Modulation of Dystrophia Myotonica-Protein Kinase (DMPK) Expression

20200362353 ยท 2020-11-19

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are methods, compounds, and compositions for reducing expression of a DMPK mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate type 1 myotonic dystrophy, or a symptom thereof.

Claims

1.-22. (canceled)

23. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 85% complementary to at least 12 contiguous nucleobases of: an equal length portion of nucleobases 178-233 of SEQ ID NO:1; an equal length portion of nucleobases 232-253 of SEQ ID NO:1; an equal length portion of nucleobases 279-299 of SEQ ID NO:1; an equal length portion of nucleobases 366-399 of SEQ ID NO:1; an equal length portion of nucleobases 519-541 of SEQ ID NO:1; an equal length portion of nucleobases 923-975 of SEQ ID NO:1; an equal length portion of nucleobases 1073-1105 of SEQ ID NO:1; an equal length portion of nucleobases 1171-1196 of SEQ ID NO:1; an equal length portion of nucleobases 1178-1206 of SEQ ID NO:1; an equal length portion of nucleobases 1215-1246 of SEQ ID NO:1; an equal length portion of nucleobases 1263-1324 of SEQ ID NO:1; an equal length portion of nucleobases 1706-1734 of SEQ ID NO:1; an equal length portion of nucleobases 1743-1763 of SEQ ID NO:1; an equal length portion of nucleobases 1932-1979 of SEQ ID NO:1; an equal length portion of nucleobases 1981-2003 of SEQ ID NO:1; an equal length portion of nucleobases 2077-2108 of SEQ ID NO:1; an equal length portion of nucleobases 2152-2173 of SEQ ID NO:1; an equal length portion of nucleobases 2159-2182 of SEQ ID NO:1; an equal length portion of nucleobases 2174-2196 of SEQ ID NO:1; an equal length portion of nucleobases 2426-2447 of SEQ ID NO:1; an equal length portion of nucleobases 2450-2518 of SEQ ID NO:1; an equal length portion of nucleobases 2679-2725 of SEQ ID NO:1; an equal length portion of nucleobases 1251-1303 of SEQ ID NO:2; an equal length portion of nucleobases 1305-1326 of SEQ ID NO:2; an equal length portion of nucleobases 1352-1372 of SEQ ID NO:2; an equal length portion of nucleobases 3762-3795 of SEQ ID NO:2; an equal length portion of nucleobases 4170-4192 of SEQ ID NO:2; an equal length portion of nucleobases 5800-5852 of SEQ ID NO:2; an equal length portion of nucleobases 6124-6149 of SEQ ID NO:2; an equal length portion of nucleobases 6168-6199 of SEQ ID NO:2; an equal length portion of nucleobases 6216-6277 of SEQ ID NO:2; an equal length portion of nucleobases 11979-12007 of SEQ ID NO:2; an equal length portion of nucleobases 12016-12036 of SEQ ID NO:2; an equal length portion of nucleobases 12993-13042 of SEQ ID NO:2; an equal length portion of nucleobases 13044-13066 of SEQ ID NO:2; an equal length portion of nucleobases 13140-13171 of SEQ ID NO:2; or an equal length portion of nucleobases 13215-13236 of SEQ ID NO:2.

24. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12 contiguous nucleobases of any of the sequences recited in SEQ ID NOs: 12-156, 160-697, or 802-837.

25. The compound of claim 23, wherein the modified oligonucleotide is a single-stranded oligonucleotide.

26. The compound of claim 23, wherein the nucleobase sequence of the modified oligonucleotide is 90% or 100% complementary to SEQ ID NOs: 1-2 or 801.

27. The compound of claim 23, wherein at least one internucleoside linkage is a modified internucleoside linkage.

28. The compound of claim 23, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

29. The compound of claim 23, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

30. The compound of claim 23, wherein at least one nucleoside comprises a modified sugar.

31. The compound of claim 30, wherein at least one modified sugar is a bicyclic sugar.

32. The compound of claim 30, wherein at least one modified sugar comprises a 2-Omethoxyethyl.

33. The compound of claim 23, wherein at least one nucleoside comprises a modified nucleobase.

34. The compound of claim 33, wherein the modified nucleobase is a 5-methylcytosine.

35. The compound of claim 23, wherein the modified oligonucleotide comprises: a gap segment consisting of linked deoxynucleosides; a 5 wing segment consisting of linked nucleosides; a 3 wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment; and wherein each nucleoside of each wing segment comprises a modified sugar.

36. The compound of claim 35, wherein the modified oligonucleotide consists of 20 linked nucleosides and comprises: gap segment consisting of ten linked deoxynucleosides; a 5 wing segment consisting of five linked nucleosides; a 3 wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment; wherein each nucleoside of each wing segment comprises a 2-Omethoxyethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.

37. The compound of claim 23, wherein the compound consists of 20 linked nucleosides.

38. The compound of claim 23, wherein the compound comprises a conjugate group.

39. A composition comprising the compound of claim 23 and a pharmaceutically acceptable carrier or diluent.

40. A method of treating a DMPK related disease or a symptom thereof in an animal, wherein the method comprises administering to said animal a therapeutically effective amount of the compound of claim 23 or the composition of claim 39.

41. The method of claim 40, wherein the DMPK related disease or a symptom thereof is: a. myotonia, or b. spliceopathy.

42. The method of claim 41, wherein the DMPK related disease or a symptom thereof is type 1 myotonic dystrophy.

43. The method of claim 42, wherein the DMPK related disease or a symptom thereof is MBNL dependent spliceopathy.

Description

DETAILED DESCRIPTION

[0017] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. Herein, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including as well as other forms, such as includes and included, is not limiting. Also, terms such as element or component encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0018] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

[0019] Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

[0020] Unless otherwise indicated, the following terms have the following meanings:

[0021] 2-O-methoxyethyl (also 2-MOE and 2-O(CH.sub.2).sub.2OCH.sub.3) refers to an O-methoxy-ethyl modification of the 2 position of a furanosyl ring. A 2-O-methoxyethyl modified sugar is a modified sugar.

[0022] 2-O-methoxyethyl nucleotide means a nucleotide comprising a 2-O-methoxyethyl modified sugar moiety.

[0023] 5-methylcytosine means a cytosine modified with a methyl group attached to position 5. A 5-methylcytosine is a modified nucleobase.

[0024] About means within 7% of a value. For example, if it is stated, the compound affected at least 70% inhibition of DMPK, it is implied that the DMPK levels are inhibited within a range of 63% and 77%.

[0025] Active pharmaceutical agent means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments an antisense oligonucleotide targeted to DMPK is an active pharmaceutical agent.

[0026] Active target region or target region means a region to which one or more active antisense compounds is targeted. Active antisense compounds means antisense compounds that reduce target nucleic acid levels or protein levels.

[0027] Administered concomitantly refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

[0028] Administering means providing an agent to an animal, and includes, but is not limited to, administering by a medical professional and self-administering.

[0029] Agent means an active substance that can provide a therapeutic benefit when administered to an animal. First Agent means a therapeutic compound of the invention. For example, a first agent can be an antisense oligonucleotide targeting DMPK. Second agent means a second therapeutic compound of the invention (e.g. a second antisense oligonucleotide targeting DMPK) and/or a non-DMPK therapeutic compound.

[0030] Amelioration refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art.

[0031] Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0032] Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

[0033] Antisense compound means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, snoRNAs, miRNAs, and satellite repeats.

[0034] Antisense inhibition means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

[0035] Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

[0036] Bicyclic sugar means a furanosyl ring modified by the bridging of two non-geminal carbon ring atoms. A bicyclic sugar is a modified sugar.

[0037] Bicyclic nucleic acid or BNA refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.

[0038] Cap structure or terminal cap moiety means chemical modifications, which have been incorporated at either terminus of an antisense compound.

[0039] Chemically distinct region refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2-O-methoxyethyl modifications.

[0040] Chimeric antisense compound means an antisense compound that has at least two chemically distinct regions.

[0041] Co-administration means administration of two or more agents to an individual. The two or more agents can be in a single pharmaceutical composition, or can be in separate pharmaceutical compositions. Each of the two or more agents can be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

[0042] Complementarity means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0043] Contiguous nucleobases means nucleobases immediately adjacent to each other.

[0044] CUGexp DMPK means mutant DMPK RNA containing an expanded CUG repeat (CUGexp). The wild-type DMPK gene has 5-37 CTG repeats in the 3 untranslated region. In a CUGexp DMPK (such as in a myotonic dystrophy type I patient) this number is significantly expanded and is, for example, in the range of 50 to greater than 3,500 (Harper, Myotonic Dystrophy (Saunders, London, ed. 3, 2001); Annu. Rev. Neurosci. 29: 259, 2006; EMBO J. 19: 4439, 2000; Curr Opin Neurol. 20: 572, 2007).

[0045] Diluent means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

[0046] DMPK means any nucleic acid or protein of DMPK. DMPK can be a mutant DMPK including CUGexp DMPK nucleic acid.

[0047] DMPK expression means the level of mRNA transcribed from the gene encoding DMPK or the level of protein translated from the mRNA. DMPK expression can be determined by art known methods such as a Northern or Western blot.

[0048] DMPK nucleic acid means any nucleic acid encoding DMPK. For example, in certain embodiments, a DMPK nucleic acid includes a DNA sequence encoding DMPK, an RNA sequence transcribed from DNA encoding DMPK (including genomic DNA comprising introns and exons), and an mRNA or pre-mRNA sequence encoding DMPK. DMPK mRNA means an mRNA encoding a DMPK protein.

[0049] Dose means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose can be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections can be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses can be stated as the amount of pharmaceutical agent per hour, day, week, or month.

[0050] Effective amount or therapeutically effective amount means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount can vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

[0051] Fully complementary or 100% complementary means each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

[0052] Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as a gap segment and the external regions can be referred to as wing segments.

[0053] Gap-widened means a chimeric antisense compound having a gap segment of 12 or more contiguous 2-deoxyribonucleosides positioned between and immediately adjacent to 5 and 3 wing segments having from one to six nucleosides.

[0054] Hybridization means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.

[0055] Identifying an animal with type 1 myotonic dystrophy means identifying an animal having been diagnosed with a type 1 myotonic dystrophy, disorder or condition or identifying an animal predisposed to develop a type 1 myotonic dystrophy, disorder or condition. For example, individuals with a familial history can be predisposed to type 1 myotonic dystrophy, disorder or condition. Such identification can be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.

[0056] Immediately adjacent means there are no intervening elements between the immediately adjacent elements.

[0057] Individual means a human or non-human animal selected for treatment or therapy.

[0058] Internucleoside linkage refers to the chemical bond between nucleosides.

[0059] Linked nucleosides means adjacent nucleosides which are bonded or linked together by an internucleoside linkage.

[0060] Mismatch or non-complementary nucleobase refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

[0061] Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

[0062] Modified nucleobase refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An unmodified nucleobase means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0063] Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A modified nucleoside means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.

[0064] Modified oligonucleotide means an oligonucleotide comprising at least one modified nucleotide.

[0065] Modified sugar refers to a substitution or change from a natural sugar.

[0066] Motif means the pattern of chemically distinct regions in an antisense compound.

[0067] Myotonia means an abnormally slow relaxation of a muscle after voluntary contraction or electrical stimulation.

[0068] Nuclear ribonuclease means a ribonuclease found in the nucleus. Nuclear ribonucleases include, but are not limited to, RNase H including RNase H1 and RNase H2, the double stranded RNase drosha and other double stranded RNases.

[0069] Naturally occurring internucleoside linkage means a 3 to 5 phosphodiester linkage.

[0070] Natural sugar moiety means a sugar found in DNA (2-H) or RNA (2-OH).

[0071] Nucleic acid refers to molecules composed of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA). A nucleic acid can also comprise a combination of these elements in a single molecule.

[0072] Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

[0073] Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.

[0074] Nucleoside means a nucleobase linked to a sugar.

[0075] Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units.

[0076] Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0077] Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by N(H)C(O)O or other non-phosphodiester linkage).

[0078] Oligomeric compound or oligomer means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

[0079] Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

[0080] Parenteral administration means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short or intermittent.

[0081] Peptide means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.

[0082] Pharmaceutical composition means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition can comprise one or more active agents and a sterile aqueous solution.

[0083] Pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0084] Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

[0085] Portion means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

[0086] Preferentially reducing CUG exp DMPK RNA refers to a preferential reduction of RNA transcripts from a CUGexp DMPK allele relative to RNA transcripts from a normal DMPK allele.

[0087] Prevent refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.

[0088] Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.

[0089] Side effects means physiological responses attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum can indicate liver toxicity or liver function abnormality. For example, increased bilirubin can indicate liver toxicity or liver function abnormality.

[0090] Single-stranded oligonucleotide means an oligonucleotide which is not hybridized to a complementary strand.

[0091] Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.

[0092] Spliceopathy means a change in the alternative splicing of one or more RNAs that leads to the expression of altered splice products in a particular tissue.

[0093] Subcutaneous administration means administration just below the skin.

[0094] Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.

[0095] Targeting or targeted means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0096] Target nucleic acid, target RNA, and target RNA transcript all refer to a nucleic acid capable of being targeted by antisense compounds.

[0097] Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. 5 target site refers to the 5-most nucleotide of a target segment.

[0098] 3 target site refers to the 3-most nucleotide of a target segment.

[0099] Therapeutically effective amount means an amount of an agent that provides a therapeutic benefit to an individual.

[0100] Treat refers to administering a pharmaceutical composition to effect an alteration or improvement of a disease, disorder, or condition.

[0101] Type 1 myotonic dystrophy or DM1 means an autosomal dominant disorder caused by expansion of a non-coding CTG repeat in DMPK. This mutation leads to RNA dominance, a process in which expression of RNA containing an expanded CUG repeat (CUGexp) induced cell dysfunction. The CUGexp tract interacts with RNA binding proteins and causes the mutant transcript to be retained in nuclear foci. The toxicity of this RNA stems from sequestration of RNA binding proteins and activation of signaling pathways.

[0102] Unmodified nucleotide means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. -D-ribonucleosides) or a DNA nucleotide (i.e. -D-deoxyribonucleoside).

Certain Embodiments

[0103] Certain embodiments provide methods, compounds, and compositions for inhibiting DMPK expression.

[0104] Certain embodiments provide a method of reducing DMPK expression in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeting DMPK.

[0105] Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeted to DMPK, wherein the modified oligonucleotide preferentially reduces CUGexp DMPK RNA, reduces myotonia or reduces spliceopathy in the animal.

[0106] Certain embodiments provide a method of administering an antisense oligonucleotide to counteract RNA dominance by directing the cleavage of pathogenic transcripts.

[0107] Certain embodiments provide a method of reducing spliceopathy of Serca1. In certain embodiments, methods provided herein result in exon 22 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0108] Certain embodiments provide a method of reducing spliceopathy of m-Titin. In certain embodiments, methods provided herein result in exon 5 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0109] Certain embodiments provide a method of reducing spliceopathy of Clcn1. In certain embodiments, methods provided herein result in exon 7a inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0110] Certain embodiments provide a method of reducing spliceopathy of Zasp. In certain embodiments, methods provided herein result in exon 11 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0111] Certain embodiments provide a method for treating an animal with type 1 myotonic dystrophy comprising: a) identifying said animal with type 1 myotonic dystrophy, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide targeted to DMPK. In certain embodiments, the therapeutically effective amount of the compound administered to the animal preferentially reduces CUGexp DMPK RNA, reduces myotonia or reduces spliceopathy in the animal.

[0112] Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including administering to the subject suspected of having type 1 myotonic dystrophy or having a CUGexp DMPK RNA a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to said CUGexp DMPK RNA, achieves a preferential reduction of the CUGexp DMPK RNA.

[0113] Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including selecting a subject having type 1 myotonic dystrophy or having a CUGexp DMPK RNA and administering to said subject a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to the CUGexp DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby achieving a preferential reduction of the CUGexp DMPK RNA in the nucleus.

[0114] Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including selecting a subject having type 1 myotonic dystrophy or having a mutant or CUGexp DMPK RNA and systemically administering to said subject a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to the mutant or CUGexp DMPK RNA, achieves a preferential reduction of the mutant or CUGexp DMPK RNA.

[0115] Certain embodiments provide a method of reducing myotonia in a subject in need thereof. The method includes administering to the subject a modified antisense oligonucleotide complementary to a non-repeat region of a DMPK RNA, wherein the modified antisense oligonucleotide, when bound to the DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby reducing myotonia. In certain embodiments, the subject has or is suspected of having type 1 myotonic dystrophy or having a mutant DMPK RNA or CUGexp DMPK RNA. In certain embodiments, the DMPK RNA is nuclear retained.

[0116] Certain embodiments provide a method of reducing spliceopathy in a subject in need thereof. The method includes administering to the subject a modified antisense oligonucleotide complementary to a non-repeat region of a DMPK RNA, wherein the modified antisense oligonucleotide, when bound to the DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby reducing spliceopathy. In certain embodiments, the subject has or is suspected of having type 1 myotonic dystrophy or having a nuclear retained CUGexp DMPK RNA. In certain embodiments, the DMPK RNA is nuclear retained. In certain embodiments, the spliceopathy is MBNL dependent spliceopathy.

[0117] In certain embodiments, the modified antisense oligonucleotide of the methods is chimeric. In certain embodiments, the modified antisense oligonucleotide of the methods is a gapmer.

[0118] In certain embodiments of the methods provided herein, the administering is subcutaneous. In certain embodiments, the administering is intravenous.

[0119] In certain embodiments, the modified antisense oligonucleotide of the methods targets a non-coding sequence within the non-repeat region of a DMPK RNA. In certain embodiments, the oligonucleotide targets a coding region, an intron, a 5UTR, or a 3UTR of the mutant DMPK RNA.

[0120] In certain embodiments of the methods provided herein, the nuclear ribonuclease is RNase H1.

[0121] In certain embodiments of the methods, the DMPK RNA is reduced in muscle tissue. In certain embodiments, the mutant DMPK RNA CUGexp DMPK RNA is preferentially reduced.

[0122] In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001081560.1 (incorporated herein as SEQ ID NO: 1). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106 (incorporated herein as SEQ ID NO: 2). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NT_039413.7 truncated from nucleotides 16666001 to Ser. No. 16/681,000 (incorporated herein as SEQ ID NO: 3). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_032418.1 (incorporated herein as SEQ ID NO: 4). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. AI007148.1 (incorporated herein as SEQ ID NO: 5). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. AI304033.1 (incorporated herein as SEQ ID NO: 6). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC024150.1 (incorporated herein as SEQ ID NO: 7). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC056615.1 (incorporated herein as SEQ ID NO: 8). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC075715.1 (incorporated herein as SEQ ID NO: 793). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BU519245.1 (incorporated herein as SEQ ID NO: 794). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CB247909.1 (incorporated herein as SEQ ID NO: 795). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CX208906.1 (incorporated herein as SEQ ID NO: 796). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CX732022.1 (incorporated herein as SEQ ID NO: 797). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. S60315.1 (incorporated herein as SEQ ID NO: 798). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. S60316.1 (incorporated herein as SEQ ID NO: 799). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001081562.1 (incorporated herein as SEQ ID NO: 800). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001100.3 (incorporated herein as SEQ ID NO: 801).

[0123] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 9, at least 10, or at least 11, contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792.

[0124] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 12 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 13, or at least 14, contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792.

[0125] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 15 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 16, or at least 17, contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792.

[0126] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 18 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 19 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792.

[0127] In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 1: 1178-1206, 2159-2182, 2174-2196, 2426-2447, 2450-2518, 2679-2704, and 2697-2725.

[0128] In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO 1: 178-223, 232-253, 279-299, 366-399, 519-541, 923-975, 1073-1105, 1171-1196, 1215-1246, 1263-1324, 1706-1734, 1743-1763, 1932-1979, 1981-2003, 2077-2108, and 2152-2173.

[0129] In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 2: 1251-1303, 1305-1326, 1352-1372, 3762-3795, 4170-4192, 5800-5852, 6124-6149, 6168-6199, 6216-6277, 11979-12007, 12016-12036, 12993-13042, 13044-13066, 13140-13171, and 13215-13236.

[0130] In certain embodiments, the animal is a human.

[0131] In certain embodiments, the compounds or compositions of the invention are designated as a first agent and the methods of the invention further comprise administering a second agent. In certain embodiments, the first agent and the second agent are co-administered. In certain embodiments the first agent and the second agent are co-administered sequentially or concomitantly.

[0132] In certain embodiments, administration comprises parenteral administration.

[0133] In certain embodiments, the compound is a single-stranded modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to any one of SEQ ID NOs: 1-8 and 793-801 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 100% complementary to any one of SEQ ID NOs: 1-8 and 793-801 as measured over the entirety of said modified oligonucleotide.

[0134] In certain embodiments, at least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0135] In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified sugar. In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar comprises a 2-O-methoxyethyl or a 4-(CH.sub.2).sub.nO-2 bridge, wherein n is 1 or 2.

[0136] In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

[0137] In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5 wing segment consisting of linked nucleosides; and c) a 3 wing segment consisting of linked nucleosides. The gap segment is positioned between the 5 wing segment and the 3 wing segment and each nucleoside of each wing segment comprises a modified sugar.

[0138] In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5 wing segment consisting of five linked nucleosides; and c) a 3 wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5 wing segment and the 3 wing segment, each nucleoside of each wing segment comprises a 2-O-methoxyethyl sugar, each internucleoside linkage of said modified oligonucleotide is a phosphorothioate linkage, and each cytosine in said modified oligonucleotide is a 5-methylcytosine.

[0139] In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

[0140] Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having a gap segment consisting of ten linked deoxynucleosides, a 5 wing segment consisting of five linked nucleosides and a 3 wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5 wing segment and the 3 wing segment, each nucleoside of each wing segment comprises a 2-O-methoxyethyl sugar, each internucleoside linkage of said modified oligonucleotide is a phosphorothioate linkage, each cytosine in said modified oligonucleotide is a 5-methylcytosine.

[0141] Certain embodiments provide the use of any compound as described herein in the manufacture of a medicament for use in any of the therapeutic methods described herein. For example, certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, or preventing type 1 myotonic dystrophy. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for inhibiting expression of DMPK and treating, preventing, delaying or ameliorating a DMPK related disease and or a symptom thereof. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for reducing DMPK expression in an animal. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for preferentially reducing CUGexp DMPK, reducing myotonia, or reducing spliceopathy in an animal. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating an animal with type 1 myotonic dystrophy. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, delaying, or ameliorating symptoms and outcomes associated with development of DM1 including muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for counteracting RNA dominance by directing the cleavage of pathogenic transcripts.

[0142] Certain embodiments provide a kit for treating, preventing, or ameliorating type 1 myotonic dystrophy as described herein wherein the kit comprises: a) a compound as described herein; and optionally b) an additional agent or therapy as described herein. The kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate type 1 myotonic dystrophy.

[0143] Certain embodiments provide any compound or composition as described herein, for use in any of the therapeutic methods described herein. For example, certain embodiments provide a compound or composition as described herein for inhibiting expression of DMPK and treating, preventing, delaying or ameliorating a DMPK related disease and or a symptom thereof. Certain embodiments provide a compound or composition as described herein for use in reducing DMPK expression in an animal. Certain embodiments provide a compound or composition as described herein for use in preferentially reducing CUGexp DMPK, reducing myotonia, or reducing spliceopathy in an animal. Certain embodiments provide a compound or composition as described herein for use in treating an animal with type 1 myotonic dystrophy. Certain embodiments provide a compound or composition as described herein for use in treating, preventing, delaying, or ameliorating symptoms and outcomes associated with development of DM1 including muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. Certain embodiments provide a compound or composition as described herein for use in counteracting RNA dominance by directing the cleavage of pathogenic transcripts. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-156, 160-770, and 774-792.

[0144] Other compounds which can be used in the methods described herein are also provided.

[0145] For example, certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 41, 44, 76, 109, 153, 320, 321, 322, 325, 329, 335, and 657.

[0146] Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20, linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15, 73, 77, 79, 83, 85, 130, 602, 648, 655, 674, and 680.

[0147] Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20, linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, or more, contiguous nucleobases complementary to an equal length portion of nucleobases 664-683, 773-792, 926-945, 927-946, 928-947, 931-950, 935-954, 941-960, 2089-2108, 2163-2182, 2490-2509, 2499-2518, 2676-2695, 2685-2704, 2676-2695, 2688-2707, 2697-2716, 2764-2783, and 2770-2789 of SEQ ID NO: 1, wherein the nucleobase sequence is complementary to SEQ ID NO: 1.

[0148] Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20, linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, or more, contiguous nucleobases complementary to an equal length portion of nucleobases 812-831, 3629-3648, 4447-4466, 4613-4632, 5803-5822, 5804-5823, 5805-5824, 5808-5827, 5818-5837, 6794-6813, 12463-12482, 13152-13171, and 13553-13572 of SEQ ID NO: 2, wherein the nucleobase sequence is complementary to SEQ ID NO: 2.

[0149] In certain embodiments, the modified oligonucleotide is a single-stranded oligonucleotide.

[0150] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%, complementary to any of SEQ ID NOs: 1-8 and 793-801.

[0151] In certain embodiments, at least one internucleoside linkage is a modified internucleoside linkage.

[0152] In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0153] In certain embodiments, at least one nucleoside comprises a modified sugar.

[0154] In certain embodiments, at least one modified sugar is a bicyclic sugar.

[0155] In certain embodiments, at least one modified sugar comprises a 2-O-methoxyethyl.

[0156] In certain embodiments, at least one nucleoside comprises a modified nucleobase.

[0157] In certain embodiments, the modified nucleobase is a 5-methylcytosine.

[0158] In certain embodiments, the modified oligonucleotide comprises:

[0159] a gap segment consisting of linked deoxynucleosides;

[0160] a 5 wing segment consisting of linked nucleosides; and

[0161] a 3 wing segment consisting of linked nucleosides;

[0162] wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

[0163] In certain embodiments, the modified oligonucleotide comprises:

[0164] a gap segment consisting of ten linked deoxynucleosides;

[0165] a 5 wing segment consisting of five linked nucleosides; and

[0166] a 3 wing segment consisting of five linked nucleosides;

[0167] wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment, wherein each nucleoside of each wing segment comprises a 2-O-methoxyethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.

[0168] In certain embodiments, the modified oligonucleotide consists of 14 linked nucleosides.

[0169] In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0170] In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

Antisense Compounds

[0171] Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound can be antisense to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

[0172] In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5 to 3 direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5 to 3 direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

[0173] In certain embodiments, an antisense compound targeted to DMPK as described herein is 10 to 30 nucleotides in length. In other words, the antisense compounds are in some embodiments from 10 to 30 linked nucleobases. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 80, 12 to 30, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values. In certain embodiments, antisense compounds of any of these lengths contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792.

[0174] In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. The shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5 end (5 truncation), or alternatively from the 3 end (3 truncation). A shortened or truncated oligonucleotide can have two nucleosides deleted from the 5 end, or alternatively can have two subunits deleted from the 3 end. Alternatively, the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one nucleoside deleted from the 5 end and one nucleoside deleted from the 3 end.

[0175] When a single additional nucleoside is present in a lengthened oligonucleotide, the additional nucleoside can be located at the 5 or 3 end of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5 end (5 addition), or alternatively to the 3 end (3 addition), of the oligonucleotide. Alternatively, the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one nucleoside added to the 5 end and one subunit added to the 3 end.

[0176] It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

[0177] Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

[0178] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Antisense Compound Motifs

[0179] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

[0180] Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0181] Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer can in some embodiments include -D-ribonucleosides, -D-deoxyribonucleosides, 2-modified nucleosides (such 2-modified nucleosides can include 2-MOE, and 2-OCH.sub.3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides can include those having a 4-(CH.sub.2).sub.nO-2 bridge, where n=1 or n=2). Preferably, each distinct region comprises uniform sugar moieties. The wing-gap-wing motif is frequently described as XYZ, where X represents the length of the 5 wing region, Y represents the length of the gap region, and Z represents the length of the 3 wing region. As used herein, a gapmer described as XYZ has a configuration such that the gap segment is positioned immediately adjacent each of the 5 wing segment and the 3 wing segment. Thus, no intervening nucleotides exist between the 5 wing segment and gap segment, or the gap segment and the 3 wing segment. Any of the antisense compounds described herein can have a gapmer motif In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, gapmers include, but are not limited to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3,2-10-2, 1-10-1,2-8-2, 6-8-6, 5-8-5, 1-8-1, or 2-6-2.

[0182] In certain embodiments, the antisense compound as a wingmer motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or YZ configuration as described above for the gapmer configuration. Thus, wingmer configurations include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4,3-14, 16-2, 18-1, 10-3,2-10, 1-10, 8-2,2-13, or 5-13.

[0183] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 5-10-5 gapmer motif.

[0184] In certain embodiments, an antisense compound targeted to a DMPK nucleic acid has a gap-widened motif.

[0185] In certain embodiments, antisense compounds of any of these gapmer or wingmer motifs contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

[0186] Nucleotide sequences that encode DMPK include, without limitation, the following sequences as set forth in GenBank Accession No. NM_001081560.1 (incorporated herein as SEQ ID NO: 1), GenBank Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NT_039413.7 truncated from nucleotides 16666001 to Ser. No. 16/681,000 (incorporated herein as SEQ ID NO: 3), GenBank Accession No. NM_032418.1 (incorporated herein as SEQ ID NO: 4), GenBank Accession No. AI007148.1 (incorporated herein as SEQ ID NO: 5), GenBank Accession No. AI304033.1 (incorporated herein as SEQ ID NO: 6), GenBank Accession No. BC024150.1 (incorporated herein as SEQ ID NO: 7), GenBank Accession No. BC056615.1 (incorporated herein as SEQ ID NO: 8), GenBank Accession No. BC075715.1 (incorporated herein as SEQ ID NO: 793), GenBank Accession No. BU519245.1 (incorporated herein as SEQ ID NO: 794), GenBank Accession No. CB247909.1 (incorporated herein as SEQ ID NO: 795), GenBank Accession No. CX208906.1 (incorporated herein as SEQ ID NO: 796), GenBank Accession No. CX732022.1 (incorporated herein as SEQ ID NO: 797), GenBank Accession No. S60315.1 (incorporated herein as SEQ ID NO: 798), GenBank Accession No. S60316.1 (incorporated herein as SEQ ID NO: 799), GenBank Accession No. NM_001081562.1 (incorporated herein as SEQ ID NO: 800), and GenBank Accession No. NM_001100.3 (incorporated herein as SEQ ID NO: 801). It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO can comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

[0187] In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region can encompass a 3 UTR, a 5 UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for DMPK can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region can encompass the sequence from a 5 target site of one target segment within the target region to a 3 target site of another target segment within the target region.

