologous recombination proteins and are used as templates for chromosomal repair. The mutations become fixed in the genomic DNA and persist to daughter cells.
[0127] Mechanism (5), introduction of single-stranded linear donors via DNA replication followed by RNA-guided endonuclease polypeptide (e.g., Cas9)/sgRNA-mediated cleavage of wild-type loci. Within the cell RNA-guided endonuclease polypeptide (e.g., Cas9) is constitutively expressed along with a heterologous recombination protein (e.g., gam from lambda red recombination system or RecT from the rac prophage). Upon transformation of the sgRNA construct and linear single-stranded repair fragment(s), the linear single-stranded repair fragment(s) are incorporated into the genomic DNA via Okazaki fragment extension during DNA replication. The sgRNA(s) are expressed, fold, and bind to RNA-guided endonuclease polypeptide (e.g., Cas9)-priming it for target recognition and cutting. At this point, primed RNA-guided endonuclease polypeptide (e.g., Cas9) recognizes and cleaves the wild-type loci (i.e., two double-stranded breaks in the chromosomal DNA), leaving the altered loci intact. The mutations become fixed in the genomic DNA and persist to daughter cells.
Guide RNAs
[0128] The guide RNA may be provided as: double-stranded DNA encoding the guide RNA, single-stranded RNA, or double-stranded RNA. In some embodiments, the guide RNA is encoded in a plasmid having additional sequences such as, for example, a replication origin, one or more promoters, and/or positive or negative selection markers, or a combination of two thereof, three thereof, or all thereof. In some embodiments, the guide RNA is provided as part of a replication-competent plasmid. In some embodiments, the guide RNA is provided as part of a replication-incompetent plasmid. Alternatively, guide RNAs can be provided as naked nucleic acid (e.g., as a linear or circular fragment), as nucleic acid complexed with an agent such as a liposome or polymer, or can be delivered by viruses (e.g., adenovirus, AAV).
[0129] In certain embodiments, two or more guide RNA-encoding nucleic acids are operably linked to differentially inducible promoters for selective induction, such as for serial editing of a host cell genome. The differentially inducible guide RNAs can be encoded by the same or a different plasmid or nucleic acid fragment.
DNA Repair Components
[0130] In certain embodiments, methods are provided for editing a host cell genome with an RNA-guided endonuclease, a donor polynucleotide, and a nucleic acid encoding a component of a heterologous DNA repair pathway. In some cases, the method includes editing a host cell genome with an RNA-guided endonuclease, a donor polynucleotide, and two or more nucleic acids encoding two or more components of a heterologous DNA repair pathway. In some cases, the method includes an RNA-guided endonuclease, a donor polynucleotide, and a nucleic acid encoding two or more components of a heterologous DNA repair pathway.
[0131] In some cases, the repair pathway is a RecA/RecBCD repair pathway. In some cases, the repair pathway is a RecE/RecT repair pathway. In some cases, the repair pathway is a Red/Red repair pathway. In some cases, the repair pathway is a lambda-derived red recombination repair pathway. In some cases, the method includes expression of RecA and/or RecBCD. In some cases, the method includes expression of RecE and/or RecT. In some cases, the method includes expression of Red and/or Red. In some cases, the method includes expression of beta, gam, and/or exo components of the lambda-derived red recombination repair pathway. A nucleic acid encoding a component of the heterologous DNA repair pathway can be on a first, second, or other plasmid. In some cases, sgRNA(s) are encoded on a first plasmid and heterologous DNA repair protein(s) are encoded on a second plasmid.
Expression, Purification, and Delivery
[0132] In one aspect, the present disclosure provides plasmids, vectors, constructs, and nucleic acid sequences encoding the CRISPR/RNA-guided endonuclease polypeptide (e.g., Cas9) gene editing complexes. In certain embodiments, the present disclosure provides plasmids for transient expression of the guide RNA, with or without simultaneous or sequential expression of the RNA-guided endonuclease (e.g., Cas9) polypeptide and/or presentation of the donor polynucleotide. In some embodiments the plasmids and vectors of the present invention will encode the guide RNA and also encode the RNA-guided endonuclease (e.g., Cas9) polypeptide and/or donor polynucleotide of the present disclosure. In other aspects, the different components of the engineered complex can be encoded in one or more distinct plasmids.
