GLUTAMATE DEHYDROGENASE MUTANT AND APPLICATION THEREOF

20200362317 ยท 2020-11-19

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention discloses a glutamate dehydrogenase mutant and an application thereof. The mutant is one of the following: a mutation of the 402th lysine of the amino acid sequence shown in SEQ ID NO. 1 to phenylalanine or aspartic acid; a mutation of the 406th isoleucine to phenylalanine or threonine; a combined mutation of the 121th threonine and the 123th leucine; a combined mutation of the 379th alanine and the 383th leucine. In the invention, the catalytic activity of glutamate dehydrogenase derived from Pseudomonas putida to 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid (PPO) is significantly improved by a molecular transformation method combining directed evolution and a semi-rational design; and the issue of low glutamate dehydrogenase activity in the process of preparing L-glufosinate by reductive amination is solved.

Claims

1. A glutamate dehydrogenase mutant, wherein the glutamate dehydrogenase mutant is one of the following: (1) a mutation of a 402th lysine of an amino acid sequence shown in SEQ ID NO. 1 to phenylalanine or aspartic acid; (2) a mutation of a 406th isoleucine of the amino acid sequence shown in SEQ ID NO. 1 to phenylalanine or threonine; (3) a mutation of a 121th threonine and a 123th leucine of the amino acid sequence shown in SEQ ID NO. 1 respectively to serine and histidine, or asparagine and tyrosine, or valine and tyrosine, or serine and serine, or asparagine and phenylalanine, or valine and phenylalanine, or isoleucine and tyrosine; (4) a mutation of a 379th alanine and a 383th leucine in the amino acid sequence shown in SEQ ID NO. 1 respectively to isoleucine and tyrosine, or isoleucine and cysteine, or serine and tyrosine, or valine and serine, or phenylalanine and cysteine, or tyrosine and cysteine, or cysteine and cysteine.

2. An encoding gene of the glutamate dehydrogenase mutant of claim 1.

3. An expression vector and an engineered bacteria comprising the encoding gene of the glutamate dehydrogenase mutant of claim 1.

4. An application of the glutamate dehydrogenase mutant of claim 1 for preparing L-glufosinate by catalyzing 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid or a salt thereof.

5. A method for preparing L-glufosinate by catalyzing 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid or a salt thereof, comprising: (1) preparing a genetically-engineered bacteria expressing a glutamate dehydrogenase mutant, wherein the glutamate dehydrogenase mutant is as described in claim 1; (2) culturing the genetically-engineered bacteria to prepare an enzyme solution; (3) adding the enzyme solution to a system containing a substrate 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid, an amino donor, and a reduced coenzyme and performing a reductive amination reaction to obtain L-glufosinate.

6. The method for preparing L-glufosinate by catalyzing 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid or a salt thereof of claim 5, wherein in step (3), a temperature of the reductive amination reaction is 15 C. to 50 C., and a pH of the reaction solution is 6 to 10.

7. The method for preparing L-glufosinate by catalyzing 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid or a salt thereof of claim 5, wherein in step (3), the reduced coenzyme is NADPH.

8. The method for preparing L-glufosinate by catalyzing 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid or a salt thereof of claim 5, wherein the reaction system of step (3) further comprises a coenzyme regeneration system; and the coenzyme regeneration system is a coenzyme regeneration system that uses glucose dehydrogenase as a coenzyme regenerating enzyme and glucose as a coenzyme regeneration substrate.

9. The method for preparing L-glufosinate by catalyzing 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid or a salt thereof of claim 8, wherein an amino acid sequence of the glucose dehydrogenase is shown in SEQ ID NO. 2.

10. The method for preparing L-glufosinate by catalyzing 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid or a salt thereof of claim 5, wherein in step (3), the amino donor is ammonium sulfate.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification. The drawings illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0033] FIG. 1 shows the results of measuring wild-type and mutant activities of PpGluDH in Example 1.

[0034] FIG. 2 is a mass spectrum of the starting material 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid (abbreviated as PPO).

[0035] FIG. 3 is a nuclear magnetic diagram of the starting material 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid (PPO).

[0036] In particular, A is a .sup.1H NMR spectrum of PPO; and B is a .sup.13C NMR spectrum of PPO.

