GENE THERAPY
20230038479 · 2023-02-09
Assignee
Inventors
Cpc classification
A61P25/28
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61P25/28
HUMAN NECESSITIES
Abstract
The present disclosure relates to transcription cassettes comprising nucleic acids encoding RuvBL1 and/or RuvBL2 and the use of said vectors in gene therapy for the treatment of neurodegenerative diseases that result from expression of polymorphic repeat expansions of the GGGGCC (SEQ ID NO: 5) hexanucleotide-repeat sequence in the first intron of the C9ORF72 gene; pharmaceutical compositions comprising said vectors and including uses and methods to treat neurodegenerative diseases.
Claims
1. An isolated nucleic acid molecule comprising: a transcription cassette comprising a promoter adapted for expression in a mammalian neurone, said cassette further comprising a nucleotide sequence encoding an ATPase selected from the group consisting of: i) a nucleotide sequence as set forth in SEQ ID NO:1 and/or SEQ ID NO: 2; ii) a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the sequence in SEQ ID NO: 1 and/or SEQ ID NO: 2 wherein said nucleic acid molecule encodes an ATPase; iv) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence as represented in SEQ ID NO: 3 and/or 4; v) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence wherein said amino acid sequence is modified by addition deletion or substitution of at least one amino acid residue as represented in iv) above and which has ATPase activity.
2. The isolated nucleic acid molecule according to claim 1 wherein said cassette is adapted for expression in a motor neurone.
3. The isolated nucleic acid molecule according to claim 1, wherein said nucleic acid molecule comprises or consists of a nucleotide sequence as represented in SEQ ID NO: 1 and/or 2 or polymorphic sequence variant thereof.
4. The isolated nucleic acid molecule according to claim 1, wherein said nucleotide sequence encodes a polypeptide comprising an amino acid sequence as represented in SEQ ID NO: 3 and/or 4, or polymorphic sequence variant thereof.
5. The isolated nucleic acid molecule according to claim 1, wherein said promoter is a constitutive promoter.
6. The isolated nucleic acid molecule according to claim 1, wherein said promoter is a regulated promoter, for example an inducible or cell specific promoter.
7. The isolated nucleic acid molecule according to a claim 1, wherein said promoter is selected from the group consisting of: chicken beta actin (CBA) promoter, chicken beta actin hybrid promoter (CBh), CAG promoter, eF-1a promoter, neuronal and glia specific promoters including, synapsin 1, Hb9, CamkII, MeCP2, and GFAP promoter nucleotide sequences.
8. The isolated nucleic acid molecule according to claim 1, wherein said promoter is selected from the group consisting of: MeP229, MeCP2 and JeT promoter nucleotide sequences.
9. An expression vector comprising a transcription cassette according to claim 1.
10. The expression vector according to claim 9 wherein said expression vector is a viral based expression vector.
11. The expression vector according to claim 10 wherein said viral based vector is an adeno-associated virus [AAV].
12. The expression vector according to claim 11 wherein said viral based vector is AAV9.
13. The expression vector according to claim 10 wherein said viral based vector is a lentiviral vector.
14. A cell transfected with an expression vector according to claim 9.
15. The cell according to claim 14 wherein said cell is a neurone.
16. The cell according to claim 15 wherein said neurone is a motor neurone.
17. A pharmaceutical composition comprising the expression vector according to claim 9 and an excipient or carrier.
18. The expression vector according to claim 9 for use as a medicament.
19. The expression vector according to claim 9 for use in the treatment of a neurodegenerative disease.
20. The expression vector according to claim 19, wherein said neurodegenerative disease is associated with polymorphic GlyGlyGlyGlyCysCys (G4C2; SEQ ID NO: 5) repeat expansions in the first intron of the C9orf72 gene.
21. The expression vector according to the use of claim 19, wherein said neurodegenerative disease is selected from the group consisting of: amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) motor neurone disease, frontotemporal lobar dementia (FTLD), Huntington's like disorder, primary lateral sclerosis, progressive muscular atrophy, corticobasal syndrome, Alzheimer's disease and Dementia with Lewy Bodies.