[0133] In some embodiments, the plasmids of the present disclosure can be used across multiple Corynebacterium species. In some embodiments, the plasmids of the present disclosure are tailored specifically to C. glutamicum. In some embodiments, the plasmids of the present disclosure are, or contain sequences (e.g., promoter, guide RNA, RNA-guided endonuclease polypeptide (e.g., Cas gene), replication origin, etc.) that are, codon-optimized to express in Corynebacterium in general, and/or C. glutamicum in particular, and/or a specific strain thereof, such as C. glutamicum NRRL-B11474.
[0134] In some embodiments, the plasmids and vectors of the present disclosure are selectively expressed in the cells of interest. Thus, in some embodiments, the present application contemplates the use of ectopic promoters, developmentally-regulated promoters, and/or inducible promoters. In some embodiments, the present disclosure provides the use of terminator sequences.
Transformation
[0135] In some embodiments, the present specification provides the use of transformation of the plasmids and vectors disclosed herein. Persons having skill in the art will recognize that the plasmids of the present specification can be transformed into cells through any known system as described in other portions of this specification. For example, in some aspects, the present specification provides transformation by electroporation, chemically-induced transformation (e.g., transformation in the presence of a divalent cation such as Mg.sup.2+), conjugation, particle bombardment, agrobacterium transformation, nano-spike transformation, and virus transformation (e.g., phage transformation).
[0136] In some embodiments, the vectors of the present specification may be introduced into the Corynebacterium host cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection, DEAE-Dextran mediated transfection, lipofection, or electroporation (Davis et al., 1986 Basic Methods in Molecular Biology; Van der Rest et al. Appl Microbiol Biotechnol. 1999 October; 52(4):541-5). Other methods of transformation include, e.g., lithium acetate transformation and electroporation. See, e.g., Gietz et al., Nucleic Acids Res. 27:69-74 (1992); Ito et al., J. Bacterol. 153:163-168 (1983); and Becker and Guarente, Methods in Enzymology 194:182-187 (1991). In some embodiments, transformed host cells are referred to as recombinant Corynebacterium host strains.
[0137] In some embodiments, the present specification provides high-throughput transformation of cells using 96-well plate robotics platform and liquid handling machines, as described in PCT/US2017/040114, entitled Apparatuses and methods for electroporation.
[0138] In some embodiments, methods for introducing exogenous protein (e.g. RNA-guided endonuclease (e.g., Cas9) polypeptides) into cells are required. Various methods for achieving this have been described previously including direct transfection of protein/RNA/DNA or DNA transformation followed by intracellular expression of RNA and protein (See, e.g., Dicarlo et al., Nucleic Acids Res 41:4336-43 (2013); Ren et al., Gene 195:303-311 (1997); Lin et al. Elife 3:e04766 (2014)).
[0139] In some embodiments, the present specification provides screening transformed cells with one or more selection markers as described above. In one such embodiment, cells transformed with a vector comprising a kanamycin resistance marker (KanR) are plated on media containing effective amounts of the kanamycin antibiotic. Colony forming units visible on kanamycin-laced media are presumed to have incorporated the vector cassette into their genome. Insertion of the desired sequences can be confirmed via PCR, restriction enzyme analysis, and/or sequencing of the relevant insertion site.
[0140] Persons having skill in the art will readily recognize that viral vectors or plasmids for gene expression can be used to deliver the sequences and/or complexes disclosed herein. Virus-like particles (VLP) can be used to encapsulate nucleic acids or nucleoprotein complexes for recombinant expression, or purified ribonucleoprotein complexes disclosed herein can be provided and delivered to cells via electroporation, contacting cell(s) with VLP, or injection.