[0188] Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

[0189] A target region can contain one or more target segments. Multiple target segments within a target region can be overlapping. Alternatively, they can be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5 target sites or 3 target sites listed herein.

[0190] Suitable target segments can be found within a 5 UTR, a coding region, a 3 UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment can specifically exclude a certain structurally defined region such as the start codon or stop codon.

[0191] The determination of suitable target segments can include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm can be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that can hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

[0192] There can be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in DMPK mRNA levels are indicative of inhibition of DMPK protein expression. Reductions in levels of a DMPK protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes, such as a reducing myotonia or reducing spliceopathy, can be indicative of inhibition of DMPK mRNA and/or protein expression.

Hybridization

[0193] In some embodiments, hybridization occurs between an antisense compound disclosed herein and a DMPK nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

[0194] Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0195] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art (Sambrooke and Russell, Molecular Cloning: A Laboratory Manual, 3.sup.rd Ed., 2001). In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a DMPK nucleic acid.

Complementarity

[0196] An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a DMPK nucleic acid).

[0197] An antisense compound can hybridize over one or more segments of a DMPK nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

[0198] In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a DMPK nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the antisense compounds are at least 70%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a DMPK nucleic acid, a target region, target segment, or specified portion thereof, and contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 12-156, 160-770, and 774-792). Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods, and is measured over the entirety of the antisense compound.

[0199] For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases can be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

[0200] In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, antisense compound can be fully complementary to a DMPK nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, fully complementary means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be fully complementary to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound can be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

[0201] The location of a non-complementary nucleobase can be at the 5 end or 3 end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases can be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they can be either contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

[0202] In certain embodiments, antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a DMPK nucleic acid, or specified portion thereof.

[0203] In certain embodiments, antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a DMPK nucleic acid, or specified portion thereof.

[0204] The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A portion can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least an 8, at least a 9, at least a 10, at least an 11, at least a 12, at least a 13, at least a 14, at least a 15, at least a 16, at least a 17, at least an 18, at least a 19, at least a 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

[0205] The antisense compounds provided herein can also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases can be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

[0206] In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to one or more of the exemplary antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

Modifications

[0207] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2, 3 or 5 hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0208] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

[0209] Chemically modified nucleosides can also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

[0210] The naturally occurring internucleoside linkage of RNA and DNA is a 3 to 5 phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0211] Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

[0212] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties

[0213] Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5 and 2 substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R.sub.1)(R.sub.2) (R, R.sub.1 and R.sub.2 are each independently H, C.sub.1-C.sub.12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2-F-5-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5,2-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5-methyl or a 5-vinyl group).

[0214] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5-vinyl, 5-methyl (R or S), 4-S, 2-F, 2-OCH.sub.3, 2-OCH.sub.2CH.sub.3, 2OCH.sub.2CH.sub.2F and 2-O(CH.sub.2).sub.20CH.sub.3 substituent groups. The substituent at the 2 position can also be selected from allyl, amino, azido, thio, 0-allyl, OC.sub.1-C.sub.10 alkyl, OCF.sub.3, OCH.sub.2F, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), OCH.sub.2C(O)N(R.sub.m)(R.sub.n), and OCH.sub.2C(O)N(R.sub.1)(CH.sub.2).sub.2N(R.sub.m)(R.sub.n), where each R.sub.1, R.sub.m and R.sub.n is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.

[0215] Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4 and the 2 ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4-(CH.sub.2)O-2 (LNA); 4-(CH.sub.2)S-2; 4(CH.sub.2).sub.2O-2 (ENA); 4-CH(CH.sub.3)O-2 and 4-CH(CH.sub.2OCH.sub.3)O-2 (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4-C(CH.sub.3)(CH.sub.3)O-2 (and analogs thereof see PCT/US2008/068922 published as WO/2009/006478, published Jan. 8, 2009); 4-CH.sub.2N(OCH.sub.3)-2 (and analogs thereof see PCT/US2008/064591 published as WO/2008/150729, published Dec. 11, 2008); 4-CH.sub.2ON(CH.sub.3)-2 (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4-CH.sub.2N(R)O-2, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4-CH.sub.2C(H)(CH.sub.3)-2 (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4-CH.sub.2C(CH.sub.2)-2 (and analogs thereof see PCT/US2008/066154 published as WO 2008/154401, published on Dec. 8, 2008).

[0216] Further bicyclic nucleosides have been reported in published literature (see for example: Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wahlestedt et al., Proc. Nat. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; U.S. Pat. Nos. 7,399,845; 7,053,207; 7,034,133; 6,794,499; 6,770,748; 6,670,461; 6,525,191; 6,268,490; U.S. Patent Publication Nos.: US2008-0039618; US2007-0287831; US2004-0171570; U.S. patent application Ser. Nos. 12/129,154; 61/099,844; 61/097,787; 61/086,231; 61/056,564; 61/026,998; 61/026,995; 60/989,574; International applications WO 2007/134181; WO 2005/021570; WO 2004/106356; WO 94/14226; and PCT International Applications Nos.: PCT/US2008/068922; PCT/US2008/066154; and PCT/US2008/064591). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example -L-ribofuranose and -D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).

[0217] In certain embodiments, bicyclic nucleosides comprise a bridge between the 4 and the 2 carbon atoms of the pentofuranosyl sugar moiety including without limitation, bridges comprising 1 or from 1 to 4 linked groups independently selected from [C(R.sub.a)(R.sub.b)].sub.n, C(R.sub.a)C(R.sub.b), C(R.sub.a)N, C(NR.sub.a), C(O), C(S), O, Si(R.sub.a).sub.2, S(O).sub.x, and N(R.sub.a); wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(O)H), substituted acyl, CN, sulfonyl (S(O).sub.2-J.sub.1), or sulfoxyl (S(O)-J.sub.1); and

[0218] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(O)H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.

[0219] In certain embodiments, the bridge of a bicyclic sugar moiety is, [C(R.sub.a)(R.sub.b)].sub.n[C(R.sub.a)(R.sub.b)].sub.nO, C(R.sub.aR.sub.b)N(R)O or C(R.sub.aR.sub.b)ON(R). In certain embodiments, the bridge is 4-CH.sub.2-2, 4(CH.sub.2).sub.2-2, 4(CH.sub.2).sub.3-2, 4CH.sub.2O-2, 4(CH.sub.2).sub.2O-2, 4CH.sub.2ON(R)-2 and 4-CH.sub.2N(R)O-2-wherein each R is, independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.

[0220] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4-(CH.sub.2)O-2 bridge, may be in the -L configuration or in the -D configuration. Previously, -L-methyleneoxy (4-CH.sub.2O-2) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0221] In certain embodiments, bicyclic nucleosides include those having a 4 to 2 bridge wherein such bridges include without limitation, -L-4-(CH.sub.2)O-2, -D-4-CH.sub.2O-2, 4(CH.sub.2).sub.2O-2, 4CH.sub.2ON(R)-2, 4CH.sub.2N(R)O-2, 4CH(CH.sub.3)O-2, 4CH.sub.2S-2, 4CH.sub.2N(R)-2, 4CH.sub.2CH(CH.sub.3)-2, and 4-(CH.sub.2).sub.3-2, wherein R is H, a protecting group or C.sub.1-C.sub.12 alkyl.

[0222] In certain embodiments, bicyclic nucleosides have the formula:

##STR00001##

wherein:

[0223] Bx is a heterocyclic base moiety;

[0224] -Q.sub.a-Q.sub.b-Q.sub.c- is CH.sub.2N(R.sub.c)CH.sub.2, C(O)N(R.sub.c)CH.sub.2, CH.sub.2ON(R.sub.c), CH.sub.2N(R.sub.c)O or N(R.sub.c)OCH.sub.2;

[0225] R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting group; and

[0226] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

[0227] In certain embodiments, bicyclic nucleosides have the formula:

##STR00002##

wherein:

[0228] Bx is a heterocyclic base moiety;

[0229] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0230] Z.sub.a is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.

[0231] In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ.sub.c, NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(X)J.sub.c, and NJ.sub.eC(X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d and J.sub.e is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted C.sub.1-C.sub.6 alkyl and X is O or NJ.

[0232] In certain embodiments, bicyclic nucleosides have the formula:

##STR00003##

wherein:

[0233] Bx is a heterocyclic base moiety;

[0234] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0235] Z.sub.b is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl or substituted acyl (C(O)).

[0236] In certain embodiments, bicyclic nucleosides have the formula:

##STR00004##

wherein:

[0237] Bx is a heterocyclic base moiety;

[0238] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0239] R.sub.d is C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;

[0240] each q.sub.a, q.sub.b, q.sub.c and q.sub.d is, independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxyl, substituted C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6 aminoalkyl or substituted C.sub.1-C.sub.6 aminoalkyl;

[0241] In certain embodiments, bicyclic nucleosides have the formula:

##STR00005##

wherein:

[0242] Bx is a heterocyclic base moiety;

[0243] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0244] q.sub.a, q.sub.b, q.sub.e and q.sub.f are each, independently, hydrogen, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxy, substituted C.sub.1-C.sub.12 alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(O)OJ.sub.j, C(O)NJ.sub.jJ.sub.k, C(O)J.sub.j, OC(O)NJ.sub.jJ.sub.k, N(H)C(NH)NJ.sub.jJ.sub.k, N(H)C(O)NJ.sub.jJ.sub.k or N(H)C(S)NJ.sub.jJ.sub.k;

[0245] or q.sub.e and q.sub.f together are C(q.sub.g)(q.sub.h);

[0246] q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.

[0247] The synthesis and preparation of adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4-CH.sub.2O-2 bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.

[0248] Analogs of various bicyclic nucleosides that have 4 to 2 bridging groups such as 4-CH.sub.2O-2 and 4-CH.sub.2S-2, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2-amino- and 2-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

[0249] In certain embodiments, bicyclic nucleosides have the formula:

##STR00006##

wherein:

[0250] Bx is a heterocyclic base moiety;

[0251] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0252] each q.sub.i, q.sub.j, q.sub.k and q.sub.i is, independently, H, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxyl, substituted C.sub.1-C.sub.12 alkoxyl, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(O)OJ.sub.j, C()NJ.sub.jJ.sub.k, C(O)J.sub.j, OC(O)NJ.sub.jJ.sub.k, N(H)C(NH)NJ.sub.jJ.sub.k, N(H)C(O)NJ.sub.jJ.sub.k or N(H)C(S)NJ.sub.jJ.sub.k; and

[0253] q.sub.i and q.sub.j or q.sub.i and q.sub.k together are C(q.sub.g)(q.sub.h), wherein q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.

[0254] One carbocyclic bicyclic nucleoside having a 4-(CH.sub.2).sub.3-2 bridge and the alkenyl analog bridge 4-CHCHCH.sub.2-2 have been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0255] In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) -L-methyleneoxy (4-CH.sub.2O-2) BNA, (B) -D-methyleneoxy (4-CH.sub.2O-2) BNA, (C) ethyleneoxy (4-(CH.sub.2).sub.2O-2) BNA, (D) aminooxy (4-CH.sub.2ON(R)-2) BNA, (E) oxyamino (4-CH.sub.2N(R)O-2) BNA, (F) methyl(methyleneoxy) (4-CH(CH.sub.3)O-2) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4-CH.sub.2S-2) BNA, (H) methylene-amino (4-CH.sub.2N(R)-2) BNA, (I) methyl carbocyclic (4-CH.sub.2CH(CH.sub.3)-2) BNA, (J) propylene carbocyclic (4-(CH.sub.2).sub.3-2) BNA, and (K) vinyl BNA as depicted below.

##STR00007## ##STR00008##

wherein Bx is the base moiety and R is, independently, H, a protecting group, C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy.

[0256] In certain embodiments, nucleosides are modified by replacement of the ribosyl ring with a sugar surrogate. Such modification includes without limitation, replacement of the ribosyl ring with a surrogate ring system (sometimes referred to as DNA analogs) such as a morpholino ring, a cyclohexenyl ring, a cyclohexyl ring or a tetrahydropyranyl ring such as one having one of the formula:

##STR00009##

[0257] In certain embodiments, sugar surrogates are selected having the formula:

##STR00010##

wherein:

[0258] Bx is a heterocyclic base moiety;

[0259] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the oligomeric compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group or a 5 or 3-terminal group;

q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl; and

[0260] one of R.sub.1 and R.sub.2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(X)J.sub.1, OC(X)NJ.sub.1J.sub.2, NJ.sub.3C(X)NJ.sub.1J.sub.2 and CN, wherein X is O, S or NJ.sub.1 and each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

[0261] In certain embodiments, q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H; R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.

[0262] Such sugar surrogates include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), altritol nucleic acid (ANA), and mannitol nucleic acid (MNA) (see Leumann, C. J., Bioorg. & Med. Chem., 2002, 10, 841-854).

[0263] In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvith et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have the formula:

##STR00011##

wherein:

[0264] Bx is a heterocyclic base moiety;

[0265] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5- or 3-terminal group; and q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6, q.sub.7, q.sub.8 and q.sub.9 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or other sugar substituent group.

[0266] Many other bicyclic and tricyclic sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Christian J., Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.

[0267] Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed Jun. 2, 2005 and published as WO 2005/121371 on Dec. 22, 2005, and each of which is herein incorporated by reference in its entirety.

[0268] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

[0269] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2-MOE. In certain embodiments, the 2-MOE modified nucleotides are arranged in a gapmer motif.

Modified Nucleobases

[0270] Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

[0271] Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (CCCH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

[0272] Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

[0273] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more modified nucleobases. In certain embodiments, gap-widened antisense oligonucleotides targeted to a DMPK nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Compositions and Methods for Formulating Pharmaceutical Compositions

[0274] Antisense oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0275] Antisense compound targeted to a DMPK nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a DMPK nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

[0276] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0277] A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense Compounds

[0278] Antisense compounds can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

[0279] Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5-terminus (5-cap), or at the 3-terminus (3-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy a basic caps. Further 3 and 5-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.

Cell Culture and Antisense Compounds Treatment

[0280] The effects of antisense compounds on the level, activity or expression of DMPK nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park, N.C.; Clonetics Corporation, Walkersville, Md.) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, primary hepatocytes, A549 cells, GM04281 fibroblasts and LLC-MK2 cells.

In Vitro Testing of Antisense Oligonucleotides

[0281] Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

[0282] In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.

[0283] One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN@ (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

[0284] Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE 2000@ (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE 2000@ in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

[0285] Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with Cytofectin in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

[0286] Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

[0287] Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

[0288] The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE 2000@, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA Isolation

[0289] RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.

Analysis of Inhibition of Target Levels or Expression

[0290] Inhibition of levels or expression of a DMPK nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels

[0291] Quantitation of target RNA levels can be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

[0292] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.

[0293] Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, Calif.). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invitrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

[0294] Probes and primers are designed to hybridize to a DMPK nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and can include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, Calif.).

Analysis of Protein Levels

[0295] Antisense inhibition of DMPK nucleic acids can be assessed by measuring DMPK protein levels. Protein levels of DMPK can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.

In Vivo Testing of Antisense Compounds

[0296] Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of DMPK and produce phenotypic changes. Testing can be performed in normal animals, or in experimental disease models, for example, the HSA.sup.LR mouse model of myotonic dystrophy (DM1).

[0297] The HSA.sup.LR mouse model is an established model for DM1 (Mankodi, A. et al. Science. 289: 1769, 2000). The mice carry a human skeletal actin (hACTA1) transgene with 220 CTG repeats inserted in the 3 UTR of the gene. The hACTA-CUG.sup.exp transcript accumulates in nuclear foci in skeletal muscles and results in myotonia similar to that in human DM1 (Mankodi, A. et al. Mol. Cell 10: 35, 2002; Lin, X. et al. Hum. Mol. Genet. 15: 2087, 2006). Hence, it is expected that amelioration of DM1 symptoms in the HSA.sup.LR mouse by antisense inhibition of the hACTA1 transgene would predict amelioration of similar symptoms in human patients by antisense inhibition of the DMPK transcript.

[0298] Expression of CUG.sup.exp RNA in mice causes extensive remodeling of the muscle transcriptome, much of which is reproduced by ablation of MBNL1. Hence, it is expected that normalization of the transcriptome in HSA.sup.LR mice would predict normalization of the human transcriptome in DM1 patients by antisense inhibition of the DMPK transcript.

[0299] For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration. Following a period of treatment with antisense oligonucleotides, RNA is isolated from tissue and changes in DMPK nucleic acid expression are measured. Changes in DMPK protein levels are also measured.

Splicing

[0300] Myotonic dystrophy (DM1) is caused by CTG repeat expansions in the 3 untranslated region of the DMPK gene (Brook, J. D. et al. Cell. 68: 799, 1992). This mutation leads to RNA dominance, a process in which expression of RNA containing an expanded CUG repeat (CUGexp) induces cell dysfunction (Osborne R J and Thornton C A., Human Molecular Genetics., 2006, 15(2): R162-R169). Such CUGexp are retained in the nuclear foci of skeletal muscles (Davis, B. M. et al. Proc. Natl. Acad. Sci. U.S.A. 94:7388, 1997). The accumulation of CUGexp in the nuclear foci leads to the sequestration of poly(CUG)-binding proteins, such as, Muscleblind-like 1 (MBLN1) (Miller, J. W. et al. EMBO J. 19: 4439, 2000). MBLN1 is a splicing factor and regulates the splicing of genes such as Serca1, CIC-1, Titin, and Zasp. Therefore, sequestration of MBLN1 by CUGexp triggers misregulated alternative splicing of the exons of genes that MBLN1 normally controls (Lin, X. et al. Hum. Mol. Genet. 15: 2087, 2006). Correction of alternative splicing in an animal displaying such disregulation, such as, for example, in a DM1 patient and the HSALR mouse model, is a useful indicator for the efficacy of a treatment, including treatment with an antisense oligonucleotide.

Certain Biomarkers

[0301] DM1 severity in mouse models is determined, at least in part, by the level of CUG.sup.exp transcript accumulation in the nucleus or nuclear foci. A useful physiological marker for DM1 severity is the development of high-frequency runs of involuntary action potentials (myotonia).

Certain Indications

[0302] In certain embodiments, provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has type 1 myotonic dystrophy (DM1).

[0303] Accordingly, provided herein are methods for ameliorating a symptom associated with type 1 myotonic dystrophy in a subject in need thereof. In certain embodiments, provided is a method for reducing the rate of onset of a symptom associated with type 1 myotonic dystrophy. In certain embodiments, provided is a method for reducing the severity of a symptom associated with type 1 myotonic dystrophy. In certain embodiments, symptoms associated with DM1 include muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. In children, the symptoms may also be developmental delays, learning problems, language and speech issues, and personality development issues.

[0304] In certain embodiments, the methods comprise administering to an individual in need thereof a therapeutically effective amount of a compound targeted to a DMPK nucleic acid.

[0305] In certain embodiments, administration of an antisense compound targeted to a DMPK nucleic acid results in reduction of DMPK expression by at least about 15%, by at least about 20%, by at least about 25%, by at least about 30%, by at least about 35%, by at least about 40%, by at least about 45%, by at least about 50%, by at least about 55%, by at least about 60%, by least about 65%, by least about 70%, by least about 75%, by least about 80%, by at least about 85%, by at least about 90%, by at least about 95% or by at least about 99%, or a range defined by any two of these values.

[0306] In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to DMPK are used for the preparation of a medicament for treating a patient suffering or susceptible to type 1 myotonic dystrophy.

[0307] In certain embodiments, the methods described herein include administering a compound comprising a modified oligonucleotide having a contiguous nucleobases portion as described herein of a sequence recited in SEQ ID NO: 12-156, 160-770, and 774-792.

Administration

[0308] In certain embodiments, the compounds and compositions as described herein are administered parenterally.

[0309] In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump. In certain embodiments, parenteral administration is by injection (e.g., bolus injection). The injection can be delivered with a syringe.

[0310] Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short, or intermittent.

[0311] In certain embodiments, the administering is subcutaneous, intravenous, intracerebral, intracerebroventricular, intrathecal or another administration that results in a systemic effect of the oligonucleotide (systemic administration is characterized by a systemic effect, i.e., an effect in more than one tissue) or delivery to the CNS or to the CSF.

[0312] The duration of action as measured by inhibition of alpha 1 actin and reduction of myotonia in the HSA.sup.LR mouse model of DM1 is prolonged in muscle tissue including quadriceps, gastrocnemius, and the tibialis anterior (see Examples, below). Subcutaneous injections of antisense oligonucleotide for 4 weeks results in inhibition of alpha 1 actin by at least 70% in quadriceps, gastrocnemius, and the tibialis anterior in HSA.sup.LR mice for at least 11 weeks (77 days) after termination of dosing. Subcutaneous injections of antisense oligonucleotide for 4 weeks results in elimination of myotonia in quadriceps, gastrocnemius, and the tibialis anterior in HSA.sup.LR mice for at least 11 weeks (77 days) after termination of dosing.

[0313] In certain embodiments, delivery of a compound of composition, as described herein, results in at least 70% down-regulation of a target mRNA and/or target protein for at least 77 days. In certain embodiments, delivery of a compound or composition, as described herein, results in 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% down-regulation of a target mRNA and/or target protein for at least 30 days, at least 35 days, at least 40 days, at least 45 days, at least 50 days, at least 55 days, at least 60 days, at least 65 days, at least 70 days, at least 75 days, at least 76 days, at least 77 days, at least 78 days, at least 79 days, at least 80 days, at least 85 days, at least 90 days, at least 95 days, at least 100 days, at least 105 days, at least 110 days, at least 115 days, at least 120 days, at least 1 year.

[0314] In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once every 77 days. In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once every month, every two months, every three months, every 6 months, twice a year or once a year.

Certain Combination Therapies

[0315] In certain embodiments, a first agent comprising the modified oligonucleotide of the invention is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same type 1 myotonic dystrophy as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect.

[0316] In certain embodiments, a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.

Examples

Non-Limiting Disclosure and Incorporation by Reference

[0317] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Antisense Inhibition of Human Dystrophia Myotonica Protein Kinase (DMPK) in Human Skeletal Muscle Cells (hSKMC)

[0318] Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured hSKM cells at a density of 20,000 cells per well were transfected using electroporation with 100 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR with human primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 9; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 10; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 11). DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of hDMPK, relative to untreated control cells.

[0319] The antisense oligonucleotides in Tables 1 and 2 are 5-10-5 gapmers, where the gap segment comprises ten 2-deoxynucleosides and each wing segment comprises five 2-MOE nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. Target start site indicates the 5-most nucleoside to which the antisense oligonucleotide is targeted. Target stop site indicates the 3-most nucleoside to which the antisense oligonucleotide is targeted. All the antisense oligonucleotides listed in Table 1 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1). All the antisense oligonucleotides listed in Table 2 target SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106).

[0320] Several antisense oligonucleotides demonstrated significant inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE-US-00001 TABLE1 InhibitionofhumanDMI3KRNAtranscriptin hSKMCby5-10-5gapmerstargetingSEQIDNO:1 Target Target % SEQ StartSite StopSite ISISNo Sequence inhibition IDNO. 93 112 299476 CTGGCTGCATGTCTGCCTGT 81 12 277 296 299479 CCAGGAGAAGGTCGAGCAGG 57 13 737 756 299493 TCTATGGCCATGACAATCTC 57 14 773 792 299494 ATGTCCCTGTGCACGTAGCC 77 15 1194 1213 299501 ATGTGTCCGGAAGTCGCCTG 50 16 1628 1647 299511 CTCAGGCTCTGCCGGGTGAG 70 17 1855 1874 299517 GGCACTGGCCCACAGCCACG 78 18 2379 2398 299526 CCTGGCCGAAAGAAAGAAAT 31 19 2367 2386 444380 AAAGAAATGGTCTGTGATCC 56 20 2370 2389 444381 AAGAAAGAAATGGTCTGTGA 77 21 2376 2395 444382 GGCCGAAAGAAAGAAATGGT 61 22 2385 2404 444383 CCTCAGCCTGGCCGAAAGAA 57 23 2388 2407 444384 GGGCCTCAGCCTGGCCGAAA 65 24 2391 2410 444385 TCAGGGCCTCAGCCTGGCCG 61 25 2411 2430 444386 CTGCAGTTTGCCCATCCACG 68 26 2414 2433 444387 GGCCTGCAGTTTGCCCATCC 77 27 2417 2436 444388 CCAGGCCTGCAGTTTGCCCA 54 28 2423 2442 444389 GCCTTCCCAGGCCTGCAGTT 77 29 2426 2445 444390 GCTGCCTTCCCAGGCCTGCA 83 30 2429 2448 444391 CTTGCTGCCTTCCCAGGCCT 69 31 2435 2454 444392 GCCCGGCTTGCTGCCTTCCC 82 32 2438 2457 444393 ACGGCCCGGCTTGCTGCCTT 78 33 2441 2460 444394 CGGACGGCCCGGCTTGCTGC 57 34 2444 2463 444395 ACACGGACGGCCCGGCTTGC 73 35 2450 2469 444396 GATGGAACACGGACGGCCCG 80 36 2453 2472 444397 GAGGATGGAACACGGACGGC 86 37 2456 2475 444398 GTGGAGGATGGAACACGGAC 84 38 2481 2500 444399 GCGAACCAACGATAGGTGGG 80 39 2484 2503 444400 TTTGCGAACCAACGATAGGT 86 40 2490 2509 444401 TTGCACTTTGCGAACCAACG 89 41 2493 2512 444402 GCTTTGCACTTTGCGAACCA 89 42 2496 2515 444403 AAAGCTTTGCACTTTGCGAA 83 43 2499 2518 444404 AAGAAAGCTTTGCACTTTGC 91 44 2502 2521 444405 CACAAGAAAGCTTTGCACTT 70 45 2508 2527 444406 GTCATGCACAAGAAAGCTTT 34 46 2527 2546 444407 ACGCTCCCCAGAGCAGGGCG 39 47 2543 2562 444408 GCAGAGATCGCGCCAGACGC 85 48 2546 2565 444409 CAGGCAGAGATCGCGCCAGA 65 49 2549 2568 444410 AAGCAGGCAGAGATCGCGCC 84 50 2555 2574 444411 CCGAGTAAGCAGGCAGAGAT 58 51 2558 2577 444412 TTCCCGAGTAAGCAGGCAGA 70 52 2564 2583 444413 GCAAATTTCCCGAGTAAGCA 62 53 2567 2586 444414 AAAGCAAATTTCCCGAGTAA 53 54 2573 2592 444415 TTGGCAAAAGCAAATTTCCC 64 55 2576 2595 444416 GGTTTGGCAAAAGCAAATTT 23 56 2579 2598 444417 GCGGGTTTGGCAAAAGCAAA 70 57 2582 2601 444418 AAAGCGGGTTTGGCAAAAGC 43 58 2588 2607 444419 CCCGAAAAAGCGGGTTTGGC 71 59 2591 2610 444420 ATCCCCGAAAAAGCGGGTTT 53 60 2595 2614 444421 CGGGATCCCCGAAAAAGCGG 45 61 2598 2617 444422 GCGCGGGATCCCCGAAAAAG 48 62 2623 2642 444423 GAGAGCAGCGCAAGTGAGGA 77 63 2626 2645 444424 TCCGAGAGCAGCGCAAGTGA 62 64 2629 2648 444425 GGCTCCGAGAGCAGCGCAAG 79 65 2649 2668 444426 AAGCGGGCGGAGCCGGCTGG 20 66 2652 2671 444427 CCGAAGCGGGCGGAGCCGGC 0 67 2658 2677 444428 AAACCGCCGAAGCGGGCGGA 0 68 2661 2680 444429 TCCAAACCGCCGAAGCGGGC 45 69 2664 2683 444430 ATATCCAAACCGCCGAAGCG 31 70 2667 2686 444431 TAAATATCCAAACCGCCGAA 42 71 2670 2689 444432 CAATAAATATCCAAACCGCC 53 72 2676 2695 444433 CGAGGTCAATAAATATCCAA 63 73 2679 2698 444434 GGACGAGGTCAATAAATATC 83 74 2682 2701 444435 GGAGGACGAGGTCAATAAAT 82 75 2685 2704 444436 GTCGGAGGACGAGGTCAATA 86 76 2688 2707 444437 CGAGTCGGAGGACGAGGTCA 73 77 2694 2713 444438 TGTCAGCGAGTCGGAGGACG 79 78 2697 2716 444439 GCCTGTCAGCGAGTCGGAGG 83 79 2700 2719 444440 GTAGCCTGTCAGCGAGTCGG 94 80 2703 2722 444441 CCTGTAGCCTGTCAGCGAGT 90 81 2706 2725 444442 GGTCCTGTAGCCTGTCAGCG 90 82 2764 2783 444443 AAATACCGAGGAATGTCGGG 82 83 2767 2786 444444 AATAAATACCGAGGAATGTC 66 84 2770 2789 444445 GACAATAAATACCGAGGAAT 67 85 2093 2112 445546 CGGGGCCCCGGAGTCGAAGA 0 86 2097 2116 445547 CCAACGGGGCCCCGGAGTCG 38 87 2099 2118 445548 TTCCAACGGGGCCCCGGAGT 22 88 2102 2121 445549 GTCTTCCAACGGGGCCCCGG 50 89 2104 2123 445550 CAGTCTTCCAACGGGGCCCC 27 90 2106 2125 445551 CTCAGTCTTCCAACGGGGCC 57 91 2109 2128 445552 GCACTCAGTCTTCCAACGGG 69 92 2115 2134 445553 CCCCGGGCACTCAGTCTTCC 76 93 2117 2136 445554 TGCCCCGGGCACTCAGTCTT 59 94 2119 2138 445555 CGTGCCCCGGGCACTCAGTC 61 95 2123 2142 445556 GTGCCGTGCCCCGGGCACTC 26 96 2126 2145 445557 TCTGTGCCGTGCCCCGGGCA 50 97 2129 2148 445558 GCTTCTGTGCCGTGCCCCGG 57 98 2132 2151 445559 GCGGCTTCTGTGCCGTGCCC 27 99 2134 2153 445560 GCGCGGCTTCTGTGCCGTGC 0 100 2136 2155 445561 GGGCGCGGCTTCTGTGCCGT 8 101 2142 2161 445562 GGCGGTGGGCGCGGCTTCTG 62 102 2146 2165 445563 GGCAGGCGGTGGGCGCGGCT 49 103 2148 2167 445564 CTGGCAGGCGGTGGGCGCGG 51 104 2150 2169 445565 AACTGGCAGGCGGTGGGCGC 38 105 2153 2172 445566 GTGAACTGGCAGGCGGTGGG 64 106 2157 2176 445567 GGTTGTGAACTGGCAGGCGG 66 107 2159 2178 445568 GCGGTTGTGAACTGGCAGGC 85 108 2163 2182 445569 CGGAGCGGTTGTGAACTGGC 92 109 2167 2186 445570 CGCTCGGAGCGGTTGTGAAC 51 110 2171 2190 445571 CCCACGCTCGGAGCGGTTGT 74 111 2174 2193 445572 AGACCCACGCTCGGAGCGGT 80 112 2177 2196 445573 CGGAGACCCACGCTCGGAGC 83 113 2180 2199 445574 GGGCGGAGACCCACGCTCGG 62 114 2183 2202 445575 GCTGGGCGGAGACCCACGCT 11 115 2186 2205 445576 GGAGCTGGGCGGAGACCCAC 42 116 2188 2207 445577 CTGGAGCTGGGCGGAGACCC 17 117 2191 2210 445578 GGACTGGAGCTGGGCGGAGA 53 118 2193 2212 445579 CAGGACTGGAGCTGGGCGGA 46 119 2197 2216 445580 ATCACAGGACTGGAGCTGGG 66 120 2209 2228 445581 GGGCGGGCCCGGATCACAGG 85 121 2211 2230 445582 GGGGGCGGGCCCGGATCACA 96 122 179 198 445583 AGGCAGCACCATGGCCCCTC 88 123 235 254 445584 GGTCCAACACCAGCTGCTGG 84 124 418 437 445585 CGATCACCTTCAGAATCTCG 11 125 498 517 445586 CTTGTTCATGATCTTCATGG 0 126 565 584 445587 CCCCATTCACCAACACGTCC 83 127 583 602 445588 GCGTGATCCACCGCCGGTCC 59 128 639 658 445589 GTAATACTCCATGACCAGGT 86 129 664 683 445590 GCAGTGTCAGCAGGTCCCCG 83 130 744 763 445591 CACCGAGTCTATGGCCATGA 60 131 761 780 445592 ACGTAGCCAAGCCGGTGCAC 68 132 812 831 445593 ATGTGGCCACAGCGGTCCAG 56 133 1099 1118 445594 CTTCGTCCACCAGCGGCAGA 32 134 1104 1123 445595 GACCCCTTCGTCCACCAGCG 83 135 1178 1197 445596 CCTGCTCCACCCCGGCCCAG 82 136 1187 1206 445597 CGGAAGTCGCCTGCTCCACC 81 137 1229 1248 445598 CGGAGACCATCCCAGTCGAG 67 138 1402 1421 445599 TGAGGGCCATGCAGGAGTAG 26 139 1443 1462 445600 CTCCAGTTCCATGGGTGTGG 80 140 1477 1496 445601 GCGCTTGCACGTGTGGCTCA 94 141 1526 1545 445602 GCCACTTCAGCTGTTTCATC 54 142 1562 1581 445603 GCCTCAGCCTCTGCCGCAGG 71 143 1576 1595 445604 GCAGCGTCACCTCGGCCTCA 31 144 1630 1649 445605 GGCTCAGGCTCTGCCGGGTG 86 145 1700 1719 445606 TTCCGAGCCTCTGCCTCGCG 73 146 1708 1727 445607 GGTCCCGGTTCCGAGCCTCT 76 147 1742 1761 445608 ATCCGCTCCTGCAACTGCCG 93 148 1750 1769 445609 GCAACTCCATCCGCTCCTGC 60 149 1812 1831 445610 AGGTGGATCCGTGGCCCGGG 48 150 2133 2152 445611 CGCGGCTTCTGTGCCGTGCC 24 151 2428 2447 445612 TTGCTGCCTTCCCAGGCCTG 80 152

