MAINTENANCE-AND-AMPLIFICATION METHOD AND DIFFERENTIATION INDUCTION METHOD FOR PRIMORDIAL GERM CELLS/PRIMORDIAL GERM CELL-LIKE CELLS
20200362303 ยท 2020-11-19
Assignee
Inventors
Cpc classification
C12N2501/385
CHEMISTRY; METALLURGY
C12N2501/04
CHEMISTRY; METALLURGY
C12N5/0611
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a method for expanding PGC/PGCLC, including culturing PGC/PGCLC in the presence of a phosphodiesterase 4 (PDE4) inhibitor and/or cyclosporine A, further in the presence of forskolin, and a method for inducing oocytes from PGC/PGCLC, including culturing PGC/PGCLC in the presence of bone forming protein (BMP) and retinoic acid (RA).
Claims
1. A method for expanding a primordial germ cell (PGC) or isolated pluripotent stem cell-derived primordial germ cell-like cell (PGCLC), comprising culturing PGC or PGCLC in the presence of a phosphodiesterase 4 (PDE4) inhibitor and/or cyclosporine A.
2. The method according to claim 1, wherein the PGC or PGCLC is cultured under a condition further comprising forskolin.
3. A reagent for expanding PGC or PGCLC, comprising a PDE4 inhibitor and cyclosporine A.
4. The reagent according to claim 3 comprising forskolin in combination.
5. A method for inducing oocyte from PGC or PGCLC, comprising culturing PGC or PGCLC in the presence of a bone morphogenetic protein (BMP) and retinoic acid (RA).
6. The method according to claim 5, wherein the BMP is one or more selected from BMP2, BMP5 and BMP7.
7-8. (canceled)
9. A method for inducing oocyte from PGC or PGCLC, comprising (a) expanding PGC or PGCLC by the method according to claim 1, and (b) culturing the PGC or PGCLC obtained in step (a) in the presence of BMP and RA culturing in the presence of BMP and RA.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
DESCRIPTION OF EMBODIMENTS
[I] Expansion Method of PGC/PGCLC
[0037] The present invention provides an expansion method of PGC or isolated PSC-derived PGCLC in vitro (sometimes to be abbreviated as method (I) of the present invention). The method is characterized by culturing PGC or PGCLC in the presence of a PDE4 inhibitor and/or cyclosporine A.
1. Production of PGC/PGCLC
1-1. Production of PGC
[0038] PGC to be used in the present invention in the case of a mouse can be isolated, for example, from embryos of embryonic day (E) 9.5 to 11.5 by FACS or the like using the expression of a PGC-specific marker (e.g., Blimp1, Stella, etc.) as an index. The method is not limited thereto and can also be isolated by any method known per se in the art. Alternatively, PGC similarly isolated from earlier mouse embryos can be used by culturing up to the stage corresponding to mobile PGC by the method described in the following 1-2. Mammals other than mice can also be prepared in the same manner from embryos of gestational age corresponding to the gestational age of the above-mentioned mice. In the present specification, unless otherwise specified, the stages of PGC are shown below by the gestational age of the mouse embryo. In other mammals, it should be understood as the gestational age corresponding to the gestational age of the mouse embryo. Such conversion is well known in the art.
1-2. Production of PGCLC from PSC
[0039] PGCLC for use in the present invention may be any as long as it is derived in vitro from isolated PSC and has properties equivalent to those of PGC. For example, PGCLCs described in the aforementioned patent document 1 and non-patent document 1 can be mentioned. The PGCLC can be produced from isolated PSC 1 by the method shown below and via epiblast-like cells (EpiLC).
[0040] PSC for use as the starting material of PGCLC production may be any as long as it is an isolated undifferentiated cell possessing a self-renewal that enables it to proliferate while retaining the undifferentiated state, and pluripotency that enables it to differentiate into all the three primary germ layers of the embryo. As used herein, isolated means being placed in a living body (in vivo) or outside a living body (in vitro), and does not necessarily mean being purified. Examples of the isolated PSC include iPS cells, ES cells, embryonic germ (EG) cells, embryonic cancer (EC) cells and the like, with preference given to iPS cells or ES cells.
[0041] The method (I) of the present invention can be applied to any mammalian species in which any PSC has been or can be established. Examples of such mammals include humans, mice, rats, monkeys, dogs, pigs, bovines, cats, goat, sheep, rabbits, guinea pigs, hamsters and the like, with preference given to humans, mice, rats, monkeys, dogs and the like, more preferably humans or mice.
(1) Preparation of Pluripotent Stem Cells
(i) ES Cells
[0042] Pluripotent stem cells can be acquired by methods known per se. For example, available methods of preparing ES cells include, but are not limited to, methods in which a mammalian inner cell mass in the blastocyst stage is cultured [see, for example, Manipulating the Mouse Embryo: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1994)] and methods in which an early embryo prepared by somatic cell nuclear transfer is cultured [Wilmut et al., Nature, 385, 810 (1997); Cibelli et al., Science, 280, 1256 (1998); Iritani et al., Protein, Nucleic Acid and Enzyme, 44, 892 (1999); Baguisi et al., Nature Biotechnology, 17, 456 (1999); Wakayama et al., Nature, 394, 369 (1998); Wakayama et al., Nature Genetics, 22, 127 (1999); Wakayama et al., Proc. Natl. Acad. Sci. USA, 96, 14984 (1999); RideoutIII et al., Nature Genetics, 24, 109 (2000)]. Also, ES cells can be obtained from various public and private depositories and are commercially available. For example, human ES cell lines H1 and H9 can be obtained from WiCell Institute of University of Wisconsin and KhES-1, -2 and -3 can be obtained from Institute for Frontier Medical Sciences, Kyoto University. When ES cells are produced by somatic cell nuclear transfer, the kinds and sources of somatic cells are the same as those used for producing iPS cells mentioned below.
(ii) iPS Cells
[0043] An iPS cell can be prepared by transferring a nuclear reprogramming substance to a somatic cell.
(a) Sources of Somatic Cells
[0044] Any cells other than germ cells of mammalian origin (e.g., mice, humans) can be used as starting material for the production of iPS cells. Examples include keratinizing epithelial cells (e.g., keratinized epidermal cells), mucosal epithelial cells (e.g., epithelial cells of the superficial layer of tongue), exocrine gland epithelial cells (e.g., mammary gland cells), hormone-secreting cells (e.g., adrenomedullary cells), cells for metabolism or storage (e.g., liver cells), intimal epithelial cells constituting interfaces (e.g., type I alveolar cells), intimal epithelial cells of the obturator canal (e.g., vascular endothelial cells), cells having cilia with transporting capability (e.g., airway epithelial cells), cells for extracellular matrix secretion (e.g., fibroblasts), constrictive cells (e.g., smooth muscle cells), cells of the blood and the immune system (e.g., T lymphocytes), sense-related cells (e.g., bacillary cells), autonomic nervous system neurons (e.g., cholinergic neurons), sustentacular cells of sensory organs and peripheral neurons (e.g., satellite cells), nerve cells and glia cells of the central nervous system (e.g., astroglia cells), pigment cells (e.g., retinal pigment epithelial cells), progenitor cells thereof (tissue progenitor cells) and the like. There is no limitation on the degree of cell differentiation; even undifferentiated progenitor cells (including somatic stem cells) and finally differentiated mature cells can be used alike as sources of somatic cells in the present invention. Examples of undifferentiated progenitor cells include tissue stem cells (somatic stem cells) such as adipose-derived stromal (stem) cells, nerve stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells.
[0045] The choice of mammal individual as a source of somatic cells is not particularly limited; however, when the GSCLC cells as a final product are to be used for the treatment of diseases such as infertility in humans, it is preferable, from the viewpoint of prevention of graft rejection and/or GvHD, that somatic cells are patient's own cells or collected from another person having the same or substantially the same HLA type as that of the patient. Substantially the same HLA type as used herein means that the HLA type of donor matches with that of patient to the extent that the transplanted cells, which have been obtained by inducing differentiation of iPS cells derived from the donor's somatic cells, can be engrafted when they are transplanted to the patient with use of immunosuppressor and the like. For example, it includes an HLA type wherein major HLAs (the three major loci of HLA-A, HLA-B and HLA-DR or four loci further including HLA-Cw) are identical (hereinafter the same meaning shall apply) and the like. When the PGC-like cells are not to be administered (transplanted) to a human, but used as, for example, a source of cells for screening for evaluating a patient's drug susceptibility or adverse reactions, it is likewise necessary to collect the somatic cells from the patient or another person with the same genetic polymorphism correlating with the drug susceptibility or adverse reactions.
[0046] Somatic cells separated from a mammal can be pre-cultured using a medium known per se suitable for the cultivation thereof, depending on the kind of the cells. Examples of such media include, but are not limited to, a minimal essential medium (MEM) containing about 5 to 20% fetal calf serum, Dulbecco's modified Eagle medium (DMEM), RPMI1640 medium, 199 medium, F12 medium, and the like. When using, for example, a transfection reagent such as a cationic liposome in contacting the cell with nuclear reprogramming substance (s) and iPS cell establishment efficiency improver(s), it is sometimes preferable that the medium be previously replaced with a serum-free medium to prevent a reduction in the transfer efficiency.
(b) Nuclear Reprogramming Substances
[0047] In the present invention, a nuclear reprogramming substance refers to any substance(s) capable of inducing an iPS cell from a somatic cell, which may be composed of any substance such as a proteinous factor or a nucleic acid that encodes the same (including forms incorporated in a vector), or a low-molecular compound. When the nuclear reprogramming substance is a proteinous factor or a nucleic acid that encodes the same, the following combinations, for example, are preferable (hereinafter, only the names for proteinous factors are shown).
(1) Oct3/4, Klf4, c-Myc
(2) Oct3/4, Klf4, c-Myc, Sox2 (Sox2 is replaceable with Sox1, Sox3, Sox15, Sox17 or Sox18; Klf4 is replaceable with Klf1, Klf2 or Klf5; c-Myc is replaceable with T58A (active mutant), N-Myc, or L-Myc)
(3) Oct3/4, Klf4, c-Myc, Sox2, Fbx15, Nanog, Eras, ECAT15-2, TclI, -catenin (active mutant S33Y)
(4) Oct3/4, Klf4, c-Myc, Sox2, TERT, SV40 Large T antigen (hereinafter SV40LT)
(5) Oct3/4, Klf4, c-Myc, Sox2, TERT, HPV16 E6
(6) Oct3/4, Klf4, c-Myc, Sox2, TERT, HPV16 E7
(7) Oct3/4, Klf4, c-Myc, Sox2, TERT, HPV6 E6, HPV16 E7
(8) Oct3/4, Klf4, c-Myc, Sox2, TERT, Bmil
[For more information on the factors shown above, see WO 2007/069666 (for information on replacement of Sox2 with Sox18 and replacement of Klf4 with Klf1 or Klf5 in the combination (2) above, see Nature Biotechnology, 26, 101-106 (2008)); for the combination Oct3/4, Klf4, c-Myc, Sox2, see also Cell, 126, 663-676 (2006), Cell, 131, 861-872 (2007) and the like; for the combination Oct3/4, Klf2 (or Klf5), c-Myc, Sox2, see also Nat. Cell Biol., 11, 197-203 (2009); for the combination Oct3/4, Klf4, c-Myc, Sox2, hTERT, SV40 LT, see also Nature, 451, 141-146 (2008).]
(9) Oct3/4, Klf4, Sox2 (see Nature Biotechnology, 26, 101-106 (2008))
(10) Oct3/4, Sox2, Nanog, Lin28 (see Science, 318, 1917-1920 (2007))
[0048] (11) Oct3/4, Sox2, Nanog, Lin28, hTERT, SV40LT (see Stem Cells, 26, 1998-2005 (2008))
(12) Oct3/4, Klf4, c-Myc, Sox2, Nanog, Lin28 (see Cell Research (2008) 600-603)
(13) Oct3/4, Klf4, c-Myc, Sox2, SV40LT (see also Stem Cells, 26, 1998-2005 (2008))
(14) Oct3/4, Klf4 (see Nature 454:646-650 (2008), Cell Stem Cell, 2:525-528 (2008))
[0049] (15) Oct3/4, c-Myc (see Nature 454:646-650 (2008))
(16) Oct3/4, Sox2 (see Nature, 451, 141-146 (2008), WO2008/118820)
(17) Oct3/4, Sox2, Nanog (see WO2008/118820)
(18) Oct3/4, Sox2, Lin28 (see WO2008/118820)
[0050] (19) Oct3/4, Sox2, c-Myc, Esrrb (Here, Essrrb can be substituted by Esrrg, see Nat. Cell Biol., 11, 197-203 (2009))
(20) Oct3/4, Sox2, Esrrb (see Nat. Cell Biol., 11, 197-203 (2009))
(21) Oct3/4, Klf4, L-Myc
(22) Oct3/4, Nanog
(23) Oct3/4
[0051] (24) Oct3/4, Klf4, c-Myc, Sox2, Nanog, Lin28, SV40LT (see Science, 324: 797-801 (2009))
[0052] In (1)-(24) above, Oct3/4 may be replaced with another member of the Oct family, for example, Oct1A, Oct6 or the like. Sox2 (or Sox1, Sox3, Sox15, Sox17, Sox18) may be replaced with another member of the Sox family, for example, Sox7 or the like. Furthermore, Lin28 may be replaced with another member of the Lin family, for example, Lin28b or the like.
[0053] Any combination that does not fall in (1) to (24) above but comprises all the constituents of any one of (1) to (24) above and further comprises an optionally chosen other substance can also be included in the scope of nuclear reprogramming substances in the present invention. Provided that the somatic cell to undergo nuclear reprogramming is endogenously expressing one or more of the constituents of any one of (1) to (24) above at a level sufficient to cause nuclear reprogramming, a combination of only the remaining constituents excluding the one or more constituents can also be included in the scope of nuclear reprogramming substances in the present invention.
[0054] Of these combinations, a combination of at least one, preferably two or more, more preferably three or more, selected from among Oct3/4, Sox2, Klf4, c-Myc, Nanog, Lin28 and SV40LT, is a preferable nuclear reprogramming substance.
[0055] Particularly, when the iPS cells obtained are to be used for therapeutic purposes, a combination of the three factors Oct3/4, Sox2 and Klf4 [combination (9) above] are preferably used. When the iPS cells obtained are not to be used for therapeutic purposes (e.g., used as an investigational tool for drug discovery screening and the like), the four factors Oct3/4, Sox2, Klf4 and c-Myc, or the five factors Oct3/4, Klf4, c-Myc, Sox2 and Lin28, or the six factors consisting of the five factors and Nanog [combination (12) above], and further, the seven factors consisting of the six factors and SV40 Large T [combination (24) above] are preferable.
[0056] Furthermore, the above-described combinations wherein c-Myc is replaced with L-Myc are also preferred as nuclear reprogramming substances.