[0037] FIG. 4 is a standard high-performance liquid detection spectrum of the substrate 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid (non-chiral analysis, 5 mM); wherein the retention time of the substrate PPO is 9.7 minutes.

[0038] FIG. 5 is an HPLC of the standard pre-column derivatization of racemic phosphinothricin (chiral analysis, 2 mM); wherein the retention time is 6.3 minutes for L-glufosinate and 7.2 minutes for D-glufosinate.

[0039] FIG. 6 is a pre-column derivatization high-performance liquid detection spectrum (chiral analysis) of the reaction solution (upon completion of the reaction) in Example 4.

DESCRIPTION OF THE EMBODIMENTS

[0040] The invention is further described below in conjunction with specific embodiments. It is to be understood that the following embodiments are merely illustrative of the invention and are not intended to limit the scope of the invention.

[0041] The experimental methods in the invention are conventional methods unless otherwise specified, and the specifics of gene cloning operation are as provided in Molecular Cloning Experiment Guide by J. Sambrook et al.

[0042] Reagents for upstream genetic engineering operations: DNA polymerase (EasyTaq DNA Polymerase) for error-prone PCR in Example 1 of the invention was purchased from Beijing TransGen Biotech; in Example 2 of the invention, DNA polymerase (PrimeSTAR Max DNA Polymerase) and Dpn I were purchased from TaKaRa (Dalian) Co., Ltd.; ClonExpress II One Step Cloning Kit was purchased from Nanjing Vazyme Biotech Co., Ltd.; the plasmid extraction kit was purchased from Axygen Hangzhou Co., Ltd.; E. coli BL21 (DE3), plasmid, etc. were purchased from Novagen; and primer synthesis and gene sequencing were completed by Hangzhou TsingKe Biological technology Co., Ltd. Refer to the product manual for the use of the above reagents.

[0043] The recombinant E. coli carrying the glutamate dehydrogenase gene of the invention is constructed and deposited by our laboratory. The vector used was pET-28a(+) and the host used was E. coli BL21 (DE3).

[0044] The reagent used in the downstream catalytic process: 2-carbonyl-4-(hydroxymethylphosphonoyl)butanoic acid (abbreviated as PPO) was artificially synthesized, and the mass spectrum and nuclear magnetic diagram thereof are shown in FIGS. 2 and 3; DL-glufosinate standard was purchased from Sigma-Aldrich; NADP.sup.+ and NADPH were purchased from Bontac-Bio-Engineering (Shenzhen) Co., Ltd.; other commonly used reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. The three-letter or one-letter expression of the amino acids used in the specification of the present application adopted the amino acid code specified by IUPAC (Eur. J. Biochem., 138:9-37,1984).

[0045] Glutamate dehydrogenase enzyme standard assay system: appropriate amount of enzyme solution, 100 mM substrate, 10 mM NADPH, 500 mM NH.sub.4.sup.+ ((NH.sub.4).sub.2SO.sub.4), total system was 400 L, reaction medium was pH 7.5 0.1 M phosphoric acid salt buffer. The reaction was performed at 35 C. for 10 minutes, and the reaction was ended by the addition of 40 uL of 5 M NaOH. The L-glufosinate concentration produced in the sample was quantified by pre-column derivatization HPLC.

[0046] Definition of enzyme unit (U): the amount of enzyme required to produce 1 mol of L-glufosinate per minute under standard reaction conditions.

[0047] In the invention, the progress of the reaction was monitored by analyzing the concentration of the substrate in the reaction solution by high-performance liquid chromatography (HPLC). HPLC analysis method: column model: Pntulips QS-C18, 5 m, 4.6 mm250 mm. Mobile phase: 50 mM (NH.sub.4).sub.2HPO.sub.4, 1% of 10% tetrabutylammonium hydroxide aqueous solution was added, pH was adjusted to 3.6 with 50% phosphoric acid (mass fraction), and 8% acetonitrile was added. Detection wavelength: 205 nm. Flow rate: 1.0 mL/min. Column temperature: 40 C. See FIG. 4 for the peak of the substrate.

[0048] The chiral analysis and concentration analysis of L-glufosinate were performed by pre-column derivatization HPLC. The specific analysis method was:

[0049] (1) Chromatographic conditions: column model: Pntulips QS-C18, 5 m, 4.6 mm250 mm. Mobile phase: 50 mM sodium acetate solution: acetonitrile=8:0.5. Detection wavelength: 338 nm. Flow rate: 0.85 mL/min. Column temperature: 30 C.