TABLE-US-00002 TABLE2 InhibitionofhumanDMPKRNAtranscriptin hSKMCby5-10-5gapmerstargeting Target Target % SEQ StartSite StopSite ISISNo Sequence inhibition IDNO. 812 831 299471 TGCTCCCGACAAGCTCCAGA 95 153 876 895 299473 AGAACCTGCCCATTGCTGAA 68 154 2381 2400 299535 CACTGAGGGCCAGACATATG 68 155 3289 3308 299544 CTCTAGATTCAGATGCAGGT 88 156

[0321] The antisense oligonucleotides from Tables 1 and 2 were also tested in an assay with similar conditions as described above, and mRNA levels measured with the human primer probe RTS3162 (forward sequence CGGGCCGTCCGTGTT, designated herein as SEQ ID NO: 157; reverse sequence CTTTGCACTTTGCGAACCAA, designated herein as SEQ ID NO: 158; probe sequence CATCCTCCACGCACCCCCACCX, designated herein as SEQ ID NO: 159). The results are presented in Table 3. DMPK mRNA expression was also assessed by RTS3162 which targets the DMPK gene near the 3UTR. The use of a second primer probe was employed to confirm that the expression of the entire DMPK gene had been inhibited

TABLE-US-00003 TABLE 3 Inhibition of human DMPK RNA transcript in hSKMC by 5-10-5 gapmers measured using primer probe set RTS3162 ISIS % No inhibition 299471 91 299473 65 299476 76 299479 53 299493 60 299494 66 299501 44 299511 39 299517 71 299526 39 299535 75 299544 84 444380 72 444381 82 444382 67 444383 63 444384 66 444385 66 444386 74 444387 85 444388 60 444389 81 444390 88 444391 79 444392 94 444393 88 444394 94 444395 96 444396 96 444397 95 444398 96 444399 95 444400 95 444401 95 444402 91 444403 84 444404 89 444405 71 444406 47 444407 42 444408 80 444409 56 444410 79 444411 66 444412 67 444413 55 444414 45 444415 57 444416 18 444417 64 444418 51 444419 66 444420 0 444421 46 444422 33 444423 74 444424 73 444425 78 444426 0 444427 0 444428 0 444429 75 444430 28 444431 58 444432 52 444433 60 444434 87 444435 76 444436 83 444437 71 444438 76 444439 73 444440 91 444441 87 444442 93 444443 77 444444 64 444445 67 445546 0 445547 59 445548 49 445549 77 445550 62 445551 74 445552 84 445553 70 445554 63 445555 75 445556 52 445557 78 445558 81 445559 58 445560 12 445561 42 445562 70 445563 76 445564 69 445565 60 445566 86 445567 84 445568 92 445569 93 445570 59 445571 84 445572 88 445573 84 445574 74 445575 26 445576 56 445577 38 445578 69 445579 70 445580 75 445581 85 445582 95 445583 88 445584 87 445585 34 445586 0 445587 82 445588 66 445589 87 445590 82 445591 68 445592 64 445593 54 445594 52 445595 77 445596 84 445597 78 445598 73 445599 29 445600 68 445601 92 445602 53 445603 70 445604 32 445605 61 445606 84 445607 80 445608 91 445609 68 445610 63 445611 44 445612 91

Example 2: Design of Antisense Oligonucleotides Targeting CUG Repeats

[0322] Antisense oligonucleotides were designed targeting mRNA transcripts that contain multiple CUG repeats. The chemistry of these oligonucleotides as well as their sequence is shown in Table 4. The symbols designated to the sugar type are shown after the base in subscript and are as follows: b=2-ON-[2-(dimethylamino)ethyl]acetamido ribose; d=2-deoxyribose; e=2-O-methoxyethyl ribose; f=2-alpha-fluoro-2-deoxyribose; g=2-O-2[2-(2-methoxyethoxy)ethoxy]ethyl ribose; h=3-fluoro-HNA; k=(S)-cEt; 1=LNA (Locked Nucleic Acids); n=2-O(N-methylacetamide) ribose; o=2-O-dimethylaminooxyethyl (DMAOE) ribose; p=PNA; r=propylribose; and x=amino acid core. The heterocycle names are defined with standard symbols for adenine, cytosine, thymine and guanine, mC for 5-methylcytosine, and K for Lysine Side Chain. Linkers are shown after the sugar type in subscript and designated with the following symbols: g=PNA-glycine full; a=amino acid; and s=thioate ester.

TABLE-US-00004 TABLE4 DesignofantisenseoligonucleotidestargetingCUGrepeats SEQ ISISNo Sequence Chemistry Backbone IDNO 431896 G.sub.dsC.sub.dsA.sub.lsG.sub.dsC.sub.dsA.sub.lsG.sub.dsC.sub.dsA.sub.lsG.sub.ds DeoxyandLNAunits Phosphorothioate 802 C.sub.dsA.sub.lsG.sub.dsC.sub.dsA.sub.lsG.sub.dsC.sub.dsA.sub.lsG.sub.d 433804 K.sub.xaG.sub.pgC.sub.pgA.sub.pgG.sub.pgC.sub.pgA.sub.pgG.sub.pgC.sub.pgA.sub.pg PNAandAminoAcid mixed 803 G.sub.pgC.sub.pgA.sub.pgG.sub.pgC.sub.pgA.sub.pgG.sub.pgC.sub.pgA.sub.pgG.sub.pg Coreunitswitha K.sub.xaK.sub.xaK.sub.xaK.sub.xaK.sub.xaK.sub.xaK.sub.xaK.sub.xa Carboxy-amideendcap 444745 A.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.es UniformMOE Phosphorothioate 789 A.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.es A.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.e 444745 A.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.es UniformMOE Phosphorothioate 804 A.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.es A.sub.esG.sub.e 444747 G.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.es UniformMOE Phosphorothioate 802 G.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.es G.sub.es 444748 G.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.es UniformMOE Phosphorothioate 805 G.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.esG.sub.esmC.sub.esA.sub.e 444750 G.sub.ksC.sub.ksA.sub.dsG.sub.dsC.sub.ksA.sub.dsG.sub.dsC.sub.ksA.sub.dsG.sub.ds Deoxyand(S)-cEt Phosphorothioate 805 C.sub.ksA.sub.dsG.sub.dsC.sub.ksA.sub.dsG.sub.dsC.sub.ksA.sub.k units 444752 G.sub.ksC.sub.ksA.sub.esG.sub.esC.sub.ksA.sub.esG.sub.esC.sub.ksA.sub.esG.sub.es Deoxyand(S)-cEt Phosphorothioate 805 C.sub.ksA.sub.esG.sub.esC.sub.ksA.sub.esG.sub.esC.sub.ksA.sub.k units 444754 G.sub.esmC.sub.esA.sub.fsG.sub.fsC.sub.fsA.sub.fsG.sub.fsC.sub.fsA.sub.fs MOEand2-alpha- Phosphorothioate 805 G.sub.fsC.sub.fsA.sub.fsG.sub.fsC.sub.fsA.sub.fsG.sub.fsmC.sub.esA.sub.es fluorounits 444759 G.sub.hsmC.sub.hsA.sub.hsG.sub.hsmC.sub.hsA.sub.hsG.sub.hsmC.sub.hsA.sub.hs Uniform3-fluoro- Phosphorothioate 805 G.sub.hsmC.sub.hsA.sub.hsG.sub.hsmC.sub.hsA.sub.hsG.sub.hsmC.sub.hsA.sub.h HNA 444761 G.sub.rsmC.sub.rsA.sub.rsG.sub.rsmC.sub.rsA.sub.rsG.sub.rsmC.sub.rsA.sub.rs Uniform2-O- Phosphorothioate 805 G.sub.rsmC.sub.rsA.sub.rsG.sub.rsmC.sub.rsA.sub.rsG.sub.rsmC.sub.rsA.sub.r propylribose 444762 G.sub.nsmC.sub.nsA.sub.nsG.sub.nsmC.sub.nsA.sub.nsG.sub.nsmC.sub.nsA.sub.ns Uniform2-O-(N- Phosphorothioate 805 G.sub.nsmC.sub.nsA.sub.nsG.sub.nsmC.sub.nsA.sub.nsG.sub.nsmC.sub.nsA.sub.n methylacetamide) ribose 444763 G.sub.osmC.sub.esA.sub.osG.sub.osmC.sub.esA.sub.osG.sub.osmC.sub.esA.sub.os MOEand2-O- Phosphorothioate 805 G.sub.osmC.sub.esA.sub.osG.sub.osmC.sub.esA.sub.osG.sub.osmC.sub.esA.sub.o dimethylaminooxyethyl (DMAOE)riboseunits 444764 G.sub.gsmC.sub.esA.sub.esG.sub.gsmC.sub.esA.sub.esG.sub.gsmC.sub.esA.sub.es MOEand2-O-2[2-(2- Phosphorothioate 802 G.sub.gsmC.sub.esA.sub.esG.sub.gsmC.sub.esA.sub.esG.sub.gsmC.sub.esA.sub.es methoxyethoxy)ethoxy] G.sub.g ethylriboseunits 444765 G.sub.bsmC.sub.esA.sub.esG.sub.bsmC.sub.esA.sub.esG.sub.bsmC.sub.esA.sub.es MOEand2-O-N-[2- Phosphorothioate 802 G.sub.bsmC.sub.esA.sub.esG.sub.bsmC.sub.esA.sub.esG.sub.bsmC.sub.esA.sub.es (dimethylamino)ethyl] G.sub.b acetamidoriboseunits 473810 A.sub.ksG.sub.dsmC.sub.dsA.sub.ksG.sub.dsmC.sub.dsA.sub.ksG.sub.dsmC.sub.ds Deoxyand(S)-cEt Phosphorothioate 806 A.sub.ksG.sub.dsmC.sub.dsA.sub.ksG.sub.dsmC.sub.dsA.sub.ksG.sub.dsmC.sub.ds units A.sub.k 473811 A.sub.ksG.sub.dsmC.sub.dsA.sub.ksG.sub.dsmC.sub.dsA.sub.ksG.sub.dsmC.sub.ds Phosphorothioate 807 A.sub.ksG.sub.dsmC.sub.dsA.sub.ksG.sub.dsmC.sub.dsAk

Example 3: Dose-Dependent Antisense Inhibition of Human DMPK in Human Skeletal Muscle Cells

[0323] Several of the antisense oligonucleotides exhibiting in vitro inhibition of DMPK in hSKMC (see Example 1) were tested at various doses. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 1,250 nM, 2,500 nM, 5,000 nM, 10,000 nM and 20,000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and DMPK mRNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164, described hereinabove. DMPK mRNA transcript levels were normalized to total RNA content, as measured by RIBOGREEN. Results are presented in Table 5 as percent inhibition of DMPK, relative to untreated control cells.

[0324] The tested antisense oligonucleotides demonstrated dose-dependent inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00005 TABLE 5 Dose-dependent antisense inhibition of human DMPK in hSKMC tested with primer probe set RTS3164 ISIS 1,250 2,500 5,000 10,000 20,000 IC.sub.50 No. nM nM nM nM nM (M) 299471 34 65 87 91 94 1.60 299473 2 33 60 89 92 4.31 299476 15 17 49 81 91 4.89 299535 0 12 34 62 59 9.95 299535 20 33 47 67 80 5.11 299544 32 63 81 85 87 1.82 444397 10 30 58 85 82 4.51 444398 33 57 74 85 87 2.07 444400 52 46 63 82 88 1.76 444401 51 71 84 89 91 0.71 444402 53 79 83 87 84 <1.25 444404 48 68 77 86 90 0.95 444408 26 47 70 87 87 2.80 444410 22 47 67 83 87 3.12 444436 28 67 76 89 92 1.94 444440 70 77 83 89 85 <1.25 444441 33 55 81 87 86 1.99 444442 54 73 84 89 88 <1.25 445568 65 83 85 84 76 <1.25 445569 60 77 87 93 91 <1.25 445581 16 44 78 86 94 3.13 445582 0 7 26 96 99 5.60 445583 39 53 73 89 94 2.00 445584 20 26 61 81 93 4.02 445589 42 61 81 91 87 1.36 445601 49 79 87 93 94 0.66 445608 26 59 71 85 97 2.41 445612 46 59 72 88 93 1.51

[0325] The antisense oligonucleotides from Table 5 were also tested with primer probe set RTS3162, described hereinabove. The results are presented in Table 6. DMPK mRNA expression was also assessed by RTS3162 which targets the DMPK gene near the 3UTR. The use of a second primer probe was employed to confirm that the expression of the entire DMPK gene had been inhibited.

TABLE-US-00006 TABLE 6 Dose-dependent antisense inhibition of human DMPK in hSKMC tested with primer probe set RTS3164 ISIS 1,250 2,500 5,000 10,000 20,000 IC.sub.50 No. nM nM nM nM nM (M) 299471 40 72 86 91 93 1.17 299473 6 43 63 87 89 3.86 299476 3 21 48 74 86 5.58 299535 9 22 36 62 77 7.05 299535 6 19 49 68 70 6.70 299544 35 66 81 84 87 1.52 444397 88 90 95 97 96 <1.25 444398 91 97 97 97 98 <1.25 444400 72 87 93 96 96 <1.25 444401 86 92 97 98 97 <1.25 444402 83 91 94 95 95 <1.25 444404 49 69 81 90 93 0.92 444408 21 46 70 84 86 3.10 444410 35 55 77 89 91 2.02 444436 37 66 81 89 92 1.50 444440 66 79 89 92 89 <1.25 444441 40 62 85 89 89 1.40 444442 55 75 86 90 91 <1.25 445568 74 92 91 92 91 <1.25 445569 68 83 90 94 93 <1.25 445581 8 48 77 85 92 3.33 445582 15 22 44 97 99 4.29 445583 36 58 71 87 92 1.96 445584 25 43 66 86 94 3.05 445589 38 56 77 85 81 1.74 445601 55 76 84 93 93 <1.25 445608 22 56 72 86 94 2.66 445612 61 75 85 91 94 <1.25

Example 4: Dose-Dependent Antisense Inhibition of Human DMPK in Human Skeletal Muscle Cells

[0326] Several of the antisense oligonucleotides exhibiting in vitro inhibition of DMPK in hSKMC (see Example 3) were tested at various doses. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 1,250 nM, 2,500 nM, 5,000 nM, 10,000 nM and 20,000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and DMPK mRNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164, described hereinabove. DMPK mRNA transcript levels were normalized to total RNA content, as measured by RIBOGREEN. Results are presented in Table 7 as percent inhibition of DMPK, relative to untreated control cells.

[0327] The majority of the tested antisense oligonucleotides demonstrated dose-dependent inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00007 TABLE 7 Dose-dependent antisense inhibition of human DMPK in hSKMC tested with primer probe set RTS3164 ISIS 1,250 2,500 5,000 10,000 20,000 IC.sub.50 No. nM nM nM nM nM (M) 299471 34 65 87 91 94 1.59 299473 2 33 60 89 92 4.31 299476 15 17 49 81 91 4.89 299535 0 12 34 62 59 9.95 299535 20 33 47 67 80 5.11 299544 32 63 81 85 87 1.82 444397 10 30 58 85 82 4.51 444398 33 57 74 85 87 2.07 444400 52 46 63 82 88 1.76 444401 51 71 84 89 91 <1.25 444402 53 79 83 87 84 <1.25 444404 48 68 77 86 90 0.95 444408 26 47 70 87 87 2.80 444410 22 47 67 83 87 3.12 444436 28 67 76 89 92 1.94 444440 66 77 83 89 85 <1.25 444441 33 55 81 87 86 1.99 444442 54 73 84 89 88 <1.25 445568 65 83 85 84 76 <1.25 445569 60 77 87 93 91 <1.25 445581 16 44 78 86 94 3.13 445582 0 7 26 96 99 5.62 445583 39 53 73 89 94 1.97 445584 20 26 61 81 93 4.20 445589 42 61 81 91 87 1.36 445601 49 79 87 93 94 0.66 445608 26 59 71 85 97 2.41 445612 46 59 72 88 93 1.51

Example 5: Dose-Dependent Antisense Inhibition of Human DMPK in Human Skeletal Muscle Cells

[0328] Several antisense oligonucleotides were designed to target human DMPK mRNA and were tested in hSKMC at various doses. Several other antisense oligonucleotides were designed to target human actin mRNA and were also tested in hSKMC at various doses. The newly designed gapmers are 2-10-2 MOE or 3-10-3 MOE gapmers. The 2-10-2 MOE gapmers are 14 nucleosides in length and where the gap segment comprises ten 2-deoxynucleosides and each wing segment comprises two 2-MOE nucleosides. The 3-10-3 MOE gapmers are 16 nucleosides in length and where the gap segment comprises ten 2-deoxynucleosides and each wing segment comprises three 2-MOE nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. Target start site indicates the 5-most nucleoside to which the antisense oligonucleotide is targeted. Target stop site indicates the 3-most nucleoside to which the antisense oligonucleotide is targeted. The antisense oligonucleotides listed in Table 8 target either the human DMPK genomic sequence, designated herein as SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106) or the human actin sequence, designated herein as SEQ ID NO: 801 (GENBANK Accession No. NM_001100.3).

[0329] Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 1,250 nM, 2,500 nM, 5,000 nM, 10,000 nM and 20,000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and DMPK mRNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3162, described hereinabove. DMPK mRNA transcript levels were normalized to total RNA content, as measured by RIBOGREEN. Results are presented in Table 8 as percent inhibition of DMPK, relative to untreated control cells. The antisense oligonucleotides were also tested under similar conditions with RTS3164. The results are presented in Table 9.

[0330] Many of the tested antisense oligonucleotides demonstrated dose-dependent inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00008 TABLE8 Dose-dependentantisenseinhibitionofhumanDMPKand humanactininhSKMCtestedwithprimerprobesetRTS3162 Target SEQ Start 1,250 2,500 5,000 10,000 20,000 IC50 ISISNo Sequence Motif IDNO Site nM nM nM nM nM (nM) SEQIDNO 468787 CTCCCGACAAGCTCCA 3-10-3 2 814 28 47 51 84 88 3.27 808 468772 TCCCGACAAGCTCC 2-10-2 2 815 17 39 67 72 80 4.04 809 468795 GCTTGCACGTGTGGCT 3-10-3 2 10935 32 58 77 85 75 1.94 810 468780 CTTGCACGTGTGGC 2-10-2 2 10936 22 17 43 66 77 6.23 811 468793 GGTTGTGAACTGGCAG 3-10-3 2 13224 69 77 93 96 96 <1.25 812 468778 GTTGTGAACTGGCA 2-10-2 2 13225 60 69 89 95 97 <1.25 813 468794 GAGCGGTTGTGAACTG 3-10-3 2 13228 21 32 61 70 86 4.27 814 468779 AGCGGTTGTGAACT 2-10-2 2 13229 40 45 72 91 97 2.20 815 468796 GCTGCCTTCCCAGGCC 3-10-3 2 13493 73 79 91 96 95 <1.25 816 468781 CTGCCTTCCCAGGC 2-10-2 2 13494 36 53 66 86 90 2.28 817 468788 GCACTTTGCGAACCAA 3-10-3 2 13555 55 80 84 94 96 <1.25 818 468773 CACTTTGCGAACCA 2-10-2 2 13556 31 52 82 91 93 2.16 819 468789 GAAAGCTTTGCACTTT 3-10-3 2 13564 42 66 83 91 98 1.31 820 468774 AAAGCTTTGCACTT 2-10-2 2 13565 21 0 31 41 55 1.87 821 468790 CGGAGGACGAGGTCAA 3-10-3 2 13750 43 57 79 87 89 1.51 822 468775 GGAGGACGAGGTCA 2-10-2 2 13751 27 51 58 78 81 3.18 823 468791 AGCCTGTCAGCGAGTC 3-10-3 2 13765 49 63 85 62 95 1.04 824 468776 GCCTGTCAGCGAGT 2-10-2 2 13766 65 47 81 88 93 <1.25 825 468792 TCCTGTAGCCTGTCAG 3-10-3 2 13771 38 57 73 85 93 1.91 826 468777 CCTGTAGCCTGTCA 2-10-2 2 13772 15 58 66 85 92 2.99 827 468783 GAAGCGAGGCTTCACT 3-10-3 801 22 0 20 5 0 0 >20.00 828 468768 AAGCGAGGCTTCAC 2-10-2 801 23 25 22 5 17 0 >20.00 829 468784 ACCTGCCCGTCTGGCA 3-10-3 801 836 15 25 32 18 25 >20.00 830 468769 CCTGCCCGTCTGGC 2-10-2 801 837 32 11 11 20 32 >20.00 831 468782 GGTCAGCGATCCCAGG 3-10-3 801 1030 0 0 0 0 0 >20.00 832 468767 GTCAGCGATCCCAG 2-10-2 801 1031 15 0 11 0 0 >20.00 833 468785 ATTTTCTTCCACAGGG 3-10-3 801 1432 12 0 0 0 0 >20.00 834 468770 TTTTCTTCCACAGG 2-10-2 801 1433 36 2 0 0 28 >20.00 835 468786 GAATGACTTTAATGCT 3-10-3 801 1462 0 0 0 4 0 >20.00 836 468771 AATGACTTTAATGC 2-10-2 801 1463 8 16 0 5 0 >20.00 837

TABLE-US-00009 TABLE 9 Dose-dependent antisense inhibition of human DMPK in hSKMC tested with primer probe set RTS3164 ISIS 1,250 2,500 5,000 10,000 20,000 IC.sub.50 No nM nM nM nM nM (M) 468777 20 66 72 87 96 2.41 468776 68 48 86 90 96 <1.25 468794 18 23 58 65 86 4.97 468787 36 50 51 88 92 2.69 468772 12 47 69 80 86 3.57 468773 33 48 82 91 96 2.21 468774 21 0 30 42 59 1.60 468790 50 57 77 91 91 1.26 468780 23 22 55 73 85 4.69 468775 29 52 55 79 84 3.03 468782 9 0 0 0 0 >20.00 468786 2 0 0 0 0 >20.00 468785 15 0 1 0 5 >20.00 468788 57 74 76 94 96 <1.25 468791 45 66 88 61 97 1.10 468789 26 65 82 90 97 2.02 468781 28 46 59 82 84 3.08 468779 26 31 66 90 97 3.29 468784 7 23 26 7 18 >20.00 468783 0 16 8 0 0 >20.00 468792 26 49 73 84 92 2.72 468795 30 53 83 86 85 2.14 468793 49 66 90 96 95 0.93 468768 23 3 5 9 0 >20.00 468767 0 0 14 0 0 >20.00 468769 31 0 0 16 25 >20.00 468771 4 0 0 0 0 >20.00 468770 33 0 0 0 32 >20.00 468796 62 72 84 96 95 <1.25 468778 44 58 86 96 98 1.44

Example 6: Dose Response Studies with Antisense Oligonucleotides Targeting Human Dystrophia Myotonica-Protein Kinase (DMPK) in DM1 Fibroblast Cells

[0331] The mutant form of the DMPK mRNA, harboring large CUG repeats, are fully transcribed and polyadenylated, but remain trapped in the nucleus (Davis et al, 1997, Proc. Natl. Acad. Sci. U.S.A. 94, 73887393). These mutant nuclear-retained mRNAs are one of the most important pathological features of myotonic dystrophy 1 (DM1). Antisense inhibition of mutant DMPK mRNA in DM1 fibroblast cells was studied.

[0332] The DMPK gene normally has 5-37 CTG repeats in the 3 untranslated region. In myotonic dystrophy type I, this number is significantly expanded and may be in the range of 50 to greater than 3,500 (Harper, Myotonic Dystrophy (Saunders, London, ed. 3, 2001); Annu. Rev. Neurosci. 29: 259, 2006; EMBO J. 19: 4439, 2000; Curr Opin Neurol. 20: 572, 2007). DM1 fibroblast cells were plated at a density of 4,500 cells per well and transfected using Cytofectin reagent with 9.4 nM, 18.8 nM, 37.5 nM, 75.0 nM, 150.0 nM, and 300.0 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164, described hereinabove. DMPK RNA transcript levels were normalized to total RNA content, as measured by RIBOGREEN. Results are presented in Table 10 as percent inhibition of DMPK, relative to untreated control cells.

[0333] An assay with similar conditions was also performed with primer probe set RTS3162, described hereinabove, which targets the 3-end of the DMPK transcript. Results are presented in Table 11 as percent inhibition of DMPK, relative to untreated control cells.

[0334] The tested antisense oligonucleotides demonstrated dose-dependent inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00010 TABLE 10 Dose-dependent antisense inhibition of DMPK mRNA in DM1 fibroblast cells with RTS3164 ISIS 9.4 18.8 37.5 75.0 150.0 300.0 IC.sub.50 No. nM nM nM nM nM nM (nM) 299471 10 25 31 47 61 73 86.3 444401 8 27 41 60 67 74 64.3 444404 10 21 31 43 55 73 100.0 444436 7 17 36 64 68 70 72.3 445569 19 31 41 59 46 77 72.2

TABLE-US-00011 TABLE 11 Dose-dependent antisense inhibition of DMPK mRNA in DM1 fibroblast cells with RTS3162 ISIS 9.4 18.8 37.5 75.0 150.0 300.0 IC.sub.50 No nM nM nM nM nM nM (nM) 299471 7 25 29 46 48 69 115.3 444401 20 34 52 72 83 89 35.8 444404 5 20 28 42 54 77 98.8 444436 12 15 27 61 68 75 74.3 445569 5 25 33 53 50 76 89.6

Example 7: Antisense Inhibition of Human DMPK in Human Skeletal Muscle Cells (hSKMc)

[0335] Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured hSKMc at a density of 20,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of DMPK, relative to untreated control cells.