22. The expression vector according to claim 21 wherein said neurodegenerative disease is amyotrophic lateral sclerosis (ALS).
23. The expression vector according to claim 21 wherein said neurodegenerative disease is frontotemporal dementia (FTD).
24. A method to treat or prevent a neurodegenerative disease comprising administering a therapeutically effective amount of the expression vector according to claim 9 to a subject to prevent and/or treat said neurodegenerative disease in the subject.
25. The method according to claim 24 wherein said neurodegenerative disease is amyotrophic lateral sclerosis (ALS).
26. The method according to claim 24 wherein said neurodegenerative disease is frontotemporal dementia (FTD).
Description
[0065] An embodiment of the invention will now be described by example only and with reference to the following figures:
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
SEQUENCE LISTING
[0075] The Sequence Listing is submitted as an ASCII text filed in the form of the file name “Sequence.txt” (˜16 kb), which was created on Jul. 6, 2022, and which is incorporated by reference herein.
Materials and Methods
Plasmids
[0076] pCi-Neo empty vector plasmid was purchased from (Promega), pCMV3 FLAG-tagged RuvBL1 and HA-tagged RuvBL2 were purchased from SinoBiologicals.
[0077] Synthetic sequences encoding poly-Gly-Ala, poly-Gyl-Arg and poly-Pro-Arg ×100 DPRs independently of G4C2 repeats were first cloned into pcDNA3.1 using EcoRl/Notl. Synthetic sequences encoding poly-Gly-Ala, poly-Gyl-Arg and poly-Pro-Arg ×100 were subcloned using BamHI/NotI into pCI-neo-V5-N using BcII/NotI. BcII restriction site was previously introduced into pCI-neo-V5-N by site directed mutagenesis using forward ACTCTAGAGGTACCACGTGATCATTCTCGAGGGTGCTATCCAGGC (SEQ ID NO: 6) and reverse GCCTGGATAGCACCCTCGAGAATGATCACGTGGTACCTCTAGAGT (SEQ ID NO: 7) primers.
Cell Culture and Transfection
[0078] HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM, SUPPLIER), supplemented with 10% FBS (SUPPLIER) and 100 IU/ml penicillin and 100 IU/ml streptomycin (Sigma) in a 5% CO.sub.2 atmosphere at 37° C. HeLa cells were transfected with plasmid DNA using polyethylenimine (PEI) (stock 1 mM; 3 μl/μg plasmid). Cells were used in experiment 24 or 48 h post DNA transfections. HeLa cells were siRNA transfected using Lipofectamine RNAiMax (Invitrogen) according to the manufacturer's instructions. Cells were used in experiments 4 days after siRNA transfection.
[0079] Cortical neurons were isolated from E15 FVB/NJ-Tg(C9orf72)500Lpwr/J (C9 BAC-500, The Jackson Laboratory) embryos and cultured on 6 well tissue culture plates coated with poly-L-lysine in neurobasal medium supplemented with B27 supplement (Invitrogen), 100 IU/ml penicillin, 100 mg/ml streptomycin, and 2 mM L-glutamine. Cells were harvested for immunoblot analysis after 10 days in vitro.
iNPC Production
[0080] Induced neural progenitor cells (iNPCs) were derived from human skin fibroblasts as previously described .sup.10. Human skin fibroblast samples were obtained from Professor Pamela J Shaw from the Sheffield tissue bank. Informed consent was obtained from all subjects before sample collection. Briefly, 10,000 fibroblasts were transduced with lentiviral vectors for OCT3, Sox2, KLF4, and C-MYC for 12 h. Forty-eight hours after transduction, the cells were washed with PBS and fibroblast medium was replaced with NPC medium (DMEM/F-12 with glutamax supplemented with 1% N2, 1% B27, 20 ng/ml FGF-b, 20 ng/ml EGF, and 5 μg/ml heparin. When the cells started changing shape and form neurospheres, they were expanded as neural rosettes. When the iNPC culture was confluent (˜3 weeks), EGF and heparin were withdrawn, and the FGF-b concentration increased to 40 ng/ml. The iNPCs can be maintained for ˜30 passages. iNPCs are not expanded by clone and therefore do not display clonal variability.