Kits
[0141] In some embodiments, the disclosure provides kits containing any one or more of the elements disclosed in the above methods and compositions. In some aspects, the kit comprises a CRISPR/RNA-guided endonuclease polypeptide (e.g., Cas9) system and instructions for using the kit. In some aspects, the CRISPR/RNA-guided endonuclease polypeptide (e.g., Cas9) system comprises a plasmid comprising a promoter operably linked to a sequence for expressing a first guide RNA, and a first donor polynucleotide having an upstream homology arm sequence and a downstream homology arm sequence each homologous to a Corynebacterium target sequence, said first donor polynucleotide including at least one mutation sequence flanked by said upstream homology arm sequence and said downstream homology arm sequence, and optionally a RNA-guided endonuclease (e.g., Cas9) polypeptide, which may also be directly integrated into the host Corynebacterium strain. The donor polynucleotide and/or RNA-guided endonuclease (e.g., Cas9) polypeptide may be encoded on the same or separate plasmids as the guide RNA. Alternatively, the donor polynucleotide may be provided as a linear or circular fragment.
[0142] Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, a tube, or a multi-well plate (e.g., 96-well, 384-well, or 1536-well plate). In some aspects, the kit includes instructions in one or more languages, for example in more than one language.
[0143] In some aspects, a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein (e.g., purified RNA-guided endonuclease (e.g., Cas9) polypeptide). Reagents may be provided in any suitable container. For example, a kit may provide one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g., in concentrated or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some aspects, the buffer is alkaline. In some aspects, the buffer has a pH from about 7 to about 10. In some aspects, the kit comprises one or more oligonucleotides corresponding to a crRNA sequence for insertion into a vector so as to operably link the crRNA sequence and a regulatory element.
[0144] Having now generally described the invention, the same will be more readily understood through reference to the following examples that are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.
[0145] Each periodical, patent, and other document or reference cited herein is herein incorporated by reference in its entirety.
EXAMPLES
Example 1
Cas9 can Induce Lethal DSBs in C. Glutamicum when Expressed in Conjunction with Functional Guide RNA
[0146] The Cas9 gene from Streptococcus pyogenes with a codon bias for Streptomyces (Cobb et al. ACS Synth. Biol. 4, 723-728 (2015)) was synthesized and linked to the Ptrc promoter and integrated into NRRL-B11474 Corynebacterium glutamicum for expression of Cas9.
[0147] Cas9 activity was tested in a strain where Cas9 was integrated in the cg0443-cg0444 locus. As double stranded breaks (DSBs) are lethal when repair is ineffective, no colonies were expected to form beyond a few escape mutants (
Example 2
CRISPR/Cas9 Genome EditingSNP Introduction
[0148] After successfully demonstrating the functionality of Cas9 and the guide RNAs to be used, plasmids were designed to introduce SNPs at 3 test loci using the validated guide RNAs and a corresponding donor polynucleotide encoded together on a single plasmid. A schematic of the configuration used to introduce SNPs is shown in Panel A of
[0149] Colonies from a transformation with the guide RNA/donor DNA plasmid were tested via colony PCR and NGS sequence analysis. An example of one NGS coverage plot is depicted in
Example 3
CRISPR/Cas9 Genome EditingGene Deletion
[0150] Deletion of 702 bp from the cg3031 locus was tested. An overview of the strategy to knock out the cg3031 ORF in C. glutamicum is provided in Panel A of
Example 4
CRISPR/Cas9 Genome EditingSmall Insertions
[0151] Polynucleotides were designed to insert 100 bp at three loci as illustrated in
Example 5
CRISPR/Cas9 Genome EditingSuccessful Simultaneous Introduction of Multiple Co-Located SNPs at Multiple Loci