[0336] The antisense oligonucleotides in Tables 12 and 13 are 5-10-5 gapmers, where the gap segment comprises ten 2-deoxynucleosides and each wing segment comprises five 2-MOE nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytsoine residues throughout each gapmer are 5-methylcytosines. Target start site indicates the 5-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. Target stop site indicates the 3-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence. All the antisense oligonucleotides listed in Table 12 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1). All the antisense oligonucleotides listed in Table 13 target SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to Ser. No. 18/555,106).

[0337] Several of the antisense oligonucleotides demonstrated significant inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00012 TABLE12 InhibitionofhumanDMPKRNAtranscriptin hSKMcby5-10-5gapmerstargeting Target Target % StartSite StopSite ISISNo Sequence inhibition SEQIDNO. 124 143 502369 GCCTGGCAGCCCCTGTCCAG 16 160 125 144 502370 GGCCTGGCAGCCCCTGTCCA 58 161 126 145 502371 GGGCCTGGCAGCCCCTGTCC 62 162 169 188 502372 ATGGCCCCTCCCCGGGCCGG 41 163 170 189 502373 CATGGCCCCTCCCCGGGCCG 29 164 171 190 502374 CCATGGCCCCTCCCCGGGCC 34 165 172 191 502375 ACCATGGCCCCTCCCCGGGC 60 166 173 192 502376 CACCATGGCCCCTCCCCGGG 68 167 174 193 502377 GCACCATGGCCCCTCCCCGG 75 168 175 194 502378 AGCACCATGGCCCCTCCCCG 65 169 176 195 502379 CAGCACCATGGCCCCTCCCC 63 170 177 196 502380 GCAGCACCATGGCCCCTCCC 73 171 178 197 502381 GGCAGCACCATGGCCCCTCC 80 172 180 199 502382 CAGGCAGCACCATGGCCCCT 82 173 181 200 502383 ACAGGCAGCACCATGGCCCC 72 174 183 202 502384 GGACAGGCAGCACCATGGCC 70 175 184 203 502385 TGGACAGGCAGCACCATGGC 71 176 185 204 502386 TTGGACAGGCAGCACCATGG 73 177 186 205 502387 GTTGGACAGGCAGCACCATG 73 178 187 206 502388 TGTTGGACAGGCAGCACCAT 60 179 188 207 502389 ATGTTGGACAGGCAGCACCA 75 180 189 208 502390 CATGTTGGACAGGCAGCACC 81 181 190 209 502391 ACATGTTGGACAGGCAGCAC 67 182 191 210 502392 GACATGTTGGACAGGCAGCA 71 183 192 211 502393 TGACATGTTGGACAGGCAGC 81 184 193 212 502394 CTGACATGTTGGACAGGCAG 76 185 194 213 502395 GCTGACATGTTGGACAGGCA 70 186 195 214 502396 GGCTGACATGTTGGACAGGC 77 187 196 215 502397 CGGCTGACATGTTGGACAGG 74 188 197 216 502398 TCGGCTGACATGTTGGACAG 63 189 198 217 502399 CTCGGCTGACATGTTGGACA 80 190 199 218 502400 CCTCGGCTGACATGTTGGAC 71 191 200 219 502401 ACCTCGGCTGACATGTTGGA 64 192 201 220 502402 CACCTCGGCTGACATGTTGG 71 193 202 221 502403 GCACCTCGGCTGACATGTTG 77 194 203 222 502404 CGCACCTCGGCTGACATGTT 80 195 204 223 502405 CCGCACCTCGGCTGACATGT 80 196 205 224 502406 GCCGCACCTCGGCTGACATG 79 197 206 225 502407 AGCCGCACCTCGGCTGACAT 74 198 207 226 502408 CAGCCGCACCTCGGCTGACA 66 199 208 227 502409 TCAGCCGCACCTCGGCTGAC 15 200 209 228 502410 CTCAGCCGCACCTCGGCTGA 32 201 210 229 502411 CCTCAGCCGCACCTCGGCTG 65 202 211 230 502412 GCCTCAGCCGCACCTCGGCT 81 203 232 251 502413 CCAACACCAGCTGCTGGAGC 90 204 233 252 502414 TCCAACACCAGCTGCTGGAG 78 205 234 253 502415 GTCCAACACCAGCTGCTGGA 84 206 236 255 502416 GGGTCCAACACCAGCTGCTG 69 207 257 276 502417 GGCTCCAGCCCCAGGAAGCC 46 208 258 277 502418 GGGCTCCAGCCCCAGGAAGC 28 209 276 295 502419 CAGGAGAAGGTCGAGCAGGG 41 210 278 297 502420 CCCAGGAGAAGGTCGAGCAG 71 211 279 298 502421 GCCCAGGAGAAGGTCGAGCA 85 212 280 299 451363 CGCCCAGGAGAAGGTCGAGC 84 213 281 300 502422 ACGCCCAGGAGAAGGTCGAG 67 214 317 336 502423 TCCTGGGCCAGTTCGGAGGC 58 215 318 337 502424 GTCCTGGGCCAGTTCGGAGG 71 216 319 338 502425 TGTCCTGGGCCAGTTCGGAG 69 217 320 339 502426 TTGTCCTGGGCCAGTTCGGA 71 218 321 340 502427 CTTGTCCTGGGCCAGTTCGG 66 219 322 341 502428 ACTTGTCCTGGGCCAGTTCG 59 220 323 342 502429 TACTTGTCCTGGGCCAGTTC 75 221 324 343 502430 GTACTTGTCCTGGGCCAGTT 78 222 325 344 502431 CGTACTTGTCCTGGGCCAGT 74 223 343 362 502432 ACTGCAAGAAGTCGGCCACG 73 224 345 364 502433 CCACTGCAAGAAGTCGGCCA 65 225 346 365 451364 CCCACTGCAAGAAGTCGGCC 32 226 347 366 502434 GCCCACTGCAAGAAGTCGGC 70 227 348 367 502435 CGCCCACTGCAAGAAGTCGG 61 228 349 368 502436 CCGCCCACTGCAAGAAGTCG 54 229 350 369 502437 TCCGCCCACTGCAAGAAGTC 40 230 351 370 502438 CTCCGCCCACTGCAAGAAGT 33 231 352 371 502439 GCTCCGCCCACTGCAAGAAG 23 232 353 372 502440 GGCTCCGCCCACTGCAAGAA 23 233 354 373 502441 GGGCTCCGCCCACTGCAAGA 17 234 355 374 502442 TGGGCTCCGCCCACTGCAAG 22 235 356 375 502443 ATGGGCTCCGCCCACTGCAA 14 236 357 376 502444 GATGGGCTCCGCCCACTGCA 43 237 358 377 502445 CGATGGGCTCCGCCCACTGC 37 238 359 378 502446 ACGATGGGCTCCGCCCACTG 0 239 360 379 502447 CACGATGGGCTCCGCCCACT 59 240 361 380 502448 CCACGATGGGCTCCGCCCAC 69 241 362 381 502449 ACCACGATGGGCTCCGCCCA 63 242 363 382 502450 CACCACGATGGGCTCCGCCC 73 243 364 383 502451 TCACCACGATGGGCTCCGCC 77 244 365 384 502452 CTCACCACGATGGGCTCCGC 66 245 366 385 502453 CCTCACCACGATGGGCTCCG 81 246 367 386 502454 GCCTCACCACGATGGGCTCC 77 247 368 387 502455 AGCCTCACCACGATGGGCTC 63 248 369 388 502456 AAGCCTCACCACGATGGGCT 70 249 370 389 502457 TAAGCCTCACCACGATGGGC 78 250 371 390 502458 TTAAGCCTCACCACGATGGG 76 251 372 391 502459 CTTAAGCCTCACCACGATGG 78 252 373 392 502460 CCTTAAGCCTCACCACGATG 68 253 374 393 502461 TCCTTAAGCCTCACCACGAT 67 254 375 394 502462 CTCCTTAAGCCTCACCACGA 84 255 376 395 502463 CCTCCTTAAGCCTCACCACG 76 256 377 396 502464 ACCTCCTTAAGCCTCACCAC 64 257 378 397 502465 GACCTCCTTAAGCCTCACCA 72 258 379 398 502466 GGACCTCCTTAAGCCTCACC 69 259 380 399 502467 CGGACCTCCTTAAGCCTCAC 81 260 381 400 502468 TCGGACCTCCTTAAGCCTCA 78 261 382 401 502469 GTCGGACCTCCTTAAGCCTC 57 262 384 403 502470 CAGTCGGACCTCCTTAAGCC 62 263 385 404 502471 GCAGTCGGACCTCCTTAAGC 45 264 386 405 502472 TGCAGTCGGACCTCCTTAAG 60 265 412 431 502473 CCTTCAGAATCTCGAAGTCG 67 266 413 432 502474 ACCTTCAGAATCTCGAAGTC 50 267 415 434 502475 TCACCTTCAGAATCTCGAAG 54 268 416 435 502476 ATCACCTTCAGAATCTCGAA 38 269 417 436 502477 GATCACCTTCAGAATCTCGA 35 270 419 438 502478 CCGATCACCTTCAGAATCTC 52 271 420 439 502479 TCCGATCACCTTCAGAATCT 50 272 421 440 502480 GTCCGATCACCTTCAGAATC 44 273 422 441 502481 CGTCCGATCACCTTCAGAAT 41 274 467 486 502482 CCCGTCTGCTTCATCTTCAC 67 275 468 487 502483 GCCCGTCTGCTTCATCTTCA 76 276 469 488 502484 GGCCCGTCTGCTTCATCTTC 57 277 470 489 502485 TGGCCCGTCTGCTTCATCTT 64 278 471 490 502486 CTGGCCCGTCTGCTTCATCT 64 279 472 491 502487 CCTGGCCCGTCTGCTTCATC 73 280 473 492 502488 ACCTGGCCCGTCTGCTTCAT 64 281 474 493 502489 CACCTGGCCCGTCTGCTTCA 80 282 475 494 502490 ACACCTGGCCCGTCTGCTTC 71 283 476 495 502491 TACACCTGGCCCGTCTGCTT 74 284 497 516 502492 TTGTTCATGATCTTCATGGC 56 285 499 518 502493 ACTTGTTCATGATCTTCATG 23 286 500 519 502494 CACTTGTTCATGATCTTCAT 43 287 501 520 502495 CCACTTGTTCATGATCTTCA 43 288 502 521 502496 CCCACTTGTTCATGATCTTC 47 289 503 522 502497 TCCCACTTGTTCATGATCTT 34 290 504 523 502498 GTCCCACTTGTTCATGATCT 34 291 505 524 502499 TGTCCCACTTGTTCATGATC 27 292 506 525 502500 ATGTCCCACTTGTTCATGAT 23 293 507 526 502501 CATGTCCCACTTGTTCATGA 51 294 508 527 502502 GCATGTCCCACTTGTTCATG 20 295 509 528 502503 AGCATGTCCCACTTGTTCAT 52 296 510 529 502504 CAGCATGTCCCACTTGTTCA 72 297 511 530 502505 TCAGCATGTCCCACTTGTTC 70 298 512 531 502506 TTCAGCATGTCCCACTTGTT 53 299 513 532 502507 CTTCAGCATGTCCCACTTGT 52 300 514 533 502508 TCTTCAGCATGTCCCACTTG 45 301 516 535 502509 CCTCTTCAGCATGTCCCACT 68 302 517 536 502510 CCCTCTTCAGCATGTCCCAC 68 303 518 537 502511 CCCCTCTTCAGCATGTCCCA 79 304 519 538 502512 GCCCCTCTTCAGCATGTCCC 85 305 520 539 502513 CGCCCCTCTTCAGCATGTCC 84 306 521 540 502514 TCGCCCCTCTTCAGCATGTC 80 307 522 541 502515 CTCGCCCCTCTTCAGCATGT 82 308 523 542 502516 CCTCGCCCCTCTTCAGCATG 78 309 524 543 502517 ACCTCGCCCCTCTTCAGCAT 73 310 525 544 502518 CACCTCGCCCCTCTTCAGCA 76 311 526 545 502519 ACACCTCGCCCCTCTTCAGC 79 312 527 546 502520 GACACCTCGCCCCTCTTCAG 73 313 821 840 502521 GCCAGGCGGATGTGGCCACA 57 314 868 887 502522 ACCGCACCGTTCCATCTGCC 62 315 869 888 502523 GACCGCACCGTTCCATCTGC 29 316 923 942 502524 ACAGCCTGCAGGATCTCGGG 86 317 924 943 502525 CACAGCCTGCAGGATCTCGG 81 318 925 944 502526 CCACAGCCTGCAGGATCTCG 83 319 926 945 502527 CCCACAGCCTGCAGGATCTC 84 320 927 946 502528 GCCCACAGCCTGCAGGATCT 91 321 928 947 502529 CGCCCACAGCCTGCAGGATC 90 322 929 948 502530 CCGCCCACAGCCTGCAGGAT 82 323 930 949 502531 ACCGCCCACAGCCTGCAGGA 83 324 931 950 502532 CACCGCCCACAGCCTGCAGG 85 325 932 951 502533 CCACCGCCCACAGCCTGCAG 84 326 933 952 502534 CCCACCGCCCACAGCCTGCA 80 327 934 953 502535 GCCCACCGCCCACAGCCTGC 90 328 935 954 502536 GGCCCACCGCCCACAGCCTG 94 329 936 955 502537 AGGCCCACCGCCCACAGCCT 88 330 937 956 502538 CAGGCCCACCGCCCACAGCC 91 331 938 957 502539 CCAGGCCCACCGCCCACAGC 73 332 939 958 502540 CCCAGGCCCACCGCCCACAG 86 333 940 959 502541 TCCCAGGCCCACCGCCCACA 88 334 941 960 502542 GTCCCAGGCCCACCGCCCAC 84 335 942 961 502543 TGTCCCAGGCCCACCGCCCA 85 336 943 962 502544 CTGTCCCAGGCCCACCGCCC 65 337 944 963 502545 CCTGTCCCAGGCCCACCGCC 81 338 945 964 502546 GCCTGTCCCAGGCCCACCGC 90 339 946 965 502547 TGCCTGTCCCAGGCCCACCG 85 340 947 966 502548 CTGCCTGTCCCAGGCCCACC 89 341 948 967 502549 GCTGCCTGTCCCAGGCCCAC 91 342 949 968 502550 AGCTGCCTGTCCCAGGCCCA 94 343 950 969 502551 TAGCTGCCTGTCCCAGGCCC 92 344 951 970 502552 GTAGCTGCCTGTCCCAGGCC 88 345 952 971 502553 CGTAGCTGCCTGTCCCAGGC 85 346 953 972 502554 CCGTAGCTGCCTGTCCCAGG 83 347 954 973 502555 CCCGTAGCTGCCTGTCCCAG 64 348 955 974 502556 GCCCGTAGCTGCCTGTCCCA 83 349 956 975 502557 GGCCCGTAGCTGCCTGTCCC 89 350 1004 1023 502558 TAGAACATTTCATAGGCGAA 68 351 1042 1061 502559 TCTCCGCCGTGGAATCCGCG 75 352 1043 1062 502560 GTCTCCGCCGTGGAATCCGC 79 353 1044 1063 502561 GGTCTCCGCCGTGGAATCCG 66 354 1045 1064 502562 AGGTCTCCGCCGTGGAATCC 50 355 1046 1065 502563 TAGGTCTCCGCCGTGGAATC 71 356 1067 1086 502564 TTGTAGTGGACGATCTTGCC 68 357 1068 1087 502565 CTTGTAGTGGACGATCTTGC 70 358 1069 1088 502566 CCTTGTAGTGGACGATCTTG 61 359 1070 1089 502567 TCCTTGTAGTGGACGATCTT 72 360 1071 1090 502568 CTCCTTGTAGTGGACGATCT 75 361 1072 1091 502569 GCTCCTTGTAGTGGACGATC 75 362 1073 1092 502570 TGCTCCTTGTAGTGGACGAT 83 363 1074 1093 502571 GTGCTCCTTGTAGTGGACGA 72 364 1075 1094 502572 GGTGCTCCTTGTAGTGGACG 66 365 1076 1095 502573 AGGTGCTCCTTGTAGTGGAC 51 366 1077 1096 502574 GAGGTGCTCCTTGTAGTGGA 46 367 1078 1097 502575 AGAGGTGCTCCTTGTAGTGG 70 368 1079 1098 502576 GAGAGGTGCTCCTTGTAGTG 47 369 1080 1099 502577 AGAGAGGTGCTCCTTGTAGT 65 370 1081 1100 502578 GAGAGAGGTGCTCCTTGTAG 45 371 1082 1101 502579 AGAGAGAGGTGCTCCTTGTA 63 372 1083 1102 502580 CAGAGAGAGGTGCTCCTTGT 77 373 1085 1104 502581 GGCAGAGAGAGGTGCTCCTT 70 374 1086 1105 502582 CGGCAGAGAGAGGTGCTCCT 80 375 1087 1106 502583 GCGGCAGAGAGAGGTGCTCC 62 376 1088 1107 502584 AGCGGCAGAGAGAGGTGCTC 44 377 1089 1108 502585 CAGCGGCAGAGAGAGGTGCT 78 378 1090 1109 502586 CCAGCGGCAGAGAGAGGTGC 71 379 1165 1184 502587 GGCCCAGCCGTGTCTCCGGG 77 380 1166 1185 502588 CGGCCCAGCCGTGTCTCCGG 69 381 1167 1186 502589 CCGGCCCAGCCGTGTCTCCG 70 382 1168 1187 502590 CCCGGCCCAGCCGTGTCTCC 75 383 1169 1188 502591 CCCCGGCCCAGCCGTGTCTC 77 384 1170 1189 502592 ACCCCGGCCCAGCCGTGTCT 73 385 1171 1190 502593 CACCCCGGCCCAGCCGTGTC 84 386 1172 1191 502594 CCACCCCGGCCCAGCCGTGT 78 387 1173 1192 502595 TCCACCCCGGCCCAGCCGTG 71 388 1174 1193 502596 CTCCACCCCGGCCCAGCCGT 81 389 1175 1194 502597 GCTCCACCCCGGCCCAGCCG 86 390 1176 1195 502598 TGCTCCACCCCGGCCCAGCC 83 391 1177 1196 502599 CTGCTCCACCCCGGCCCAGC 88 392 1199 1218 502600 AAGGGATGTGTCCGGAAGTC 60 393 1200 1219 502601 GAAGGGATGTGTCCGGAAGT 58 394 1201 1220 502602 AGAAGGGATGTGTCCGGAAG 63 395 1202 1221 502603 AAGAAGGGATGTGTCCGGAA 62 396 1203 1222 502604 GAAGAAGGGATGTGTCCGGA 61 397 1204 1223 502605 AGAAGAAGGGATGTGTCCGG 62 398 1205 1224 502606 AAGAAGAAGGGATGTGTCCG 56 399 1206 1225 502607 AAAGAAGAAGGGATGTGTCC 58 400 1207 1226 502608 CAAAGAAGAAGGGATGTGTC 50 401 1208 1227 502609 CCAAAGAAGAAGGGATGTGT 61 402 1210 1229 502610 GGCCAAAGAAGAAGGGATGT 73 403 1211 1230 502611 AGGCCAAAGAAGAAGGGATG 56 404 1212 1231 502612 GAGGCCAAAGAAGAAGGGAT 73 405 1213 1232 502613 CGAGGCCAAAGAAGAAGGGA 75 406 1214 1233 502614 TCGAGGCCAAAGAAGAAGGG 75 407 1215 1234 502615 GTCGAGGCCAAAGAAGAAGG 83 408 1216 1235 502616 AGTCGAGGCCAAAGAAGAAG 58 409 1217 1236 502617 CAGTCGAGGCCAAAGAAGAA 52 410 1218 1237 502618 CCAGTCGAGGCCAAAGAAGA 68 411 1219 1238 502619 CCCAGTCGAGGCCAAAGAAG 78 412 1220 1239 502620 TCCCAGTCGAGGCCAAAGAA 66 413 1221 1240 502621 ATCCCAGTCGAGGCCAAAGA 75 414 1222 1241 502622 CATCCCAGTCGAGGCCAAAG 70 415 1223 1242 502623 CCATCCCAGTCGAGGCCAAA 81 416 1224 1243 502624 ACCATCCCAGTCGAGGCCAA 82 417 1225 1244 502625 GACCATCCCAGTCGAGGCCA 88 418 1226 1245 502626 AGACCATCCCAGTCGAGGCC 79 419 1227 1246 502627 GAGACCATCCCAGTCGAGGC 82 420 1228 1247 502628 GGAGACCATCCCAGTCGAGG 60 421 1263 1282 502629 TTCGAAATCCGGTGTAAAGG 84 422 1264 1283 502630 CTTCGAAATCCGGTGTAAAG 57 423 1265 1284 502631 CCTTCGAAATCCGGTGTAAA 64 424 1266 1285 502632 ACCTTCGAAATCCGGTGTAA 73 425 1267 1286 502633 CACCTTCGAAATCCGGTGTA 77 426 1268 1287 502634 GCACCTTCGAAATCCGGTGT 59 427 1269 1288 502635 GGCACCTTCGAAATCCGGTG 85 428 1270 1289 502636 TGGCACCTTCGAAATCCGGT 86 429 1271 1290 502637 GTGGCACCTTCGAAATCCGG 74 430 1272 1291 502638 GGTGGCACCTTCGAAATCCG 79 431 1273 1292 502639 CGGTGGCACCTTCGAAATCC 85 432 1274 1293 502640 TCGGTGGCACCTTCGAAATC 71 433 1275 1294 502641 GTCGGTGGCACCTTCGAAAT 88 434 1276 1295 502642 TGTCGGTGGCACCTTCGAAA 89 435 1277 1296 502643 GTGTCGGTGGCACCTTCGAA 88 436 1278 1297 502644 TGTGTCGGTGGCACCTTCGA 87 437 1279 1298 502645 ATGTGTCGGTGGCACCTTCG 88 438 1280 1299 502646 CATGTGTCGGTGGCACCTTC 88 439 1281 1300 502647 GCATGTGTCGGTGGCACCTT 91 440 1282 1301 502648 TGCATGTGTCGGTGGCACCT 87 441 1283 1302 502649 TTGCATGTGTCGGTGGCACC 86 442 1284 1303 502650 GTTGCATGTGTCGGTGGCAC 83 443 1285 1304 502651 AGTTGCATGTGTCGGTGGCA 81 444 1286 1305 502652 AAGTTGCATGTGTCGGTGGC 79 445 1287 1306 502653 GAAGTTGCATGTGTCGGTGG 58 446 1288 1307 502654 CGAAGTTGCATGTGTCGGTG 85 447 1290 1309 502655 GTCGAAGTTGCATGTGTCGG 77 448 1291 1310 502656 AGTCGAAGTTGCATGTGTCG 79 449 1292 1311 502657 AAGTCGAAGTTGCATGTGTC 74 450 1293 1312 502658 CAAGTCGAAGTTGCATGTGT 82 451 1294 1313 502659 CCAAGTCGAAGTTGCATGTG 82 452 1295 1314 502660 ACCAAGTCGAAGTTGCATGT 70 453 1296 1315 502661 CACCAAGTCGAAGTTGCATG 76 454 1297 1316 502662 CCACCAAGTCGAAGTTGCAT 79 455 1298 1317 502663 TCCACCAAGTCGAAGTTGCA 68 456 1299 1318 502664 CTCCACCAAGTCGAAGTTGC 71 457 1300 1319 502665 CCTCCACCAAGTCGAAGTTG 67 458 1301 1320 502666 TCCTCCACCAAGTCGAAGTT 70 459 1302 1321 502667 GTCCTCCACCAAGTCGAAGT 80 460 1303 1322 502668 CGTCCTCCACCAAGTCGAAG 76 461 1304 1323 502669 CCGTCCTCCACCAAGTCGAA 78 462 1305 1324 502670 CCCGTCCTCCACCAAGTCGA 83 463 1306 1325 502671 GCCCGTCCTCCACCAAGTCG 76 464 1307 1326 502672 AGCCCGTCCTCCACCAAGTC 72 465 1308 1327 502673 GAGCCCGTCCTCCACCAAGT 71 466 1309 1328 502674 TGAGCCCGTCCTCCACCAAG 60 467 1702 1721 502675 GGTTCCGAGCCTCTGCCTCG 44 468 1703 1722 502676 CGGTTCCGAGCCTCTGCCTC 74 469 1704 1723 502677 CCGGTTCCGAGCCTCTGCCT 72 470 1705 1724 502678 CCCGGTTCCGAGCCTCTGCC 73 471 1706 1725 502679 TCCCGGTTCCGAGCCTCTGC 84 472 1707 1726 502680 GTCCCGGTTCCGAGCCTCTG 66 473 1709 1728 502681 AGGTCCCGGTTCCGAGCCTC 82 474 1710 1729 502682 TAGGTCCCGGTTCCGAGCCT 83 475 1711 1730 502683 CTAGGTCCCGGTTCCGAGCC 81 476 1712 1731 502684 TCTAGGTCCCGGTTCCGAGC 74 477 1713 1732 502685 CTCTAGGTCCCGGTTCCGAG 78 478 1714 1733 502686 CCTCTAGGTCCCGGTTCCGA 75 479 1715 1734 502687 GCCTCTAGGTCCCGGTTCCG 80 480 1743 1762 502688 CATCCGCTCCTGCAACTGCC 89 481 1744 1763 502689 CCATCCGCTCCTGCAACTGC 81 482 1745 1764 502690 TCCATCCGCTCCTGCAACTG 71 483 1746 1765 502691 CTCCATCCGCTCCTGCAACT 75 484 1747 1766 502692 ACTCCATCCGCTCCTGCAAC 64 485 1748 1767 502693 AACTCCATCCGCTCCTGCAA 52 486 1749 1768 502694 CAACTCCATCCGCTCCTGCA 45 487 1751 1770 502695 AGCAACTCCATCCGCTCCTG 78 488 1752 1771 502696 CAGCAACTCCATCCGCTCCT 64 489 1753 1772 502697 GCAGCAACTCCATCCGCTCC 56 490 1774 1793 502698 CAGCTGTGGCTCCCTCTGCC 60 491 1775 1794 502699 ACAGCTGTGGCTCCCTCTGC 45 492 1776 1795 502700 GACAGCTGTGGCTCCCTCTG 49 493 1777 1796 502701 TGACAGCTGTGGCTCCCTCT 26 494 1778 1797 502702 GTGACAGCTGTGGCTCCCTC 32 495 1779 1798 502703 CGTGACAGCTGTGGCTCCCT 28 496 1780 1799 502704 CCGTGACAGCTGTGGCTCCC 35 497 1781 1800 502705 CCCGTGACAGCTGTGGCTCC 33 498 1782 1801 502706 CCCCGTGACAGCTGTGGCTC 53 499 1783 1802 502707 CCCCCGTGACAGCTGTGGCT 39 500 1784 1803 502708 ACCCCCGTGACAGCTGTGGC 53 501 1785 1804 502709 GACCCCCGTGACAGCTGTGG 51 502 1786 1805 502710 GGACCCCCGTGACAGCTGTG 58 503 1787 1806 502711 GGGACCCCCGTGACAGCTGT 71 504 1814 1833 502712 GAAGGTGGATCCGTGGCCCG 73 505 1815 1834 502713 GGAAGGTGGATCCGTGGCCC 70 506 1816 1835 502714 GGGAAGGTGGATCCGTGGCC 72 507 1817 1836 502715 TGGGAAGGTGGATCCGTGGC 50 508 1818 1837 502716 ATGGGAAGGTGGATCCGTGG 62 509 1819 1838 502717 GATGGGAAGGTGGATCCGTG 75 510 1821 1840 502718 TAGATGGGAAGGTGGATCCG 52 511 1822 1841 502719 CTAGATGGGAAGGTGGATCC 56 512 1823 1842 502720 TCTAGATGGGAAGGTGGATC 21 513 1824 1843 502721 ATCTAGATGGGAAGGTGGAT 34 514 1826 1845 502722 CCATCTAGATGGGAAGGTGG 43 515 1827 1846 502723 GCCATCTAGATGGGAAGGTG 17 516 1828 1847 451383 GGCCATCTAGATGGGAAGGT 0 517 1863 1882 502724 CACCAGCGGGCACTGGCCCA 51 518 1864 1883 502725 CCACCAGCGGGCACTGGCCC 55 519 1865 1884 502726 CCCACCAGCGGGCACTGGCC 61 520 1866 1885 502727 CCCCACCAGCGGGCACTGGC 43 521 1868 1887 502728 GGCCCCACCAGCGGGCACTG 16 522 1869 1888 502729 TGGCCCCACCAGCGGGCACT 43 523 1870 1889 502730 CTGGCCCCACCAGCGGGCAC 43 524 1871 1890 502731 CCTGGCCCCACCAGCGGGCA 41 525 1872 1891 502732 GCCTGGCCCCACCAGCGGGC 30 526 1874 1893 502733 GGGCCTGGCCCCACCAGCGG 66 527 1892 1911 502734 AGGTGGCGGCGGTGCATGGG 31 528 1893 1912 502735 CAGGTGGCGGCGGTGCATGG 23 529 1894 1913 502736 GCAGGTGGCGGCGGTGCATG 57 530 1895 1914 502737 AGCAGGTGGCGGCGGTGCAT 54 531 1896 1915 502738 CAGCAGGTGGCGGCGGTGCA 61 532 1897 1916 502739 GCAGCAGGTGGCGGCGGTGC 57 533 1898 1917 502740 AGCAGCAGGTGGCGGCGGTG 36 534 1899 1918 502741 GAGCAGCAGGTGGCGGCGGT 53 535 1900 1919 502742 GGAGCAGCAGGTGGCGGCGG 39 536 1901 1920 502743 GGGAGCAGCAGGTGGCGGCG 36 537 1902 1921 502744 AGGGAGCAGCAGGTGGCGGC 62 538 1903 1922 502745 CAGGGAGCAGCAGGTGGCGG 56 539 1904 1923 502746 GCAGGGAGCAGCAGGTGGCG 58 540 1905 1924 502747 GGCAGGGAGCAGCAGGTGGC 65 541 1906 1925 502748 TGGCAGGGAGCAGCAGGTGG 47 542 1907 1926 502749 CTGGCAGGGAGCAGCAGGTG 41 543 1909 1928 451432 CCCTGGCAGGGAGCAGCAGG 53 544 1910 1929 502750 ACCCTGGCAGGGAGCAGCAG 52 545 1911 1930 502751 GACCCTGGCAGGGAGCAGCA 77 546 1912 1931 502752 GGACCCTGGCAGGGAGCAGC 0 547 1919 1938 502753 GGCCTAGGGACCCTGGCAGG 39 548 1920 1939 502754 AGGCCTAGGGACCCTGGCAG 35 549 1922 1941 502755 CCAGGCCTAGGGACCCTGGC 44 550 1923 1942 502756 GCCAGGCCTAGGGACCCTGG 60 551 1924 1943 502757 GGCCAGGCCTAGGGACCCTG 58 552 1925 1944 502758 AGGCCAGGCCTAGGGACCCT 57 553 1926 1945 502759 TAGGCCAGGCCTAGGGACCC 52 554 1927 1946 502760 ATAGGCCAGGCCTAGGGACC 51 555 1928 1947 502761 GATAGGCCAGGCCTAGGGAC 41 556 1929 1948 502762 CGATAGGCCAGGCCTAGGGA 69 557 1930 1949 502763 CCGATAGGCCAGGCCTAGGG 80 558 1931 1950 502764 TCCGATAGGCCAGGCCTAGG 78 559 1932 1951 502765 CTCCGATAGGCCAGGCCTAG 89 560 1933 1952 502766 CCTCCGATAGGCCAGGCCTA 79 561 1934 1953 502767 GCCTCCGATAGGCCAGGCCT 73 562 1936 1955 502768 GCGCCTCCGATAGGCCAGGC 83 563 1952 1971 502769 AACAGGAGCAGGGAAAGCGC 83 564 1953 1972 502770 GAACAGGAGCAGGGAAAGCG 70 565 1954 1973 502771 CGAACAGGAGCAGGGAAAGC 43 566 1955 1974 502772 GCGAACAGGAGCAGGGAAAG 47 567 1956 1975 502773 GGCGAACAGGAGCAGGGAAA 61 568 1957 1976 502774 CGGCGAACAGGAGCAGGGAA 74 569 1958 1977 502775 ACGGCGAACAGGAGCAGGGA 60 570 1959 1978 502776 AACGGCGAACAGGAGCAGGG 86 571 1960 1979 502777 CAACGGCGAACAGGAGCAGG 84 572 1981 2000 502778 GGGCGGCGGCACGAGACAGA 80 573 1982 2001 502779 AGGGCGGCGGCACGAGACAG 76 574 1983 2002 502780 CAGGGCGGCGGCACGAGACA 58 575 1984 2003 502781 CCAGGGCGGCGGCACGAGAC 80 576 1985 2004 502782 CCCAGGGCGGCGGCACGAGA 59 577 1986 2005 502783 GCCCAGGGCGGCGGCACGAG 68 578 1987 2006 502784 AGCCCAGGGCGGCGGCACGA 75 579 1988 2007 502785 CAGCCCAGGGCGGCGGCACG 76 580 1989 2008 502786 GCAGCCCAGGGCGGCGGCAC 70 581 2026 2045 502787 CTGCGGTGAGTTGGCCGGCG 68 582 2027 2046 502788 ACTGCGGTGAGTTGGCCGGC 67 583 2028 2047 502789 GACTGCGGTGAGTTGGCCGG 58 584 2029 2048 502790 AGACTGCGGTGAGTTGGCCG 71 585 2030 2049 502791 CAGACTGCGGTGAGTTGGCC 70 586 2031 2050 502792 CCAGACTGCGGTGAGTTGGC 79 587 2032 2051 502793 GCCAGACTGCGGTGAGTTGG 76 588 2033 2052 502794 CGCCAGACTGCGGTGAGTTG 66 589 2077 2096 502795 AAGACAGTTCTAGGGTTCAG 87 590 2078 2097 502796 GAAGACAGTTCTAGGGTTCA 78 591 2079 2098 502797 CGAAGACAGTTCTAGGGTTC 85 592 2080 2099 502798 TCGAAGACAGTTCTAGGGTT 78 593 2081 2100 502799 GTCGAAGACAGTTCTAGGGT 92 594 2082 2101 502800 AGTCGAAGACAGTTCTAGGG 85 595 2083 2102 502801 GAGTCGAAGACAGTTCTAGG 83 596 2084 2103 502802 GGAGTCGAAGACAGTTCTAG 86 597 2085 2104 502803 CGGAGTCGAAGACAGTTCTA 91 598 2086 2105 502804 CCGGAGTCGAAGACAGTTCT 76 599 2087 2106 502805 CCCGGAGTCGAAGACAGTTC 90 600 2088 2107 502806 CCCCGGAGTCGAAGACAGTT 83 601 2089 2108 502807 GCCCCGGAGTCGAAGACAGT 82 602 2090 2109 502808 GGCCCCGGAGTCGAAGACAG 73 603 2091 2110 502809 GGGCCCCGGAGTCGAAGACA 67 604 2143 2162 502810 AGGCGGTGGGCGCGGCTTCT 73 605 2144 2163 502811 CAGGCGGTGGGCGCGGCTTC 57 606 2145 2164 502812 GCAGGCGGTGGGCGCGGCTT 69 607 2147 2166 502813 TGGCAGGCGGTGGGCGCGGC 73 608 2149 2168 502814 ACTGGCAGGCGGTGGGCGCG 56 609 2151 2170 502815 GAACTGGCAGGCGGTGGGCG 71 610 2152 2171 502816 TGAACTGGCAGGCGGTGGGC 80 611 2154 2173 502817 TGTGAACTGGCAGGCGGTGG 85 612 2187 2206 502818 TGGAGCTGGGCGGAGACCCA 55 613 2189 2208 502819 ACTGGAGCTGGGCGGAGACC 53 614 2190 2209 502820 GACTGGAGCTGGGCGGAGAC 55 615 2192 2211 502821 AGGACTGGAGCTGGGCGGAG 76 616 2194 2213 502822 ACAGGACTGGAGCTGGGCGG 77 617 2195 2214 502823 CACAGGACTGGAGCTGGGCG 74 618 2196 2215 502824 TCACAGGACTGGAGCTGGGC 90 619 2386 2405 502825 GCCTCAGCCTGGCCGAAAGA 80 620 2387 2406 502826 GGCCTCAGCCTGGCCGAAAG 72 621 2490 2509 444401 TTGCACTTTGCGAACCAACG 97 41