[0050] (2) Derivatization reagent: 0.03 g of o-phthalaldehyde and 0.1 g of

[0051] N-acetam-L-cysteine were weighed separately, solubilized with 400 uL of ethanol, and then 4 mL of 0.2 mol/L boric acid buffer (pH 9.8) was added, then oscillated for complete dissolution, and then stored in a refrigerator at 4 C. as reserve (for no more than 4 days).

[0052] (3) Derivatization reaction and determination: 100 L of sample was added to 150 L of derivatization reagent, mixed and kept at 25 C. for 5 minutes. 1 mL of pure water was added for dilution, filmed, and 20 uL was sampled for analysis.

[0053] The peak of D-glufosinate and L-glufosinate is shown in FIG. 5.

EXAMPLE 1

Pseudomonas putida-Derived GlutamateDdehydrogenase (PpGluDH) Directed Evolution Based on Error-Prone PCR

[0054] Step 1: Activation of PpGluDH Recombinant Strain and Plasmid Extraction

[0055] E. coli-engineered bacteria carrying pET-28a(+)-PpGluDH recombinant plasmid were activated and cultured using LB medium.

[0056] The specific formula of LB was is: peptone 10 g/L, yeast powder 5 g/L, NaCl 10 g/L, dissolved in deionized water then kept at constant volume, sterilized at 121 C. for 20 minutes, and kept ready for use. The solid medium was LB medium supplemented with 2% agar.

[0057] A glycerol tube containing a PpGluDH recombinant strain was streaked onto a dish containing LB solid medium (50 g/mL kanamycin), and cultured in static at 37 C. for 12 hours. A single colony was picked from the dish and placed in 5 mL of LB medium containing 50 g/mL kanamycin, and cultured at 37 C., 200 rpm for 12 hours. After the culture solution was obtained, the plasmid was extracted according to the instruction manual of the plasmid extraction kit.

[0058] Step 2: Construction of Random Mutation Library

[0059] The pET-28a(+)-PpGluDH plasmid extracted in step 1 was used as a template, and a random mutation was introduced into the PpGluDH gene by error-prone PCR. The primers and PCR reaction systems used are shown in Table 1 and Table 2, respectively.

TABLE-US-00001 TABLE1 Primersforerror-pronePCR Primer Sequence(5to3).sup.a PpGluDH-F CGCGGATCCATGTCTACCATGATCGAATCTG (BamHI) PpGluDH-R CCCAAGCTTTCAGACCACGCCCTGAGCCA (HindIII) Note: .sup.arestriction endonuclease sites were respectively added to the upstream and downstream primers, as shown by the underline, and the specific restriction endonuclease is shown in the parentheses in the primer sequence.

TABLE-US-00002 TABLE 2 PCR amplification system Component Volume (uL) EasyTaq DNA Polymerase 1 PpGluDH-F (10 uM) 1.5 PpGluDH-R (10 uM) 1.5 10 EasyTaq buffer 5 dNTPs (2.5 mM) 4 Plasmid template 1 Mn.sup.2+ solution (5 mM) 8 ddH.sub.2O 28

[0060] Error-prone PCR amplification conditions: [0061] 1) pre-denaturation at 94 C. for 3 minutes; [0062] 2) denaturation at 94 C. for 30 seconds, annealing at 58 C. for 30 seconds, extension at 72 C. for 2 minutes (cycle 35 times in this phase); [0063] 3) post-extension at 72 C. for 8 minutes; [0064] 4) storage at 4 C.

[0065] After the end of PCR amplification, the amplified product was detected by 1.0% agarose gel electrophoresis, and the target band was purified and recovered by a DNA recovery and purification kit. The recovered PCR amplified product and the expression vector pET-28a(+) were respectively double digested with the corresponding restriction endonucleases at 37 C. for 3 hours. The enzyme digestion system is shown in the following table:

TABLE-US-00003 TABLE 3 Enzyme digestion system Reagent Volume (L) PCR amplification product/plasmid 15 BamHI 2 HindIII 2 dd H.sub.2O 17 10 Buffer 4

[0066] After the enzyme digestion, the digested product was purified and recovered by using a DNA purification kit. The digested PCR amplified product was ligated to the expression vector pET-28a(+) with the corresponding nick using T4 DNA ligase, and the ligation system is shown in the following table:

TABLE-US-00004 TABLE 4 Enzyme system Reagent Volume (L) PCR amplification product 10 Vector 7 T4 ligase 1 10 ligase buffer 2

[0067] The enzyme-linked product was transformed into E. coli BL21 (DE3) competent cells, plated, and placed in an inverted culture at 37 C. until a single colony of appropriate size was grown.