[0057] Information on the mouse and human cDNA sequences of the aforementioned nuclear reprogramming substances is available with reference to the NCBI accession numbers mentioned in WO 2007/069666 (in the publication, Nanog is described as ECAT4. Mouse and human cDNA sequence information on Lin28, Lin28b, Esrrb, Esrrg and L-Myc can be acquired by referring to the following NCBI accession numbers, respectively); those skilled in the art are easily able to isolate these cDNAs.
TABLE-US-00001 Name of gene Mouse Human Lin28 NM_145833 NM_024674 Lin28b NM_001031772 NM_001004317 Esrrb NM_011934 NM_004452 Esrrg NM_011935 NM_001438 L-Myc NM_008506 NM_001033081
[0058] A proteinous factor for use as a nuclear reprogramming substance can be prepared by inserting the cDNA obtained into an appropriate expression vector, introducing the vector into a host cell, and recovering the recombinant proteinous factor from the cultured cell or its conditioned medium. Meanwhile, when the nuclear reprogramming substance used is a nucleic acid that encodes a proteinous factor, the cDNA obtained is inserted into a viral vector, plasmid vector, episomal vector etc. to construct an expression vector, and the vector is subjected to the step of nuclear reprogramming.
(c) Method of Transferring a Nuclear Reprogramming Substance to a Somatic Cell
[0059] Transfer of a nuclear reprogramming substance to a somatic cell can be achieved using a method known per se for protein transfer into a cell, provided that the substance is a proteinous factor. In view of human clinical applications, it is preferable that the starting material iPS cell be also prepared without gene manipulation.
[0060] Such methods include, for example, the method using a protein transfer reagent, the method using a protein transfer domain (PTD)- or cell penetrating peptide (CPP)-fusion protein, the microinjection method and the like. Protein transfer reagents are commercially available, including those based on a cationic lipid, such as BioPOTER Protein Delivery Reagent (Gene Therapy Systems), Pro-Ject Protein Transfection Reagent (PIERCE) and ProVectin (IMGENEX); those based on a lipid, such as Profect-1 (Targeting Systems); those based on a membrane-permeable peptide, such as Penetrain Peptide (Q biogene) and Chariot Kit (Active Motif), GenomONE (ISHIHARA SANGYO KAISHA, LTD.) utilizing HVJ envelope (inactivated hemagglutinating virus of Japan) and the like. The transfer can be achieved per the protocols attached to these reagents, a common procedure being as described below. Nuclear reprogramming substance(s) is(are) diluted in an appropriate solvent (e.g., a buffer solution such as PBS or HEPES), a transfer reagent is added, the mixture is incubated at room temperature for about 5 to 15 minutes to form a complex, this complex is added to cells after exchanging the medium with a serum-free medium, and the cells are incubated at 37 C. for one to several hours. Thereafter, the medium is removed and replaced with a serum-containing medium.
[0061] Developed PTDs include those using transcellular domains of proteins such as drosophila-derived AntP, HIV-derived TAT (Frankel, A. et al, Cell 55, 1189-93 (1988) or Green, M. & Loewenstein, P. M. Cell 55, 1179-88 (1988)), Penetratin (Derossi, D. et al, J. Biol. Chem. 269, 10444-50 (1994)), Buforin II (Park, C. B. et al. Proc. Natl Acad. Sci. USA 97, 8245-50 (2000)), Transportan (Pooga, M. et al. FASEB J. 12, 67-77 (1998)), MAP (model amphipathic peptide) (Oehlke, J. et al. Biochim. Biophys. Acta. 1414, 127-39 (1998)), K-FGF (Lin, Y. Z. et al. J. Biol. Chem. 270, 14255-14258 (1995)), Ku70 (Sawada, M. et al. Nature Cell Biol. 5, 352-7 (2003)), Prion (Lundberg, P. et al. Biochem. Biophys. Res. Commun. 299, 85-90 (2002)), pVEC (Elmquist, A. et al. Exp. Cell Res. 269, 237-44 (2001)), Pep-1 (Morris, M. C. et al. Nature Biotechnol. 19, 1173-6 (2001)), Pep-7 (Gao, C. et al. Bioorg. Med. Chem. 10, 4057-65 (2002)), SynB1 (Rousselle, C. et al. Mol. Pharmacol. 57, 679-86 (2000)), HN-I (Hong, F. D. & Clayman, G L. Cancer Res. 60, 6551-6 (2000)), and HSV-derived VP22. CPPs derived from the PTDs include polyarginines such as 11R (Cell Stem Cell, 4, 381-384 (2009)) and 9R (Cell Stem Cell, 4, 472-476 (2009)).
[0062] A fused protein expression vector incorporating cDNA of a nuclear reprogramming substance and PTD or CPP sequence is prepared, and recombination expression is performed using the vector. The fused protein is recovered and used for transfer. Transfer can be performed in the same manner as above except that a protein transfer reagent is not added.
[0063] Microinjection, a method of placing a protein solution in a glass needle having a tip diameter of about 1 m, and injecting the solution into a cell, ensures the transfer of the protein into the cell.
[0064] However, taking into account the efficiency of establishment of iPS cells, nuclear reprogramming substance may also be used preferably in the form of a nucleic acid that encodes a proteinous factor, rather than the factor as it is. The nucleic acid may be a DNA or an RNA, or a DNA/RNA chimera, and may be double-stranded or single-stranded. Preferably, the nucleic acid is a double-stranded DNA, particularly a cDNA.
[0065] A cDNA of a nuclear reprogramming substance is inserted into an appropriate expression vector comprising a promoter capable of functioning in a host somatic cell. Useful expression vectors include, for example, viral vectors such as retrovirus, lentivirus, adenovirus, adeno-associated virus, herpesvirus and Sendai virus, plasmids for the expression in animal cells (e.g., pAl-11, pXT1, pRc/CMV, pRc/RSV, pcDNAI/Neo) and the like.
[0066] A vector for this purpose can be chosen as appropriate according to the intended use of the iPS cell to be obtained. Useful vectors include adenovirus vector, plasmid vector, adeno-associated virus vector, retrovirus vector, lentivirus vector, Sendai virus vector, episomal vector and the like.
[0067] Examples of promoters used in expression vectors include the EF1 promoter, the CAG promoter, the SR promoter, the SV40 promoter, the LTR promoter, the CMV (cytomegalovirus) promoter, the RSV (Rous sarcoma virus) promoter, the MoMuLV (Moloney mouse leukemia virus) LTR, the HSV-TK (herpes simplex virus thymidine kinase) promoter and the like, with preference given to the EF1 promoter, the CAG promoter, the MoMuLV LTR, the CMV promoter, the SR promoter and the like.
[0068] The expression vector may contain as desired, in addition to a promoter, an enhancer, a polyadenylation signal, a selectable marker gene, a SV40 replication origin and the like. Examples of selectable marker genes include the dihydrofolate reductase gene, the neomycin resistant gene, the puromycin resistant gene and the like.
[0069] The nucleic acids as nuclear reprogramming substances (reprogramming genes) may be separately integrated into different expression vectors, or 2 kinds or more, preferably 2 to 3 kinds, of genes may be incorporated into a single expression vector. Preference is given to the former case with the use of a retrovirus or lentivirus vector, which offers high gene transfer efficiency, and to the latter case with the use of a plasmid, adenovirus, or episomal vector and the like. Furthermore, an expression vector incorporating two kinds or more of genes and another expression vector incorporating one gene alone can be used in combination.
[0070] In the context above, when a plurality of genes are incorporated in one expression vector, these genes can preferably be inserted into the expression vector via an intervening sequence enabling polycistronic expression. By using an intervening sequence enabling polycistronic expression, it is possible to more efficiently express a plurality of genes incorporated in one kind of expression vector. Useful sequences enabling polycistronic expression include, for example, the 2A sequence of foot-and-mouth disease virus (PLoS ONE 3, e2532, 2008, Stem Cells 25, 1707, 2007), IRES sequence (U.S. Pat. No. 4,937,190) and the like, with preference given to the 2A sequence.
[0071] An expression vector harboring a nucleic acid as a nuclear reprogramming substance can be introduced into a cell by a technique known per se according to the choice of the vector. In the case of a viral vector, for example, a plasmid containing the nucleic acid is introduced into an appropriate packaging cell (e.g., Plat-E cells) or a complementary cell line (e.g., 293-cells), the viral vector produced in the culture supernatant is recovered, and the vector is infected to the cell by a method suitable for the viral vector. For example, specific means using a retroviral vector are disclosed in WO2007/69666, Cell, 126, 663-676 (2006) and Cell, 131, 861-872 (2007). Specific means using a lentivirus vector is disclosed in Science, 318, 1917-1920 (2007). When PGC-like cells induced from iPS cells are utilized for regenerative medicine such as treatment of infertility and gene therapy of germ cells, an expression (reactivation) of a reprogramming gene potentially increases the risk of carcinogenesis in germ cells or reproductive tissues regenerated from PGC-like cells derived from iPS cells; therefore, a nucleic acid encoding a nuclear reprogramming substance is preferably expressed transiently, without being integrated into the chromosome of the cells. From this viewpoint, use of an adenoviral vector, whose integration into chromosome is rare, is preferred. Specific means using an adenoviral vector is disclosed in Science, 322, 945-949 (2008). Because an adeno-associated viral vector is also low in the frequency of integration into chromosome, and is lower than adenoviral vectors in terms of cytotoxicity and inflammation-inducibility, it can be mentioned as another preferred vector. Because Sendai viral vector is capable of being stably present outside the chromosome, and can be degraded and removed using an siRNA as required, it is preferably utilized as well. Regarding a Sendai viral vector, one described in J. Biol. Chem., 282, 27383-27391 (2007) and JP-3602058 B can be used.
[0072] When a retroviral vector or a lentiviral vector is used, even if silencing of the transgene has occurred, it possibly becomes reactivated; therefore, for example, a method can be used preferably wherein a nucleic acid encoding a nuclear reprogramming substance is cut out using the Cre-loxP system, when becoming unnecessary. That is, with loxP sequences arranged on both ends of the nucleic acid in advance, iPS cells are induced, thereafter the Cre recombinase is allowed to act on the cells using a plasmid vector or adenoviral vector, and the region sandwiched by the loxP sequences can be cut out. Because the enhancer-promoter sequence of the LTR U3 region possibly upregulates a host gene in the vicinity thereof by insertion mutation, it is more preferable to avoid the expression regulation of the endogenous gene by the LTR outside of the loxP sequence remaining in the genome without being cut out, using a 3-self-inactivating (SIN) LTR prepared by deleting the sequence, or substituting the sequence with a polyadenylation sequence such as of SV40. Specific means using the Cre-loxP system and SIN LTR is disclosed in Chang et al., Stem Cells, 27: 1042-1049 (2009).
[0073] Meanwhile, being a non-viral vector, a plasmid vector can be transferred into a cell using the lipofection method, liposome method, electroporation method, calcium phosphate co-precipitation method, DEAE dextran method, microinjection method, gene gun method and the like. Specific means using a plasmid as a vector are described in, for example, Science, 322, 949-953 (2008) and the like.
[0074] When a plasmid vector, an adenovirus vector and the like are used, the transfection can be performed once or more optionally chosen times (e.g., once to 10 times, once to 5 times or the like). When two or more kinds of expression vectors are introduced into a somatic cell, it is preferable that these all kinds of expression vectors be concurrently introduced into a somatic cell; however, even in this case, the transfection can be performed once or more optionally chosen times (e.g., once to 10 times, once to 5 times or the like), preferably the transfection can be repeatedly performed twice or more (e.g., 3 times or 4 times).
[0075] Also when an adenovirus or a plasmid is used, the transgene can get integrated into chromosome; therefore, it is eventually necessary to confirm the absence of insertion of the gene into chromosome by Southern blotting or PCR. For this reason, like the aforementioned Cre-loxP system, it can be advantageous to use a means wherein the transgene is integrated into chromosome, thereafter the gene is removed. In another preferred mode of embodiment, a method can be used wherein the transgene is integrated into chromosome using a transposon, thereafter a transposase is allowed to act on the cell using a plasmid vector or adenoviral vector so as to completely eliminate the transgene from the chromosome. As examples of preferable transposons, piggyBac, a transposon derived from a lepidopterous insect, and the like can be mentioned. Specific means using the piggyBac transposon is disclosed in Kaji, K. et al., Nature, 458: 771-775 (2009), Woltjen et al., Nature, 458: 766-770 (2009).
[0076] Another preferred non-recombination type vector is an episomal vector autonomously replicable outside the chromosome. A specific procedure for using an episomal vector is disclosed by Yu et al. in Science, 324, 797-801 (2009). As required, an expression vector may be constructed by inserting a reprogramming gene into an episomal vector having loxP sequences placed in the same orientation at both the 5 and 3 sides of the vector element essential for the replication of the episomal vector, and this may be transferred into a somatic cell.
[0077] Examples of the episomal vector include vectors comprising a sequence required for its autonomous replication, derived from EBV, SV40 and the like, as a vector element. Specifically, the vector element required for its autonomous replication is a replication origin or a gene that encodes a protein that binds to the replication origin to regulate its replication; examples include the replication origin oriP and EBNA-1 gene for EBV, and the replication origin ori and SV40 large T antigen gene for SV40.
[0078] The episomal expression vector contains a promoter that controls the transcription of the reprogramming gene. The promoter used can be the same promoter as the above. The episomal expression vector may further comprise an enhancer, poly-A addition signal, selection marker gene and the like as desired, as described above. Examples of selection marker gene include the dihydrofolate reductase gene, neomycin resistance gene and the like.
[0079] An episomal vector can be introduced into a cell using, for example, lipofection method, liposome method, electroporation method, calcium phosphate co-precipitation method, DEAE dextran method, microinjection method, gene gun method and the like. Specifically, the method described in Science, 324: 797-801 (2009), for example, can be used.
[0080] Whether or not the vector element required for replication of reprogramming gene has been removed from the iPS cell can be determined by performing Southern blot analysis or PCR analysis using a part of the vector as a probe or primer, with an episome fraction isolated from the iPS cell as the template, to examine for the presence or absence of a band or the length of the band detected. An episome fraction can be prepared using a method well known in the art, for example, the method described in Science, 324: 797-801 (2009).
[0081] When the nuclear reprogramming substance is a low-molecular compound, introduction thereof into a somatic cell can be achieved by dissolving the substance at an appropriate concentration in an aqueous or non-aqueous solvent, adding the solution to a medium suitable for cultivation of somatic cells isolated from human or mouse [e.g., minimal essential medium (MEM) comprising about 5 to 20% fetal bovine serum, Dulbecco's modified Eagle medium (DMEM), RPMI1640 medium, 199 medium, F12 medium, and the like] so that the nuclear reprogramming substance concentration will fall in a range that is sufficient to cause nuclear reprogramming in somatic cells and does not cause cytotoxicity, and culturing the cells for a given period. The nuclear reprogramming substance concentration varies depending on the kind of nuclear reprogramming substance used, and is chosen as appropriate over the range of about 0.1 nM to about 100 nM. Duration of contact is not particularly limited, as far as it is sufficient to cause nuclear reprogramming of the cells; usually, the nuclear reprogramming substance may be allowed to be co-present in the medium until a positive colony emerges.