TABLE-US-00013 TABLE13 InhibitionofhumanDMPKRNAtranscript inhSKMcby5-10-5gapmerstargetingSEQIDNO:2 Target Target Start Stop ISIS % SEQID Site Site No Sequence inhibition NO. 503 522 502983 TGGTGGAGCCAAGCCCTCCC 83 622 561 580 502984 GGGCACCCTCAGAGCCTGAA 82 623 1197 1216 502369 GCCTGGCAGCCCCTGTCCAG 16 160 1198 1217 502370 GGCCTGGCAGCCCCTGTCCA 58 161 1199 1218 502371 GGGCCTGGCAGCCCCTGTCC 62 162 1242 1261 502372 ATGGCCCCTCCCCGGGCCGG 41 163 1243 1262 502373 CATGGCCCCTCCCCGGGCCG 29 164 1244 1263 502374 CCATGGCCCCTCCCCGGGCC 34 165 1245 1264 502375 ACCATGGCCCCTCCCCGGGC 60 166 1246 1265 502376 CACCATGGCCCCTCCCCGGG 68 167 1247 1266 502377 GCACCATGGCCCCTCCCCGG 75 168 1248 1267 502378 AGCACCATGGCCCCTCCCCG 65 169 1249 1268 502379 CAGCACCATGGCCCCTCCCC 63 170 1250 1269 502380 GCAGCACCATGGCCCCTCCC 73 171 1251 1270 502381 GGCAGCACCATGGCCCCTCC 80 172 1253 1272 502382 CAGGCAGCACCATGGCCCCT 82 173 1254 1273 502383 ACAGGCAGCACCATGGCCCC 72 174 1256 1275 502384 GGACAGGCAGCACCATGGCC 70 175 1257 1276 502385 TGGACAGGCAGCACCATGGC 71 176 1258 1277 502386 TTGGACAGGCAGCACCATGG 73 177 1259 1278 502387 GTTGGACAGGCAGCACCATG 73 178 1260 1279 502388 TGTTGGACAGGCAGCACCAT 60 179 1261 1280 502389 ATGTTGGACAGGCAGCACCA 75 180 1262 1281 502390 CATGTTGGACAGGCAGCACC 81 181 1263 1282 502391 ACATGTTGGACAGGCAGCAC 67 182 1264 1283 502392 GACATGTTGGACAGGCAGCA 71 183 1265 1284 502393 TGACATGTTGGACAGGCAGC 81 184 1266 1285 502394 CTGACATGTTGGACAGGCAG 76 185 1267 1286 502395 GCTGACATGTTGGACAGGCA 70 186 1268 1287 502396 GGCTGACATGTTGGACAGGC 77 187 1269 1288 502397 CGGCTGACATGTTGGACAGG 74 188 1270 1289 502398 TCGGCTGACATGTTGGACAG 63 189 1271 1290 502399 CTCGGCTGACATGTTGGACA 80 190 1272 1291 502400 CCTCGGCTGACATGTTGGAC 71 191 1273 1292 502401 ACCTCGGCTGACATGTTGGA 64 192 1274 1293 502402 CACCTCGGCTGACATGTTGG 71 193 1275 1294 502403 GCACCTCGGCTGACATGTTG 77 194 1276 1295 502404 CGCACCTCGGCTGACATGTT 80 195 1277 1296 502405 CCGCACCTCGGCTGACATGT 80 196 1278 1297 502406 GCCGCACCTCGGCTGACATG 79 197 1279 1298 502407 AGCCGCACCTCGGCTGACAT 74 198 1280 1299 502408 CAGCCGCACCTCGGCTGACA 66 199 1281 1300 502409 TCAGCCGCACCTCGGCTGAC 15 200 1282 1301 502410 CTCAGCCGCACCTCGGCTGA 32 201 1283 1302 502411 CCTCAGCCGCACCTCGGCTG 65 202 1284 1303 502412 GCCTCAGCCGCACCTCGGCT 81 203 1305 1324 502413 CCAACACCAGCTGCTGGAGC 90 204 1306 1325 502414 TCCAACACCAGCTGCTGGAG 78 205 1307 1326 502415 GTCCAACACCAGCTGCTGGA 84 206 1309 1328 502416 GGGTCCAACACCAGCTGCTG 69 207 1330 1349 502417 GGCTCCAGCCCCAGGAAGCC 46 208 1331 1350 502418 GGGCTCCAGCCCCAGGAAGC 28 209 1349 1368 502419 CAGGAGAAGGTCGAGCAGGG 41 210 1351 1370 502420 CCCAGGAGAAGGTCGAGCAG 71 211 1352 1371 502421 GCCCAGGAGAAGGTCGAGCA 85 212 1353 1372 451363 CGCCCAGGAGAAGGTCGAGC 84 213 1354 1373 502422 ACGCCCAGGAGAAGGTCGAG 67 214 1390 1409 502423 TCCTGGGCCAGTTCGGAGGC 58 215 1391 1410 502424 GTCCTGGGCCAGTTCGGAGG 71 216 1392 1411 502425 TGTCCTGGGCCAGTTCGGAG 69 217 1393 1412 502426 TTGTCCTGGGCCAGTTCGGA 71 218 1394 1413 502427 CTTGTCCTGGGCCAGTTCGG 66 219 1395 1414 502428 ACTTGTCCTGGGCCAGTTCG 59 220 1396 1415 502429 TACTTGTCCTGGGCCAGTTC 75 221 1397 1416 502430 GTACTTGTCCTGGGCCAGTT 78 222 1398 1417 502431 CGTACTTGTCCTGGGCCAGT 74 223 1416 1435 502432 ACTGCAAGAAGTCGGCCACG 73 224 1418 1437 502433 CCACTGCAAGAAGTCGGCCA 65 225 1419 1438 451364 CCCACTGCAAGAAGTCGGCC 32 226 1421 1440 502985 ACCCCACTGCAAGAAGTCGG 60 624 1551 1570 502986 GCCCCAGGATGGGAGGATCT 58 625 1597 1616 502987 CATAGGACAGAGAAATGTTG 70 626 1630 1649 502988 TGCTGACCTTACTCTGCCCC 86 627 1666 1685 502989 TAAGCCATGGCTCTGAGTCA 51 628 1712 1731 502990 AGAGAGGCCATGGGAGGCTG 42 629 1841 1860 502991 CTGGCCCTCCTGGCTTGCCC 72 630 1853 1872 502992 AGCTGCCCCATGCTGGCCCT 76 631 1862 1881 502993 GCCCCTGGCAGCTGCCCCAT 70 632 1873 1892 502994 CTGTCGGCTGCGCCCCTGGC 78 633 1887 1906 502995 CGCCGAACACCTGCCTGTCG 68 634 1931 1950 502996 CCTCCCAGTGCCTGGGCACC 52 635 1981 2000 502998 GCGCCTGTCTGCAAAGCTGG 84 636 2025 2044 502999 CCCAAAGTTGTCCCTCCTGG 83 637 2038 2057 503000 ACACCCAGAAGAACCCAAAG 75 638 2117 2136 503001 CTGACCCACACGGCTCATAG 65 639 2235 2254 503002 TGGCCCCAGGCCCTGGAAAG 67 640 2278 2297 503003 GACAAGGCAGCTGGCAGAAG 79 641 2331 2350 503004 AAGAAACCAGTGACCAGTGA 85 642 2523 2542 503005 CTGTGAAATGGGAGGAGGAG 0 643 2578 2597 503006 GAAGGTTTTTCCAGAGGCTG 88 644 2615 2634 503007 GGCCAGGAGAGTCATTAGGG 84 645 2710 2729 503008 CCACAAAAGGAGTGCTCCTC 79 646 2789 2808 503009 CCTTTTAAGGCAGCAGGAAC 78 647 3629 3648 503010 CTAGGACTGTCTGCTTCCCA 88 648 3761 3780 502452 CTCACCACGATGGGCTCCGC 66 245 3762 3781 502453 CCTCACCACGATGGGCTCCG 81 246 3763 3782 502454 GCCTCACCACGATGGGCTCC 77 247 3764 3783 502455 AGCCTCACCACGATGGGCTC 63 248 3765 3784 502456 AAGCCTCACCACGATGGGCT 70 249 3766 3785 502457 TAAGCCTCACCACGATGGGC 78 250 3767 3786 502458 TTAAGCCTCACCACGATGGG 76 251 3768 3787 502459 CTTAAGCCTCACCACGATGG 78 252 3769 3788 502460 CCTTAAGCCTCACCACGATG 68 253 3770 3789 502461 TCCTTAAGCCTCACCACGAT 67 254 3771 3790 502462 CTCCTTAAGCCTCACCACGA 84 255 3772 3791 502463 CCTCCTTAAGCCTCACCACG 76 256 3773 3792 502464 ACCTCCTTAAGCCTCACCAC 64 257 3774 3793 502465 GACCTCCTTAAGCCTCACCA 72 258 3775 3794 502466 GGACCTCCTTAAGCCTCACC 69 259 3776 3795 502467 CGGACCTCCTTAAGCCTCAC 81 260 3777 3796 502468 TCGGACCTCCTTAAGCCTCA 78 261 3778 3797 502469 GTCGGACCTCCTTAAGCCTC 57 262 3780 3799 502470 CAGTCGGACCTCCTTAAGCC 62 263 3781 3800 502471 GCAGTCGGACCTCCTTAAGC 45 264 3782 3801 502472 TGCAGTCGGACCTCCTTAAG 60 265 3808 3827 502473 CCTTCAGAATCTCGAAGTCG 67 266 3809 3828 502474 ACCTTCAGAATCTCGAAGTC 50 267 3811 3830 502475 TCACCTTCAGAATCTCGAAG 54 268 3812 3831 502476 ATCACCTTCAGAATCTCGAA 38 269 3813 3832 502477 GATCACCTTCAGAATCTCGA 35 270 3815 3834 502478 CCGATCACCTTCAGAATCTC 52 271 3816 3835 502479 TCCGATCACCTTCAGAATCT 50 272 3817 3836 502480 GTCCGATCACCTTCAGAATC 44 273 3818 3837 502481 CGTCCGATCACCTTCAGAAT 41 274 3921 3940 503011 GTCATTCATCAATTTCTAAG 44 649 4118 4137 502482 CCCGTCTGCTTCATCTTCAC 67 275 4119 4138 502483 GCCCGTCTGCTTCATCTTCA 76 276 4120 4139 502484 GGCCCGTCTGCTTCATCTTC 57 277 4121 4140 502485 TGGCCCGTCTGCTTCATCTT 64 278 4122 4141 502486 CTGGCCCGTCTGCTTCATCT 64 279 4123 4142 502487 CCTGGCCCGTCTGCTTCATC 73 280 4124 4143 502488 ACCTGGCCCGTCTGCTTCAT 64 281 4125 4144 502489 CACCTGGCCCGTCTGCTTCA 80 282 4126 4145 502490 ACACCTGGCCCGTCTGCTTC 71 283 4127 4146 502491 TACACCTGGCCCGTCTGCTT 74 284 4148 4167 502492 TTGTTCATGATCTTCATGGC 56 285 4150 4169 502493 ACTTGTTCATGATCTTCATG 23 286 4151 4170 502494 CACTTGTTCATGATCTTCAT 43 287 4152 4171 502495 CCACTTGTTCATGATCTTCA 43 288 4153 4172 502496 CCCACTTGTTCATGATCTTC 47 289 4154 4173 502497 TCCCACTTGTTCATGATCTT 34 290 4155 4174 502498 GTCCCACTTGTTCATGATCT 34 291 4156 4175 502499 TGTCCCACTTGTTCATGATC 27 292 4157 4176 502500 ATGTCCCACTTGTTCATGAT 23 293 4158 4177 502501 CATGTCCCACTTGTTCATGA 51 294 4159 4178 502502 GCATGTCCCACTTGTTCATG 20 295 4160 4179 502503 AGCATGTCCCACTTGTTCAT 52 296 4161 4180 502504 CAGCATGTCCCACTTGTTCA 72 297 4162 4181 502505 TCAGCATGTCCCACTTGTTC 70 298 4163 4182 502506 TTCAGCATGTCCCACTTGTT 53 299 4164 4183 502507 CTTCAGCATGTCCCACTTGT 52 300 4165 4184 502508 TCTTCAGCATGTCCCACTTG 45 301 4167 4186 502509 CCTCTTCAGCATGTCCCACT 68 302 4168 4187 502510 CCCTCTTCAGCATGTCCCAC 68 303 4169 4188 502511 CCCCTCTTCAGCATGTCCCA 79 304 4170 4189 502512 GCCCCTCTTCAGCATGTCCC 85 305 4171 4190 502513 CGCCCCTCTTCAGCATGTCC 84 306 4172 4191 502514 TCGCCCCTCTTCAGCATGTC 80 307 4173 4192 502515 CTCGCCCCTCTTCAGCATGT 82 308 4174 4193 502516 CCTCGCCCCTCTTCAGCATG 78 309 4175 4194 502517 ACCTCGCCCCTCTTCAGCAT 73 310 4176 4195 502518 CACCTCGCCCCTCTTCAGCA 76 311 4239 4258 503012 GGAGGAGCTGCAGCCGGAGA 7 650 4245 4264 503013 GCACCCGGAGGAGCTGCAGC 0 651 4261 4280 503014 GCACGACACCTGCAGGGCAC 23 652 4355 4374 503015 AGCTCACCAGGTAGTTCTCA 49 653 4427 4446 503016 GCTTCCTCTCCCCACCTCCT 65 654 4447 4466 503017 GCAGCACCCCCAATCCTAGA 67 655 4508 4527 503018 GCCCCTCATCCACCTGACAC 62 656 4613 4632 503019 TTCCAGGTAAGAGACCCCCC 87 657 4679 4698 503020 AGAATAGGTCCCAGACACTC 81 658 4731 4750 503021 CTCCCCCTGAGATGTTCTGG 53 659 4858 4877 503022 CCCCAGCCCAGAGATAACCA 74 660 4927 4946 503023 CCTGATCCATCACGGATGGC 69 661 4987 5006 503024 TACTCCATGACCAGGTACTG 81 662 5185 5204 503025 GCTCTGACCTTCCAAGAACC 56 663 5354 5373 503026 CTCCCTTCTGTGGTCCCACC 0 664 5407 5426 503027 GTCGGGTTTGATGTCCCTGC 75 665 5445 5464 502521 GCCAGGCGGATGTGGCCACA 57 314 5500 5519 503028 AGGGCACTGGCTCACCGTTC 45 666 5681 5700 503029 GGGCCCTCCTTCCAACCACT 28 667 5708 5727 503030 GCCCACCCCTCTGGGCCCAC 45 668 5728 5747 503031 AGGAGCAGAGCGAGGCTTGG 38 669 5800 5819 502524 ACAGCCTGCAGGATCTCGGG 86 317 5801 5820 502525 CACAGCCTGCAGGATCTCGG 81 318 5802 5821 502526 CCACAGCCTGCAGGATCTCG 83 319 5803 5822 502527 CCCACAGCCTGCAGGATCTC 84 320 5804 5823 502528 GCCCACAGCCTGCAGGATCT 91 321 5805 5824 502529 CGCCCACAGCCTGCAGGATC 90 322 5806 5825 502530 CCGCCCACAGCCTGCAGGAT 82 323 5807 5826 502531 ACCGCCCACAGCCTGCAGGA 83 324 5808 5827 502532 CACCGCCCACAGCCTGCAGG 85 325 5809 5828 502533 CCACCGCCCACAGCCTGCAG 84 326 5810 5829 502534 CCCACCGCCCACAGCCTGCA 80 327 5811 5830 502535 GCCCACCGCCCACAGCCTGC 90 328 5812 5831 502536 GGCCCACCGCCCACAGCCTG 94 329 5813 5832 502537 AGGCCCACCGCCCACAGCCT 88 330 5814 5833 502538 CAGGCCCACCGCCCACAGCC 91 331 5815 5834 502539 CCAGGCCCACCGCCCACAGC 73 332 5816 5835 502540 CCCAGGCCCACCGCCCACAG 86 333 5817 5836 502541 TCCCAGGCCCACCGCCCACA 88 334 5818 5837 502542 GTCCCAGGCCCACCGCCCAC 84 335 5819 5838 502543 TGTCCCAGGCCCACCGCCCA 85 336 5820 5839 502544 CTGTCCCAGGCCCACCGCCC 65 337 5821 5840 502545 CCTGTCCCAGGCCCACCGCC 81 338 5822 5841 502546 GCCTGTCCCAGGCCCACCGC 90 339 5823 5842 502547 TGCCTGTCCCAGGCCCACCG 85 340 5824 5843 502548 CTGCCTGTCCCAGGCCCACC 89 341 5825 5844 502549 GCTGCCTGTCCCAGGCCCAC 91 342 5826 5845 502550 AGCTGCCTGTCCCAGGCCCA 94 343 5827 5846 502551 TAGCTGCCTGTCCCAGGCCC 92 344 5828 5847 502552 GTAGCTGCCTGTCCCAGGCC 88 345 5829 5848 502553 CGTAGCTGCCTGTCCCAGGC 85 346 5830 5849 502554 CCGTAGCTGCCTGTCCCAGG 83 347 5831 5850 502555 CCCGTAGCTGCCTGTCCCAG 64 348 5832 5851 502556 GCCCGTAGCTGCCTGTCCCA 83 349 5833 5852 502557 GGCCCGTAGCTGCCTGTCCC 89 350 5881 5900 502558 TAGAACATTTCATAGGCGAA 68 351 5919 5938 502559 TCTCCGCCGTGGAATCCGCG 75 352 5920 5939 502560 GTCTCCGCCGTGGAATCCGC 79 353 5921 5940 502561 GGTCTCCGCCGTGGAATCCG 66 354 5922 5941 502562 AGGTCTCCGCCGTGGAATCC 50 355 5923 5942 502563 TAGGTCTCCGCCGTGGAATC 71 356 5944 5963 502564 TTGTAGTGGACGATCTTGCC 68 357 5945 5964 502565 CTTGTAGTGGACGATCTTGC 70 358 5946 5965 502566 CCTTGTAGTGGACGATCTTG 61 359 5948 5967 503032 CACCTTGTAGTGGACGATCT 62 670 6039 6058 502582 CGGCAGAGAGAGGTGCTCCT 80 375 6040 6059 502583 GCGGCAGAGAGAGGTGCTCC 62 376 6041 6060 502584 AGCGGCAGAGAGAGGTGCTC 44 377 6042 6061 502585 CAGCGGCAGAGAGAGGTGCT 78 378 6043 6062 502586 CCAGCGGCAGAGAGAGGTGC 71 379 6118 6137 502587 GGCCCAGCCGTGTCTCCGGG 77 380 6119 6138 502588 CGGCCCAGCCGTGTCTCCGG 69 381 6120 6139 502589 CCGGCCCAGCCGTGTCTCCG 70 382 6121 6140 502590 CCCGGCCCAGCCGTGTCTCC 75 383 6122 6141 502591 CCCCGGCCCAGCCGTGTCTC 77 384 6123 6142 502592 ACCCCGGCCCAGCCGTGTCT 73 385 6124 6143 502593 CACCCCGGCCCAGCCGTGTC 84 386 6125 6144 502594 CCACCCCGGCCCAGCCGTGT 78 387 6126 6145 502595 TCCACCCCGGCCCAGCCGTG 71 388 6127 6146 502596 CTCCACCCCGGCCCAGCCGT 81 389 6128 6147 502597 GCTCCACCCCGGCCCAGCCG 86 390 6129 6148 502598 TGCTCCACCCCGGCCCAGCC 83 391 6130 6149 502599 CTGCTCCACCCCGGCCCAGC 88 392 6152 6171 502600 AAGGGATGTGTCCGGAAGTC 60 393 6153 6172 502601 GAAGGGATGTGTCCGGAAGT 58 394 6154 6173 502602 AGAAGGGATGTGTCCGGAAG 63 395 6155 6174 502603 AAGAAGGGATGTGTCCGGAA 62 396 6156 6175 502604 GAAGAAGGGATGTGTCCGGA 61 397 6157 6176 502605 AGAAGAAGGGATGTGTCCGG 62 398 6158 6177 502606 AAGAAGAAGGGATGTGTCCG 56 399 6159 6178 502607 AAAGAAGAAGGGATGTGTCC 58 400 6160 6179 502608 CAAAGAAGAAGGGATGTGTC 50 401 6161 6180 502609 CCAAAGAAGAAGGGATGTGT 61 402 6163 6182 502610 GGCCAAAGAAGAAGGGATGT 73 403 6164 6183 502611 AGGCCAAAGAAGAAGGGATG 56 404 6165 6184 502612 GAGGCCAAAGAAGAAGGGAT 73 405 6166 6185 502613 CGAGGCCAAAGAAGAAGGGA 75 406 6167 6186 502614 TCGAGGCCAAAGAAGAAGGG 75 407 6168 6187 502615 GTCGAGGCCAAAGAAGAAGG 83 408 6169 6188 502616 AGTCGAGGCCAAAGAAGAAG 58 409 6170 6189 502617 CAGTCGAGGCCAAAGAAGAA 52 410 6171 6190 502618 CCAGTCGAGGCCAAAGAAGA 68 411 6172 6191 502619 CCCAGTCGAGGCCAAAGAAG 78 412 6173 6192 502620 TCCCAGTCGAGGCCAAAGAA 66 413 6174 6193 502621 ATCCCAGTCGAGGCCAAAGA 75 414 6175 6194 502622 CATCCCAGTCGAGGCCAAAG 70 415 6176 6195 502623 CCATCCCAGTCGAGGCCAAA 81 416 6177 6196 502624 ACCATCCCAGTCGAGGCCAA 82 417 6178 6197 502625 GACCATCCCAGTCGAGGCCA 88 418 6179 6198 502626 AGACCATCCCAGTCGAGGCC 79 419 6180 6199 502627 GAGACCATCCCAGTCGAGGC 82 420 6181 6200 502628 GGAGACCATCCCAGTCGAGG 60 421 6216 6235 502629 TTCGAAATCCGGTGTAAAGG 84 422 6217 6236 502630 CTTCGAAATCCGGTGTAAAG 57 423 6218 6237 502631 CCTTCGAAATCCGGTGTAAA 64 424 6219 6238 502632 ACCTTCGAAATCCGGTGTAA 73 425 6220 6239 502633 CACCTTCGAAATCCGGTGTA 77 426 6221 6240 502634 GCACCTTCGAAATCCGGTGT 59 427 6222 6241 502635 GGCACCTTCGAAATCCGGTG 85 428 6223 6242 502636 TGGCACCTTCGAAATCCGGT 86 429 6224 6243 502637 GTGGCACCTTCGAAATCCGG 74 430 6225 6244 502638 GGTGGCACCTTCGAAATCCG 79 431 6226 6245 502639 CGGTGGCACCTTCGAAATCC 85 432 6227 6246 502640 TCGGTGGCACCTTCGAAATC 71 433 6228 6247 502641 GTCGGTGGCACCTTCGAAAT 88 434 6229 6248 502642 TGTCGGTGGCACCTTCGAAA 89 435 6230 6249 502643 GTGTCGGTGGCACCTTCGAA 88 436 6231 6250 502644 TGTGTCGGTGGCACCTTCGA 87 437 6232 6251 502645 ATGTGTCGGTGGCACCTTCG 88 438 6233 6252 502646 CATGTGTCGGTGGCACCTTC 88 439 6234 6253 502647 GCATGTGTCGGTGGCACCTT 91 440 6235 6254 502648 TGCATGTGTCGGTGGCACCT 87 441 6236 6255 502649 TTGCATGTGTCGGTGGCACC 86 442 6237 6256 502650 GTTGCATGTGTCGGTGGCAC 83 443 6238 6257 502651 AGTTGCATGTGTCGGTGGCA 81 444 6239 6258 502652 AAGTTGCATGTGTCGGTGGC 79 445 6240 6259 502653 GAAGTTGCATGTGTCGGTGG 58 446 6241 6260 502654 CGAAGTTGCATGTGTCGGTG 85 447 6243 6262 502655 GTCGAAGTTGCATGTGTCGG 77 448 6244 6263 502656 AGTCGAAGTTGCATGTGTCG 79 449 6245 6264 502657 AAGTCGAAGTTGCATGTGTC 74 450 6246 6265 502658 CAAGTCGAAGTTGCATGTGT 82 451 6247 6266 502659 CCAAGTCGAAGTTGCATGTG 82 452 6248 6267 502660 ACCAAGTCGAAGTTGCATGT 70 453 6249 6268 502661 CACCAAGTCGAAGTTGCATG 76 454 6250 6269 502662 CCACCAAGTCGAAGTTGCAT 79 455 6251 6270 502663 TCCACCAAGTCGAAGTTGCA 68 456 6252 6271 502664 CTCCACCAAGTCGAAGTTGC 71 457 6253 6272 502665 CCTCCACCAAGTCGAAGTTG 67 458 6254 6273 502666 TCCTCCACCAAGTCGAAGTT 70 459 6255 6274 502667 GTCCTCCACCAAGTCGAAGT 80 460 6256 6275 502668 CGTCCTCCACCAAGTCGAAG 76 461 6257 6276 502669 CCGTCCTCCACCAAGTCGAA 78 462 6258 6277 502670 CCCGTCCTCCACCAAGTCGA 83 463 6259 6278 502671 GCCCGTCCTCCACCAAGTCG 76 464 6260 6279 502672 AGCCCGTCCTCCACCAAGTC 72 465 6261 6280 502673 GAGCCCGTCCTCCACCAAGT 71 466 6262 6281 502674 TGAGCCCGTCCTCCACCAAG 60 467 6289 6308 503033 CTACCCCGCCCCCGCTCACC 60 671 6445 6464 503034 CTAGGTCACTGCTGGGTCCT 86 672 6596 6615 503035 CTCAGATAGCTCCCCACTCC 55 673 6794 6813 503036 AATTCTCTAATTCTCTAGAC 19 674 8666 8685 503037 TACCTGAGGGCCATGCAGGA 51 675 8765 8784 503038 GTTCCAAGACTGATCCTGCA 69 676 11975 11994 502675 GGTTCCGAGCCTCTGCCTCG 44 468 11976 11995 502676 CGGTTCCGAGCCTCTGCCTC 74 469 11977 11996 502677 CCGGTTCCGAGCCTCTGCCT 72 470 11978 11997 502678 CCCGGTTCCGAGCCTCTGCC 73 471 11979 11998 502679 TCCCGGTTCCGAGCCTCTGC 84 472 11980 11999 502680 GTCCCGGTTCCGAGCCTCTG 66 473 11982 12001 502681 AGGTCCCGGTTCCGAGCCTC 82 474 11983 12002 502682 TAGGTCCCGGTTCCGAGCCT 83 475 11984 12003 502683 CTAGGTCCCGGTTCCGAGCC 81 476 11985 12004 502684 TCTAGGTCCCGGTTCCGAGC 74 477 11986 12005 502685 CTCTAGGTCCCGGTTCCGAG 78 478 11987 12006 502686 CCTCTAGGTCCCGGTTCCGA 75 479 11988 12007 502687 GCCTCTAGGTCCCGGTTCCG 80 480 12016 12035 502688 CATCCGCTCCTGCAACTGCC 89 481 12017 12036 502689 CCATCCGCTCCTGCAACTGC 81 482 12018 12037 502690 TCCATCCGCTCCTGCAACTG 71 483 12019 12038 502691 CTCCATCCGCTCCTGCAACT 75 484 12020 12039 502692 ACTCCATCCGCTCCTGCAAC 64 485 12021 12040 502693 AACTCCATCCGCTCCTGCAA 52 486 12022 12041 502694 CAACTCCATCCGCTCCTGCA 45 487 12024 12043 502695 AGCAACTCCATCCGCTCCTG 78 488 12025 12044 502696 CAGCAACTCCATCCGCTCCT 64 489 12026 12045 502697 GCAGCAACTCCATCCGCTCC 56 490 12173 12192 503039 AGGAGGGCGGTGGCGCGGCG 0 677 12221 12240 503040 TGACAGCTGGAAGGAGAAGA 41 678 12258 12277 502712 GAAGGTGGATCCGTGGCCCG 73 505 12259 12278 502713 GGAAGGTGGATCCGTGGCCC 70 506 12260 12279 502714 GGGAAGGTGGATCCGTGGCC 72 507 12261 12280 502715 TGGGAAGGTGGATCCGTGGC 50 508 12262 12281 502716 ATGGGAAGGTGGATCCGTGG 62 509 12263 12282 451417 CATGGGAAGGTGGATCCGTG 77 679 12463 12482 503041 GGAGGTTATCTAGGGAGATC 42 680 12542 12561 503042 GAAGGGACAGGTGACCCGAT 69 681 12596 12615 502724 CACCAGCGGGCACTGGCCCA 51 518 12597 12616 502725 CCACCAGCGGGCACTGGCCC 55 519 12598 12617 502726 CCCACCAGCGGGCACTGGCC 61 520 12599 12618 502727 CCCCACCAGCGGGCACTGGC 43 521 12601 12620 502728 GGCCCCACCAGCGGGCACTG 16 522 12602 12621 502729 TGGCCCCACCAGCGGGCACT 43 523 12603 12622 502730 CTGGCCCCACCAGCGGGCAC 43 524 12604 12623 502731 CCTGGCCCCACCAGCGGGCA 41 525 12605 12624 502732 GCCTGGCCCCACCAGCGGGC 30 526 12607 12626 502733 GGGCCTGGCCCCACCAGCGG 66 527 12625 12644 502734 AGGTGGCGGCGGTGCATGGG 31 528 12626 12645 502735 CAGGTGGCGGCGGTGCATGG 23 529 12627 12646 502736 GCAGGTGGCGGCGGTGCATG 57 530 12628 12647 502737 AGCAGGTGGCGGCGGTGCAT 54 531 12629 12648 502738 CAGCAGGTGGCGGCGGTGCA 61 532 12630 12649 502739 GCAGCAGGTGGCGGCGGTGC 57 533 12631 12650 502740 AGCAGCAGGTGGCGGCGGTG 36 534 12632 12651 502741 GAGCAGCAGGTGGCGGCGGT 53 535 12633 12652 502742 GGAGCAGCAGGTGGCGGCGG 39 536 12634 12653 502743 GGGAGCAGCAGGTGGCGGCG 36 537 12635 12654 502744 AGGGAGCAGCAGGTGGCGGC 62 538 12636 12655 502745 CAGGGAGCAGCAGGTGGCGG 56 539 12637 12656 502746 GCAGGGAGCAGCAGGTGGCG 58 540 12638 12657 502747 GGCAGGGAGCAGCAGGTGGC 65 541 12639 12658 502748 TGGCAGGGAGCAGCAGGTGG 47 542 12640 12659 502749 CTGGCAGGGAGCAGCAGGTG 41 543 12642 12661 451432 CCCTGGCAGGGAGCAGCAGG 53 544 12643 12662 502750 ACCCTGGCAGGGAGCAGCAG 52 545 12646 12665 503043 CGTACCCTGGCAGGGAGCAG 59 682 12918 12937 502977 GGACTCGCCCCGCCTACGCC 71 683 12924 12943 502978 CTCCTGGGACTCGCCCCGCC 67 684 12925 12944 503044 GCTCCTGGGACTCGCCCCGC 66 685 12929 12948 503045 ATTGGCTCCTGGGACTCGCC 77 686 12930 12949 502979 GATTGGCTCCTGGGACTCGC 70 687 12936 12955 502980 GCCTCTGATTGGCTCCTGGG 56 688 12942 12961 502981 GCATGGGCCTCTGATTGGCT 20 689 12948 12967 502982 CACCCGGCATGGGCCTCTGA 20 690 12986 13005 503046 GCCAGGCCTAGGGACCTGCG 58 691 12990 13009 502760 ATAGGCCAGGCCTAGGGACC 51 555 12991 13010 502761 GATAGGCCAGGCCTAGGGAC 41 556 12992 13011 502762 CGATAGGCCAGGCCTAGGGA 69 557 12993 13012 502763 CCGATAGGCCAGGCCTAGGG 80 558 12994 13013 502764 TCCGATAGGCCAGGCCTAGG 78 559 12995 13014 502765 CTCCGATAGGCCAGGCCTAG 89 560 12996 13015 502766 CCTCCGATAGGCCAGGCCTA 79 561 12997 13016 502767 GCCTCCGATAGGCCAGGCCT 73 562 12999 13018 502768 GCGCCTCCGATAGGCCAGGC 83 563 13015 13034 502769 AACAGGAGCAGGGAAAGCGC 83 564 13016 13035 502770 GAACAGGAGCAGGGAAAGCG 70 565 13017 13036 502771 CGAACAGGAGCAGGGAAAGC 43 566 13018 13037 502772 GCGAACAGGAGCAGGGAAAG 47 567 13019 13038 502773 GGCGAACAGGAGCAGGGAAA 61 568 13020 13039 502774 CGGCGAACAGGAGCAGGGAA 74 569 13021 13040 502775 ACGGCGAACAGGAGCAGGGA 60 570 13022 13041 502776 AACGGCGAACAGGAGCAGGG 86 571 13023 13042 502777 CAACGGCGAACAGGAGCAGG 84 572 13044 13063 502778 GGGCGGCGGCACGAGACAGA 80 573 13045 13064 502779 AGGGCGGCGGCACGAGACAG 76 574 13046 13065 502780 CAGGGCGGCGGCACGAGACA 58 575 13047 13066 502781 CCAGGGCGGCGGCACGAGAC 80 576 13048 13067 502782 CCCAGGGCGGCGGCACGAGA 59 577 13049 13068 502783 GCCCAGGGCGGCGGCACGAG 68 578 13050 13069 502784 AGCCCAGGGCGGCGGCACGA 75 579 13051 13070 502785 CAGCCCAGGGCGGCGGCACG 76 580 13052 13071 502786 GCAGCCCAGGGCGGCGGCAC 70 581 13089 13108 502787 CTGCGGTGAGTTGGCCGGCG 68 582 13090 13109 502788 ACTGCGGTGAGTTGGCCGGC 67 583 13091 13110 502789 GACTGCGGTGAGTTGGCCGG 58 584 13092 13111 502790 AGACTGCGGTGAGTTGGCCG 71 585 13093 13112 502791 CAGACTGCGGTGAGTTGGCC 70 586 13094 13113 502792 CCAGACTGCGGTGAGTTGGC 79 587 13095 13114 502793 GCCAGACTGCGGTGAGTTGG 76 588 13096 13115 502794 CGCCAGACTGCGGTGAGTTG 66 589 13140 13159 502795 AAGACAGTTCTAGGGTTCAG 87 590 13141 13160 502796 GAAGACAGTTCTAGGGTTCA 78 591 13142 13161 502797 CGAAGACAGTTCTAGGGTTC 85 592 13143 13162 502798 TCGAAGACAGTTCTAGGGTT 78 593 13144 13163 502799 GTCGAAGACAGTTCTAGGGT 92 594 13145 13164 502800 AGTCGAAGACAGTTCTAGGG 85 595 13146 13165 502801 GAGTCGAAGACAGTTCTAGG 83 596 13147 13166 502802 GGAGTCGAAGACAGTTCTAG 86 597 13148 13167 502803 CGGAGTCGAAGACAGTTCTA 91 598 13149 13168 502804 CCGGAGTCGAAGACAGTTCT 76 599 13150 13169 502805 CCCGGAGTCGAAGACAGTTC 90 600 13151 13170 502806 CCCCGGAGTCGAAGACAGTT 83 601 13152 13171 502807 GCCCCGGAGTCGAAGACAGT 82 602 13153 13172 502808 GGCCCCGGAGTCGAAGACAG 73 603 13154 13173 502809 GGGCCCCGGAGTCGAAGACA 67 604 13206 13225 502810 AGGCGGTGGGCGCGGCTTCT 73 605 13207 13226 502811 CAGGCGGTGGGCGCGGCTTC 57 606 13208 13227 502812 GCAGGCGGTGGGCGCGGCTT 69 607 13210 13229 502813 TGGCAGGCGGTGGGCGCGGC 73 608 13212 13231 502814 ACTGGCAGGCGGTGGGCGCG 56 609 13214 13233 502815 GAACTGGCAGGCGGTGGGCG 71 610 13215 13234 502816 TGAACTGGCAGGCGGTGGGC 80 611 13217 13236 502817 TGTGAACTGGCAGGCGGTGG 85 612 13250 13269 502818 TGGAGCTGGGCGGAGACCCA 55 613 13252 13271 502819 ACTGGAGCTGGGCGGAGACC 53 614 13253 13272 502820 GACTGGAGCTGGGCGGAGAC 55 615 13255 13274 502821 AGGACTGGAGCTGGGCGGAG 76 616 13257 13276 502822 ACAGGACTGGAGCTGGGCGG 77 617 13258 13277 502823 CACAGGACTGGAGCTGGGCG 74 618 13259 13278 502824 TCACAGGACTGGAGCTGGGC 90 619 13449 13468 502825 GCCTCAGCCTGGCCGAAAGA 80 620 13450 13469 502826 GGCCTCAGCCTGGCCGAAAG 72 621 13553 13572 444401 TTGCACTTTGCGAACCAACG 97 41 14037 14056 503047 TTCCTCCCCCAACCCTGATT 34 692 14255 14274 503048 AAGTTTGCAGCAACTTTTCT 0 693 14325 14344 503049 GCCCCTCGGAATTCCCGGCT 0 694 14343 14362 503050 CATCTCGGCCTGCGCTCCGC 39 695 14361 14380 503051 GCAGGCCCCCACATTCCCCA 0 696 14392 14411 503052 CTTCTGCACGCCTCCGTCTC 30 697