[0068] Step 3: High-Throughput Screening of Random Mutation Libraries-Primary Screening

[0069] 200 L of LB medium (50 g/mL kanamycin) was added to a sterilized 96-deep well plate and a single colony was picked to the 96-deep well plate using a sterile tip. The deep well plate was then placed at 37 C. and cultured at 200 rpm for 8 hours and referred to as the primary plate. 400 L of LB medium (50 g/mL kanamycin) was added to an additional sterilized 96-well plate as a secondary plate. 50 L of the bacterial solution was pipetted into the secondary plate in the primary plate, and 20% glycerin was added to the primary plate and placed in a refrigerator at 80 C. for long-term storage. The secondary plate was then oscillated and cultured at 37 C. for 3 hours, induced by IPTG at a final concentration of 0.5 mM, and then the secondary plate was placed at 18 C. and cultured at 200 rpm for 18 hours.

[0070] The secondary plate was centrifuged at 4000 rpm at 4 C. for 20 minutes to collect the bacteria, and then frozen at 80 C. for 3 hours or more. The secondary plate was removed from 80 C. and allowed to thaw at room temperature for 0.5 hours. Then, 300 L of lysate (10 mM pH 7.5 phosphate buffer, 750 mg/L lysozyme, 10 mg/L DNase I) was added to each well, and the cells were suspended by oscillation and placed in a shaker at 37 C. and incubated at 200 rpm for 1 hour. After the incubation, the cells were centrifuged at 4000 rpm at 4 C. for 20 minutes, and the supernatant was taken for enzyme activity measurement.

[0071] An assay mixture for screening was prepared: pH 7.5 phosphate buffer (0.1 M), 2 mM NADPH, 20 mM substrate PPO, 1 M NH.sub.4.sup.+. 200 L of the assay mixture was added to each well of a fresh 96-well plate (reaction plate) and kept at 37 C. for 15 minutes. 200 L of enzyme solution was pipetted into the reaction plate to start the reaction. 100 uL was sampled at 20 minutes, 40 minutes, and 60 minutes, respectively and added to an enzyme plate pre-charged with 100 uL of pH 7.5 phosphate buffer (0.1 M), and the absorbance at 340 nm was measured using a microplate reader. The lower the absorbance, the higher the catalytic activity, and the selection of a mutant strain with an absorbance significantly lower than that of the control (wild-type) was used as a candidate strain for rescreening.

[0072] Step 4: Rescreening

[0073] The mutants exhibiting a significant increase in enzyme activity in the primary screening were subjected to rescreening by HPLC. After the corresponding mutant strains on the primary plate were activated by dish scribing, a single colony was inoculated into 5 mL LB liquid medium containing 50 g/mL kanamycin and oscillated and cultured at 37 C. for 12 hours.

[0074] 2% of the inoculum was transferred to 50 mL of LB liquid medium also containing 50 g/mL kanamycin, and when OD.sub.600 reached around 0.6 to 0.8 by oscillation and culturing at 37 C., IPTG was added to reach a final concentration of 0.5 mM, and then the inoculum was inductively cultured at 18 C. for 16 hours. After the completion of the culture, 12,000 g of the culture solution was centrifuged at 4 C. for 10 minutes, and the supernatant was discarded to collect the bacteria. The bacteria collected after the completion of the culture were washed twice with 50 mM of pH 7.5 phosphate buffer, resuspended in the pH 7.5 phosphate buffer, and ultrasonically disrupted 30 times at 400 W, with each ultrasound lasting 3 seconds and pausing 7 seconds. The cell-disrupted solution was centrifuged at 12,000 g at 4 C. for 10 minutes to remove the precipitate, and the obtained supernatant was a crude enzyme solution.