SDS-PAGE and Immunoblotting
[0081] Cells were harvested in Trypsin/EDTA (Lonza) and pelleted at 400 xg for 4 min. Pellets were washed once in phosphate buffered saline (PBS). Cell pellets were lysed in ice for 30 min in ice cold RIPA buffer (50 mM Tris-HCl pH 6.8, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.1% (w/v) SDS, 0.5% (w/v) deoxycholic acid, 1% (w/v) Triton X-100+protease inhibitor cocktail). Lysates were cleared at 17,000 xg for 20 min at 4° C. Protein concentration was measured by Bradford assay (BioRad). Proteins were separated by SDS-PAGE and transferred to nitrocellulose membranes (Whatmann) by electroblotting (BioRad). Membranes were blocked for 1 h in Tris buffered saline (TBS) with 5% fat-free milk (Marvel) and 0.1% Tween-20. Membranes were incubated in primary antibodies in blocking buffer overnight at 4° C. Membranes were washed three times for 10 min in TBS with 0.1% Tween-20 before incubation with secondary antibodies diluted in TBS with 0.1% Tween-20 for 1 h at room temperature.
[0082] Membranes were washed again three times for 10 min in TBS with 0.1% Tween-20. Membranes were prepared for chemiluminescent signal detection with Enhanced Chemiluminescent (ECL) substrate according to the manufacturer's instructions. Chemiluminescent signal was detected on a Syngene Gbox and signal intensities were quantified using ImageJ.
Dot-blotting
[0083] For dot blot analysis cells were harvested directly into 2× laemmli loading buffer and diluted 1:2 with distilled H.sub.2O. Lysates were passed 20 times through a 25 G needle to shear genomic DNA before boiling at 95° C. for 3 min. Equal volumes of lysate were loaded to the 96 well Bio-Dot Microfiltration Apparatus (BioRad) and transferred to nitrocellulose membranes under vacuum. Sample wells were washed 3 times in TBS with 0.1% Tween-20 before dismantling. Nitrocellulose membrane was then subjected to clocking and immunoblotting as described above. Chemiluminescent signal was detected on a Syngene Gbox and signal intensities were quantified using ImageJ.
Antibodies
[0084] Primary antibodies used were as follows: rabbit anti-RuvBL1 (Bethyl Laboratories, WB: 1:1,000), rabbit anti-RuvBL2 (Bethyl Laboratories, WB: 1:1,000), rabbit anti-53BP1 (Bethyl Laboratories, IF: 1:500), mouse anti-γH2AX (Merck Millipore, IF: 1:1,000), mouse anti-GAPDH (Merck Millipore, WB: 1:4,000), mouse anti-Tubulin (DM1A, Sigma, WB: 1:10,000), mouse anti-V5 (Invitrogen, WB: 1:5,000), mouse anti-FLAG (M2, Sigma, WB and IF: 1:2,000), mouse anti-HA (HA-7, Sigma, WB and IF: 1:2,000). Secondary antibodies used for immunoblotting were horseradish peroxidase-coupled goat anti-rabbit, and rabbit anti-mouse IgG (Dako; 1:5,000). Secondary antibodies used for immunofluorescence were Alexa fluorophore (488 and 568)-coupled goat/donkey anti-mouse IgG, Alexa fluorophore (488 or 568)-coupled goat/donkey anti-rabbit IgG (Invitrogen; 1:500).
Immunofluorescence
[0085] Cells cultured on glass coverslips were fixed with 3.7% formaldehyde in PBS for 20 min at room temperature or with ice cold methanol:acetone (50:50). Cells were washed twice in PBS before excess formaldehyde was quenched by incubation with 50 mM NH.sub.4Cl in PBS for 20 min at room temperature. Cells were further washed two times in PBS before permeabilising with 0.2% Triton X-100 in PBS for 3 min at room temperature. After washing three times in PBS to remove Triton X-100, cells were blocked in 3% BSA in PBS for 30 min at room temperature before incubation with primary antibodies diluted in 3% BSA-PBS for 1 h at room temperature. After washing three times in PBS, cells were incubated with secondary antibodies diluted in 3% BSA-PBS for 1 h and stained with Hoechst 33342. After a final wash in PBS, cells were mounted to cover slips in fluorescent mounting medium (Dako).