(d) iPS Cell Establishment Efficiency Improvers
[0082] In recent years, various substances that improve the efficiency of establishment of iPS cells, which has traditionally been low, have been proposed one after another. When brought into contact with a somatic cell together with the aforementioned nuclear reprogramming substances, these establishment efficiency improvers are expected to further raise the efficiency of establishment of iPS cells.
[0083] Examples of iPS cell establishment efficiency improvers include, but are not limited to, histone deacetylase (HDAC) inhibitors [e.g., valproic acid (VPA) (Nat. Biotechnol., 26(1): 795-797 (2008)], low-molecular inhibitors such as trichostatin A, sodium butyrate, MC 1293, and M344, nucleic acid-based expression inhibitors such as siRNAs and shRNAs against HDAC (e.g., HDAC1 siRNA Smartpool (Millipore), HuSH 29mer shRNA Constructs against HDAC1 (OriGene) and the like), and the like], DNA methyltransferase inhibitors (e.g., 5-azacytidine) [Nat. Biotechnol., 26(1): 795-797 (2008)], G9a histone methyltransferase inhibitors [e.g., low-molecular inhibitors such as BIX-01294 (Cell Stem Cell, 2: 525-528 (2008)), nucleic acid-based expression inhibitors such as siRNAs and shRNAs against G9a (e.g., G9a siRNA (human) (Santa Cruz Biotechnology) and the like) and the like], L-channel calcium agonists (e.g., Bayk8644) [Cell Stem Cell, 3, 568-574 (2008)], p53 inhibitors [e.g., siRNA and shRNA against p53 (Cell Stem Cell, 3, 475-479 (2008)), UTF1 [Cell Stem Cell, 3, 475-479 (2008)], Wnt Signaling (e.g., soluble Wnt3a) [Cell Stem Cell, 3, 132-135 (2008)], 2i/LIF [2i is an inhibitor of mitogen-activated protein kinase signaling and glycogen synthase kinase-3, PloS Biology, 6(10), 2237-2247 (2008)] and the like. As mentioned above, the nucleic acid-based expression inhibitors may be in the form of expression vectors harboring a DNA that encodes an siRNA or shRNA.
[0084] Among the constituents of the aforementioned nuclear reprogramming substances, SV40 large T and the like, for example, can also be included in the scope of iPS cell establishment efficiency improvers because they are deemed not so essential, but auxiliary, factors for somatic cell nuclear reprogramming. In the situation of the mechanisms for nuclear reprogramming remaining unclear, the auxiliary factors, which are not essential for nuclear reprogramming, may be conveniently considered as nuclear reprogramming substances or iPS cell establishment efficiency improvers. Hence, because the somatic cell nuclear reprogramming process is understood as an overall event resulting from contact of nuclear reprogramming substance(s) and iPS cell establishment efficiency improver(s) with a somatic cell, it seems unnecessary for those skilled in the art to always distinguish between the nuclear reprogramming substance and the iPS cell establishment efficiency improver.
[0085] Contact of an iPS cell establishment efficiency improver with a somatic cell can be achieved as described above for each of three cases: (a) the improver is a proteinous factor, (b) the improver is a nucleic acid that encodes the proteinous factor, and (c) the improver is a low-molecular compound.
[0086] An iPS cell establishment efficiency improver may be brought into contact with a somatic cell simultaneously with a nuclear reprogramming substance, or either one may be contacted in advance, as far as the efficiency of establishment of iPS cells from the somatic cell is significantly improved, compared with the absence of the improver. In an embodiment, for example, when the nuclear reprogramming substance is a nucleic acid that encodes a proteinous factor and the iPS cell establishment efficiency improver is a chemical inhibitor, the iPS cell establishment efficiency improver can be added to the medium after the cell is cultured for a given length of time after the gene transfer treatment, because the nuclear reprogramming substance involves a given length of time lag from the gene transfer treatment to the mass-expression of the proteinous factor, whereas the iPS cell establishment efficiency improver is capable of rapidly acting on the cell. In another embodiment, when a nuclear reprogramming substance and an iPS cell establishment efficiency improver are both used in the form of a viral or plasmid vector, for example, both may be simultaneously introduced into the cell.
(e) Improving the Establishment Efficiency by Culture Conditions
[0087] The efficiency of establishment of iPS cells can be further improved by culturing the somatic cells therefor under hypoxic conditions in the step of nuclear reprogramming of the cells. The term hypoxic conditions as used herein means that the oxygen concentration in the ambient atmosphere during cell culture is significantly lower than that in the air. Specifically, such conditions include lower oxygen concentrations than the oxygen concentrations in the ambient atmosphere of 5-10% CO.sub.2/95-90% air, which is commonly used for ordinary cell culture; for example, oxygen concentrations of 18% or less in the ambient atmosphere are applicable. Preferably, the oxygen concentration in the ambient atmosphere is 15% or less (e.g., 14% or less, 13% or less, 12% or less, 11% or less and the like), 10% or less (e.g., 9% or less, 8% or less, 7% or less, 6% or less and the like), or 5% or less (e.g., 4% or less, 3% or less, 2% or less and the like). The oxygen concentration in the ambient atmosphere is preferably 0.1% or more (e.g., 0.2% or more, 0.3% or more, 0.4% or more and the like), 0.5% or more (e.g., 0.6% or more, 0.7% or more, 0.8% or more, 0.9% or more and the like), or 1% or more (e.g., 1.1% or more, 1.2% or more, 1.3% or more, 1.4% or more and the like).
[0088] There is no limitation on how to create hypoxic conditions in a cellular environment; the easiest of suitable methods is to culture cells in a CO.sub.2 incubator that allows control of oxygen concentrations. Such CO.sub.2 incubators are commercially available from a number of manufacturers of equipment (e.g., CO.sub.2 incubators for hypoxic culture manufactured by Thermo Scientific, Ikemoto Scientific Technology, Juji Field Inc., and Wakenyaku Co., Ltd. can be used).
[0089] The timing of beginning cell culture under hypoxic conditions is not particularly limited, as far as it does not interfere with improving the efficiency of establishment of iPS cells compared with that obtained at a normal oxygen concentration (20%). The starting time may be before or after contact of nuclear reprogramming substances with a somatic cell, and may be at the same time as the contact. For example, it is preferable that cell culture under hypoxic conditions be begun just after contacting a nuclear reprogramming substance with a somatic cell, or after a given time (e.g., 1 to 10 (e.g., 2, 3, 4, 5, 6, 7, 8 or 9) days) following the contact.
[0090] The duration of cell culture under hypoxic conditions is not particularly limited, as far as it does not interfere with improving the efficiency of establishment of iPS cells compared with that obtained at a normal oxygen concentration (20%); examples include, but are not limited to, between 3 days or more, 5 days or more, 7 days or more or 10 days or more, and 50 days or less, 40 days or less, 35 days or less or 30 days or less. The preferred duration of cell culture under hypoxic conditions also varies depending on the oxygen concentration in the ambient atmosphere; those skilled in the art can adjust as appropriate the duration of cell culture according to the oxygen concentration used. In an embodiment of the present invention, when iPS cell candidate colonies are selected with drug resistance as an indicator, it is preferable that a normal oxygen concentration be restored from hypoxic conditions by the start of drug selection.
[0091] Furthermore, the preferred starting time and duration of cell culture under hypoxic conditions also vary depending on the choice of nuclear reprogramming substances used, the efficiency of establishment of iPS cells under conditions involving a normal oxygen concentration, and other factors.
[0092] After the nuclear reprogramming substance(s) (and iPS cell establishment efficiency improver(s)) is(are) brought into contact with the cell, the cell can be cultured under conditions suitable for the cultivation of, for example, ES cells. In the case of mouse cells, the cultivation is carried out with the addition of Leukemia Inhibitory Factor (LIF) as a differentiation suppressor to an ordinary medium. Meanwhile, in the case of human cells, it is desirable that basic fibroblast growth factor (bFGF) and/or stem cell factor (SCF) be added in place of LIF. Usually, the cells are cultured in the co-presence of mouse embryo-derived fibroblasts (MEFs) treated with radiation or an antibiotic to terminate the cell division thereof, as feeder cells. Usually, STO cells and the like are commonly used as MEFs, but for inducing iPS cells, SNL cells [McMahon, A. P. & Bradley, A. Cell 62, 1073-1085 (1990)] and the like are commonly used. Co-culture with feeder cells may be started before contact of the nuclear reprogramming substance, at the time of the contact, or after the contact (e.g., 1-10 days later).
[0093] A candidate colony of iPS cells can be selected by a method with drug resistance and reporter activity as indicators, and also by a method based on visual examination of morphology.
[0094] As an example of the former, a colony positive for drug resistance and/or reporter activity is selected using a recombinant somatic cell wherein a drug resistance gene and/or a reporter gene is targeted to the locus of a gene highly expressed specifically in pluripotent cells (e.g., Fbx15, Nanog, Oct3/4 and the like, preferably Nanog or Oct3/4). Examples of such recombinant somatic cells include MEFs from a mouse having the geo (which encodes a fusion protein of -galactosidase and neomycin phosphotransferase) gene knocked-in to the Fbx15 locus [Takahashi & Yamanaka, Cell, 126, 663-676 (2006)], MEFs from a transgenic mouse having the green fluorescent protein (GFP) gene and the puromycin resistance gene integrated in the Nanog locus [Okita et al., Nature, 448, 313-317 (2007)] and the like. Meanwhile, examples of the method of selecting candidate colonies based on visual examination of morphology include the method described by Takahashi et al. in Cell, 131, 861-872 (2007). Although the method using reporter cells is convenient and efficient, it is desirable from the viewpoint of safety that colonies be selected by visual examination when iPS cells are prepared for the purpose of human treatment. When the three factors Oct3/4, Klf4 and Sox2 are used as nuclear reprogramming substances, the number of clones established decreases but the resulting colonies are mostly of iPS cells of high quality comparable to ES cells, so that iPS cells can efficiently be established even without using reporter cells.
[0095] The identity of the cells of a selected colony as iPS cells can be confirmed by positive responses to a Nanog (or Oct3/4) reporter (puromycin resistance, GFP positivity and the like) as well as by the formation of a visible ES cell-like colony, as described above. However, to ensure higher accuracy, it is possible to perform tests such as analyzing the expression of various ES-cell-specific genes and transplanting the cells selected to a mouse and confirming the formation of teratomas.
(iii) Naive Human ES and iPS Cells
[0096] Conventional human ES cells derived from blastocyst-stage embryos have very different biological (morphological, molecular and functional) properties from mouse ES cells. Mouse pluripotent stem cells can exit in two functionally distinct states, LIF-dependent ES cells and bFGF-dependent epiblast stem cells (EpiSCs). Molecular analyses suggest that the pluripotent state of human ES cells is similar to that of mouse EPiSCs rather than that of mouse ES cells. Recently, human ES and iPS cells in a mouse ES cell-like pluripotent state (also referred to as naive human ES and iPS cells) have been established by ectopic induction of Oct3/4, Sox2, Klf4, c-Myc and Nanog in the presence of LIE (see Cell Stem Cells, 6: 535-546, 2010), or ectopic induction of Oct3/4, Klf4 and Klf2 combined with LIE and inhibitors of GSK3 and ERK1/2 pathway (see Proc. Natl. Acad. Sci. USA, online publication doi/10.1073/pnas.1004584107). These naive human ES and iPS cells may be preferable starting materials for the present invention due to their pluripotent more immature compared to that of conventional human ES and iPS cells.
(2) Induction of Differentiation from PSC to EpiLCs
[0097] Basal media for differentiation induction include, but are not limited to, Neurobasal medium, Neural Progenitor Basal medium, NS-A medium, BME medium, BGJb medium, CMRL 1066 medium, minimal essential medium (MEM), Eagle MEM, MEM, Dulbecco's modified Eagle medium (DMEM), Glasgow MEM, Improved MEM Zinc Option medium, IMDM medium, 199 medium, DMEM/F12 medium, Ham's medium, RPMI1640 medium, Fischer's medium, and mixtures thereof.
[0098] The medium can be a serum-containing or serum-free medium. Preferably, a serum-free medium can be used. The serum-free medium (SFM) refers to media with no unprocessed or unpurified serum and accordingly, can include media with purified blood-derived components or animal tissue-derived components (such as growth factors). The concentration of serum (for example, fetal bovine serum (FBS), human serum, etc.) can be 0-20%, preferably 0-5%, more preferably 0-2%, most preferably 0% (i.e., serum-free). The SEM may contain or may not contain any alternatives to serum. The alternatives to serum can include materials which appropriately contain albumin (such as lipid-rich albumin, albumin substitutes such as recombinant albumin, plant starch, dextrans and protein hydrolysates), transferrin (or other iron transporters), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3thiolglycerol, or equivalents thereto. The alternatives to serum can be prepared by the method disclosed in WO 98/30679, for example. Alternatively, any commercially available materials can be used for more convenience. The commercially available materials include Knockout Serum Replacement (KSR), Chemically-defined Lipid concentrated, and Glutamax (Invitrogen).
[0099] The medium can also contain other additives known per se. The additive is not subject to limitation, as long as EpiLCs equivalent to pre-gastrulating epiblast cells can be produced by the method of the present invention; for example, growth factors (for example, insulin and the like), polyamines (for example, putrescine and the like), minerals (for example, sodium selenate and the like), saccharides (for example, glucose and the like), organic acids (for example, pyruvic acid, lactic acid and the like), amino acids (for example, non-essential amino acids (NEAA), L-glutamine and the like), reducing agents (for example, 2-mercaptoethanol and the like), vitamins (for example, ascorbic acid, d-biotin and the like), steroids (for example, [beta]-estradiol, progesterone and the like), antibiotics (for example, streptomycin, penicillin, gentamycin and the like), buffering agents (for example, HEPES and the like), nutritive additives (for example, B27 supplement, N2 supplement, StemPro-Nutrient Supplement and the like) and the like can be mentioned. It is preferable that each of the additives be contained in a concentration range known per se.
[0100] In the method of producing EpiLCs of the present invention, pluripotent stem cells may be cultured in the presence or absence of feeder cells. The feeder cells are not subject to limitation, as long as EpiLCs can be produced by the method of the present invention. Feeder cells known per se for use in culturing pluripotent stem cells such as ESCs and iPSCs can be used. For example, fibroblasts (mouse embryonic fibroblasts, mouse fibroblast cell line STO and the like) can be mentioned. The feeder cells are preferably inactivated by a method known per se, for example, radiation (gamma rays and the like), treatment with an anticancer agent (mitomycin C and the like) and the like. However, in a preferred embodiment of the present invention, pluripotent stem cells are cultured under feeder-free conditions.
[0101] The medium for inducing differentiation from pluripotent stem cells to EpiLCs (medium A) contains activin A as an essential additive in the basal medium. The activin A concentration is, for example, about 5 ng/ml or more, preferably about 10 ng/ml or more, more preferably about 15 ng/ml or more, and is, for example, about 40 ng/ml or less, preferably about 30 ng/ml or less, more preferably 25 ng/ml or less.