[0075] The crude enzyme activity of PPO was determined for each mutant strain according to the standard enzyme activity assay system. Lastly, 13 mutants with significantly improved enzyme activity were obtained, containing 8 single-point mutant strains, 4 two-point mutant strains, and 1 three-point mutant strain. The enzyme activity of the unit volume fermentation broth was 0.167 U/mL to 0.897 U/mL, which was 1.5 to 8.2 times that of the original glutamate dehydrogenase. See FIG. 1 for details. Mutations in the two-point and three-point mutant strains that were positively mutated were analyzed by reverse mutation, and the positive mutations in these mutant strains were determined to be the three mutations of V29A, L354P, and I406T. A summary of the positive mutations obtained by directed evolution of PpGluDH is shown in Table 5.

TABLE-US-00005 TABLE5 Summaryofpositivemutationsobtainedby directedevolution Amino Codon acid mutation mutation (before (before Mutant mutation mutation strain Enzyme .fwdarw. .fwdarw. enzyme activity after after activity increase Site mutation) mutation) (U/mL) factor.sup.a) 29 GTG.fwdarw.GCA Val.fwdarw.Ala 0.2520.013 2.3 81 TAC.fwdarw.TGC Tyr.fwdarw.Cys 0.1880.004 1.7 194 GTG.fwdarw.GCG Val.fwdarw.Ala 0.1670.006 1.5 352 ACT.fwdarw.GCT Thr.fwdarw.Ala 0.2550.009 2.3 354 GTC.fwdarw.CCC Leu.fwdarw.Pro 0.3150.011 2.9 380 GTG.fwdarw.GGG Val.fwdarw.Gly 0.3030.018 2.8 390 ATG.fwdarw.TTG Met.fwdarw.Leu 0.2260.021 2.1 400 GAC.fwdarw.GGC Asp.fwdarw.Gly 0.2300.015 2.1 406 ATC.fwdarw.ACC lie.fwdarw.Thr 0.6130.019 5.6 406 ATC.fwdarw.TTC lie.fwdarw.Phe 0.8970.026 8.2 411 CAC.fwdarw.TAC His.fwdarw.Tyr 0.2230.102 2.0 Note: .sup.a)fold-increase in the enzyme activity of the mutant strain relative to the PpGluDH wild-type (0.11 U/mL)

EXAMPLE 2

Construction and Screening of Focus Saturated Mutation Library

[0076] The results of Example 1 were analyzed to perform saturated mutation on the 121th, 123th, 379th, 383th, and 402th amino acid residues of PpGluDH. Primers (Table 6) were designed, and pET-28a(+)-PpGluDH plasmid was used as a template and K402X-F, T121X/L123X-F, or A379X/L383X-F and Aid-R were used as primer pairs to obtain linearized short fragments, and then PCR was performed using K402X-R, T121X/L123X-R, or A379X/L383X-R and Aid-F as primer pairs to obtain linearized long fragments. The user manual of ClonExpress II One Step Cloning Kit was used for subsequent Dpn I digestion, gel recovery, recombination, and transformation operations to construct the three mutation libraries of a 402nd saturated mutation library (K402X), a 121st and 123rd combined mutation library (T121X/L123X), and a 379th and 383rd combined mutation library (A379X/L383X).

TABLE-US-00006 TABLE6 Primersusedtoconstructafocused saturatedmutationlibrary Primer Sequence(5to3) K402X-F TGGACAGCNNKCTGCACAACA TCATGCAGTC K402X-R TTGTGCAGMNNGCTGTCCACT TCACCGGCCG T121X/L123X-F TCGCTGNDTTCGNDTCCCATG GGCGGCGGCAAGGG T121X/L123X-R CATGGGAHNCGAAHNCAGCGA GTTCTTGAACACCT A379X/L383X-F GGCGTANDTGTGTCGGGCNDT GAAATGTCGCAGAACGCCAT A379X/L383X-R CATTTCAHNGCCCGACACAHN TACGCCGCCCGCATTGGAGG Aid-F TGAGATCCGGCTGCTAACAAA Aid-R TTTGTTAGCAGCCGGATCTCA

[0077] The three mutation libraries were pre-screened by the high-throughput screening method described in Example 1, and then subjected to rescreening by HPLC. Lastly, two mutant strains with significant increase in PPO enzyme activity were obtained from the 402nd saturated mutation library (K402X): K402F and K402D; seven mutant strains with significant increase in PPO enzyme activity were screened from the 121st and 123rd combined mutation library (T121X/L123X): T121S/L123H, T121N/L123Y, T121V/L123Y, T121S/L123S, T121N/L123F, T121V/L123F, T121I/L123Y; and seven mutant strains with significant increase in PPO enzyme activity were screened from the 379th and 383rd combined mutation library (A379X/L383X): A379I/L383Y, A379I/L383C, A379S/L383Y, A379V/L3835, A379F/L383C,

[0078] A379Y/L383C, A379C/L383C. The specific mutations and changes in enzyme activity are shown in Table 7.