[0152] If a target SNP is positioned outside of a PAM region or if multiple SNPs are desirable then multiple co-located SNPs can be introduced on the same donor fragment. To explore the simultaneous introduction of multiple co-located SNPs, donor fragments were designed to introduce two simultaneous SNPs at the cg0167 and cg3404 test loci, and three simultaneous edits at the rpsL test locus. The donor fragment targeting cg0167 consists of 1 SNP that scrambles the PAM region and another SNP 10 bp away from the PAM. The donor fragment targeting cg3404 includes 1 SNP that scrambles the PAM region and another SNP 70 bp away from the PAM. The rpsL donor fragment includes 1 SNP that scrambles the PAM region, another SNP in the seed region of the protospacer (10 bp downstream of the PAM), and another SNP 65 bp away from the PAM. Target SNPs at the PAM and seed region prevent further cutting of the modified genome by the CRISPR/Cas9 complex. Coverage plots from sequence analysis of edited and unedited colonies are shown in
Example 6
CRISPR/Cas9 Editing Efficiency Varies Depending on Length of Homology Arms in a Plasmid-Encoded Donor Polynucleotide
[0153] Targeted SNPs and insertions were tested at three loci with different length homology arms. Donor fragments contained left and right symmetrical homology arm lengths of 25, 50, 75, 100, and 125 bp. Target SNPs were generated at three test loci (cg0167, cg3404, and rpsL) and longer homology arms resulted in higher percentages of colonies edited (
Example 7
Transformation Efficiency Depends on Origin of Replication and is Unique in NRRL-B11474 Strain of C. Glutamicum
[0154] A panel of five C. glutamicum origins of replication were built into plasmids and transformed into WT NRRL-B11474 C. glutamicum to test transformation efficiency (
Example 8
Origin of Replication Impacts Editing Efficiency
[0155] Polynucleotide copy number may impact expression levels of guide RNA and delivery of donor fragments. To investigate if origin of replication has an impact on editing efficiency two C. glutamicum origins of replication (pCASE1 and pCG1) were included in polynucleotides containing guide RNA specific to the target locus, and a donor fragment that contains either 125 bp of homology on either side of the SNP, or 500 bp on either side of the insertion. Plasmids were transformed into a C. glutamicum NRRL-B11474 strain carrying an integrated, constitutively expressed copy of the Cas9 gene, and up to 8 colonies were picked for screening by NGS. Two biological replicates were averaged for each editing construct. Origin of replication had a significant impact on editing efficiency with pCASE1 showing significantly higher editing efficiency than pCG1 (
Example 9
Expression of RecET in Conjunction with PCR Donor Polynucleotide Results in Successful Incorporation of Desired Edits
[0156] A configuration that can be used to generate edits includes delivery of a guide RNA on a replicating plasmid and a donor fragment as a PCR product. These components were transformed into a strain background containing a helper plasmid containing an inducible promoter operably linked to RecET (pRecET) (
Example 10
Multiplexed Parallel SNP Editing at cg3404 and rpsL Using Plasmid-Based Donor Polynucleotides
[0157] Prior reports suggest that introducing multiple CRISPR Cas9-mediated edits in parallel is an inefficient process. In one experiment (
Example 11
Stacking Genomic Edits by Iterative CRISPR Editing
[0158] Prior reports and our data suggest that introducing multiple edits is inefficient]] that introducing multiple CRISPR Cas9-mediated edits in parallel is an inefficient process.
[0159] One alternative is to incorporate multiple edits sequentially. In one such configuration, a plasmid with a single sgRNA/donor fragment pair and containing an element for plasmid clearance can be introduced into the Cas9-expressing strain. Following transformation and editing, the plasmid can be cleared, and a second plasmid containing a different sgRNA/donor fragment pair can be transformed to introduce a second edit. Colonies can then be assayed to verify the incorporation of all intended edits.
[0160] While the present disclosure has been described with reference to preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof to adapt to particular situations without departing from the scope of the present disclosure. Therefore, it is intended that the present disclosure not be limited to the particular embodiments disclosed as the best mode contemplated for carrying out the present disclosure, but that the present disclosure will include all embodiments falling within the scope and spirit of the appended claims.