[0102] The medium A preferably further contains bFGF and/or KSR. bFGF and KSR remarkably increase the induction efficiency for EpiLCs when present in a range of effective concentrations. The bFGF concentration is, for example, about 5 ng/ml or more, preferably about 7.5 ng/ml or more, more preferably about 10 ng/ml or more, and is, for example, about 30 ng/ml or less, preferably about 20 ng/ml or less, more preferably about 15 ng/ml or less. The KSR concentration is, for example, about 0.1 w/w % or more, preferably about 0.3 w/w % or more, more preferably about 0.5 w/w % or more, and is, for example, about 5 w/w % or less, preferably about 3 w/w % or less, more preferably about 2 w/w % or less.
[0103] In a particularly preferred embodiment, the medium A contains activin A, bFGF and KSR in addition to the basal medium. Appropriate concentrations of these ingredients can be chosen over the range of about 10-30 ng/ml, preferably 15-25 ng/ml for activin A, about 7.5-20 ng/ml, preferably about 10-15 ng/ml for bFGF, and about 0.3-3 w/w %, preferably about 0.5-2 w/w % for KSR.
[0104] The activin A and bFGF contained in the medium A are not subject to limitation as to the source thereof, may be isolated and purified from cells of any mammals (for example, human, mouse, monkey, swine, rat, dog and the like). It is preferable to use activin A and bFGF homologous to the pluripotent stem cells subjected to the culture. The activin A and bFGF may also be chemically synthesized or biochemically synthesized using a cell-free translation system, or produced from a transformant bearing a nucleic acid encoding each of the proteins. The recombinant products of activin A and bFGF are commercially available.
[0105] A culture vessel used for inducing pluripotent stem cells into EpiLCs can include, but is particularly not limited to, flask, flask for tissue culture, dish, petri dish, dish for tissue culture, multi dish, micro plate, micro-well plate, multi plate, multi-well plate, micro slide, chamber slide, schale, tube, tray, culture bag, and roller bottle. The culture vessel can be cellular adhesive. The cellular adhesive culture vessel can be coated with any of substrates for cell adhesion such as extracellular matrix (ECM) to improve the adhesiveness of the vessel surface to the cells. The substrate for cell adhesion can be any material intended to attach pluripotent stem cells or feeder cells (if used). The substrate for cell adhesion includes collagen, gelatin, poly-L-lysine, poly-D-lysine, poly-L-ornithine, laminin, and fibronectin and mixtures thereof for example Matrigel, and lysed cell membrane preparations (Klimanskaya I et al 2005. Lancet 365: p 1636-1641).
[0106] In this cultivation, pluripotent stem cells are plated onto the culture vessel mentioned above to obtain a cell density of, for example, about 10.sup.4-10.sup.5 cells/cm.sup.2, preferably about 2 to 810.sup.4 cells/cm.sup.2, and cultured in an incubator under atmospheric conditions of 1-10% CO.sub.2/99-90% air at about 30-40 C., preferably about 31 C., for less than 3 days, preferably about 2 days (e.g., 4812 hours, preferably 486 hours). As a result of the culture, cells with flattened epiblast-like structure uniformly emerges.
[0107] The fact of differentiation into EpiLCs can be confirmed by, for example, analyzing the expression levels of EPiLC- and/or pluripotent stem cell-marker genes using RT-PCR. The EpiLC of the present invention means a cell in E5.5-E6.0 epiblast-like (pre-gastrulating epiblast-like) state. To be specific, the EpiLC is defined as a cell having either or both of the following properties:
(1) elevated gene expression of at least one selected from Fgf5, Wnt3 and Dnmt3b compared to the pluripotent stem cell before inducing differentiation;
(2) reduced gene expression of at least one selected from Gata4, Gata6, Sox17 and Blimp1 compared to the pluripotent stem cell before inducing differentiation. Therefore, the fact of differentiation into EpiLCs can be confirmed by determining the expression levels of at least one selected from Fgf5, Wnt3 and Dnmt3b and/or at least one selected from Gata4, Gata6, Sox17 and Blimp1 in the cells obtained by the culture, and comparing the expression levels with those in the pluripotent stem cells before inducing differentiation.
[0108] More preferably, the EpiLC of the present invention has the following properties:
(1) continuous gene expression of Oct3/4;
(2) reduced gene expression of Sox2 and Nanog compared to the pluripotent stem cell before inducing differentiation;
(3) elevated gene expression of Fgf5, Wnt3 and Dnmt3b compared to the pluripotent stem cell before inducing differentiation; and
(4) reduced gene expression of Gata4, Gata6, Sox17 and Blimp1 compared to the pluripotent stem cell before inducing differentiation.
[0109] As mentioned above, in a preferred embodiment, the medium A of the present invention contains activin A, bFGF and KSR. Accordingly, the present invention also provides a reagent kit for inducing the differentiation from pluripotent stem cells to EpiLCs comprising activin A, bFGF and KSR. These ingredients may be supplied in a state dissolved in water or an appropriate buffer solution, and may also be supplied as a lyophilized powder which may be used after being freshly dissolved in an appropriate solvent. These ingredients may be supplied as individual reagents in respective kits, and, as far as they do not adversely affect each other, they can be supplied as a single mixed reagent of 2 kinds or more.
(3) Induction of Differentiation from EpiLCs to PGCLC Cells
[0110] By culturing thus-obtained EpiLCs in the presence of BMP4 and LIF, it is possible to induce differentiation into PGC-like cells (Cell, 137, 571-584 (2009)). Accordingly, a second aspect of the present invention relates to a method of producing PGC-like cells from pluripotent stem cells through EpiLCs obtained by the method of (2) above. Namely, the method comprises:
I) the step for producing an EpiLC from pluripotent stem cells according to any of the methods described in (2) above; and
II) the step for culturing the EpiLC obtained in the step I) in the presence of BMP4 and LIF.
[0111] As the basal medium for differentiation induction in the step II), the basal media exemplified for the use in the step I) are likewise preferably used. The medium may contain the same additives as those exemplified for the use in the step I), as long as PGC-like cells capable of contributing to normal spermatogenesis can be produced by the method of the present invention.
[0112] The medium can be a serum-containing or serum-free medium (SFM). Preferably, a serum-free medium can be used. The concentration of serum (for example, fetal bovine serum (FBS), human serum, etc.) can be 0-20%, preferably 0-5%, more preferably 0-2%, most preferably 0% (i.e., serum-free). The SFM may contain or may not contain any alternatives to serum such as KSR.
[0113] The medium for inducing differentiation from EpiLCs to PGC-like cells (medium B) contains bone morphogenetic protein 4 (BMP4) and leukemia inhibitory factor (LIF) as an essential additive in the basal medium. The concentration of BMP4 is, for example, about 100 ng/ml or more, preferably about 200 ng/ml or more, more preferably about 300 ng/ml or more. Also, the concentration of BMP4 is, for example, about 1,000 ng/ml or less, preferably about 800 ng/ml or less, more preferably 600 ng/ml or less. The concentration of LIF is, for example, about 300 U/ml or more, preferably about 500 U/ml or more, more preferably about 800 U/ml or more. Also, the concentration of LIF is, for example, about 2,000 U/ml or less, preferably about 1,500 U/ml or less, more preferably 1,200 U/ml or less.
[0114] The medium B preferably further contains at least one additive(s) selected from stem cell factor (SCF), bone morphogenetic protein 8b (BMP8b) and epidermal growth factor (EGF). SCF, BMP8b and EGF remarkably prolong the period of time which PGC-like cells are maintained in a Blimp1- and Stella-positive state, when present in ranges of effective concentrations. The concentration of SCF is, for example, about 30 ng/ml or more, preferably about 50 ng/ml or more, more preferably about 80 ng/ml or more. Also, the concentration of SCF is, for example, about 200 ng/ml or less, preferably about 150 ng/ml or less, more preferably about 120 ng/ml or less. The concentration of BMP8b is, for example, about 100 ng/ml or more, preferably about 200 ng/ml or more, more preferably about 300 ng/ml or more. Also, the concentration of BMP8b is, for example, about 1,000 ng/ml or less, preferably about 800 ng/ml or less, more preferably 600 ng/ml or less. The concentration of EGF is, for example, about 10 ng/ml or more, preferably about 20 ng/ml or more, more preferably about 30 ng/ml or more. Also, the concentration of EGF is, for example, about 100 ng/ml or less, preferably about 80 ng/ml or less, more preferably about 60 ng/ml.
[0115] In a particularly preferred embodiment, the medium B contains BMP, LIF, SCF, BMP8b and EGF in addition to the basal medium. The concentrations of these ingredients can be chosen as appropriate over the ranges of about 200-800 ng/ml, preferably about 300-600 ng/ml for BMP4, about 500-1500 U/ml, preferably about 800-1,200 U/ml for LIF, about 50-150 ng/ml, preferably about 80-120 ng/ml for SCF, about 200-800 ng/ml, preferably about 300-600 ng/ml for BMP8b, and about 20-80 ng/ml, preferably about 30-60 ng/ml for EGF.
[0116] The BMP4, LIF, SCF, BMP8b and EGF contained in the medium B are not subject to limitation as to the source thereof, may be isolated and purified from cells of any mammals (for example, human, mouse, monkey, swine, rat, dog and the like). It is preferable to use BMP4, LIF, SCF, BMP8b and EGF homologous to the EpiLCs subjected to the culture. The BMP4, LIF, SCF, BMP8b and EGF may also be chemically synthesized or biochemically synthesized using a cell-free translation system, or produced from a transformant bearing a nucleic acid encoding each of the proteins. The recombinant products of BMP4, LIF, SCF, BMP8b and EGF are commercially available.
[0117] In this cultivation, EpiLCs are seeded to a cellular non-adhesive or low-adhesive culture vessel known per se to obtain a cell density of, for example, about 3 to 1010.sup.4 cells/mL, preferably about 4 to 810.sup.4 cells/mL, and cultured in an incubator in an atmosphere of 1-10% CO.sub.2/99-90% air at about 30-40 C., preferably about 37 C., for about 4-10 days, preferably about 4-8 days, more preferably about 4-6 days, more preferably 4 days.
[0118] The fact of differentiation into PGC-like cells can be confirmed by, for example, analyzing the expression of Blimp1 by RT-PCR and the like. As required, furthermore, the expression of other genes and cell surface antigens can also be examined. Examples of other genes include Stella. When pluripotent stem cells bearing fluorescent protein genes under the control of Blimp1- and/or Stella-promoters are used as a starting material, the fact of differentiation into PGC-like cells can be confirmed by FACS analysis. When the pluripotent stem cells bear no appropriate transgenic reporter, such as ESCs or iPSCs derived from human or other non-mouse mammals, it is preferable to confirm the fact of differentiation into PGC-like cells by FACS analysis and the like using one or more cell surface antigens specifically expressed on PGC-like cells. As the cell surface antigens, preferably SSEA-1 and integrin-3 are exemplified.
[0119] A cell population containing PGC-like cells derived from pluripotent stem cells and produced by the aforementioned step I) and II) may be a purified population of PGC-like cells, and 1 kind or more of cells other than PGC-like cells may be co-present. Here, PGC-like cell is defined as a cell that shows elevated expression of Blimp1 and/or Stella compared to the EpiLC before inducing differentiation, is capable of contributing to normal spermatogenesis, and does not form teratoma when transplanted into an immunodeficient mouse. As stated above, when PGC-like cells are induced using pluripotent stem cells bearing fluorescent protein genes under the control of Blimp1- and/or Stella-promoters as a starting material, the Blimp1- and/or Stella-positive PGC-like cells can be easily isolated and purified by sorting out the cell population obtained in the foregoing step II) using a cell sorter. The PGC-like cells can also be isolated and purified by FACS using a reporter under the control of gene whose expression increases along with Blimp1 and Stella (e.g., Nanog) as a marker.
2. Expansion of PGC/PGCLC
[0120] In the present step, for example, PGC or PGCLC obtained by the above-mentioned method is cultivated in the presence of a PDE4 inhibitor and/or cyclospoeine A. When the PGCLC to be used is a non-uniform cell population, for example, an SSEA-1 positive and integrin-3 positive cell fraction can be used by isolating using FACS. As PGCLC, the cells on d4-d10, preferably d4-d8, more preferably d4-d6, further preferably about d4 EpiLC, wherein the day of start of differentiation induction is d0, may be used.
[0121] As the medium to be used in the present step, the medium exemplified for the differentiation induction from PSC into EpiLC can be similarly used as the basal medium. It is preferable to add a serum or serum replacement to the medium. The kind and concentration of the serum or serum replacement to be used here may be the same as those exemplified for the differentiation induction from PSC into EpiLC. In addition, the medium may contain other additives known per se. Such additive is not particularly limited as long as it can support the expansion of PGC/PGCLC, and those exemplified for the differentiation induction from PSC into EpiLC can be used in the same manner. Examples of the medium used in this step include, but are not limited to, GMEM medium containing 10% Knockout Serum Replacement (KSR), 2.5% fetal bovine serum (FCS), 0.1 mM NEAA, 1 mM sodium pyruvate, 0.1 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 2 mM L-glutamine and the like.
[0122] The PDE4 inhibitor to be added to the above-mentioned medium is not particularly limited as long as it is a substance that can inhibit the enzyme activity of PDE4, namely, hydrolysis activity of cAMP. Preferably, it is a selective inhibitor of PDE4 (which does not inhibit not only enzyme other than phosphodiesterase (PDE) but also PDEs other than PDE4). Examples of the inhibitor include, but are not limited to, ibudilast, S-(+)-rolipram, rolipram, GSK256066, cilomilast and the like.
[0123] The concentration of the PDE4 inhibitor is, for example, about 0.1 M or more, preferably about 0.5 M or more, more preferably about 1 M or more. The concentration of the PDE4 inhibitor is, for example, about 100 M or less, preferably about 50 M or less, more preferably 30 M or less. In a preferred embodiment, the concentration of the PDE4 inhibitor may be appropriately selected from the range of about 0.5-50 M, preferably about 1-30 M.
[0124] In the present specification, Cyclosporine A includes a cyclic polypeptide consisting of 11 amino acids specified by IUPAC name: cyclo{-[(2S,3R,4R,6E)-3-hydroxy-4-methyl-2-methylaminooct-6-enoyl]-L-2-aminobutanoyl-N-methylglycyl-N-methyl-L-leucyl-L-valyl-N-methyl-L-leucyl-L-alanyl-D-alanyl-N-methyl-L-leucyl-N-methyl-L-leucyl-N-methyl-L-valyl-}, and a derivative thereof known per se (see, for example, WO 2012/051194 and the like). Cyclosporin A can be isolated from the fungus producing same by a fermentation method or can be organically synthesized by a well-known peptide synthesis technique. In addition, a commercially available cyclosporine A (e.g., Sigma-Aldrich Ltd.) can also be used.
[0125] The concentration of cyclosporine A is, for example, about 0.1 M or more, preferably about 0.5 M or more, more preferably about 1 M or more. The concentration of cyclosporine A is, for example, about 100 M or less, preferably about 50 M or less, more preferably 30 M or less. In a preferred embodiment, the concentration of cyclosporine A may be appropriately selected from the range of about 0.5-50 M, preferably about 1-30 M, more preferably about 1-10 M.