TABLE-US-00007 TABLE 7 Screening results of mutation library Mutant strain Enzyme enzyme activity Mutation Raw amino Mutated amino activity increase library Site acid acid (U/mL) factor.sup.a) K402X 402 Lys Phe; 0.42 0.03 3.8 Asp 0.21 0.01 1.9 T121X/L123X 121/123 Thr/Leu Ser/His 5.42 0.26 49.3 Asn/Tyr 11.21 0.57 102 Val/Tyr 3.71 0.50 33.7 Ser/Ser 2.79 0.09 25.4 Asn/Phe 2.59 0.19 23.5 Val/Phe 2.02 0.16 18.4 Ile/Tyr 2.00 0.23 18.2 A379X/L383X 379/383 Ala/Leu Ile/Tyr 1.01 0.02 9.2 Ile/Cys 2.11 0.05 19.2 Ser/Tyr 0.61 0.04 5.5 Val/Ser 1.63 0.01 14.8 Phe/Cys 1.94 0.10 17.6 Tyr/Cys 1.52 0.07 13.8 Cys/Cys 2.25 0.10 20.5 Note: .sup.a)fold-increase in the enzyme activity of the mutant strain relative to the PpGluDH wild-type (0.11 U/mL)

EXAMPLE 3

Preparation of L-Glufosinate by Glutamic Acid Dehydrogenase Wild-Type (PpGluDH) and Glucose Dehydrogenase Double Enzyme Coupling

[0079] Culture of bacteria and preparation of crude enzyme solution: glycerol tubes of engineered bacteria harboring wild-type PpGluDH and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 2) were activated by dish scribing, and then a single colony was inoculated in 50 mL LB liquid medium containing 50 g/mL kanamycin and oscillated and cultured at 37 C. for 12 hours. 2% of the inoculum was transferred to 1 L of fresh LB liquid medium also containing 50 g/mL kanamycin, and when OD.sub.600 reached around 0.6 by oscillation and culturing at 37 C., IPTG was added to reach a final concentration of 0.5 mM, and then the inoculum was inductively cultured at 18 C. for 16 hours. After the completion of the culture, the culture solution was centrifuged at 12000 g at 4 C. for 10 minutes, the bacteria was collected, and a crude enzyme solution was prepared by ultrasonic disruption.

[0080] The reaction system was 30 mL containing 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4, and 0.5 mM NADP.sup.+. The concentration of glutamate dehydrogenase (dry weight) was 1.25 g/L, and the concentration of glucose dehydrogenase (dry weight) was 1.25 g/L. The reaction temperature was controlled at 35 C. by a water bath, and the pH was controlled at 7.5 by dropwise addition of aqueous ammonia. After 12 hours of reaction, the residual concentration of PPO was detected by achiral HPLC, and the amount of L-glufosinate produced and the ee value thereof were determined by pre-column derivatization HPLC.

[0081] The reaction end data is as follows: PPO had 373 mM remaining, and the conversion rate was 25.4%. The production concentration of L-glufosinate was 20.5 g/L, and the ee value >99%.

EXAMPLE 4

Glutamate Dehydrogenase Mutant Strain (PpGluDH-T121N/L123Y), Glucose Dehydrogenase Double Enzyme Coupling for Preparation of L-Glufosinate

[0082] An engineered bacteria expressing glutamate dehydrogenase (PpGluDH-T121N/L123Y) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 2) was cultured in the same manner as in Example 3, and the cells were collected by centrifugation and disrupted by ultrasound to prepare a crude enzyme solution.

[0083] The reaction system was 30 mL containing 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4, and 0.5 mM NADP.sup.+. The concentration of glutamate dehydrogenase (dry weight) was 1.25 g/L, and the concentration of glucose dehydrogenase (dry weight) was 1.25 g/L. The reaction temperature was controlled at 35 C. by a water bath, and the pH was controlled at 7.5 by dropwise addition of aqueous ammonia. After 2.5 hours of reaction, the residual concentration of PPO was detected by achiral HPLC, and the amount of L-glufosinate produced and the ee value thereof were determined by pre-column derivatization HPLC.