Example 8: Antisense Inhibition of Murine DMPK in Mouse Primary Hepatocytes

[0338] Antisense oligonucleotides targeted to a murine DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured mouse primary hepatocytes at a density of 35,000 cells per well were transfected using electroporation with 8,000 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of DMPK, relative to untreated control cells.

[0339] The antisense oligonucleotides in Tables 14, 15, and 16 are 5-10-5 gapmers, where the gap segment comprises ten 2-deoxynucleosides and each wing segment comprises five 2-MOE nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. Murine Target start site indicates the 5-most nucleoside to which the antisense oligonucleotide is targeted in the murine gene sequence. Murine Target stop site indicates the 3-most nucleoside to which the antisense oligonucleotide is targeted in the murine gene sequence. All the antisense oligonucleotides listed in Table 12 target SEQ ID NO: 3 (GENBANK Accession No. NT_039413.7 truncated from nucleotides 16666001 to Ser. No. 16/681,000). All the antisense oligonucleotides listed in Table 13 target SEQ ID NO: 4 (GENBANK Accession No. NM_032418.1). The antisense oligonucleotides of Table 14 target SEQ ID NO: 5 (GENBANK Accession No. A007148.1), SEQ ID NO: 6 (GENBANK Accession No. A304033.1), SEQ ID NO: 7 (GENBANK Accession No. BC024150.1), SEQ ID NO: 8 (GENBANK Accession No. BC056615.1), SEQ ID NO: 793 (GENBANK Accession No. BC075715.1), SEQ ID NO: 794 (GENBANK Accession No. BU519245.1), SEQ ID NO: 795 (GENBANK Accession No. CB247909.1), SEQ ID NO: 796 (GENBANK Accession No. CX208906.1), SEQ ID NO: 797 (GENBANK Accession No. CX732022.1), SEQ ID NO: 798 (GENBANK Accession No. S60315.1), or SEQ ID NO: 799 (GENBANK Accession No. S60316.1). In addition, the human antisense oligonucleotide ISIS 451421 targeting SEQ ID NO: 800(GENBANK Accession No. NM_001081562.1) was also included in this assay and is listed in Table 14.

[0340] The murine oligonucleotides of Tables 14, 15, and 16 may also be cross-reactive with human gene sequences. Mismatches indicate the number of nucleobases by which the murine oligonucleotide is mismatched with a human gene sequence. The greater the complementarity between the murine oligonucleotide and the human sequence, the more likely the murine oligonucleotide can cross-react with the human sequence. The murine oligonucleotides in Tables 14, 15, and 16 were compared to SEQ ID NO: 800 (GENBANK Accession No. NM_001081562.1). Human Target start site indicates the 5-most nucleoside to which the gapmer is targeted in the human gene sequence. Human Target stop site indicates the 3-most nucleoside to which the gapmer is targeted human gene sequence.

[0341] Several of the tested antisense oligonucleotides demonstrated significant inhibition of DMPK mRNA levels under the conditions specified above. Certain of the tested antisense oligonucleotides are cross-reactive with human gene sequences.

TABLE-US-00014 TABLE14 InhibitionofmurineDMPKRNAtranscriptinmouseprimary hepatocytesby5-10-5gapmerstargetingSEQIDNO:800 Murine Murine Human Human Target Target SEQ Target Target Start Stop ISIS % ID Start Stop Mis- Site Site No Sequence inhibition NO. Site Site matches 11904 11923 299516 TGGCCCACAGCCACGGCCGG 47 698 1850 1869 0 11927 11946 299520 GGCCTGGCCCCACCAGCGGG 58 699 1873 1892 0 11962 11981 299521 CCTGGCAGGGAGCAGCAGGT 44 700 1908 1927 0 3345 3364 451360 CAGCCGCACTTCGGCTGACA 29 701 207 226 1 3378 3397 451361 GCCTGGGTCCAGCACCAGCT 67 702 240 259 2 3388 3407 451362 GTCCCAGGAAGCCTGGGTCC 62 703 250 269 2 3418 3437 451363 CGCCCAGGAGAAGGTCGAGC 69 213 280 299 0 3484 3503 451364 CCCACTGCAAGAAGTCGGCC 69 226 346 365 0 6264 6283 451366 CGTTAGCAGGTCCCCGCCCA 73 704 660 679 2 6342 6361 451367 GTCTATGGCCATGACAATCT 61 705 738 757 0 6363 6382 451368 GTAGCCCAGCCGGTGCACGG 54 706 759 778 2 6851 6870 451370 GGGTGCCCACAGCCACCAGC 72 707 889 908 0 6919 6938 451371 TGGCCCGTAGCTGCCTGCCC 80 708 957 976 2 7448 7467 451373 GGAAATCACCTGCCCCACCT 80 709 n/a n/a n/a 7458 7477 451374 GGATGTTTCTGGAAATCACC 84 710 n/a n/a n/a 7533 7552 451375 GTGGCACCCTCGAAGTCTGG 77 711 1271 1290 3 7589 7608 451376 CCCCGCTCACCATGGCAGTG 31 712 n/a n/a n/a 10278 10297 451378 GGTCCGGGACCTGATTGTCT 85 713 n/a n/a n/a 3229 3248 451385 GCTGCATGTCTGCCCGTCCC 74 714 90 109 1 3244 3263 451386 GGCCCCAGAACCCTAGCTGC 73 715 n/a n/a n/a 3270 3289 451387 TCACAGGGCCTGGCTGCCCC 62 716 131 150 1 3333 3352 451388 GGCTGACATGTTGGGCAGGC 60 717 195 214 1 3250 3269 451389 TGTCCAGGCCCCAGAACCCT 68 718 111 130 3 12295 12314 451391 GGCCAGGCCTAGGGATCTGC 51 719 n/a n/a n/a 12306 12325 451392 CGCCTCGGATAGGCCAGGCC 52 720 1935 1954 1 12450 12469 451393 GGCTTGGAGTCTTAGGGTTC 85 721 n/a n/a n/a 12623 12642 451394 TCCCCGGCCGCCAGGTGGCA 43 722 2224 2243 3 12651 12670 451395 GGTGCTGGGCACGAGCCCTG 62 723 n/a n/a n/a 12698 12717 451396 GCCCAGCTGCTGCAGCAGCG 66 724 n/a n/a n/a 12876 12895 451397 CCGTGTGTGCTGGCAGAGGT 76 725 n/a n/a n/a 13084 13103 451398 ATAAATACCGAGGAATGTCG 77 726 2766 2785 0 13094 13113 451399 GGGACAGACAATAAATACCG 80 727 2776 2795 0 12362 12381 451405 GTGCAGCCCAGTGTGGCGGC 69 728 1991 2010 3 11175 11194 451415 CCTGGAGAAGTTCTGGTTGG 48 729 1674 1693 3 11585 11604 451417 CATGGGAAGGTGGATCCGTG 65 679 1819 1838 1 11854 11873 451419 GGTGACCCGATCGGAGCCCA 11 730 n/a n/a n/a 11874 11893 451420 AGCTGGAGAGAGAAGGGACA 37 731 n/a n/a n/a 11379 11398 451422 GTGAGGGACTCGCCTGCGGC 36 732 n/a n/a n/a 11479 11498 451423 GCGGCTGCGGTGCCCCAGCC 50 733 n/a n/a n/a 11883 11902 451424 GGGCCATCTAGCTGGAGAGA 45 734 n/a n/a n/a 3485 3504 451427 CCCCACTGCAAGAAGTCGGC 57 735 347 366 1 4621 4640 451428 TTGAGCCCTTTTAAGGCAGC 43 736 n/a n/a n/a 6232 6251 451429 TGACCAGGTACTGGGAGCGG 47 737 n/a n/a n/a 10985 11004 451430 CCTGGAGCTGGATCAGTCCC 6 738 n/a n/a n/a 11586 11605 451431 ACATGGGAAGGTGGATCCGT 70 739 1820 1839 1 11963 11982 451432 CCCTGGCAGGGAGCAGCAGG 42 544 1909 1928 0 11973 11992 451433 GTGGGACATACCCTGGCAGG 34 740 n/a n/a n/a 12294 12313 451434 GCCAGGCCTAGGGATCTGCA 35 741 n/a n/a n/a

TABLE-US-00015 TABLE15 InhibitionofmurineDMPKRNAtranscriptinmouseprimary hepatocytesby5-10-5gapmerstargetingSEQIDNO:800 Murine Murine Human Human Target Target SEQ Target Target Start Stop ISIS % ID Start Stop Mis- Site Site No Sequence inhibition NO. Site Site matches 330 349 451365 GGAAGCACGACACCTCGCCT 67 742 535 554 1 662 681 451369 CCTCACCATTCCATCAGGCT 81 743 n/a n/a n/a 881 900 451372 CGGCAGCGACAAGTGTTCCC 90 744 n/a n/a n/a 1217 1236 451377 GTCTCTGAAGGCCATGCAGC 69 745 1407 1426 3 1329 1348 451379 CAGCCACTTGATCCGGTGGG 62 746 n/a n/a n/a 1342 1361 451380 AGGTCGGCCTCTTCAGCCAC 74 747 n/a n/a n/a 1494 1513 451381 GTTGGCTGGAGAAGTTCTGG 39 748 1678 1697 2 1598 1617 451382 CCCCGTGATGGCTGCGGCTC 54 749 1782 1801 3 1644 1663 451383 GGCCATCTAGATGGGAAGGT 21 517 1828 1847 0 1741 1760 451384 AGGCCAGGCCTAGGGATCCT 39 750 1925 1944 1

TABLE-US-00016 TABLE16 InhibitionofmurineDMPKRNAtranscriptinmouse primaryhepatocytesby5-10-5gapmerstargeting SEQIDNOs:5-8and793-799 Murine Murine Murine Human Human Target Target Target SEQ Target Target Start Stop SEQ ISIS % ID Start Stop Mis- Site Site IDNO No Sequence inhibition NO. Site Site matches 324 343 5 451410 GGCGCGGTGCCCCAGCCTGG 67 751 n/a n/a n/a 485 504 5 451411 GTCCTGGCCCCACCAGCGGG 66 752 1873 1892 1 534 553 5 451412 CCAGGCCTAGGAATCCTGGC 17 753 1922 1941 2 547 566 5 451413 GCGCCTCGGATAGCCAGGCC 51 754 n/a n/a n/a 594 613 5 451414 CCCAGTGTGGCGCAGCAGCC 65 755 n/a n/a n/a 393 412 6 451402 GTGTTTCATCTTCACCACCG 80 756 462 481 3 1475 1494 7 451390 AGGTCAGCCTCTTCAGCCAC 60 757 n/a n/a n/a n/a n/a n/a 451425 GGCCATATGGGAAGGTGGAT 48 758 1824 1843 0 1763 1782 8 451418 GGAGGATTTGGCGAGAAGCA 48 759 n/a n/a n/a 1032 1051 793 451403 CGAAGTCTGCCCCACCTCGA 58 760 n/a n/a n/a 1042 1061 793 451404 GTGGCACCCTCGAAGTCTGC 72 761 n/a n/a n/a 217 236 794 451400 GGGTCCATTGTAAGGAAGCT 4 762 n/a n/a n/a 754 773 794 451401 GGTGCCCACAGCCACCAGGG 82 763 888 907 1 322 341 795 451406 TCCATGGCAGTGAGCCGGTC 55 764 1319 1338 1 523 542 795 451407 GGGACCACTTGATCCGGTGG 63 765 n/a n/a n/a 534 553 795 451408 GGATCAGAGTTGGGACCACT 0 766 n/a n/a n/a 492 511 796 451416 CCCCGTGATGGCTGCGGTTC 49 767 n/a n/a n/a 469 488 797 451409 GTGTGTCCTCATACCCCGCC 60 768 n/a n/a n/a 629 648 798 451421 GCACCCTCGAAGTCTCGACC 72 769 n/a n/a n/a 854 873 799 451426 GCTCTGAAGGCCATGCAGCA 52 770 n/a n/a n/a

Example 9: Dose-Dependent Antisense Inhibition of Murine DMPK in Mouse Primary Hepatocytes

[0342] Several of the antisense oligonucleotides exhibiting in vitro inhibition of DMPK in mouse primary hepatocytes (see Example 8) were tested at various doses. Cells were plated at a density of 35,000 cells per well and transfected using electroporation with 1,000 nM, 2,000 nM, 4,000 nM, 8,000 nM, and 16,000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR using primer probe set RTS3181 (forward sequence GACATATGCCAAGATTGTGCACTAC, designated herein as SEQ ID NO: 771; reverse sequence CACGAATGAGGTCCTGAGCTT, designated herein as SEQ ID NO:772; probe sequence AACACTTGTCGCTGCCGCTGGCX, designated herein as SEQ ID NO: 773). DMPK transcript levels were normalized to total RNA content, as measured by RIBOGREEN. Results are presented in Table 17 as percent inhibition of DMPK, relative to untreated control cells.

[0343] The majority of the tested antisense oligonucleotides demonstrated dose-dependent inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00017 TABLE 17 Dose-dependent antisense inhibition of murine DMPK in mouse primary hepatocytes ISIS 1,000 2,000 4,000 8,000 16,000 IC.sub.50 No nM nM nM nM nM (M) 451369 33 59 78 87 94 1.57 451371 60 77 84 90 91 0.24 451373 53 62 82 89 92 0.74 451374 33 42 76 88 94 2.00 451375 43 62 81 89 88 1.05 451378 39 79 80 87 94 0.87 451385 22 57 80 78 93 2.01 451393 49 63 86 80 80 0.59 451397 63 75 74 81 92 0.22 451398 29 72 84 83 90 1.29 451399 27 53 81 68 80 2.07 451401 34 71 87 86 92 1.12 451402 34 69 75 86 74 1.14

Example 10: Antisense Inhibition of Human Alpha1 Skeletal Actin in HepG2 Cells

[0344] Antisense oligonucleotides targeted to a human alpha1 skeletal actin nucleic acid, a gene which may carry an expanded CTG repeat capable of causing symptoms of DM1 when inserted into mouse models, were tested for their effect on alpha1 actin RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and alpha1 actin RNA transcript levels were measured by quantitative real-time PCR. Alpha1 actin RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of alpha1 actin, relative to untreated control cells.

[0345] The antisense oligonucleotides in Table 18 are 5-10-5 gapmers, where the gap segment comprises ten 2-deoxynucleosides and each wing segment comprises five 2-MOE nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (PS) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. Target start site indicates the 5-most nucleoside to which the antisense oligonucleotide is targeted. Target stop site indicates the 3-most nucleoside to which the antisense oligonucleotide is targeted. All the antisense oligonucleotides listed in Table 18 target SEQ ID NO: 801 (GENBANK Accession No. NM_001100.3).

[0346] The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of alpha 1 actin mRNA levels under the conditions specified above.