[0086] Images were captured using appropriate filtersets (Omega Optical and Chroma Technology) using MicroManager software on a Zeiss Axioplan2 microscope fitted with a Retiga R3 (QImaging) CCD camera, PE-300 LED illumination (CoolLED), and a 63×, 1.4NA Plan Apochromat objective (Zeiss). Illumination intensities, exposure times, and camera settings were kept constant during experiments.
Image Analysis
[0087] Image analysis was performed using ImageJ. 53BP1 puncta were counted in single nuclei using the Particle Analysis facility of ImageJ. Nuclei were defined by the Hochest 33342 stain. Where possible, the cells for analysis were selected based on fluorescence in the other channel. Images were filtered using a Hat filter (7×7 kernel) to extract puncta and thresholded such that the visible puncta within the cell were highlighted, but no background was included. Puncta were counted with the Measure Particles facility of ImageJ. For analysis of γ-H2AX signals, corrected total nuclear fluorescence (CTNF) of the γ-H2AX signal was calculated as CTNF=Integrated Density−(Area of selected nuclei X Mean fluorescence of background readings).
AAV9 Production
[0088] AAV9 viral particles were produced by transfecting human embryonic kidney HEK293T cells and purifying using iodixanol gradient purification method. Briefly, HEK293T cells in thirty T175 flasks were transfected with packaging plasmids pHelper (Stratagene; Stockport, UK), pAAV2/9 (kindly provided by J. Wilson, University of Pennsylvania) and one of the transgene plasmids at 2:1:1 ratio, respectively, using polyethylenimine (1 mg/ml) in serum-free Dulbecco's modified Eagle's medium. At 4 days post-transfection, supernatant containing cell-released virus was harvested, treated with benzonase (10 unit/ml; Sigma, Poole, UK) for 2 hours at 37° C. and concentrated to equal to approximately 24 ml using Amicon Ultra-15 Centrifugal 100 K Filters (Millipore, Watford, UK). Iodixanol gradient containing 15, 25, 40, and 54% iodixanol solution in phosphate-buffered saline (PBS)/1 mmol/l MgCl2/2.5 mmol/l KCl and virus solution was loaded and centrifuged at 69,000 revolutions per minute for 90 minutes at 18° C. After ultracentrifugation, the virus fractions were visualized on a 10% polyacrylamide gel, stained using SYPRO Ruby (Life Technologies, Paisley, UK) according to the manufacturer's guidelines. The highest purity fractions (identified by the presence of the three bands corresponding to VP1, VP2, and VP3) were pooled and concentrated further in the final formulation buffer consisting of PBS supplemented with an additional 35 mmol/l NaCl40 using Amicon Ultra-15 Centrifugal 100 K filters. Viral titers were determined by quantitative PCR assays using primers directed against the transgene and a linearized pAAV-CMV vector as a standard curve.
Transduction of Cortical Neurons with AAV9
[0089] To transduce primary cortical neuron cultures, 1.5×10.sup.5 viral genomes (vg) per cell of AAV9 were added to the culture media after 2-5 days in vitro (DIV). Transduction media was replaced with conditioned media after 4 hours of incubation. Half of the culture media was replaced with fresh media every 3 days. 7-days post-transduction (13 DIV), cells were fixed using 4% paraformaldehyde or methanol:acetone (50:50), or harvested for SDS-PAGE and immunoblot as appropriate.
[0090] In-vivo AAV9 Delivery to Mice
[0091] All experiments involving mice were conducted according to the Animal (Scientific Procedures) Act 1986, under Project License 40/3739 and approved by the University of Sheffield Ethical Review Sub-Committee, and the UK Animal Procedures Committee (London, UK). The UK Home Office code of practice for the housing and care of animals used in scientific procedures was followed according to Animal (Scientific Procedures) Act 1986. Animals were maintained in a controlled facility in a 12-hour dark/12-hour light cycle, a standardized room temperature of 21° C., with free access to food and water.