[0084] The reaction end data is as follows: PPO had 2.4 mM remaining, and the conversion rate was 99.5%. The production concentration of L-glufosinate was 80.6 g/L, and the ee value >99% (FIG. 6).

EXAMPLE 5

Glutamate Dehydrogenase Mutant Strain (PpG1uDH-A379C/L383C), Glucose Dehydrogenase Double Enzyme Coupling for Preparation of L-Glufosinate

[0085] An engineered bacteria expressing glutamate dehydrogenase (PpGluDH-A379C/L383C) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 2) was cultured in the same manner as in Example 3, and the cells were collected by centrifugation and disrupted by ultrasound to prepare a crude enzyme solution.

[0086] The reaction system was 30 mL containing 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4, and 0.5 mM NADP.sup.+. The concentration of glutamate dehydrogenase (dry weight) was 1.25 g/L, and the concentration of glucose dehydrogenase (dry weight) was 1.25 g/L. The reaction temperature was controlled at 35 C. by a water bath, and the pH was controlled at 7.5 by dropwise addition of aqueous ammonia. After 5 hours of reaction, the residual concentration of PPO was detected by achiral HPLC, and the amount of L-glufosinate produced and the ee value thereof were determined by pre-column derivatization HPLC.

[0087] The reaction end data is as follows: PPO had 3.4 mM remaining, and the conversion rate was 99.3%. The production concentration of L-glufosinate was 79.4 g/L, and the ee value >99%.

EXAMPLE 6

Glutamate Dehydrogenase Mutant Strain (PpGluDH-I406F), Glucose Dehydrogenase Double Enzyme Coupling for Preparation of L-Glufosinate

[0088] An engineered bacteria expressing glutamate dehydrogenase (PpGluDH-I406F) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 2) was cultured in the same manner as in Example 3, and the cells were collected by centrifugation and disrupted by ultrasound to prepare a crude enzyme solution.

[0089] The reaction system was 30 mL containing 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4, and 0.5 mM NADP.sup.+. The concentration of glutamate dehydrogenase (dry weight) was 1.25 g/L, and the concentration of glucose dehydrogenase (dry weight) was 1.25 g/L. The reaction temperature was controlled at 35 C. by a water bath, and the pH was controlled at 7.5 by dropwise addition of aqueous ammonia. After 10 hours of reaction, the residual concentration of PPO was detected by achiral HPLC, and the amount of L-glufosinate produced and the ee value thereof were determined by pre-column derivatization HPLC.

[0090] The reaction end data is as follows: PPO had 4.6 mM remaining, and the conversion rate was 99.1%. The production concentration of L-glufosinate was 78.7 g/L, and the ee value >99%.

EXAMPLE 7

Glutamate Dehydrogenase Mutant Strain (PpGluDH-K402F), Glucose Dehydrogenase Double Enzyme Coupling for Preparation of L-Glufosinate

[0091] An engineered bacteria expressing glutamate dehydrogenase (PpGluDH-K402F) and glucose dehydrogenase (BsGDH-2M, SEQ ID NO. 2) was cultured in the same manner as in Example 3, and the cells were collected by centrifugation and disrupted by ultrasound to prepare a crude enzyme solution.

[0092] The reaction system was 30 mL containing 500 mM substrate PPO, 600 mM glucose, 250 mM (NH.sub.4).sub.2SO.sub.4, and 0.5 mM NADP.sup.+. The concentration of glutamate dehydrogenase (dry weight) was 1.25 g/L, and the concentration of glucose dehydrogenase (dry weight) was 1.25 g/L. The reaction temperature was controlled at 35 C. by a water bath, and the pH was controlled at 7.5 by dropwise addition of aqueous ammonia. After 12 hours of reaction, the residual concentration of PPO was detected by achiral HPLC, and the amount of L-glufosinate produced and the ee value thereof were determined by pre-column derivatization HPLC.

[0093] The reaction end data is as follows: PPO had 37.6 mM remaining, and the conversion rate was 92.5%. The production concentration of L-glufosinate was 72.8 g/L, and the ee value >99%.