TABLE-US-00018 TABLE18 Inhibitionofhumanalpha1actinRNAtranscript inHepG2cellsby5-10-5gapmerstargeting SEQIDNO:801 Target Target Start Stop % SEQID Site Site ISISNo Sequence inhibition NO. 16 35 445205 AGCGAGGCTTCACTTGGCGC 74 774 20 39 190403 GGGAAGCGAGGCTTCACTTG 75 775 1028 1047 190401 GCGGTCAGCGATCCCAGGGT 78 776 1058 1077 445225 GGGTGCCAGCGCGGTGATCT 73 777 1320 1339 445231 TGTTACAAAGAAAGTGACTG 74 778 1339 1358 445232 CGATGGCAGCAACGGAAGTT 96 779 1348 1367 445233 GTCAGTTTACGATGGCAGCA 100 780 1417 1436 445235 CAGGGCTTTGTTTCGAAAAA 91 781 1430 1449 445236 CCATTTTCTTCCACAGGGCT 99 782 1447 1466 445237 ATGCTTCTTCAAGTTTTCCA 97 783 1460 1479 445238 CAGAATGACTTTAATGCTTC 95 784

Example 11: Dose-Dependent Antisense Inhibition of Human Alpha1 Actin in HepG2 Cells

[0347] Several of the antisense oligonucleotides exhibiting in vitro inhibition of alpha1 actin in HepG2 cells (see Example 8) were tested at various doses. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 625 nM, 1,250 nM, 2,500 nM, 5,000 nM, 10,000 nM and 20,000 nM concentrations of each antisense oligonucleotide. After approximately 16 hours, RNA was isolated from the cells and alpha1 actin RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3154 (forward sequence CCACCGCAAATGCTTCTAGAC, designated herein as SEQ ID NO: 785; reverse sequence CCCCCCCATTGAGAAGATTC, designated herein as SEQ ID NO: 786; probe sequence CTCCACCTCCAGCACGCGACTTCTX, designated herein as SEQ ID NO: 787). Alpha1 actin RNA transcript levels were normalized to total RNA content, as measured by RIBOGREEN. Results are presented in Table 19 as percent inhibition of alpha1 actin, relative to untreated control cells.

[0348] Several of the antisense oligonucleotides demonstrated dose-dependent inhibition of alpha 1 actin mRNA levels under the conditions specified above.

TABLE-US-00019 TABLE 19 Dose-dependent antisense inhibition of human alpha1 actin in HepG2 cells ISIS 625 1,250 2,500 5,000 10,000 20,000 IC.sub.50 No. nM nM nM nM nM nM (M) 445233 21 72 63 82 96 83 1.1 445236 26 68 82 91 90 91 0.8 445237 36 59 76 84 83 90 0.8 445232 14 42 54 59 80 91 2.6 445238 27 43 54 73 76 90 2.0 445235 26 52 29 58 59 24 0.7 190403 25 29 36 25 61 54 11.9 190401 17 14 40 68 76 72 3.9 445225 25 23 49 28 52 50 15.8 445205 26 31 34 28 55 36 7.6 445231 30 25 39 26 42 36 >20.0

Example 12: In Vivo Antisense Inhibition of Human Alpha1 Actin by Intramuscular Administration in Transgenic Mice

[0349] To test the effect of antisense inhibition for the treatment of myotonic dystrophy, an appropriate mouse model was required. The HSA.sup.LR mouse model is an established model for DM1 (Mankodi, A. et al. Science. 289: 1769, 2000). The mice carry a human skeletal actin (hACTA1) transgene with 220 CTG repeats inserted in the 3 UTR of the gene. The hACTA1-CUGexp transcript accumulates in nuclear foci in skeletal muscles and results in myotonia similar to that in human DM1 (Mankodi, A. et al. Mol. Cell 10: 35, 2002; Lin, X. et al. Hum. Mol. Genet. 15: 2087, 2006). Hence, it was expected that amelioration of DM1 symptoms in the HSA.sup.LR mouse by antisense inhibition of the hACTA1 transgene would predict amelioration of similar symptoms in human patients by antisense inhibition of the DMPK transcript.

[0350] HSA (human skeletal actin).sup.LR (long repeat) DM1 mice were generated by insertion in FVB/N mice of a transgene with 250 CUG repeats in the 3 UTR of human skeletal actin. The transgene is expressed in the mice as a CUG repeat RNA, which is retained in the nucleus, forming nuclear inclusions or foci, similar to that seen in human tissue samples of patients with myotonic dystrophy (DM1).

[0351] ISIS 190403 and ISIS 445238, which demonstrated statistically significant dose-dependent inhibition in vitro (see Example 11), were evaluated for their ability to reduce human alpha1 actin RNA transcript in vivo.

Treatment

[0352] HSA.sup.LR mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

[0353] The mice were divided into two treatment groups. The two groups received direct intramuscular injections of ISIS 190403 or ISIS 445238 at a dose of 0.8 nM into the tibialis anterior muscle on one side. The contralateral tibialis anterior muscle in each mouse received a single dose intramuscular injection of PBS. The PBS-injected muscle acted as the control.

Inhibition of Alpha1 Actin RNA

[0354] Twenty four hours after the final dose, the animals were sacrificed and tissue from the tibialis anterior muscles of both sides was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 20, treatment with antisense oligonucleotides reduced human alpha1 actin RNA transcript expression. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the PBS control.

[0355] The results indicate that treatment with ISIS 190403 and ISIS 445238 resulted in inhibition of alpha 1 actin RNA levels in the mice.

TABLE-US-00020 TABLE 20 Percent inhibition of human alphal actin RNA transcript in HSA.sup.LR mice ISIS % No. inhibition 190403 38 445238 40

Example 13: Dose Dependent Antisense Inhibition of Human Alpha1 Actin by Intramuscular Administration in Transgenic Mice

[0356] ISIS 445236, which demonstrated statistically significant dose-dependent inhibition in vitro (see Example 11), was evaluated for its ability to reduce human alpha1 actin RNA transcript in vivo.

Treatment

[0357] HSA.sup.LR mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

[0358] The mice were divided into three treatment groups. The groups received direct intramuscular injections of ISIS 445236 at doses of 0.2 nM, 0.4 nM or 0.8 nM into the tibialis anterior muscle of one side. The contralateral tibialis anterior muscle in each mouse received a single dose intramuscular injection of PBS. The PBS-injected muscle acted as the control.

Inhibition of Alpha1 Actin RNA

[0359] Twenty four hours after the final dose, the animals were sacrificed and tissue from the tibialis anterior muscles of both sides was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 21, treatment with ISIS 445236 reduced human alpha1 actin RNA transcript expression at all dosages. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the control.

[0360] The results indicate that treatment with ISIS 445236 resulted in significant inhibition of alpha 1 actin mRNA levels under the conditions specified above.

TABLE-US-00021 TABLE 21 Inhibition of human alpha1 actin RNA transcript by ISIS 445236 in HSA.sup.LR mice Dose % (nM) inhibition 0.2 70 0.4 54 0.8 78

Assessment of Myotonia by Electromyography

[0361] Myotonia refers to repetitive action potential that is due to delayed relaxation of muscle fibers. This phenomenon is observed in patients of myotonic dystrophy as well as in the HSA.sup.LR mice. When the EMG needle is inserted into a myotonic muscle, the electrical activity is prolonged for up to several seconds past when the insertional activity should normally cease. The frequency of myotonic discharges ranges from 50 to 100 impulses per second.

[0362] Myotonia was measured via electromyography and graded in the following manner: grade 0 refers to no myotonia elicited by any needle insertion (0%); grade 1 refers to myotonia elicited by less than 50% needle insertions; grade 2 refers to myotonia elicited by more than 50% needle insertions; and grade 3 refers to mytonia elicited by 100% needle insertions.

[0363] Before electromyography, mice were anesthetized by using i.p. a cocktail of 100 mg/kg ketamine, 10 mg/kg xylazine, and 3 mg/kg acepromazine. Electromyography on left and right quadriceps, left and right gastrocnemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 22 as the average myotonia grade observed in four mice of each group and demonstrates significant reduction of myotonia in mice treated with ISIS 445236.

TABLE-US-00022 TABLE 22 Average reduction of myotonia in various muscles of antisense oligonucleotide- treated HSA.sup.LR mice Dose Myotonia Treatment (nM) grade PBS 2.7 ISIS 0.2 1.3 455236 0.4 1.0 0.8 1.0

Correction of Alternative Splicing

[0364] In DM1/HSA.sup.LR mouse model, the accumulation of expanded CUG RNA in the nucleus leads to the sequestration of poly(CUG)-binding proteins, such as Muscleblind-like 1 (MBLN1) (Miller, J. W. et al. EMBO J. 19: 4439, 2000). The splicing factor MBNL1, which controls alternative splicing of the Serca1 gene is sequestered in expanded CUG foci. This triggers dysregulation of the alternative splicing of this gene. To evaluate the effect of antisense inhibition of human alpha 1 actin on such alternative splicing, total RNA was purified from the tibialis anterior, gastrocnemius, and quadriceps muscle using RNeasy Lipid Tissue Mini Kit (Qiagen), according to the manufacturer's instructions. RT-PCR was performed with the SuperScript III One-Step RT-PCR System and Platinum Taq Polymerase (Invitrogen), using gene-specific primers for cDNA synthesis and PCR amplification. The forward and reverse primers for Serca-1 have been described in Bennett and Swayze (Annu. Rev. Pharmacol. 2010; 50: 259-93). PCR products were separated on agarose gels, stained with SybrGreen I Nucleic Acid Gel Stain (Invitrogen), and imaged using a Fujifilm LAS-3000 Intelligent Dark Box.

[0365] The PCR products of Serca1 splicing in the PBS control demonstrated exon 22 exclusion as a result of dysregulation of MBLN1. Treatment with ISIS 445236 resulted in exon 22 inclusion and normalization of alternative splicing of the Serca1 gene in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0366] Therefore, antisense inhibition of alpha1 actin corrected Serca1 splicing dysregulation, which indicates that treatment with antisense oligonucleotide reduced accumulation of CUGexp in the nuclear foci. Reduced accumulation of CUGexp in the nuclear foci corrects MBLN1 sequestration thereby allowing normal splicing to occur.

Example 14: In Vivo Antisense Inhibition of Human Alpha1 Actin by Subcutaneous Administration in Transgenic Mice

[0367] ISIS 190403, ISIS 445236 and ISIS 445238 were evaluated for their ability to reduce human alpha1 actin RNA transcript in vivo.

Treatment

[0368] HSA.sup.LR mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

[0369] The mice were divided into four treatment groups. The first three groups received subcutaneous injections of ISIS 190403, ISIS 445236 or ISIS 445238 at a dose of 25 mg/kg twice per week for 4 weeks. The fourth group received subcutaneous injections of PBS twice weekly for 4 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared.

Inhibition of Alpha1 Actin RNA

[0370] Twenty four hours after the final dose, the animals were sacrificed and tissue from the quadriceps muscles (left and right), gastrocnemius muscles (left and right), and tibialis anterior muscles (left and right) was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 23, treatment with antisense oligonucleotides reduced human alpha1 actin RNA transcript expression. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the control.

[0371] Both ISIS 445236 and ISIS 445238 demonstrated significant inhibition of alpha1 actin mRNA levels under the conditions specified above.

TABLE-US-00023 TABLE 23 Percent inhibition of human alpha1 actin RNA transcript in HSA.sup.LR mice ISIS ISIS ISIS Muscle Type 190403 445236 445238 Quadriceps 16 83 72 Gastrocnemius 0 85 73 Tibialis anterior 2 81 71

Fluorescence In Situ Hybridization of Alpha1 Actin in Muscles

[0372] Frozen muscle tissue sections were fixed in fresh 3% paraformaldehyde in PBS solution for 15-20 minutes, after which they were rinsed twice with PBS for 5 minutes. The nuclei were permeabilized with 0.5% Triton X-100 for 5 minutes after which the tissue was blocked with normal goat serum for 30 minutes. The sections were incubated a 2-O-methyl RNA targeted to alpha1 actin that is 5-labeled with Texas Red (Integrated DNA Technologies). The sections were counter-stained with DAPI to label the nuclei. The sections were mounted and viewed with a standard fluorescence microscope. Image acquisition was by Metavue software and deconvolution was achieved by Autoquant software.

[0373] All muscle tissue sections from mice treated with ISIS 445236 and ISIS 445238 displayed reduced fluorescent intensity of alpha1 actin signal at the ribonuclear foci, indicating antisense inhibition of human alpha1 actin mRNA and reduction of the RNA in the nuclear foci.

Assessment of Myotonia by Electromyography

[0374] Myotonia refers to repetitive action potential that is due to delayed relaxation of muscle fibers. This phenomenon is observed in patients of myotonic dystrophy as well as in the HSA.sup.LR mice. When the EMG needle is inserted into a myotonic muscle, the electrical activity is prolonged for up to several seconds past when the insertional activity should normally cease. The frequency of myotonic discharges ranges from 50 to 100 impulses per second.

[0375] Myotonia may be measured via electromyography and is graded in the following manner: grade 0 refers to no myotonia elicited by any needle insertion (0%); grade 1 refers to myotonia elicited by less than 50% needle insertions; grade 2 refers to myotonia elicited by more than 50% needle insertions; and grade 3 refers to mytonia elicited by 100% needle insertions.

[0376] Before electromyography, mice were anesthetized by using i.p. 100 mg/kg ketamine, 10 mg/kg xylazine, and 3 mg/kg acepromazine or 250 mg/kg 2,2,2-tribromoethanol. Electromyography on left and right quadriceps, left and right gastrocnemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 24 as the average myotonia grade observed in four mice of each group and demonstrates significant reduction of myotonia in mice treated with ISIS 445236 and ISIS 445238.

TABLE-US-00024 TABLE 24 Average reduction of myotonia in various muscles of antisense oligonucleotide-treated HSA.sup.LR mice ISIS ISIS ISIS PBS 190403 445236 445238 Left quadriceps 3.00 3.00 0.00 0.25 Right quadriceps 3.00 3.00 0.00 0.00 Left gastrocnemius 3.00 3.00 0.00 0.25 Right gastrocnemius 3.00 3.00 0.00 0.25 Left Tibialis anterior 2.75 2.50 0.00 0.00 Right Tibialis anterior 2.75 2.50 0.00 0.00 Lumbar paraspinals 3.00 3.00 0.00 0.75

Correction of Alternative Splicing

[0377] The splicing factor MBNL1, which controls Serca1 splicing, m-Titin splicing, CIC-1 chloride channel gene (Clcn1) splicing, and Zasp splicing, is sequestered in expanded CUG foci. MBNL1 sequestration triggers dysregulated splicing in each of these genes. To evaluate the effect of antisense inhibition of human alpha 1 actin on splicing, total RNA was purified from the tibialis anterior, gastrocnemius, and quadriceps muscle and RT-PCR was performed, as described in Example 13. The forward and reverse primers for Serca-1, m-Titin, Clcn1, and ZASP have been described in Bennett and Swayze, Annu. Rev. Pharmacol. 2010; 50: 259-93.

[0378] In PBS treated HSA.sup.LR mice, Serca1 splicing is dysregulated as demonstrated by exon 22 exclusion. Treatment with each of ISIS 445236 and ISIS 445238 resulted in exon 22 inclusion and normalization of alternative splicing of the Serca1 gene in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0379] In PBS treated HSA.sup.LR mice, m-Titin splicing is dysregulated as demonstrated by exon 5 inclusion. Treatment with each of ISIS 445236 and ISIS 445238 resulted in skipping of exon 5 and normalization of alternative splicing of the m-Titin gene in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0380] In PBS treated HSA.sup.LR mice, Clcn1 splicing is dysregulated as demonstrated by exon 7a inclusion. Treatment with each of ISIS 445236 and ISIS 445238 resulted in skipping of exon 7a and normalization of alternative splicing of the Clcn1 gene in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0381] In PBS treated HSA.sup.LR mice, Zasp splicing is dysregulated as demonstrated by exon 11 inclusion. Treatment with each of ISIS 445236 and ISIS 445238 resulted in skipping of exon 11 and normalization of alternative splicing of the Zasp gene in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0382] Therefore, antisense inhibition of alpha1 actin corrected Serca1, m-Titin, Clcn1, and Zasp splicing dysregulation, which indicates that treatment with antisense oligonucleotide reduced accumulation of CUGexp in the nuclear foci. Reduced accumulation of CUGexp in the nuclear foci correct MBLN1 sequestration thereby allowing normal splicing to occur.

Example 15: In Vivo Antisense Inhibition of Human Alpha1 Actin in Transgenic Mice

[0383] Antisense inhibition of human alpha1 actin RNA transcript by ISIS 445236 and ISIS 445238 on myotonia in HSA.sup.LR mice was further evaluated.

Treatment

[0384] HSA.sup.LR mice were divided into three treatment groups. The first two groups received subcutaneous injections of ISIS 445236 or ISIS 445238 at a dose of 25 mg/kg twice per week for 2 weeks. The third group received subcutaneous injections of PBS twice per week for 2 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared.

Inhibition of Alpha1 Actin RNA

[0385] Twenty four hours after the final dose, the animals were sacrificed and tissue from the quadriceps muscles, gastrocnemius muscles, and tibialis anterior muscles was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 25, treatment with antisense oligonucleotides reduced human alpha1 actin RNA transcript expression. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the PBS control.

[0386] Both ISIS 445236 and ISIS 445238 demonstrated significant inhibition of alpha1 actin mRNA levels under the conditions specified above.

TABLE-US-00025 TABLE 25 Percent inhibition of human alpha1 actin RNA transcript in HSA.sup.LR mice Muscle Type ISIS 445236 ISIS 445238 Quadriceps 61 64 Gastrocnemius 68 37 Tibialis anterior 68 41

Assessment of Myotonia by Electromyography

[0387] Electromyography on left and right quadriceps, left and right gastroenemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 26 as the average myotonia grade observed in four mice of each group and demonstrates significant reduction of myotonia in mice treated with ISIS 445236 and ISIS 445238.

TABLE-US-00026 TABLE 26 Average reduction of myotonia in various muscles of antisense oligonucleotide-treated HSA.sup.LR mice ISIS ISIS PBS 445236 445238 Left quadriceps 3.00 0.00 1.75 Right quadriceps 3.00 0.00 1.75 Left gastrocnemius 3.00 0.25 1.5 Right gastrocnemius 3.00 0.25 1.00 Left Tibialis anterior 2.75 0.00 0.00 Right Tibialis anterior 2.75 0.00 0.00 Lumbar paraspinals 3.00 0.50 2.00

Correction of Alternative Splicing

[0388] To evaluate the effect of ISIS 190401 on alternative splicing of Serca1, total RNA purified from the tibialis anterior gastrocnemius, and quadriceps muscle was analyzed in a procedure similar to that described in Example 13.

[0389] In PBS treated HSA.sup.LR mice, Serca1 splicing is dysregulated as demonstrated by exon 22 exclusion, as a result of MBLN1 dysregulation. Treatment with each of ISIS 445236 and ISIS 445238 resulted in near-complete inclusion and normalization of alternative splicing of exon 22 of the Serca1 gene in the tibialis anterior and quadriceps muscles.

[0390] Therefore, antisense inhibition of alpha1 actin corrected Serca1 splicing dysregulation, which indicates that treatment with antisense oligonucleotide reduced accumulation of CUGexp in the nuclear foci. Reduced accumulation of CUGexp in the nuclear foci correct MBLN1 sequestration thereby allowing normal splicing to occur.

Example 16: Dose-Dependent Antisense Inhibition of Human Alpha1 Actin in Transgenic Mice

[0391] Dose-dependent inhibition of human alpha1 actin RNA transcript by ISIS 445236 and ISIS 445238 on myotonia in HSA.sup.LR mice was evaluated.

Treatment

[0392] HSA.sup.LR mice were subcutaneously injected with ISIS 445236 or ISIS 445238 at doses of 2.5 mg/kg, 8.5 mg/kg or 25.0 mg/kg twice per week for 4 weeks. The control group received subcutaneous injections of PBS twice per week for 4 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared.

Inhibition of Alpha1 Actin RNA

[0393] Twenty four hours after the final dose, the animals were sacrificed and tissue from the quadriceps muscles (Quad), gastrocnemius muscles (Gastroc), and tibialis anterior muscles (TA) was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 27, treatment with antisense oligonucleotides reduced human alpha1 actin RNA transcript expression. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the PBS control.

[0394] Both the antisense oligonucleotides demonstrated dose-dependent inhibition of alpha1 actin mRNA levels in quadriceps muscles, gastrocnemius muscles, and tibialis anterior muscles under the conditions specified above.

TABLE-US-00027 TABLE 27 Dose-dependent inhibition of human alphal actin RNA transcript in HSA.sup.LR mice mg/kg/wk Quad Gastroc TA ISIS 445236 5 24 36 46 17 53 57 59 50 86 86 90 ISIS 445238 5 21 37 3 17 30 39 60 50 59 81 70

Assessment of Myotonia by Electromyography

[0395] Electromyography on left and right quadriceps (Quad), left and right gastrocnemius muscles (Gastroc), left and right tibialis anterior (TA) muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 28 as the average myotonia grade observed in four mice of each group and demonstrates significant dose-dependent reduction of myotonia in mice treated with ISIS 445236 and ISIS 445238.

TABLE-US-00028 TABLE 28 Average reduction of myotonia in various muscles of antisense oligonucleotide-treated HSA.sup.LR mice mg/ Lumbar kg/ Left Right Left Right Left Right para- wk Quad Quad Gastroc Gastroc TA TA spinals PBS 3.00 3.00 3.00 3.00 2.75 2.75 3.00 ISIS 5 3.00 3.00 3.00 3.00 2.25 2.25 3.00 445236 17 0.75 0.75 0.75 1.00 0.00 0.00 1.75 50 0.00 0.00 0.00 0.00 0.00 0.00 0.00 ISIS 5 2.75 2.75 2.50 2.50 2.00 1.75 2.75 445238 17 3.00 3.00 2.00 2.25 0.00 0.00 2.75 50 0.75 0.75 0.25 0.25 0.00 0.00 1.00

Correction of Alternative Splicing

[0396] To evaluate the effect of ISIS 190401 on alternative splicing of Serca1, total RNA purified from the tibialis anterior gastrocnemius, and quadriceps muscle was analyzed in a procedure similar to that described in Example 13.

[0397] In PBS treated HSA.sup.LR mice, Serca1 splicing is dysregulated as demonstrated by exon 22 exclusion, as a result of MBLN1 dysregulation. Treatment with either ISIS 445236 or ISIS 445238 at doses of 8.5 mg/kg or 25.0 mg/kg twice a week (or 17.0 mg/kg/week and 50.0 mg/kg/week) resulted in complete inclusion and normalization of alternative splicing of exon 22 of the Serca1 gene in all three muscle types.

[0398] Therefore, antisense inhibition of alpha1 actin corrected Serca1 splicing dysregulation, which indicates that treatment with antisense oligonucleotide reduced accumulation of CUGexp in the nuclear foci. Reduced accumulation of CUGexp in the nuclear foci correct MBLN1 sequestration thereby allowing normal splicing to occur.

Example 17: In Vivo Antisense Inhibition by an Oligonucleotide Targeting the HSA Coding Region of Human Alpha1 Actin in Transgenic Mice

[0399] Antisense inhibition of human alpha1 actin RNA transcript by ISIS 190401 (5-GCGGTCAGCGATCCCAGGGT-3 (SEQ ID NO: 788), target start site 1028 of SEQ ID NO: 1) on myotonia in HSA.sup.LR mice was evaluated.

Treatment

[0400] HSA.sup.LR mice received subcutaneous injections of ISIS 190401 at a dose of 25 mg/kg twice per week for 4 weeks. A control group received subcutaneous injections of PBS twice per week for 2 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared.

Inhibition of Alpha1 Actin RNA

[0401] Twenty four hours after the final dose, the animals were sacrificed and tissue from the quadriceps muscles, gastrocnemius muscles, and tibialis anterior muscles was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 29, treatment with antisense oligonucleotides reduced human alpha1 actin RNA transcript expression. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the PBS control.

[0402] Treatment with ISIS 190401 resulted in significant inhibition of alpha1 actin mRNA levels in quadriceps muscle, gastrocnemius muscle, and tibialis anterior muscle under the conditions specified above.

TABLE-US-00029 TABLE 29 Antisense inhibition of human alpha 1 actin RNA transcript in HSA.sup.LR mice Muscle Type % inhibition Quadriceps 85 Gastrocnemius 86 Tibialis anterior 89

Assessment of Myotonia by Electromyography

[0403] Electromyography on left and right quadriceps, left and right gastrocnemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 30 as the average myotonia grade observed in four mice of each group and demonstrates significant reduction of myotonia in mice treated with ISIS 190401.

TABLE-US-00030 TABLE 30 Average reduction of myotonia in various muscles of antisense oligonucleotide-treated HSA.sup.LR mice PBS ISIS 190401 Left quadriceps 3.00 0.00 Right quadriceps 3.00 0.00 Left gastrocnemius 3.00 0.00 Right gastrocnemius 3.00 0.00 Left Tibialis anterior 2.50 0.00 Right Tibialis anterior 2.50 0.00 Lumbar paraspinals 3.00 0.50

Correction of Alternative Splicing

[0404] To evaluate the effect of ISIS 190401 on alternative splicing of Serca1, total RNA purified from the tibialis anterior gastrocnemius, and quadriceps muscle was analyzed in a procedure similar to that described in Example 13.

[0405] In PBS treated HSA.sup.LR mice, Serca1 splicing is dysregulated as demonstrated by exon 22 exclusion, as a result of MBLN1 dysregulation. Treatment with ISIS 190401 resulted in complete inclusion and normalization of alternative splicing of exon 22 of the Serca1 gene in all three muscle types.

[0406] Therefore, antisense inhibition of alpha1 actin corrected Serca1 splicing dysregulation, which indicates that treatment with antisense oligonucleotide reduced accumulation of CUGexp in the nuclear foci. Reduced accumulation of CUGexp in the nuclear foci corrects MBLN1 sequestration thereby allowing normal splicing to occur.

Example 18: Duration of Action of Antisense Inhibition by an Oligonucleotide Targeting Human Alpha1 Actin in Transgenic Mice

[0407] The duration of action of antisense inhibition of human alpha1 actin RNA transcript by ISIS 445236 in HSA.sup.LR mice was evaluated.

Treatment

[0408] HSA.sup.LR mice received subcutaneous injections of ISIS 445236 at a dose of 25 mg/kg twice per week for 4 weeks. A control group received subcutaneous injections of PBS twice per week for 2 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared. The mice were analyzed 6 weeks after administration of the last dose.

Inhibition of Alpha1 Actin RNA

[0409] Six weeks after the final dose, the animals were sacrificed and tissue from the quadriceps muscles, gastrocnemius muscles, and tibialis anterior muscles was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 31, treatment with ISIS 445236 reduced human alpha1 actin RNA transcript expression, and this effect was sustained at least for 6 weeks. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the PBS control.

[0410] Treatment with ISIS 445236 resulted in significant inhibition of alpha1 actin mRNA levels in quadriceps muscle, gastrocnemius muscle, and tibialis anterior muscle under the conditions specified above.

TABLE-US-00031 TABLE 31 Antisense inhibition of human alpha1 actin RNA transcript in HSA.sup.LR mice Muscle Type % inhibition Quadriceps 88 Gastrocnemius 76 Tibialis anterior 67

Assessment of Myotonia by Electromyography

[0411] Electromyography on left and right quadriceps, left and right gastrocnemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 32 as the average myotonia grade observed in four mice of each group and demonstrates significant reduction of myotonia in mice treated with ISIS 445236. Therefore, the effect of antisense inhibition of alpha actin by ISIS 445236 was sustained at least for 6 weeks.

TABLE-US-00032 TABLE 32 Average reduction of myotonia in various muscles of antisense oligonucleotide-treated HSA.sup.LR mice PBS ISIS 445236 Left quadriceps 3.00 0.00 Right quadriceps 3.00 0.00 Left gastrocnemius 3.00 0.00 Right gastrocnemius 3.00 0.00 Left Tibialis anterior 2.50 0.00 Right Tibialis anterior 2.50 0.00 Lumbar paraspinals 3.00 0.00

Example 19: In Vivo Effect of Antisense Inhibition of mRNA with CUG Repeats by Intramuscular Administration in Transgenic Mice

[0412] The effect of antisense inhibition of mRNA transcripts containing multiple CUG repeats on myotonia in HSA.sup.LR mice was evaluated. Three antisense oligonucleotides targeting the CUG repeats and with varying lengths were assayed for their effectiveness in inhibiting myotonia in the mice. ISIS 444745 (AGCAGCAGCAGCAGCAGCAGCAGCA (SEQ ID NO: 789) is a uniform 2-O-methoxyethyl oligonucleotide, 25 nucleotides in length and with a phosphorothioate backbone. ISIS 444746 (AGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 790) is a uniform 2-O-methoxyethyl oligonucleotide, 20 nucleotides in length and with a phosphorothioate backbone. ISIS 444749 (GCAGCAGCAGCAGCA (SEQ ID NO: 791) is a uniform 2-O-methoxyethyl oligonucleotide, 15 nucleotides in length and with a phosphorothioate backbone. ISIS 445236 was included in the assay as a positive control.

Treatment

[0413] HSA.sup.LR mice were divided into three treatment groups. The groups received direct intramuscular injections of ISIS 444745, ISIS 444746 or ISIS 444749 at a dose of 0.4 nM into the tibialis anterior muscle. The contralateral tibialis anterior muscle in each mouse received a single dose intramuscular injection of PBS. The PBS-injected muscle acted as the control.

Inhibition of Alpha1 Actin RNA

[0414] Twenty four hours after the final dose, the animals were sacrificed and tissue from the tibialis anterior (left and right) was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 33, only treatment with ISIS 444745 reduced human alpha1 actin RNA transcript expression. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the PBS control.

TABLE-US-00033 TABLE 33 Percent inhibition of human alpha1 actin RNA transcript in HSA.sup.LR mice ISIS No. % inhibition 444745 51 444746 0 444749 12

Example 20: In Vivo Dose Dependent Inhibition of mRNA with CUG Repeats by Intramuscular Administration in Transgenic Mice

[0415] ISIS 444745 and ISIS 444746 were further evaluated for their ability to reduce human alpha 1 actin mRNA in vivo.