[0126] Preferably, the present culture step is performed using a medium containing at least a PDE4 inhibitor, more preferably, a medium further containing cyclosporine A.
[0127] In a preferred embodiment, the present culture step is performed using a medium further containing forskolin.
[0128] Forskolin is a potent activator of adenylate cyclase and increases intracellular cAMP levels by a different action mechanism than PDE4 inhibitors. It can act synergistically with PDE4 inhibitors to remarkably increase PGC/PGCLC expansion efficiency.
[0129] The concentration of forskolin is, for example, about 0.1 M or more, preferably about 0.5 M or more, more preferably about 1 M or more. The concentration of forskolin is, for example, about 100 M or less, preferably about 50 pH or less, more preferably 30 M or less. In a preferred embodiment, the concentration of forskolin may be appropriately selected from the range of about 0.5 to 50 M, preferably about 1 to 30 M.
[0130] The medium for expansion of PGC/PGCLC preferably further contains SCF. The concentration of SCF is, for example, about 30 ng/ml or more, preferably about 50 ng/ml or more, more preferably about 80 ng/ml or more. The concentration of SCF is, for example, about 200 ng/ml or less, preferably about 150 ng/ml or less, more preferably about 120 ng/ml or less. In a preferred embodiment, the concentration of SCF may be appropriately selected from the range of about 50 to 150 ng/ml, preferably about 80 to 120 ng/ml.
[0131] In a particularly preferred embodiment, the medium for expansion of PGC/PGCLC contains 10 M PDE4 inhibitor, 10 M forskolin and 100 ng/ml SCF. When combined with other PGC proliferation stimulation factors, dedifferentiation of PGC/PGCLC into EGC may be promoted. Thus, it may be preferable not to add LIE to the medium for expansion of PGC/PGCLC.
[0132] In the expansion method of PGC/PGCLC, PGC/PGCLC may be cultured in the presence or absence of feeder cells. The kind of the feeder cell is not particularly limited, and a feeder cell known per se can be used. For example, fibroblasts (mouse embryonic fibroblasts, mouse fibroblast cell line STO and the like) can be mentioned. The feeder cells are preferably inactivated by a method known per se, for example, radiation (gamma rays and the like), treatment with an anticancer agent (mitomycin C and the like) and the like. When the feeder cells are vulnerable to PDE4 inhibitors and/or forskolin, it is desirable to subculture several generations of feeder cells in the presence of these additives and acclimate them to the additives in advance.
[0133] The incubator to be used for the expansion of PGC/PGCLC is not particularly limited, and those exemplified in the differentiation induction from PSC into EpiLC can be similarly used.
[0134] In this cultivation, PGC/PGCLC is plated onto an incubator (feeder cells seeded thereon in advance) to obtain a cell density of, for example, about 10.sup.4-10.sup.5 cells/cm.sup.2, preferably about 2 to 810.sup.4, and cultured in an incubator under atmospheric conditions of 1-10% CO.sub.2/99-90% air at about 30-40 C., preferably about 37 C., for 3 to 9 days, preferably 4 to 8 days, more preferably 5 to 7 days. As a result of culture, flat colonies are formed, Blimp1 and Stella are strongly expressed, the characteristics of motile cells with filopodia and lamellipodia are shown, and the properties of PGC in the mobile phase are maintained.
[0135] From the results of comprehensive gene expression analysis, the amplified PGCLC obtained as mentioned above maintains the gene expression of mobile PGC without increasing the expression of gene group (e.g., Daz1, Ddx4, Piwi12, Mae1, etc.) expressed in late PGC (E12.5 and later).
[0136] From the results of epigenetic analysis, amplified PGCLC progressively eliminates 5-methylcytosine in all genomic regions, and faithfully reproduces genome-wide demethylation in the germ cell of the gonad. That is, the amplified PGC/PGCLC obtained by the method of the present invention reproduces the epigenetic blank state of the germ line immediately before sex differentiation.
[0137] The amplified PGC/PGCLC obtained by the method (I) of the present invention can be used for varied purposes. For example, since the PGC-like cells transplanted into a testis of a recipient animal can robustly contribute to spermatogenesis in the testis and the generation of healthy offspring, they can be used for the treatment of infertility or hereditary diseases of reproductive tissues.
[0138] PGC/PGCLC can be transplanted into a testis by using PGC/PGCLC in place of germlime stem cells (GS cells) in the methods disclosed in WO 2004/092357 and Biol. Reprod., 69: 612-616 (2003). Alternatively, PGC/PGCLC can be cultured in the same manner as in WO 2004/092357 and Biol. Reprod. (2003), supra to induce differentiation into GS cells, then transplanted into a testis.
[0139] PGC/PGCLC (including a cell population containing PGC/PGCLC; the same applies below) of the present invention are produced as a parenteral preparation, preferably as an injection, suspension, or drip infusion, in a mixture with a pharmaceutically acceptable carrier, by a conventional means. Examples of the pharmaceutically acceptable carrier that can be contained in the parenteral preparation include aqueous liquids for injection, such as physiological saline and isotonic solutions containing glucose and other auxiliary drugs (e.g., D-sorbitol, D-mannitol, sodium chloride and the like). The agent of the present invention may be formulated with, for example, a buffering agent (e.g., phosphate buffer solution, sodium acetate buffer solution), a soothing agent (e.g., benzalkonium chloride, procaine hydrochloride and the like), a stabilizer (e.g., human serum albumin, polyethylene glycol and the like), a preservative, an anti-oxidant and the like.
[0140] When the agent of the present invention is prepared as an aqueous suspension, PGC/PGCLC is suspended in one of the aforementioned aqueous liquids to obtain a cell density of about 1.010.sup.6 to about 1.010.sup.7 cells/ml.
[0141] The agent of the present invention can be cryopreserved under conditions typically used for the cryopreservation of stem cells, and thawed immediately before use.
[0142] The preparation thus obtained is stable and less toxic, and therefore, it can be safely administered to mammals such as humans. Although the method of administration is not particularly limited, the preparation is preferably administered by injection or drip infusion into a seminiferous tubule. For a male infertility patient, for example, it is usually convenient to administer the agent in an amount of about 1.010.sup.5 to about 110.sup.7 cells, based on the amount of PGC-like cells per dose, once or 2-10 times at about 1- to 2-week intervals.
[II] Induction Method of Oocyte from PGC/PGCLC
[0143] The differentiation of amplified PGC/PGCLC obtained by the method (I) of the present invention into oocyte can be induced in the absence of somatic cell of the gonad by culturing same in the presence of BMP and RA. Therefore, the present invention also provides a method for inducing oocyte from PGC or PGCLC by culturing the PGC or PGCLC in the presence of BMP and RA (sometimes to be abbreviated as the method (II) of the present invention).
[0144] The method (II) of the present invention is characterized in that it is performed in the absence of somatic cell of the gonad. As used herein, the gonad refers to a structure consisting of germ cells and somatic cells in support thereof. It is formed by the time when male and female sex differentiation in fetal (pup) primordial germ cells (PGC) begins in the mother' womb (12.5 days after fertilization (E12.5) in mice). PGCs are differentiated into gametes (spermatozoon and ovum) while being surrounded by somatic cells of the gonad which are characteristic of male and female. In the conventional method, somatic cells of the gonad at this time (for example, in the case of mouse, E12.0-E13.0, preferably about E12.5) and PGC/PGCLC are co-cultured to mimic the cellular environment at the time when PGC becomes prespermatogonium or oocyte. In The method (II) of the present invention does not require gonadal somatic cells, and therefore, the operation is not complicated, can perform differentiation into oocytes under specified conditions, and can be used practically for animal species including human where collection of gonadal somatic cells in the embryonic period is difficult.
[0145] The PGC/PGCLC to be used in the method (II) of the present invention is not particularly limited as long as at least the gene group important for late PGC and meiosis are demethylated. Since PGC/PGCLC immediately after induction from epiblast and EpiLC has insufficient genomic demethylation, it is preferable to use the amplified PGC/PGCLC obtained by the method (I) of the present invention. For example, PGC/PGCLC cultured in the presence of a PDE4 inhibitor, further preferably forskolin, further more preferably SCF for, for example, 3 days or more, preferably 3 to 9 days, more preferably 3 to 8 days, further preferably 3 to 7 days, can be used.
[0146] The medium to be used in the method (II) of the present invention can similarly use, as a basal medium, the medium exemplified for the induction of differentiation of PSC into EpiLC. It is preferable to add a serum or serum replacement to the medium. The kind and concentration of the serum or serum replacement to be used here are the same as those exemplified for the differentiation induction from PSC into EpiLC. The medium may also contain other additives known per se. Such additive is not particularly limited as long as it can support the differentiation from PGC/PGCLC into oocyte, and those exemplified for the differentiation induction from PSC into EpiLC can be used in the same manner. Examples of the medium used in this step include, but are not limited to, GMEM medium containing 10% Knockout Serum Replacement (KSR), 2.5% fetal bovine serum (FCS), 0.1 mM NEAA, 1 mM sodium pyruvate, 0.1 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and 2 mM L-glutamine, and the like, like the method (I) of the present invention.
[0147] BMP to be added to the above-mentioned medium is not particularly limited as long as it can support differentiation of PGC/PGCLC into oocyte. For example, BMP2, BMP4, BMP5, BMP7 and the like can be mentioned. Preferably, it is BMP2, BMP5 or BMP7. Any one kind of BMP may be used, or two or more kinds of BMP may be used in combination.
[0148] The concentration of BMP is, for example, about 100 ng/ml or more, preferably about 200 ng/ml or more, more preferably about 300 ng/ml or more. Also, the concentration of BMP is, for example, about 1,000 ng/ml or less, preferably about 800 ng/ml or less, more preferably about 600 ng/ml or less. In a preferred embodiment, the concentration of BMP may be appropriately selected from the range of about 200 to 800 ng/ml, preferably about 300 to 600 ng/ml.
[0149] The concentration of RA is, for example, about 10 nM or more, preferably about 30 nM or more, more preferably about 50 nM or more. The concentration of RA is, for example, about 500 nM or less, preferably about 300 M or less, more preferably 200 M or less. In a preferred embodiment, the concentration of RA may be appropriately selected from the range of about 30-300 nM, preferably about 50-200 nM.
[0150] In a preferred embodiment, the medium for induction of oocyte from PGC/PGCLC further contains PDE4 inhibitor, forskolin and SCF, like the aforementioned medium for expansion of PGC/PGCLC. The concentration of each additive may be appropriately selected from the same concentration range of the aforementioned method (I) of the present invention.
[0151] In a particularly preferred embodiment, the medium for induction of oocyte from PGC/PGCLC contains 500 ng/ml BMP and 100 nM RA.
[0152] In the induction method of oocyte from PGC/PGCLC, the PGC/PGCLC may be cultured in the presence or absence of a feeder cell. The kind of the feeder cell is not particularly limited and a feeder cell known per se can be used. The incubator to be used in this culture step is not particularly limited, and those exemplified for the differentiation induction from PSC into EpiLC can be used in the same manner.
[0153] In this cultivation, for example, the medium is replaced with a medium supplemented with BMP and RA 3 to 9 days, preferably 3 to 8 days, more preferably 3 to 7 days, after placing PGC/PGCLC under conditions for expansion in the method (I) of the present invention, and culture is continued for further 2-7 days, preferably 2-6 days. As a result of the culture, PGC/PGCLC differentiates synchronously with Daz1-positive, Ddx4-positive, and SCP3-positive oocyte-like cells, and differentiates into the pachytene stage of meiosis.
[0154] The present invention is explained in more specifically in the following by referring to Examples. It is needless to say that the present invention is not limited thereto.
Example
[I] Expansion of PGC/PGCLC Using PDE4 Inhibitor or the Inhibitor and Forskolin in Combination
[0155] For more information on the references cited below, see Ohta, H. et al., EMBO J., 36(13): 1888-1907 (2017).
<Materials and Methods>
Mouse
[0156] All animal experiments were performed under the ethical guidelines of Kyoto University. BVSC (Acc. No. BV, CDB0460T; SC, CDB0465T: http://www.cdb.riken.jp/arg/TG%20 mutant %20 mice%20 list.html) and Stella-EGFP transgenic mice were established as previously reported (Payer et al, 2006; Seki et al, 2007; Ohinata et al, 2008; Imamura et al, 2010), and maintained mostly in the C57BL/6 background. WBB6F1-W/Wv, C57BL/6, DBA/2, C3H, BDF1, and ICR mice were purchased from SLC (Shizuoka, Japan). The noon of the day when the vaginal plug was confirmed was designated as 0.5 days of embryonic period (E). All mice were housed in a specific pathogen-free animal facility under a 14-hr light/10-hr dark cycle.
Induction and Culture of ES Cell (ESC)
[0157] BVSC R8, H14, and H18 were previously reported (Hayashi et al, 2011, 2012). Female BVSC mice (mostly C57BL/6 background) were mated with male DBA/2 or C3H mice to obtain BDF1 or BCF1 embryos. Blastocysts were seeded and cultured on mouse embryonic fibroblasts (MEF) (Ying et al, 2008; Hayashi et al, 2011) in the wells of a 96-well plate in N2B27 medium containing 2i (PD0325901, 0.4 M: Stemgent, San Diego, Calif.; CHIR99021, 3 M: Stemgent) and LIF (1,000 U/ml; Merck Millipore). The proliferated colonies were passaged by dissociating with TrypLE (Thermo Fisher Scientific). ESC was maintained on MEF for up to 2 passages. Thereafter, male ESC was cultured on a dish coated with poly-L-ornithine (0.01%; Sigma) and laminin (10 ng/ml; BD Biosciences) and maintained at feeder free.
Induction of EpiLC and PGCLC
[0158] Induction of EpiLC and PGCLC was performed as reported previously (Hayashi et al, 2011). In short, 110.sup.5 cells of ESC were seeded in N2B27 medium containing activin A (20 ng/ml), bFGF (12 ng/ml), and KSR (1%) in the wells of a 12 well plate coated with human plasma fibronectin (16.7 mg/ml) to induce EpiLC. PGCLC was induced from d2 EpiLC under floating conditions in the presence of cytokine BMP4 (500 ng/ml; R&D Systems), LIF (1,000 U/ml; Merck Millipore), SCF (100 ng/ml; R&D Systems) and EGF (50 ng/ml; R&D Systems) using the wells of a low cell binding U-bottom 96 well plate (Thermo Scientific) in a serum-free medium [GK15 containing 15% KSR; GMEM (Thermo Fisher Scientific), 0.1 mM NEAA, 1 mM sodium pyruvate, 0.1 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and 2 mM L-glutamine]. To prepare many PGCLCs for compound library screening, PGCLC was induced with AgglreWell400 (STEMCELL Technologies) using the same medium.
Fluorescence Activated Cell Sorting
[0159] Sample preparation from cell aggregates was performed as previously reported (Hayashi et al, 2011). FACS was performed on a FACSAriaIII (BD) cell sorter. BV and SC fluorescence was detected on FITC and AmCyan Horizon V500 channels, respectively. Data was analyzed using FACSDiva (BD) software.