[0092] For AAV9 delivery into the CSF via cisterna magna, 15 wild-type C57BL/6 mice (n=3 per group) at postnatal day 1 were anesthetized in an induction chamber using 5% isoflurane and oxygen at 3 l/minute before being placed on a red transilluminator (Philips Healthcare “Wee Sight”—product no. 1017920) with their head tilted slightly forward and nose attached to an anesthetic supply. Anesthesia was maintained with 2% isoflurane and oxygen at 0.3 l/minute. A 33-gauge needle attached to a Hamilton syringe and peristaltic pump was lowered approximately 1 mm into the cisterna magna area using stereotaxic apparatus at an angle of 45 degrees, and 1 μl of viral solution (1×1010 vg/μl) was injected at a rate of 1 μl/minute. An equal volume of PBS/35 mmol/l NaCl was used as a control solution.
[0093] For tail vein injections of AAV9, animals aged 3-4 weeks old were placed in a warmer environment (31° C.) for up to 15 minutes and then firmly held with the aid of a restraining device. A heat lamp was used to further dilate the lateral veins in the tail, after which mice received a single intravenous dose of 1×10.sup.12 vg per mouse, in a final volume of 100 pL. Non-treated animals were injected with 100 μL of PBS supplemented with 35 mM NaCl.
EXAMPLE 1
[0094] Genome stability is crucial for cell survival and is maintained by the DNA damage response (DDR). Failure of the DDR to rectify damage has been implicated in a range of neurodegenerative diseases.sup.11,12. We previously demonstrated that the C9orf72 repeat expansion leads to DNA damage via the formation of RNA/DNA hybrids called R-loops, which in turn lead to DNA double stand breaks (DSBs).sup.1. Therefore, correcting this genomic instability in C9ALS/FTD is of therapeutic benefit.
[0095] RuvBL1/2 containing complexes are involved in a range of cellular processes, including the DDR. As part of the TIP60 and Ino80 complexes, RuvBL1/2 are recruited to DNA damage sites to regulate histone modification, DNA accessibility, DDR signal amplification and, ultimately, repair.sup.13-17. We therefore first investigated whether elevating RuvBL1/2 levels could promote DNA damage repair. Chemically induced DNA damage in HeLa cells with camptothecin led to nuclear accumulations of the DSB markers yH2AX and 53BP1 (
EXAMPLE 2
[0096] If modulating RuvBL1/2 levels in C9ALS/FTD patients was to be considered as a therapeutic approach, we next investigated the endogenous expression of RuvBL1 and RuvBL2 in C9ALS/FTD patient cells. All 3 C9ALS/FTD patients iNPCs showed significantly less RuvBL1 protein compared to their age and sex matched controls (
EXAMPLE 3
[0097] Recently RuvBL1/2 have been implicated in protein folding and aggregate clearance.sup.18, 19. The C9orf72-repeat expansion is aberrantly translated into 5 species of DPR proteins: poly GA, GR, GP, PA and PR. Since these C9orf72 associated DPR proteins form toxic aggregates within cells, we investigated whether RuvBL1/2 overexpression could promote C9ALS/FTD-associated DPR clearance. HeLa cells were co-transfected with either poly GA, GR or PR, considered the three most toxic DPRs, along with empty vector control, FLAG-RuvBL1 or HA-RuvBL2. Overexpression or RuvBL1 and RuvBL2 led to a significant reduction in the amount of GA and GR DPR proteins as quantified by dot blot (
EXAMPLE 4
[0098] Previous studies have indicated that reduced levels of RuvBL1/2 can lead to defective DNA damage repair and DNA damage hypersensitivity .sup.17. Since C9ALS/FTD patient have reduced expression of either RuvBL1 and/or RuvBL2 (
EXAMPLE 5