Treatment

[0416] HSA.sup.LR mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

[0417] The mice were divided into 6 treatment groups. Three of the groups received direct intramuscular injections of ISIS 444745 at doses of 0.2 nM, 0.5 nM, or 1.0 nM into the tibialis anterior muscle on one side. Another three groups direct intramuscular injections of ISIS 444746 at doses of 0.2 nM, 0.5 nM, or 1.0 nM into the tibialis anterior muscle on one side. The contralateral tibialis anterior muscle in each mouse received a single dose intramuscular injection of PBS. The PBS-injected muscle acted as the control for the corresponding muscle treated with ISIS oligonucleotide.

Assessment of Myotonia by Electromyography

[0418] Electromyography on left and right quadriceps, left and right gastrocnemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 34 as the average myotonia grade observed in four mice of each group and demonstrates significant reduction of myotonia in mice treated with either ISIS 444745 or ISIS 444746. The effect of antisense inhibition of alpha actin by ISIS 444745 and 444746 was sustained at least for 6 weeks.

TABLE-US-00034 TABLE 34 Dose-dependent reduction of myotonia in muscles of antisense oligonucleotide-treated HSA.sup.LR mice 0.2 nM 0.5 nM 1.0 nM PBS 3.00 3.00 2.33 ISIS 444745 1.67 1.00 0.33 PBS 2.50 2.00 3.00 ISIS 444746 2.00 0.00 1.00

Example 21: In Vivo Effect of Antisense Inhibition of mRNA with CUG Repeats by Subcutaneous Administration in Transgenic Mice

[0419] The effect of antisense inhibition of mRNA transcripts containing multiple CUG repeats on myotonia in HSA.sup.LR mice was evaluated. ISIS 445236 was included in the assay as a positive control.

Treatment

[0420] HSA.sup.LR mice were divided into five treatment groups. The first three groups received subcutaneous injections of ISIS 444745, ISIS 444746 or ISIS 444749 at a dose of 25 mg/kg twice per week for 4 weeks. The fourth group received subcutaneous injections of PBS twice per week for 4 weeks. The fifth group received subcutaneous injections of ISIS 445236 at a dose of 25 mg/kg twice per week for 4 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared.

Assessment of Myotonia by Electromyography

[0421] Electromyography on left and right quadriceps, left and right gastrocnemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 35 as the average myotonia grade observed in four mice of each group.

[0422] Treatment with ISIS 445236 led to significant reduction in myotonia. Treatment with ISIS 444745 and ISIS 444746 also resulted in reduced myotonia in some of the tissues tested.

TABLE-US-00035 TABLE 35 Average reduction of myotonia in various muscles of antisense oligonucleotide-treated HSA.sup.LR mice ISIS ISIS ISIS ISIS PBS 444745 444746 444749 445236 Left quadriceps 3.00 3.00 3.00 3.00 0.00 Right quadriceps 3.00 3.00 3.00 3.00 0.00 Left gastrocnemius 3.00 2.75 3.00 3.00 0.00 Right gastrocnemius 3.00 2.75 2.75 3.00 0.00 Left Tibialis anterior 3.00 2.25 2.75 2.75 0.00 Right Tibialis anterior 3.00 2.25 2.50 2.75 0.00 Lumbar paraspinals 3.00 3.00 3.00 3.00 0.00

Example 22: Dose-Dependent Inhibition of Long CUG Repeat mRNA (HSA.SUP.LR .Mice) and a Short CUG Repeat (HSA.SUP.SR .Mice) by Subcutaneous Administration in Transgenic Mice

[0423] Dose-dependent inhibition of mRNA transcripts containing a long CUG repeat (HSA.sup.LR mice) and a short CUG repeat (HSA.sup.SR mice), was evaluated. HSA-short repeat (HSA.sup.SR) mice express the identical transgene as the HSA.sup.LR mice, except that 5 instead of 250 CUG repeats are inserted in the 3 UTR. HSA.sup.SR mice do not have myotonia, splicing changes, or any other observable myotonia phenotype. ISIS 445236 was used in this assay.

Treatment

[0424] HSA.sup.LR mice were divided into four treatment groups. The first three groups received subcutaneous injections of ISIS 445236 at doses of 2.5 mg/kg, 8.5 mg/kg or 25.0 mg/kg twice per week for 4 weeks. The fourth group received subcutaneous injections of PBS twice per week for 4 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared. HSA.sup.SR mice were also divided into four groups and similarly treated.

Inhibition of Alpha1 Actin RNA

[0425] Twenty four hours after the final dose, the animals were sacrificed and tissue from the quadriceps muscles (left and right), gastrocnemius muscles (left and right), and tibialis anterior muscles (left and right) was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. The results are presented in Tables 36 and 37 and are expressed as percent inhibition of alpha1 actin transcript, relative to the control. Greater inhibition of the nuclear-retained long repeat in the muscle of HSA.sup.LR mice was achieved compared with the non-nuclear-retained short repeat in the muscle of HSA.sup.SR mice.

TABLE-US-00036 TABLE 36 Percent inhibition of human alpha1 actin RNA transcript in HSA.sup.LR mice Dose (mg/kg) Quadriceps Gastrocnemius Tibialis anterior 2.5 24 36 46 8.5 53 66 59 25 86 86 90

TABLE-US-00037 TABLE 37 Percent inhibition of human alpha1 actin RNA transcript in HSA.sup.SR mice Dose (mg/kg) Quadriceps Gastrocnemius Tibialis anterior 2.5 15 14 0 8.5 30 11 0 25 59 48 54

Example 23: In Vivo Antisense Inhibition of Human DMPK in Transgenic Mice

[0426] LC15 mice, Line A, are transgenic mice containing the entire human DMPK 3UTR (developed by Wheeler et al, University of Rochester). The mice are the second generation of mice backcrossed to an FVB background. The transgene is expressed in the mice as a CUG repeat RNA, which is retained in the nucleus, forming nuclear inclusions or foci, similar to that seen in human tissue samples of patients with myotonic dystrophy (DM1). There are 350-400 CUG repeats in the DMPK transgene. These mice display early signs of DM1 and do not display any myotonia in their muscle tissues.

[0427] ISIS 445569, ISIS 444404, ISIS 444436 and ISIS 473810, which demonstrated statistically significant dose-dependent inhibition in vitro (see Example 5), were evaluated for their ability to reduce human DMPK RNA transcript in vivo.

Treatment

[0428] LC15, Line A mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

[0429] The mice were divided into five treatment groups. The first three groups received subcutaneous injections of ISIS 445569, ISIS 444404 or ISIS 444436 at a dose of 25 mg/kg twice per week for 4 weeks. The fourth group received subcutaneous injections of ISIS 473810 at a dose of 12.5 mg/kg twice per week for 4 weeks. The fifth group received subcutaneous injections of PBS twice weekly for 4 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared.

Inhibition of DMPK RNA

[0430] Twenty four hours after the final dose, the animals were sacrificed and tissue from the quadriceps muscles was isolated. RNA was isolated for real-time PCR analysis of DMPK and normalized to 18s RNA. As presented in Table 38, treatment with antisense oligonucleotides reduced human DMPK RNA transcript expression. The results are expressed as percent inhibition of DMPK transcript, relative to the PBS control.

TABLE-US-00038 TABLE 38 Antisense inhibition of human DMPK RNA transcript in LC15 mice ISIS No mg/kg/wk % inhibition 444404 50 20 444404 50 55 444436 50 41 473810 25 56

Assessment of Myotonia by Electromyography

[0431] Electromyography on left and right quadriceps, left and right gastrocnemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. Since LC15 mice do not have myotonia, neither the control group nor the treatment groups displayed any myotonia in any muscle tested.

Example 24: In Vivo Antisense Inhibition of Human DMPK in Transgenic Mice

[0432] LC15 mice, Line D, are transgenic mice containing the entire human DMPK 3UTR (developed by Wheeler et al, University of Rochester). The mice are the third generation of mice backcrossed to an FVB background. The transgene is expressed in the mice as a CUG repeat RNA, which is retained in the nucleus, forming nuclear inclusions or foci, similar to that seen in human tissue samples of patients with myotonic dystrophy (DM1). There are 350-400 CUG repeats in the DMPK transgene. These mice display early signs of DM1 and do not display any myotonia in their muscle tissues.

[0433] ISIS 445569, ISIS 444404, ISIS 444436 and ISIS 473810 were further evaluated for their ability to reduce human DMPK RNA transcript in vivo.

Treatment

[0434] LC15, Line D mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.

[0435] The mice were divided into six treatment groups. The first three groups received subcutaneous injections of ISIS 445569, ISIS 444404 or ISIS 444436 at a dose of 25.00 mg/kg twice per week for 4 weeks. The fourth group received subcutaneous injections of ISIS 473810 at a dose of 12.50 mg/kg twice per week for 4 weeks. The fifth group received subcutaneous injections of ISIS 473810 at a dose of 6.25 mg/kg twice per week for 4 weeks. The sixth group received subcutaneous injections of PBS twice weekly for 4 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared.

Inhibition of DMPK RNA

[0436] Twenty four hours after the final dose, the animals were sacrificed and tissue from the quadriceps muscles was isolated. RNA was isolated for real-time PCR analysis of DMPK and normalized to 18s RNA. As presented in Table 39, treatment with antisense oligonucleotides reduced human DMPK RNA transcript expression. The results are expressed as percent inhibition of DMPK transcript, relative to the PBS control.

[0437] The results indicate that treatment with the antisense oligonucleotides resulted in inhibition of DMPK mRNA in the mice.

TABLE-US-00039 TABLE 39 Antisense inhibition of human DMPK RNA transcript in LC15 mice ISIS No mg/kg/wk % inhibition 444404 50.00 24 444404 50.00 30 444436 50.00 17 473810 25.00 7 473810 12.50 18

Assessment of Myotonia by Electromyography

[0438] Electromyography on left and right quadriceps, left and right gastroenemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. Since LC15 mice do not have myotonia, neither the control group nor the treatment groups displayed any myotonia in any muscle tested.

Example 25: In Vivo Antisense Inhibition of Human DMPK in SXL Transgenic Mouse Model

[0439] Using hDMPK-targeting ASOs 444401 and 299471 target knockdown in soleus muscle was measured in SXL mice. The SXL mouse is transgenic for the entire DMPK gene and promoter and contains a 1000 CUG repeat sequence in the 3UTR of DMPK gene. Mice were dosed 50 mg/kg twice weekly for 4 weeks (n=3 mice per group, except n=2 for saline-injected controls). Results of Taqman assays demonstrated that treatment with either ISISI 444401 or ISIS 299471 significantly reduced mut-hDMPK mRNA levels but had negligible effect on endogenous mouse Dmpk mRNA levels.

[0440] Therefore, ISIS 444401 and ISIS 299471 selectively target human DMPK mRNA transcript.

Example 26: Duration of Action of Antisense Inhibition by an Oligonucleotide Targeting Human Alpha1 Actin in Transgenic Mice

[0441] The duration of action of antisense inhibition of human alpha1 actin RNA transcript by ISIS 190401 in HSA.sup.LR mice was evaluated.

Treatment

[0442] HSA.sup.LR mice received subcutaneous injections of ISIS 190401 at a dose of 25 mg/kg twice per week for 4 weeks. A control group received subcutaneous injections of PBS twice per week for 4 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared. The mice were analyzed 15 weeks after administration of the last dose.

Inhibition of Alpha1 Actin RNA

[0443] Fifteen weeks after the final dose, the animals were sacrificed and tissue from the quadriceps muscles, gastrocnemius muscles, and tibialis anterior muscles was isolated. RNA was isolated for real-time PCR analysis of alpha1 actin and normalized to 18s RNA. As presented in Table 40, treatment with ISIS 190401 reduced human alpha1 actin RNA transcript expression, and this effect was sustained at least for 15 weeks. The results are expressed as percent inhibition of alpha1 actin transcript, relative to the PBS control.

[0444] Treatment with ISIS 190401 resulted in significant inhibition of alpha1 actin mRNA levels under the conditions specified above.

TABLE-US-00040 TABLE 40 Antisense inhibition of human alpha1 actin RNA transcript in HSA.sup.LR mice Muscle Type % inhibition Quadriceps 74 Gastrocnemius 81 Tibialis anterior 75

Assessment of Myotonia by Electromyography

[0445] Electromyography on left and right quadriceps, left and right gastrocnemius muscles, left and right tibialis anterior muscles and lumbar paraspinals muscles was performed as previously described (Kanadia et al, 2003, Science, 302: 1978-1980) by using 30 gauge concentric needle electrodes and a minimum of 10 needle insertions for each muscle. The data is presented in Table 41 as the average myotonia grade observed in four mice of each group and demonstrates significant reduction of myotonia in mice treated with ISIS 190401. Therefore, the effect of antisense inhibition of alpha actin by ISIS 190401 was sustained at least for 15 weeks.

TABLE-US-00041 TABLE 41 Average reduction of myotonia in various muscles of antisense oligonucleotide-treated HSA.sup.LR mice PBS ISIS 190401 Left quadriceps 3.0 0.0 Right quadriceps 3.0 0.0 Left gastrocnemius 2.5 0.0 Right gastrocnemius 2.5 0.0 Left Tibialis anterior 2.5 0.0 Right Tibialis anterior 2.5 0.0 Lumbar paraspinals 2.5 0.0

Correction of Alternative Splicing

[0446] To evaluate the effect of ISIS 190401 on alternative splicing of Serca1, total RNA purified from the tibialis anterior gastrocnemius, and quadriceps muscle was analyzed in a procedure similar to that described in Example 13.

[0447] In PBS treated HSA.sup.LR mice, Serca1 splicing is dysregulated as demonstrated by exon 22 exclusion. Treatment with ISIS 190401 resulted in complete inclusion and normalization of alternative splicing of exon 22 of the Serca1 gene in all three muscle types, which was sustained even after 15 weeks.

[0448] Therefore, antisense inhibition of alpha1 actin corrected Serca1 splicing dysregulation, which indicates that treatment with antisense oligonucleotide reduced accumulation of CUGexp in the nuclear foci. Reduced accumulation of CUGexp in the nuclear foci corrects MBLN1 sequestration thereby allowing normal splicing to occur.

Example 27: Microarray Analysis of Transcriptomic Effect of Antisense Inhibition of Human Actin

[0449] Expression of actin mRNA with expanded CUG repeats causes extensive remodeling of the muscle transcriptome. To evaluate the overall transcriptomic effects of ISIS 190401 and ISIS 445236, microarray analyses was utilized in HSA.sup.LR mice.

Treatment

[0450] HSA.sup.LR mice received subcutaneous injections of ISIS 190401 or ISIS 445236 at a dose of 25 mg/kg twice per week for 4 weeks. A control group received subcutaneous injections of PBS twice per week for 4 weeks. The PBS-injected group served as the control group to which the oligonucleotide-treated group was compared.

Transcriptome Analysis by Microarray

[0451] RNA was isolated from the quadriceps muscle of wild-type or HSA.sup.LR mice. RNA integrity was verified using an Agilent Bioanalyzer (RNA integrity number >7.5). RNA was processed to complementary RNA (cRNA) and hybridized on microbeads using MouseRef-8 v2.0 Expression BeadChip Kits (Illumina, San Diego), according to the manufacturer's recommendations. Image data were quantified using BeadStudio software (Illumina). Signal intensities were quantile normalized. Row-specific offsets were used to avoid any values of less than 2 prior to normalization. Data from all probe sets with 6 or more nucleotides of CUG, UGC, or GCU repeats was suppressed to eliminate the possibility that expanded repeats in the hybridization mixture (CAG repeats in cRNA originating from CUG repeats in the mRNA) could cross-hybridize with repeat sequences in the probes. To eliminate genes whose expression was not readily quantified on the arrays, probes showing a P value for detection probability of <0.1 were suppressed in all samples. Comparisons between groups were summarized and rank-ordered by fold-changes of mean expression level and t tests. The software package R (Butler et al. Diabetes. 2002; 51: 1028-34) was used to perform principal components analysis (Levin et al. In Antisense Drug Technology: Principles, Strategies, and Applications, S. T. Crooke, Ed. (CRC Press, Boca Raton, 2008), pp 183-215; Geary et al. Drug Metab. Dispos. 2003; 31: 1419-28) on wild-type, ISIS oligonucleotide-treated, and PBS-treated microarray samples. The principle components allowed the capture of the majority of the expression variation in each sample within 3 dimensions. The first three principal components of each sample were plotted.

[0452] The principle component analysis of untreated wild-type and HSA.sup.LR mice demonstrated segregation of HSA.sup.LR away from wild-type mice, in widely separated clusters. In contrast, antisense oligonucleotide-treated HSA.sup.LR mice clustered more closely to wild-type mice, suggesting an overall trend for transcriptome normalization. Comparisons of HSA.sup.LR transgenic mice with wild-type mice identified 93 transcripts whose expression levels were altered more than two-fold (P<0.0001), as presented in Table 42, below. The extent of dysregulation for these transcripts was reduced or normalized for antisense oligonucleotides (88% dysregulated transcripts responded to ISIS 445236, P<0.05 for ISIS 445236 vs. PBS control, whereas 90% responded to ISIS 190401).

[0453] In order to consider transcripts that have off-target knockdown, all transcripts whose expression was reduced in antisense oligonucleotide-treated HSA.sup.LR mice wee identified (>two-fold reduction by either oligonucleotide, P<0.0001, n=41 transcripts). All transcripts that were down-regulated by these criteria demonstrated upregulation in HSA.sup.LR mice. The only exception, collagen 6 alpha2, is unlikely to result from off-target cleavage because it was down-regulated by the two antisense oligonucleotides with non-overlapping sequences.

[0454] These results indicate that treatment with antisense oligonucleotides for 4 weeks resulted in a general improvement of the muscle transcriptome without any evidence for off-target effects.

TABLE-US-00042 TABLE 42 Comparisons of HSA.sup.LR transgenic mice with wild-type mice identified 93 transcripts Fold- Fold- t test Fold- Fold- t test Fold- change t test change HASLR change t test change HSALR- change t test HSALR- HSALR- HSALR- 190401 HSALR- HSALR- HSALR- 445236 HSALR- HSALR- saline Saline 190104 vs. vs. 190401 190401 445236 vs. vs. 445236 445236 vs. vs. HSALR- HSALR- vs. vs. HSALR- HSALR- vs. vs. Transcript WT WT saline saline WT WT saline saline WT WT OSBPL10 15.11 0.0000 0.46 0.0023 6.95 0.0008 0.39 0.0007 5.92 0.0002 FBXL13 12.12 0.0000 0.49 0.0159 5.91 0.0385 0.65 0.0255 7.93 0.0026 NGFR 11.57 0.0000 0.23 0.0001 2.66 0.0314 0.16 0.0000 1.84 0.0133 SLC1A1 9.39 0.0000 0.39 0.0001 3.66 0.0001 0.30 0.0001 2.85 0.0116 CXADR 9.13 0.0000 0.14 0.0000 1.30 0.6119 0.21 0.0001 1.94 0.2244 NFATC2 8.48 0.0000 0.32 0.0002 2.67 0.0043 0.22 0.0001 1.84 0.0394 ATP1B4 7.02 0.0000 0.24 0.0000 1.68 0.0021 0.24 0.0000 1.70 0.0091 UCHL1 6.80 0.0000 0.71 0.0168 4.86 0.0005 0.72 0.1187 4.91 0.0090 TEAD4 6.76 0.0000 0.50 0.0030 3.39 0.0085 0.30 0.0004 2.06 0.1213 TAS1R1 6.72 0.0000 0.28 0.0003 1.91 0.1857 0.43 0.0002 2.88 0.0047 MUSTN1 6.52 0.0000 0.31 0.0000 2.01 0.0006 0.33 0.0000 2.15 0.0115 IRF5 6.01 0.0000 0.21 0.0000 1.28 0.0556 0.33 0.0001 1.96 0.0035 CRIP3 5.82 0.0000 0.33 0.0000 1.92 0.0151 0.29 0.0001 1.67 0.1470 TAL2 5.75 0.0000 0.20 0.0001 1.13 0.7717 0.36 0.0002 2.08 0.0274 ORF63 5.39 0.0000 0.27 0.0001 1.45 0.0206 0.47 0.0018 2.51 0.0066 COPG 5.05 0.0000 0.30 0.0000 1.53 0.0218 0.25 0.0001 1.25 0.3617 CAMK1D 4.92 0.0000 0.23 0.0002 1.12 0.8157 0.27 0.0000 1.32 0.2449 HSPA2 4.76 0.0000 0.43 0.0000 2.02 0.0079 0.42 0.0000 2.02 0.0197 CAMK2D 4.70 0.0000 0.36 0.0001 1.70 0.0493 0.45 0.0004 2.12 0.0095 CNTNAP2 4.49 0.0000 0.58 0.0001 2.59 0.0000 0.67 0.0007 3.02 0.0000 TTC7 4.33 0.0000 0.38 0.0000 1.63 0.0085 0.68 0.0468 2.96 0.0126 CD276 4.08 0.0001 0.36 0.0001 1.47 0.1613 0.59 0.0029 2.39 0.0072 USH1C 4.07 0.0000 0.50 0.0011 2.04 0.0077 0.38 0.0029 1.55 0.2881 LRP11 4.03 0.0000 0.55 0.0017 2.24 0.0011 0.55 0.0006 2.23 0.0000 PHLDA3 3.96 0.0000 0.40 0.0001 1.60 0.0019 0.36 0.0001 1.42 0.0609 HSPB7 3.80 0.0000 0.30 0.0000 1.14 0.5358 0.30 0.0000 1.15 0.4474 TRIT1 3.74 0.0000 0.43 0.0000 1.62 0.0003 0.31 0.0000 1.16 0.1043 PCNX 3.66 0.0000 0.37 0.0002 1.34 0.1628 0.42 0.0001 1.53 0.0105 3632451O06RIK 3.51 0.0000 0.81 0.1094 2.83 0.0025 0.71 0.0015 2.51 0.0002 AMHR2 3.46 0.0000 0.45 0.0001 1.56 0.0037 0.52 0.0003 1.79 0.0016 SNX13 3.27 0.0000 0.47 0.0000 1.55 0.0007 0.44 0.0000 1.42 0.0003 ATP9A 3.26 0.0000 0.60 0.0001 1.96 0.0024 0.42 0.0002 1.38 0.2009 D030028O16RIK 3.22 0.0000 0.53 0.0011 1.70 0.0104 0.48 0.0001 1.56 0.0007 RPS6KA3 3.09 0.0000 0.38 0.0000 1.17 0.1845 0.44 0.0001 1.37 0.0321 GCA 3.00 0.0000 0.70 0.0031 2.09 0.0005 0.74 0.0103 2.22 0.0006 PACRG 2.89 0.0001 0.51 0.0002 1.46 0.0063 0.46 0.0001 1.34 0.0229 SPSB2 2.88 0.0001 0.33 0.0000 0.95 0.6599 0.37 0.0000 1.07 0.6216 POU4F1 2.83 0.0000 0.42 0.0000 1.19 0.2046 0.60 0.0007 1.68 0.0074 STRN4 2.72 0.0000 0.38 0.0000 1.03 0.8900 0.46 0.0000 1.25 0.2128 NCAM1 2.67 0.0001 0.70 0.0259 1.87 0.0135 0.54 0.0006 1.43 0.0343 A930018M24Rik 2.65 0.0001 0.58 0.0058 1.53 0.0727 0.43 0.0002 1.13 0.3919 TUBA4A 2.60 0.0000 0.42 0.0000 1.09 0.1806 0.50 0.0000 1.31 0.0041 1AP 2.57 0.0000 0.57 0.0002 1.46 0.0108 0.59 0.0016 1.52 0.0333 ANKRD40 2.56 0.0000 0.63 0.0155 1.60 0.0683 0.57 0.0002 1.46 0.0047 UVRAG 2.48 0.0000 0.59 0.0000 1.48 0.0005 0.52 0.0000 1.28 0.0165 HIST1H4H 2.46 0.0001 0.55 0.0001 1.34 0.0474 0.65 0.0014 1.60 0.0125 EPS15 2.44 0.0000 0.61 0.0001 1.50 0.0057 0.77 0.0043 1.87 0.0007 PANX1 2.41 0.0001 0.46 0.0004 1.11 0.4311 0.36 0.0000 0.87 0.0561 CALML4 2.41 0.0001 0.45 0.0008 1.10 0.6994 0.67 0.0154 1.62 0.0538 ASPH 2.40 0.0000 0.40 0.0000 0.95 0.6969 0.44 0.0000 1.05 0.7267 CREB3L2 2.37 0.0001 0.71 0.0287 1.67 0.0416 0.65 0.0051 1.54 0.0410 TRAF3 2.32 0.0001 0.50 0.0001 1.16 0.2851 0.57 0.0001 1.32 0.0481 CMYA1 2.30 0.0000 0.44 0.0007 1.02 0.9450 0.44 0.0000 1.01 0.9265 ADAMTSL5 2.30 0.0001 0.48 0.0000 1.11 0.3365 0.53 0.0004 1.22 0.1827 HS2ST1 2.27 0.0001 0.64 0.0002 1.44 0.0223 0.74 0.0041 1.68 0.0062 HIST1H4J 2.21 0.0000 0.59 0.0000 1.31 0.0283 0.72 0.0002 1.60 0.0023 SPSB1 2.20 0.0000 0.53 0.0005 1.16 0.2409 0.48 0.0000 1.05 0.3088 LANCL1 2.20 0.0000 0.63 0.0002 1.39 0.0002 0.66 0.0006 1.46 0.0005 KCNC4 2.16 0.0000 0.91 0.3892 1.96 0.0036 0.98 0.8712 2.12 0.0029 PRRC1 2.16 0.0000 0.57 0.0001 1.23 0.0324 0.59 0.0000 1.26 0.0070 MID1IP1 2.13 0.0001 1.27 0.0161 2.70 0.0001 1.09 0.4336 2.32 0.0014 DICER1 2.13 0.0000 0.65 0.0006 1.39 0.0051 0.69 0.0018 1.47 0.0035 IKBKB 2.10 0.0001 0.74 0.0240 1.56 0.0262 0.78 0.0039 1.64 0.0015 D5WSU178E 2.10 0.0000 0.86 0.1447 1.80 0.0049 0.88 0.0352 1.84 0.0002 ZFP106 2.08 0.0000 0.53 0.0000 1.11 0.1324 0.58 0.0002 1.20 0.0706 B930041F14RIK 2.06 0.0000 0.71 0.0002 1.47 0.0000 0.72 0.0030 1.49 0.0025 FHL1 2.04 0.0000 0.58 0.0000 1.17 0.1332 0.40 0.0000 0.81 0.0815 UHRF1BP1L 2.04 0.0001 0.78 0.0315 1.59 0.0071 0.68 0.0024 1.38 0.0151 PHCA 2.02 0.0000 0.64 0.0001 1.29 0.0354 0.74 0.0070 1.50 0.0145 B230312A22RIK 2.02 0.0000 0.79 0.0022 1.59 0.0004 0.77 0.0019 1.56 0.0007 PPP2R5C 2.01 0.0000 0.59 0.0001 1.16 0.0161 0.66 0.0017 1.32 0.0177 UCK2 2.01 0.0001 0.70 0.0004 1.41 0.0129 0.64 0.0001 1.28 0.0510 LEPROTL1 0.50 0.0000 1.45 0.0013 0.72 0.0004 1.47 0.0011 0.73 0.0005 COPS7A 0.49 0.0000 1.35 0.0645 0.66 0.0039 1.49 0.0026 0.73 0.0016 PRM17 0.48 0.0001 1.51 0.2023 0.73 0.1585 1.34 0.0445 0.65 0.0002 LDB3 0.47 0.0000 1.55 0.0550 0.73 0.0607 1.57 0.0010 0.74 0.0055 LOC100046120 0.47 0.0000 1.31 0.0077 0.61 0.0000 1.27 0.0381 0.60 0.0002 LOC677317 0.45 0.0001 1.49 0.0004 0.68 0.0012 1.93 0.0011 0.88 0.2082 LDB2 0.45 0.0000 1.73 0.0424 0.78 0.1234 1.23 0.0817 0.56 0.0000 SUM03 0.44 0.0000 1.70 0.0123 0.74 0.0223 1.37 0.0960 0.60 0.0023 LRRC24 0.43 0.0001 1.89 0.0009 0.82 0.0212 1.42 0.0898 0.61 0.0041 HNRPH1 0.42 0.0000 1.64 0.0077 0.69 0.0094 1.70 0.0057 0.71 0.0144 ARMETL1 0.38 0.0000 2.58 0.0000 0.98 0.7666 2.70 0.0000 1.02 0.7109 LOC100041504 0.37 0.0000 2.02 0.0001 0.75 0.0061 1.84 0.0040 0.68 0.0094 MMP9 0.32 0.0000 2.40 0.0006 0.77 0.0340 1.37 0.1834 0.44 0.0009 CBFB 0.28 0.0000 2.66 0.0304 0.75 0.1852 1.94 0.0056 0.55 0.0004 MDH2 0.24 0.0000 1.20 0.0473 0.29 0.0000 1.12 0.1037 0.27 0.0000 APCDD1 0.20 0.0000 1.98 0.2157 0.39 0.0059 4.55 0.0001 0.90 0.2873 LOC654842 0.19 0.0000 1.28 0.1712 0.24 0.0000 1.07 0.8807 0.20 0.0001 F2RL3 0.15 0.0000 5.78 0.0001 0.86 0.1901 4.92 0.0004 0.73 0.0310 EIF3H 0.13 0.0000 1.99 0.2185 0.26 0.0001 1.86 0.1997 0.24 0.0000 AVIL 0.12 0.0000 4.22 0.0156 0.52 0.0081 1.88 0.2270 0.23 0.0001 ACTC1 0.08 0.0000 1.42 0.0346 0.11 0.0000 6.07 0.0098 0.48 0.0087