Establishment of m220 Subline
[0160] The m220 cell line (Majumdar et al, 1994) was cultured in DMEM containing 10% FCS on a plate coated with gelatin. Since the m220 cells were very vulnerable to a mitomycin C (MMC) treatment, m220 subline resistant to MMC was established. In short, by FACS, single m220 cells were seeded on the wells of a 96 well plate (6 plates). One week after the seeding, cell proliferation was observed in about half of the wells. The cells were passaged in one well each of two 96 well plates, one plate was frozen as a replica and the other plate was treated with MMC (4 g/ml, for 2 hr). On day 10 from the MMC treatment, MMC resistance was evaluated by microscopic observation. A total of 242 m220 sublines were established, and 7 sublines showed high MMC resistance. The m220-5 sublines were mainly used for the experiment.
Detection of BV(+) PGCLC by Cell Analyzer
[0161] d4 PGCLC was seeded by FACS on m220-5 feeders in 96-well plates and BV fluorescence was monitored by cell analyzer (Cellavista; SynenTec). Fluorescence photograph for BV was taken by Cellavista cell analyzer with the following settings: 10 objectives; exposure time: 140 sec; gain: 4; binning: 44; excitation: 500/24 nm; emission: 542/27 nm. BV fluorescence was detected using the following algorithm/attribute parameters: sensitivity: 10; region merging: 200; min. granule intensity: 50; well edge distance: 200; contrast: 1; size: 3,000; intensity: 255; roughness: 500; granularity: 100; granule intensity: 255; granule count: 10,000; longishness: 100; compactness: 1. The value of cell nucleus was used for the detection of BV fluorescence.
Compound Library Screening for PGCLC Proliferation
[0162] The compound library was screened at concentrations of 10 M and 1 M. A 96-well plate containing m220-5 cells treated with MMC was used. In each 96-well plate, negative (DMSO only) and positive (LIF) controls were assigned to both sides and a compound was added to 80 wells. 200 BV (+) d4 PGCLCs induced from BDF1-2 ESC were seeded in the wells of a 96-well plate, and BV fluorescence was measured on the Cellavista cell analyzer on day 1 of culture (c1), c3, c5 and c7. The value of cell nucleus was used for the detection of BV fluorescence. Since the proliferation rate of d4 PGCLC was slightly different between experiments, the values from different experiments were adjusted based on the mean value of the negative control obtained from the first experiment. For each compound, the fold difference in BV fluorescence between c1 and c7 was calculated for each compound and compounds with a fold difference value exceeding 3SD of the mean of the negative control were identified as those that potentiate PGCLC proliferation.
Expansion Culture of d4 PGCLC and E9.5 PGC
[0163] Since the m220-5 feeder treated with MMC was vulnerable to forskolin and rolipram, m220-5 cells were subcultured 3 times with both forskolin and rolipram each at 10 M and adapted to these compounds before MMC treatment (1-2 g/ml for 2 hr). d4 PGCLC or E9.5 PGC(BDF1Stella-EGFP) was selected by FACS, and the cells were seeded on m220-5 cells in GMEM medium containing 10% KSR, 0.1 mM NEAA, 1 mM sodium pyruvate, 0.1 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 2 mM L-glutamine, 2.5% FCS, 100 ng/ml SCF, 10 M forskolin, and 10 M rolipram. Half of the culture medium was changed every 2 days.
Immunofluorescence
[0164] The following antibodies were used as the indicated dilution solutions: rabbit anti-MVH (1/250; Abeam ab13840); rabbit anti-DAZL (1/250; Abeam ab34139); mouse anti-OCT4 (1/250; BD 611203); mouse anti-5 mC (1/500; Abeam ab10805); rabbit anti-H3K27 me3 (1/500; Millipore 07-449); rabbit anti-H3K9 me2 (1/500; Millipore 07-441); rabbit anti-DNMT1 (1/100; Santa Cruz Biotechnology sc-20701); mouse anti-DNMT3A (1/200; Abeam ab13888); mouse anti-DNMT3B (1/200; Novus Biologicals NB100-56514); rabbit anti-UHRF1 (1/100; Santa Cruz Biotechnology sc-98817); and chicken anti-GFP (1/500; Abeam ab13970). The following secondary antibodies obtained from Thermo Fisher Scientific were used at 1/500 dilution: Alexa Fluor 568 goat anti-rabbit IgG; Alexa Fluor 568 goat anti-mouse IgG; Alexa Fluor 488 goat anti-chicken IgG. Phalloidin (1/40, Thermo Fisher Scientific A12380) conjugated with Alexa Fluor 568 was used to stain F-actin.
[0165] A protocol for immunofluorescence staining has been previously reported (Hayashi et al, 2011; Nakaki et al, 2013). For MVH, DAZL and OCT4 staining, d4c7 PGCLC (BDF1-2) was selected by FACS, mixed with male PGC at E13.5 at a ratio of 1:1, and spread on glass slides coated with MAS by using Cyto Spin 4 (Thermo Fisher Scientific). E13.5 male germ cells (ICR) were sorted by FACS using SSEA1 antibody conjugated with Alexa Fluor 647. For 5 mC, H3K27 me3 and H3K9 me2 staining, D4c7 PGCLC (BDF1-2) was selected by FACS, mixed with d2 EpiLC in a 1:1 ratio and spread on glass slides coated with MAS by using Cyto Spin 4 (Thermo Fisher Scientific). Images were captured with a confocal microscope (Zeiss, LSM780) and signal intensity was analyzed by ImageJ (NIH).
Measurement of cAMP Concentration
[0166] The intracellular cAMP concentration was measured using cAMPGlo Max assay kit (Promega) according to the manufacturer's instructions. A standard curve using purified cAMP was prepared by calculating the relative light unit (RLU) (RLU [0 nM]-RLU [X nM]). For each sample, 110.sup.4 d4 PGCLC was pretreated with forskolin and/or rolipram for 30 min at room temperature and the RLU (RLU [untreated sample-RLU [treated sample]) was calculated. An increase in the intracellular cAMP level due to chemical treatments was inferred from the cAMP standard curve. Three biological replicates were analyzed for each sample.
Cell Cycle Analysis
[0167] The cell cycle status of ESC, EpiLC, d4, d4c3, d4c5 and d4c7 PGCLC(BDF1-2) at E13.5, E14.5 and E15.5 and male germ cells was examined in the same manner as in a previous report (Kagiwada et al, 2013). To label the cultured cells, the cells were incubated with BrdU (10 M) for 30 min. To label gem cells, female mice (ICR) were mated with Stella-EGFP males and pregnant females were intraperitoneally injected with 1 mg BrdU and embryos were harvested 30 min later. Cultured cells or male gonads were dispersed in single cells by TrypLE treatment. To detect BrdU uptake, the APC-BrdU Flow Kit (BD Biosciences) was used according to the manufacturer's instructions. The stained samples were analyzed using BD FACSAriaIII (BD) with FACS Diva (BD) software, and PGCLC or male gem cells were respectively identified by BV or Stella-EGFP fluorescence. Three biological replicates were analyzed for each sample.
Transplantation of PGCLC into Testis of W/W.sup.v Mouse
[0168] After purification of PGCLC by FACS, 110.sup.4-110.sup.5 cells per testis were injected into the testes of randomly selected neonatal (7 days old) or adult W/W.sup.v mouse, as previously reported (Chuma et al, 2005). Where necessary, anti-mouse CD4 antibody (50 mg per dose, clone GK1.5; Biolegend) was injected intraperitoneally on day 0, 2 or 4 for immunosuppression (Kanatsu-Shinohara et al, 2003). To assess pregnancy, recipients at 10 weeks post-transplant were mated with BDF1 females. The genotype of BVSC transgene progeny was determined as previously reported (Ohinata et al, 2008). For HE staining, testis or epididymis was fixed with Bouin's solution and embedded in paraffin, and sections were produced.
In Vitro Fertilization
[0169] Spermatozoons were collected from the cauda epididymis and pre-incubated in HTF medium (Kyudo Co., Ltd.) for 1 hr at 37 C. Eggs were collected from BDF1 females that were superovulated by injecting PMSG and hCG and fertilized with sperm in HTF medium. The obtained 2-cell embryos were transferred to the fallopian tube of pseudopregnant ICR females 0.5 days after pregnancy (dpc). Pups were delivered by cesarean section at 18.5 dpc.
LacZ Staining
[0170] The seminiferous tubes were fixed with 2% paraformaldehyde and 0.2% glutaraldehyde in PBS at 4 C. for 1 hr. After washing 3 times with PBS, the seminiferous tubes were washed with X-gal solution (PBS containing 0.1% X-gal, 0.1% Triton X-100, 1 mM MgCl.sub.2, 3 mM IQ [Fe(CN).sub.6] and 3 mM K.sub.3 [Fe(CN).sub.6] and incubated at 37 C. for 2-3 hr.
DNA FISH and Immunofluorescence-DNA FISH in PGCLC
[0171] ESCs, EpiLCs, and female MEFs were dissociated with TrypLE, and d4, d4c3 and d4c7 PGCLCs were purified using FACS. Cell samples were transferred onto poly-L-lysine (Sigma)-coated glass coverslips in a small amount of PBS and adhered to the coverslips by absorbing excess medium before fixation. For DNA FISH, the cell samples on the coverslips were fixed in 3% paraformaldehyde (PFA) (pH7.4) for 10 min, permeabilized in 0.5% Triton X-100/PBS for 3 min on ice, and stored in 70% ethanol at 20 C. After dehydration with a dilution series of ethanol, the samples were denatured in 70% formamide/2SSC (pH 7.4) at 80 C. for 30 min, and dehydrated again with an ice-cold ethanol series. Then, the samples were hybridized with a fluorescent BAC probe for Huwe1 (RP24-157H12) at 37 C. overnight. Coverslips were counterstained with DAPI (1 g/ml) and mounted on Vectashield (Vector Laboratories).
[0172] Immunofluorescence followed by DNA FISH was performed as described previously (Chaumeil et al, 2004, 2008). The cell samples on the coverslips were fixed in 3% PFA (pH 7.4) for 10 min at room temperature. The cells were permeabilized on ice for 3 min in 0.5% Triton X-100/PBS. After washing with PBS, the prepared products were blocked in 1% BSA (Sigma)/PBS for 30 min, incubated with anti-H3K27me3 (1/200; Millipore) overnight at 4 C., then washed 3 times with PBS, and incubated with Alexa Fluor 488 anti-rabbit secondary antibody (1/500; Thermo Fisher Scientific) for 30 min at room temperature. After washing in PBS, the prepared products were fixed in 4% PFA for 10 min at room temperature and then washed with PBS. The prepared products were incubated in 0.7% Triton X-100, 0.1 M HCl for 10 min on ice. They were then washed twice in 2SSC for 10 min at room temperature. Finally, the prepared product were denatured in 70% formamide/2SSC (pH7.4) for 30 min at 80 C., immersed in ice-cold 2SSC and hybridized with the above-mentioned fluorescent BAC probe for Huwe1.
RNA Sequencing (RNA-Seq)
[0173] Using RNAeasy Micro Kit (Qiagen), total RNA was purified from d4, d6, d4c3, d4c5, and d4c7 PGCLC (two biological replicates each) of ESC, EpiLC and BV and SC double positive (sometimes to be abbreviated as BVSC(+) in the present specification). As reported previously (Kurimoto et al, 2006), ng RNA (corresponding to 1,000 cells) was subjected to cDNA replication method, and as reported previously (Nakamura et al, 2015), the 3-terminal was subjected to deep sequencing by the SOLiD 55001 system. Male/female germ cell-derived 1 ng RNA at j E10.5 PGC, E12.5 and E13.5 prepared in a previous study (Kagiwada et al, 2013), and cDNAs amplified from E9.5 PGC (two biological replicates each) were also subjected to RNA-seq.
Chromatin Immunoprecipitation Sequence (ChIP-Seq)
[0174] ChIP-seq was performed as reported previously (Kurimoto et al, 2015). In short, 110.sup.5-110.sup.6 BV(+)d4c7 PGCLC were purified by FACS and fixed with 1% formalin (Sigma) for 10 min at room temperature and then quenched with 150 mM glycine. The fixed cells were washed with PBS, lysed in a lysis buffer containing 1% SDS, and sonicated with Bioruptor UCD250 for 10 cycles with a high power for 30 sec. The solubilized chromatin fraction was incubated with M280 Dynabeads sheep anti-mouse IgG (Life Technologies) and a mouse monoclonal antibody against histone H3K4me3, H3K27ac, or H3K27me3 (Hayashi-Takanaka et al., 2011) in the complex while rotating overnight at 4 C. (two biological replicates each). After washing, chromatin was eluted in a buffer containing 1% SDS and 10 mM DTT. The eluate was reverse-crosslinked overnight at 65 C., treated with 4 g of proteinase K at 45 C. for 1 hr, and purified by Qiaquick PCR purification column (Qiagen). The ChIP-treated DNA and input DNA were then sheared by sonication (Covaris, Woburn, Mass.) to an average size of about 150 bp and subjected to a library preparation method (Kurimoto et al., 2015) for deep sequencing in the SOLiD55001 system in the previous report (Kurimoto et al, 2015).
Bisulfite Sequencing of Whole Genome (WGBS)
[0175] WGBS was performed as reported previously (Shirane et al, 2016). In short, BV positive d4c3 and d4c7 PGCLCs (two biological replicates each) purified by 10 mM tris-Cl (pH 8.0) containing 150 mM NaCl, 10 mM EDTA, 0.5% SDS and 1 mg/mL proteinase K were thawed at 55 C. with shaking overnight. The lysate was incubated with 1.32 g/ml RNase A at 37 C. for 1 hr, and extracted once with TE-saturated phenol, twice with phenol-chloroform, and once with chloroform. Genomic DNA was precipitated with an equal volume of isopropanol, washed twice with 70% ethanol, air-dried, and then dissolved in 10 mM Tris-Cl (pH 8.0). Purified genomic DNA (50 ng) was spiked with 0.5 ng unmethylated lambda phage DNA (Promega), and subjected to bisulfite conversion and library construction using post-bisulfite adaptor tagging (PBAT) method (Miura et al, 2012) for deep sequencing on the Illumina HiSeq 1500/2500 system as reported previously (Shirane et al, 2016).
Data Analysis of RNA-Seq
[0176] As described previously (Nakamura et al, 2015), RNA-seq read data was mapped onto the mouse mm10 genome by using cutadapt v1.3 (Martin, 2011), tophat v1.4.1/bowtie v1.0.1 (Kim et al, 2013), and cufflinks v2.2.0 (Trapnell et al, 2012), and annotated to a reference gene with the terminal region of the extended transcript. Expression levels were normalized to reads per million-mapped reads (RPM). Significant expression levels were defined as log.sub.2 (RPM+1)>3. Genes were considered to be expressed differentially when the fold changes in the expression level were greater than 2 (i.e., the difference in log.sub.2 (RPM+1) was greater than 1). Genes that were significantly expressed in at least one sample and were differentially expressed in at least one pair of comparison (10,437 genes) were used for principal component analysis (PGA) and unsupervised hierarchical clustering (UHC). Gene ontology (GO) of differentially expressed genes (Ashburner et al, 2000) was analyzed using the DAVID program (Huang da et al, 2009).