[0099] Since RuvBL1 and RuvBL2 are involved in aggregate protein clearance, we next investigated the effect of RuvBL1/2 knockdown on the autophagic degradation pathway. HeLa cells treated with control, RuvBL1 or RuvBL2 targeting siRNA were analysed by western blot for two of the most commonly assessed autophagy associated proteins p62 and LC3-II. P62 is an autophagy receptor protein and delivery autophagy substrates, including protein aggregates, to the autophagosome for lysosomal degradation. Knockdown of both RuvBL1 and RuvBL2 led to a significant reduction in p62 protein levels (
[0100] Further to this, we have previously demonstrated that the C9orf72 protein is itself involved in autophagy .sup.21. This therefore leads to the hypothesis of a toxic feedforward mechanism, whereby haploinsufficiency of C9orf72 leads to defective autophagy, therefore preventing the efficient clearance of the C9orf72-associated DPR autophagy substrates, and leading to their toxic accumulation. The C9orf72 protein is now known to function as part of a complex with SMCR8 and WDR41, and the presence of C9orf72 appears to stabilise SMCR8 as part of this complex.sup.22. Indeed, loss of C9orf72 appears to reduce SMCR8 expression and stability .sup.23,24. A wide range of other C9orf72 interacting partners have been described and interestingly a number of mass spectroscopy screens have identified RuvBL1 or RuvBL2 as potential interactors of the C9orf72 complex.sup.25-27. We therefore investigated whether RuvBL1 and RuvBL2 could interact with C9orf72. HeLa cells were co-transfected with empty vector control or Myc-C9orf72 along with FLAG-RuvBL1 or HA-RuvBL2. Myc-C9orf72 was immunoprecipitated from cell lysates with anti-Myc antibodies, and immune pellets probed for FLAG-RuvBL1 and HA-RuvBL2. An efficient co-immunoprecipitation was observed between C9orf72 and RuvBL1, indicating they are indeed interacting partners (
[0101] Together these data support our proposal of increasing RuvBL1/2 levels to alleviate a number of the pathogenic mechanisms associated with the C9orf72 repeat expansion.
REFERENCES
[0102] 1 Walker, C. et al. C9orf72 expansion disrupts ATM-mediated chromosomal break repair. Nat Neurosci 20, 1225-1235, doi:10.1038/nn.4604 (2017). [0103] 2 Matias, P. M., Gorynia, S., Donner, P. & Carrondo, M. A. Crystal structure of the human AAA+ protein RuvBL1. J Biol Chem 281, 38918-38929, doi:10.1074/jbc.M605625200 (2006). [0104] 3 Puri, T., Wendler, P., Sigala, B., Saibil, H. & Tsaneva, I. R. Dodecameric structure and ATPase activity of the human TIP48/TIP49 complex. J Mol Biol 366, 179-192, doi:10.1016/j.jmb.2006.11.030 (2007). [0105] 4 Torreira, E. et al. Architecture of the pontin/reptin complex, essential in the assembly of several macromolecular complexes. Structure 16, 1511-1520, doi:10.1016/j.str.2008.08.009 (2008). [0106] 5 Lakomek, K., Stoehr, G., Tosi, A., Schmailzl, M. & Hopfner, K. P. Structural basis for dodecameric assembly states and conformational plasticity of the full-length AAA+ATPases Rvb1 . Rvb2. Structure 23, 483-495, doi:10.1016/j.str.2014.12.015 (2015). [0107] 6 Gorynia, S. et al. Structural and functional insights into a dodecameric molecular machine—the RuvBL1/RuvBL2 complex. J Struct Biol 176, 279-291, doi:10.1016/j.jsb.2011.09.001 (2011). [0108] 7 Huen, J. et al. Rvb1-Rvb2: essential ATP-dependent helicases for critical complexes. Biochem Cell Biol 88, 29-40, doi:10.1139/o09-122 (2010). [0109] 8 Nano, N. & Houry, W. A. Chaperone-like activity of the AAA+ proteins Rvb1 and Rvb2 in the assembly of various complexes. Philos Trans R Soc Lond B Biol Sci 368, 20110399, doi:10.1098/rstb.2011.0399 (2013). [0110] 9 Jha, S. & Dutta, A. RVB1/RVB2: running rings around molecular biology. Mol Cell 34, 521-533, doi:10.1016/j.molcel.2009.05.016 (2009). [0111] 10 Meyer, K. et al. Direct conversion of patient fibroblasts demonstrates non-cell autonomous toxicity of astrocytes to motor neurons in familial and sporadic ALS. Proceedings of the National Academy of Sciences 111, 829-832, doi:10.1073/pnas.1314085111 (2014). [0112] 11 McKinnon, P. J. ATM and the molecular pathogenesis of ataxia telangiectasia. Annu Rev Pathol 7, 303-321, doi:10.1146/annurev-pathol-011811-132509 (2012). [0113] 12 Obulesu, M. & Rao, D. M. DNA damage and impairment of DNA repair in Alzheimer's disease. Int J Neurosci 120, 397-403, doi:10.3109/00207450903411133 (2010). [0114] 13 Jha, S., Gupta, A., Dar, A. & Dutta, A. RVBs are required for assembling a functional TIP60 complex. Mol Cell Biol 33, 1164-1174, doi:10.1128/MCB.01567-12 (2013). [0115] 14 Jha, S., Shibata, E. & Dutta, A. Human Rvb1/Tip49 is required for the histone acetyltransferase activity of Tip60/NuA4 and for the downregulation of phosphorylation on H2AX after DNA damage. Mol Cell Biol 28, 2690-2700, doi:10.1128/MCB.01983-07 (2008). [0116] 15 Ikura, T. et al. DNA damage-dependent acetylation and ubiquitination of H2AX enhances chromatin dynamics. Mol Cell Biol 27, 7028-7040, doi:10.1128/MCB.00579-07 (2007). [0117] 16 Murr, R. et al. Histone acetylation by Trrap-Tip60 modulates loading of repair proteins and repair of DNA double-strand breaks. Nat Cell Biol 8, 91-99, doi:10.1038/ncb1343 (2006). [0118] 17 Wu, S. et al. A YY1-IN080 complex regulates genomic stability through homologous recombination-based repair. Nat Struct Mol Biol 14, 1165-1172, doi:10.1038/nsmb1332 (2007). [0119] 18 Zaarur, N. et al. RuvbL1 and RuvbL2 enhance aggresome formation and disaggregate amyloid fibrils. EMBO J 34, 2363-2382, doi:10.15252/embj.201591245 (2015). [0120] 19 Narayanan, A. et al. A first order phase transition mechanism underlies protein aggregation in mammalian cells. Elife 8, doi:10.7554/eLife.39695 (2019). [0121] 20 Boivin, M. et al. Reduced autophagy upon C9ORF72 loss synergizes with dipeptide repeat protein toxicity in G4C2 repeat expansion disorders. EMBO J 39, e100574, doi:10.15252/embj.2018100574 (2020). [0122] 21 Webster, C. P. et al. The C9orf72 protein interacts with Rabi a and the ULK1 complex to regulate initiation of autophagy. The EMBO Journal 35, 1656-1627, doi:10.15252/embj.201694401 (2016). [0123] 22 Su, M. Y., Fromm, S. A., Zoncu, R. & Hurley, J. H. Structure of the C9orf72 ARF GAP complex that is haploinsufficient in ALS and FTD. Nature 585, 251-255, doi:10.1038/s41586-020-2633-x (2020). [0124] 23 Amick, J., Roczniak-Ferguson, A. & Ferguson, S. M. C9orf72 binds SMCR8, localizes to lysosomes and regulates mTORC1 signaling. Mol Biol Cell, doi:10.1091/mbc.E16-01-0003 (2016). [0125] 24 Zhang, Y. et al. The C9orf72-interacting protein Smcr8 is a negative regulator of autoimmunity and lysosomal exocytosis. Genes Dev 32, 929-943, doi:10.1101/gad.313932.118 (2018). [0126] 25 Sivadasan, R. et al. C9ORF72 interaction with cofilin modulates actin dynamics in motor neurons. Nat Neurosci 19, 1610-1618, doi:10.1038/nn.4407 (2016). [0127] 26 Chitiprolu, M. et al. A complex of C9ORF72 and p62 uses arginine methylation to eliminate stress granules by autophagy. Nat Commun 9, 2794, doi:10.1038/s41467-018-05273-7 (2018). [0128] 27 Goodier, J. L. et al. C9orf72-associated SMCR8 protein binds in the ubiquitin pathway and with proteins linked with neurological disease. Acta Neuropathol Commun 8, 110, doi:10.1186/s40478-020-00982-x (2020).