Data Analysis of ChIP-Seq
[0177] As reported previously (Kurimoto et al, 2015), read data of ESC, EpiLC, d6 PGCLC (Kurimoto et al, 2015), and d4c7 PGCLC was mapped onto the mouse mm10 genome by using bowtie v1.1.2 (Langmead et al, 2009), picard-tools v2.1.0 (http://broadinstitute.github.io/picard/), IGVtools v2.3.52 (Robinson et al, 2011), samtools v1.3 (Li et al, 2009), and MACS v2.1.0 (Zhang et al, 2008), and analyzed. Read pattern was visualized by IGV (Robinson et al, 2011).
[0178] H3K4me3 peaks with P values of less than 10.sup.5 and detected in close proximity (within 1 kb) were combined as a single peak, and read densities of the peaks within 500 bp from the center were normalized to those of Input (500 bp or more and within 5 kb thereof) (IP/input level). The H3K4me3 peak with the highest IP/input level located within 2 kb of TSS was considered as the peak associated with TSS. The IP/input level of the H3K4me3 peak associated with TSS was further normalized to that relating to genes with 95 percentile of the significant expression level and defined as the H3K4me3 level.
[0179] The H3K27ac peak with a P value smaller than 10.sup.20 detected in proximity (within 1 kb) was combined as a single peak. The read densities of peaks within 500 bp from the center were normalized to the mean of log.sub.2 IP/input levels and defined as H3K27ac levels. When the fold change in H3K27ac level was greater than 2, the H3K27ac peak was considered to be biased to d6- or d4c7.
[0180] The read densities of TSS (within 1 kb) and H3K27me3 in the region around the H3K4me3 peak and related to TSS were normalized by Input, and to define H3K27me3, normalized to the mean of IP/input levels of H3K27me3 around the TSS of a gene having an expression level with log.sub.2 (RPM+1) greater than 2.5 and smaller than 3.5.
Data Analysis of WGBS
[0181] Adapter trimming, mapping to mouse mm10 genome, and analysis of WGBS data were performed using Trim Galore! v0.4.1 (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/), cutadapt v1.9.1, and Bismark v0.15.0 (Krueger & Andrews, 2011), bowtie v1.1.2 and R program, as in the previous report (Shirane et al, 2016). The bisulfite conversion rate was estimated to be >99.5% using the lambda phage genome as a positive control.
[0182] As reported previously (HCP, ICP and LCP) (Borgel et al, 2010), the promoter was defined as the region 0.9 kb upstream and 0.4 kb downstream from the transcription start site, and classified into 3 categories according to the GC content and CpG density. Promoters with at least 5 CpGs were used for methylation analysis. The ICR coordinates defined in the E12.5 embryo were obtained from a previous publication (Tomizawa et al, 2011). For methylation analysis of repeat factors, the processed reads were mapped on repeat consensus sequence (Shirane et al, 2016) and CpG sites covering at least 4 reads were used. RepeatMasker (Smit, A F A, Hubley, R&Green, P. Repeat-Masker Open-4.0. 2013-2015 http://www.repeatmasker.org) was used to define uniquely mapped region that overlaps with repeat. For analysis of uniquely mapped whole genomic regions, 5mC levels in a 2 kb sliding window with 1 kb overlap were calculated.
[0183] For methylation analysis of uniquely mapped regions, CpG sites covering less than 4 reads and more than 200 reads were excluded. Therefore, the minimum sequence depth for calling methylated/unmethylated cytosine was 4. For methylation analysis of repeat factors, the processed reads were mapped on repetitive consensus sequences (RepBase19.0.4) and CpG sites covering at least 5 reads were used.
Accession No.
[0184] The accession number for RNA sequence data for d4c3/d4c5/d4c PGCLC and E9.5/E12.5 germ cells is GSE87644 (GEO database). RNA sequence data for ESC/EpiLC/d4/d6 PGCLC [BVSC (+)] (GSE67259) and E10.5/E11.5/E13.5 germ cells (GSE74094) were downloaded from the GEO database. The accession number for the ChIP sequence data of H3K4me3, H3K27ac, and H3K27me3 of d4c7 PGCLC is GSE87645 (GEO database).
[0185] ChIP sequence data of H3K4me3, H3K27ac, H3K27me3 of ESC/EpiLC/d2/d4/d6 PGCLC (GSE60204) was downloaded from the GEO database. The accession number of the WGBS sequence data of d4c3/d4c7 PGCLC is DRA005166 (DDBJ database). WGBS sequence data of ESC/EpiLC/d2/d4/d6 PGCLC (DRA003471) and E10.5/E13.5 PGC (DRA000607) were downloaded from the DDBJ database.
<Results>
[0186] Screening for Compound that Amplifies PGCLC
[0187] Male stem cell lines of some novel mouse embryonic stem cells (ESC) having Blimp1-mVenus and Stella-ECFP (Blimp1-mVenus is also called BV, Stella-ECFP is also called SC) transgene (Ohinata et al, 2008) were obtained, and the efficiency thereof in induction and proliferation of PGCLC was evaluated. All ESC lines were induced into EpiLC by activin A (ActA) and basic fibroblast growth factor (bFGF) and induced by bone morphogenetic protein 4 (BMP4), leukemia inhibitory factor (LIF), stem cell factor (SCF), and epidermal growth factor (EGF) into BV positive or BV and SC double positive (sometimes abbreviated as BV/BVSC (+) in the present specification) PGCLC. The number of BV(+) PGCLC in floating aggregates increased until day 6 (d6) or day 8 (d8) of induction and then decreased. This is in agreement with a previous report of the present inventors (Hayashi et al, 2011). Of the strains evaluated, BVSC BDF1-2 showed the strongest induction and proliferation in floating aggregates. This strain was used for subsequent screening.
[0188] d4 PGCLC seemingly in a proliferation period in floating aggregates was seeded on a 96-well plate together with m220 feeder (Dolci et al, 1991; Majumdar et al, 1994) expressing a membrane-bound SCF known to support the survival of PGC. In addition, it was decided to screen for compounds that enhance the proliferation of BV(+) PGCLC by using a cell analyzer (
[0189] In addition, 426 and 178 compounds negatively affecting the proliferation or survival of BV(+) cells were respectively identified from the 10 and 1 M screening (fold reduction of BV fluorescence between days 1 and 7 of culture was greater than the negative control mean 3SD:
Synergistic Effect of Rolipram and Forskolin on PGCLC Expansion
[0190] Of the hit compounds, the PDE4 inhibitor was the most concentrated compound (
[0191] To investigate whether forskolin and rolipram actually increased cAMP concentration in PGCLC, an increase in cAMP concentration in PGCLC in response to forskolin, rolipram, or both was measured. As shown in
[0192] FR10 was effective in amplifying PGCLC derived from other male and female ESC strains at an average expansion rate of about 20 times on day 7 of culture. In some cases, PGCLC was amplified about 50-fold, corresponding to 5-6 doublings (
Potent Ability of Spermatogenesis of Expansion Cultured PGCLC
[0193] Next, it was evaluated whether PGCLC amplified by FR10 maintained the function as PGC/PGCLC during culture. To this end, d4c7 and d4 PGCLC induced from BVSC BDF1-2, BCF1-2, or R8 (mainly C57BL/6) ESCs were transplanted into the testes of neonatal W/Wv mice lacking endogenous germ cells. Testes transplanted with d4c7 PGCLC and d4 PGCLC derived from BVSC BDF1-2 or BCF1-2 ESC showed a marked increase in size 7 months after transplantation (
[0194] In contrast, testes transplanted with BVSC R8 ESC-derived d4c7 or d4 PGCLC showed only a modest increase in size, reduced number of seminiferous tubules with spermatogenesis, and the resulting spermatozoon did not reach cauda epididymis. Nevertheless, as previously reported (Hayashi et al, 2011), intracytoplasmic injection (ICSI) of the resulting spermatozoon was able to obtain clearly normal offspring. Importantly, as in the case of d4/d6 PGCLC or PGC (Ohta et al., 2004), d4c7 PGCLC derived from either ESC strain failed to colonize adult testes. Teratoma formation was not observed in any of the transplants. Taken together, these findings show that PGCLC amplified by FR10 during culture faithfully maintain its original functional properties, and PGCLC with a hybrid genetic background is sufficiently strong to reconstitute spermatogenesis in infertile mice. Thus, the recipient mice produce offspring by natural mating.
Transcription Property of PGCLC in Expansion Culture
[0195] Next, detailed transcriptional properties of PGCLC in expansion culture were determined. First, immunofluorescence (IF) analysis showed that d4c7 PGCLC expressed higher levels of OCT4 compared to E13.5 male germ cells, whereas PGC expressed lower levels of DDX4 and DAZL that are major translation regulatory factors that gradually upregulate after embryonic gonadal colonization (Fujiwara et al., 1994; Cooke et al., 1996) (some d4c7 PGCLCs fully express DAZL) (
[0196] Consistent with UHC and PCA between PGCLCs, DEG between d4c7 and d6 PGCLCs progressively acquired such a state in culture (
Epigenetic Property of PGCLC During Expansion Culture
[0197] To explore the mechanisms governing the properties of cultured PGCLC, their epigenetic profile was determined. IF analysis revealed that d4c7 PGCLC had lower 5-methylcitron (5mC) levels compared to EpiLC (
[0198] Therefore, whole genome bisulfite sequencing (WGBS) was used to quantify the genome-wide level and distribution of DNA methylation in d4c3 and d4c7 PGCLC (derived from BVSC R8 ESC). In addition, chromatin immunoprecipitation sequence (ChIP-seq) followed by massively parallel sequencing was used to quantify genome-wide levels and distribution of H3K4me3 (indicating promoter activity), H3K27 acetylation (ac) (indicating activity enhancer), and H3K27me3 in d4c7 PGCLC (derived from BVSC R8 or BDF1-2ESC). In addition, the data was analyzed compared to the data on major cell types (ESCs, EpiLCs, and d2, d4 and d6 PGCLC) during the recently reported induction of PGCLC (Kurimoto et al., 2015; Shirane et al., 2016). Bisulfite sequencing does not distinguish 5mC and 5-hydroxymethylcytosine (5hmC) (Hayatsu&Shiragami, 1979), and since the 5hmC level during induction of PGCLC is almost negligible (Shirane et al, 2016), 5mC and 5hmC are collectively referred to as 5mC below.
Comprehensive Elimination of DNA Methylation in Cultured PGCLC
[0199] Next, a more detailed analysis of the kinetics of 5mC level during PGCLC culture was performed. CpH (H=A, C, or T) methylation is restricted during the induction of PGCLC (Shirane et al, 2016) and has been shown to have no clear biological role in mammalian cells (Schubeler, 2015). Thus, 5mCs of CpG was focused on. As a key parameter for genome-wide DNA methylation status, the average of 5 mC levels of the whole unique sequence region was determined (unique region: 2 kb sliding window with 1 kb overlap). Promoters (high, medium, and low CpG density promoters: HCP, ICP, and LCP, respectively) (Weber et al., 2007), consensus sequence of repeat factor [long interspersed repeat 1 (LINE1); intracapsular A particle (IAP); Endogenous retroviral sequences (ERV) other than IAP; major and minor satellites], and the imprinted regulatory region (ICR) of the imprinted gene were determined separately. In addition, non-promoter CpG island (CGI), exons, intron, intergenic region, cell type-specific enhancer (Kurimoto et al., 2015), and 5mC level of germline gene CGI (Weber et al, 2007; Borgel et al, 2010; Kurimoto et al, 2015) were determined.
[0200] As previously reported, PGCLCs showed a serial dilution of 5mCs established with EpiLCs having DNA methylomes very similar to blastoderm, as a result of which d6 PGCLCs acquire about 37% on average of 5mC levels (state considered to be similar to the mobile PGC at about E9.0-9.5). Surprisingly, consistent with analysis of the Prdm14 and Hoxb loci, continuous dilutions of 5mC levels of d4/d6 cells were present in cultured PGCLC with different kinetics for unique region, repeat, and distinct regulatory elements. As a result, d4c7 cells had only about 6% mean 5mC level (
[0201] Therefore, the effect of promoter demethylation on transcriptional activation in d4c7 PGCLC was investigated. As many as 7,737 promoters were demethylated between d6 PGCLC and d4c7 PGCLC (5 mC>20% for d6, <20% for d4c7), reflecting global DNA demethylation in cultured PGCLC (
Compensatory Up-Regulation of H3K27 Me3 Demethylated Promoter in Cultured PGCLC
[0202] Next, the kinetics of the distribution of H3K4me3, H3K27ac and H3K27me3 during the induction and expansion of PGCLC was analyzed. Similar to the major cell types during PGCLC induction, high levels of H3K4me3 bound predominantly to HCP in d4c7 PGCLC, and H3K4me3 levels around the transcription start site (TSS) were positive for expression levels of related genes (Ohta et el., 2017. Fig. EV5A and B). This reflected the transcriptional similarity between d6 PGCLC and d4c7 PGCLC, and the H3K4me3 profile across the genome was similar between d6 PGCLC and d4c7 PGCLC. Importantly, the distribution of H3K27ac showing the use of enhancers and showing highly dynamic changes between different cell types (Calo & Wysocka, 2013) and during PGCLC induction (Kurimoto et al, 2015) was also similar between d6 PGCLC and d4c7 PGCLC (
[0203] The distribution pattern of H3K27me3 also appeared to be very similar between d6 PGCLC and d4c7 PGCLC (
[0204] A bivalent promoter that activates H3K4me3 and suppresses H3K27me3, which serves to a state that supports and triggers the activation of proper developmental (Voigt et al, 2013), was evaluated (for the definition of bivalent, see Materials and methods). Consistent with a previous report (Kurimoto et al, 2015), the number of bivalent genes was highest in EpiLC among j major cell types, and d6 and d4c7 PGCLC showed similar numbers of bivalent genes (
[0205] X-chromosome dynamics in female PGCLC and female ESC have two activated X chromosomes (XaXa) and show lower genome-wide 5mC levels compared to male ESCs (Zvetkova et al, 2005; Shirane et al, 2016). The majority of female EpiLCs carry XaXa, which undergoes X inactivation during floating aggregate formation, and female mPGCLC show one Xa and one inactive X chromosome (XaXi) (Hayashi et al, 2012; Shirane et al, 2016). Next, X chromosome dynamics during the growth of female PGCLC in culture were evaluated. Since female ESCs can lose one X chromosome to become XO (Robertson et al, 1983; Zvetkova et al, 2005), the extent of maintenance of the two X chromosomes during PGCLC induction and proliferation from female ESCs of two lines (BVSC H14 and H18 (129sv/C57BL/6 background)) were first investigated by the DNA fluorescence in situ hybridization (FISH) analysis of Huwe1 of an X-linked gene. As shown in
[0206] Next, the present inventors investigated the Xa/Xi state during the expansion of PGCLC by evaluating H3K27me3 positivity on the X chromosome. As shown in
[II] Induction of Oocyte-Like Cell from PGC/PGCLC
[0207] For the detail information of the document cited below, see Miyauchi, H. et al., EMBO J., 36(21): 3100-3119 (2017).
<Materials and Methods>
Animal
[0208] All animal experiments were performed under the ethical guidelines of Kyoto University. BVSC (Acc. No. BV, CDB0460T; SC CDB0465T: http://www.cdb.riken.jp/arg/TG %20 mutant %20 mice %20 list.html), Stella-EGFP(SG) and mVH-RFP(VR) transgenic mice were established as previously reported (Payer et al, 2006; Seki et al, 2007; Ohinata et al, 2008; Imamura et al, 2010), and maintained primarily in the C57BL/6 background. Daz1-tdTomato(DT) mice were generated by injecting BVSCDT ESC(XY) into blastocysts (ICR) and then transferring same to a foster parent. ICR mice were purchased from SLC (Shizuoka, Japan). The noon of the day when the vaginal plug was identified was designated as 0.5 days of embryonic period (E).
[0209] To administer LDN-193189 to pregnant females (ICR), LDN-193189 (sm10559; Sigma-Aldrich) is dissolved in sterile water, and 2.5 mg LDN-193189 was injected intraperitoneally every 12 hours from E11 to E14 per kg body weight.
ESC Culture/Induction and PGCLC Induction/Culture
[0210] H8 BVSC ESC(XX) (Hayashi et al, 2012), R8 BVSC ESC(XY) (Hayashi et al, 2011), L9 BVSCVR ESC(XX), L5 BVSCVR ESC(XY), BVSCDT ESC (XY; R8 subline), BDF1-2-1 BVSC ESC(XY) (Ohta et al, 2017), and Stra8knockout BVSC ESC (SK1,2,3; XY; BDF1-2-1 subline) were used for this study. L5 and L9 BVSCVR ESCs were established from blastocysts obtained by mating VR females (Imamura et al, 2010) with BVSC males (Ohinata et al, 2008) according to previously described procedures and adapted to feeder-free condition (Hayashi et al, 2011). The establishment procedures of BVSCDT and Stra8knockout ESC are described in the sections Establishing the BVSCDT ESC and Establishing the Stra8 knockout ESC below, respectively.
[0211] ESC culture and PGCLC induction was performed as described previously (Hayashi et al, 2011; Hayashi & Saitou, 2013) with some modifications. ESCs were maintained under 2i+LIF conditions on dishes coated with poly-L-ornithine (0.01%; Sigma) and laminin (300 ng/ml; BD Biosciences) or on mouse embryonic fibroblasts (MEFs). EpiLC was induced by plating 1.010.sup.5 ESC in N2B27 medium containing activin A (20 ng/ml; PeproTech), bFGF (12 ng/ml; Life Technology) and KSR (1%; Thermo Fisher), on the wells of a 12-well plate coated with human plasma fibronectin (16.7 g/ml; Millipore). 42-46 hours after EpiLC induction, PGCLC was induced under suspension conditions by plating 2.010.sup.3 EpiLC in 200 l of GK15 medium containing BMP4 (500 ng/ml; R & D Systems), LIF (1,000U/ml; Merck Millipore), SCF (100 ng/ml; R & D Systems) and EGF (50 ng/ml; R & D Systems) in wells of low-cell binding 96-well lipidure-coated plates (Thermo Fisher). The GK15 medium was constituted of GMEM (Thermo Fisher) containing 15% KSR, 0.1 mM NEAA, 1 mM sodium pyruvate, 0.1 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM L-glutamine. PGC/PGCLC culture was performed as described previously (Ohta et al, 2017). In short, d4 PGCLC aggregates were collected, washed with PBS and dissociated with TrypLE Express (Thermo Fisher). They were then washed with DMEM/F12+0.1% BSA (Gibco) and filtered on a cell strainer (BD Bioscience) to remove large cell clumps. The samples were then centrifuged, resuspended in 0.1% BSA-PBS and sorted by FACS (Aria III; BD Bioscience). BV (+) cells were seeded on mitomycin C (MMC)-treated m220 feeder cells in PGC/PGCLC expansion medium.
[0212] The PGC/PGCLC expansion medium was constituted of 10% KSR, 2.5% FBS, 0.1 mM NEAA, 1 mM sodium pyruvate, 2 mM L-glutamine, 0.1 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml GMEM streptomycin, 10 pH forskolin, and 10 M rolipram. The entire medium was changed every 2 days from c3. Cytokines/compounds for induction of female fate were provided from c3 to the end of culture. RA and BMP concentrations used were 100 nM and 300 ng/ml, respectively, unless otherwise specified. Brightfield and fluorescence images were captured using an IX73 inverted microscope (Olympus).
Establishment of BVSCDT ESC
[0213] To construct a donor vector for the production of Daz1-tdTomato (DT) knockin ESCs, the homology arms of Daz1 (fragments from 1,048 bp upstream and 1,247 bp downstream of the stop codon, respectively) were amplified from genomic DNA of R8 BVSC ESC by PCR (Primers) and subcloned into pCR2.1 vector (TOPO TA Cloning; Life Technologies). The P2A-tdTomato fragment with the Pgk-Puro cassette flanked by LoxP sites was amplified by PCR from a previously reported vector (Sasaki et al, 2015) and inserted in frame into 3-terminal (containing homology arm) of the Daz1 coding sequence of the subcloned vector by using GeneArt Seamless Cloning & Assembly Kit (Life Technologies). The stop codon was removed for expression of the in-frame fusion protein.
[0214] TALEN constructs targeting sequences flanking the stop codon of Daz1 were generated using the GoldenGate TALEN and TAL Effector kit (Addgene #1000000016) as previously described (Sakuma et al, 2013; Sasaki et al, 2015). The TALEN activity was assessed by single-strand annealing (SSA) assay.
[0215] Donor vector (5 g) and TALEN plasmid (10 g each) were introduced into R8 BVSC ESC by electroporation using NEPA21 type II electroporator (Nepagene). Single colonies were picked after puromycin selection and random or targeted integration was assessed by PCR (Primers), followed by Southern blot analysis. A strain with correct targeting was transfected with a plasmid expressing Cre recombinase to remove the Pgk-Puro cassette.
Establishment of Stra8 Knockout Esc
[0216] A vector expressing the Cas9 nickase (Addgene #42335) fused in-frame with the reporter gene GSG-p2A-mCherry was constructed (the mCherry used contained a silent mutation, 432G>A). According to the reported protocol (Ran et al, 2013a, b), two pairs of oligonucleotides (Primers) for targeting exon 6 of Stra8 were annealed, phosphorylated and ligated separately to the above vector digested with Bbs1 (NEB). Nickase activity was assessed by SSA assay. A pair of nickase plasmids (200 ng each) was introduced into BDF1-2-1 BVSC ESC by electroporation using NEPA21 type II electroporator. ESCs were dissociated 2 days after transfection, single cells expressing high levels of mCherry and also expected to express high levels of Cas9 nickase were sorted by FACS and seeded on MEFs in single wells of 96-well plates such that each well contained a single clone. Clones were cultured, expanded, and disruption of the Stra8 locus in the clones was assessed by Sanger sequencing (Primers) of PCR products of the relevant region. Stra8 knockout was confirmed by Western blot and IF analysis.
Ex Vivo Culture of PGC or Fetal Gonadal
[0217] For PGC culture, fetal gonads of SG mice at E11.5 (without gender discrimination) were cut and dissociated. SG (+) PGCs were selected by FACS, plated on m220 feeder cells, and cultured in PGC/PGCLC expansion medium. Reagents for induction of female fate were provided from c0. For fetal gonadal culture, the ovary of the embryonic stage, including the E11.5 [identified by PCR (Primers)] mesonephros, was removed and cultured under conditions of the gas-liquid interface on the culture medium insert (353095; BD Falcon). The medium used was DMEM containing 10% FBS, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM L-glutamine. Small molecule inhibitors were provided with medium from c0.
Fluorescence Activation Cell Sorting, Cell Cycle Analysis, and Cell Count
[0218] The preparation of d4/c0 PGCLC for FACS is described in ESC culture/induction and PGCLC induction/culture. To isolate germ cells in vivo, fetal gonads of BVSC, VR or SG mice were cut and processed for FACS according to the procedure described for d4/c0 PGCLC. Culture PGCLC was also prepared by the same method except that, after dissociation, the cells were washed with 0.1% BSA-DMEM containing 100 g/ml DNase (Sigma-Aldrich), lysed DNA from dead cells was digested to prevent the formation of cell/debris clumps. Fluorescent activity of BV/SG, SC, or DT/VR was detected with FITC, Horizon V500 or PE-Texas Red channels, respectively. FACS data was analyzed using FlowJo or FACS Diva software package.
[0219] Cell cycle analysis was performed using the Click-iT EdU Flow Cytometry Assay Kit (C10424; Thermo Fischer Scientific) according to the manufacturer's instructions. Cultured PGCLC was treated with 10 g/ml EdU for 30 min to 2 hr and analyzed by FACS.
[0220] Cultured PGCLC was stained with chicken anti-GFP antibody, followed by Alexa Fluor 633-goat anti-chicken antibody and analyzed using Cellavista instrument (SynenTec) (Ohta et al, 2017).
Cytokine/Compound
[0221] The cytokines/compounds used to screen for activities involved in female fate induction were as follows (
Immununofluorescence (IF) Analysis
[0222] Immunofluorescence (IF) analysis was performed as described previously (Hayashi et al, 2012). The following primary antibodies were used: chicken anti-GFP (ab13970; Abeam), rabbit anti-DDX4 (ab13840; Abeam), mouse anti-DDX4 (ab27591; Abeam), rabbit anti-DAZL (ab34129; Abeam), goat anti-DAZL (sc-27333; Santa Cruz), rabbit anti-STRA8 (ab49602; Abeam), mouse anti-SYCP3 (ab97672; Abeam) and rabbit anti-TEX14 (ab41733; Abeam)IgG. The following secondary antibodies were used: Alexa Fluor 488-goat anti-mouse or chicken IgG; Alexa Fluor 568-goat anti-rabbit IgG and Alexa Fluor 633-goat anti-mouse, anti-chicken IgG; Alexa Fluor 488-donkey anti-mouse IgG; Alexa Fluor 568-donkey anti-rabbit IgG and Alexa Fluor 633-donkey anti-goat IgG. IF images were acquired using a confocal microscope [FV1000 (Olympus) or LSM780 (Zeiss)].
Spread Analysis of Meiotic Chromosome in Fetal Oocyte-Like Cell
[0223] Spread preparation and IF analysis were performed with slight alteration and as described previously (Yamashiro et al, 2016). c9 RAB2 cells were sorted by FACS, sorted cells were washed with PBS and treated with hypotonic extraction solution at 25 C. for 1 hr. The primary antibodies used are as follows: goat anti-SCP3 (1:250; sc-20845; Santa Cruz), mouse anti-H2AX (1:1,000; 05-636; Millipore) and rabbit anti-SCP1 antibody (1:250; NB300-229; Novus). The secondary antibodies used are as follows: Alexa Fluor 488-donkey anti-goat IgG (A11055; Thermo Fisher), Alexa Fluor 568-donkey anti-rabbit IgG (A10042; Thermo Fisher), and Alexa 647-donkey anti-mouse IgG (A31571; Thermo Fisher). The present inventors counted SYCP3 (+) cells. The definition of the meiotic stage was as follows: at least 80% of the chromosomes, thread stage: H2AX (+) and SYCP1 (); mating stage: H2AX (+) and SYCP1 (+). Thick thread period: SYCP1 (++).
Southern Blot Analysis
[0224] Southern blot analysis was performed as described previously (Nakaki et al, 2013). Briefly, 10 g of genomic DNA was digested with restriction enzymes, the resulting DNA fragment was electrophoresed on a 0.9% agarose gel, transferred to Hybond N+membrane (RPN303B; GE Healthcare) and baked for crosslinking. A DIG-labeled probe for tdTomato and 5 and 3 prime sides of the relevant region of Daz1 were generated by PCR (PCR DIG Labeling Mix; Sigma-Aldrich) (Primers). Images were captured using LAS4000 (Fujifilm).
Western Blot Analysis
[0225] For Western blot analysis, 510.sup.4 cells were lysed in SDS sample buffer [62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 0.025% bromophenol blue and 0.14 M-mercaptoethanol] at 90 C. for 5 min. For detection of phosphorylated (p)SMAD1/5/8, the cells were treated with PhosSTOP (Roche) and complete protease inhibitor cocktail (Roche) before lysis. The extracted protein was separated by SuperSep Ace 10-20% gel (Wako), blotted on iBlot2 PVDF transfer membrane (Thermo Fisher) by iBlot2 dry blotting system (Thermo Fisher), and incubated with the primary antibody: rabbit anti-STRA8 IgG (ab49405; Abeam), mouse anti- tubulin (T9026; Sigma-Aldrich), rabbit anti-pSMAD1/5/8 IgG (#9511; CST), or rabbit anti-SMAD1 IgG (#97435 CST). Primary antibodies were detected with goat anti-rabbit IgG or sheep anti-mouse IgG conjugated to HRP (A0545, M8642; Sigma-Aldrich), followed by Chemi-Lumi One Super (Nacalai). Chemiluminescence image acquisition and analysis was performed using the Fusion Solo system and Fusion-Capt software (M & S Instruments).
Transcriptome Analysis
[0226] E14.5 and E15.5 male and female germ cells were used as VR (+) cells, cultured PGCLC were used as SC(+) cells, and collected by FACS, and total RNA of the sample was analyzed using RNeasy Micro Kit (74004; QIAGEN) according to the manufacturer's instructions. cDNA synthesis, library construction, and analysis with Nextseq 500 (Illumina) from 1 ng of total RNA from each sample were performed according to the methods described previously (Nakamura et al, 2015; Ishikura et al, 2016). The germline cDNAs from E9.5 to E13.5 prepared in previous studies (Kagiwada et al, 2013; Ohta et al, 2017) were also analyzed by the Nextseq 500 sequencer system. All readings were converted to expression levels as previously described (Nakamura et al, 2015). Briefly, all reads were treated with cutadapt-1.3 (Martin, 2011) to remove VI and V3 adapter sequences and poly A sequences. The resulting reads of 30 bp or above were mapped to the mm10 genome using TopHat1.4.1/Bowtie1.0.1 using the -no-coverage-search option (Kim et al, 2013). The mapped reads were then converted to expression levels (RPM) using cufflinks-2.2.0 with -compatible-hits-norm, no-length-correction, -max-mle-iterations 50000, and library-type fr-secondstrand option and mm1-reference gene annotation of maximum 10-kb at 30 endo. The total set of genes analyzed was the same as in the previous study (Ishikura et al, 2016). Transcriptome analysis was performed using the R software package version 3.2.1 with the gplots package and Microsoft Excel. First, the raw expression data was converted to log.sub.2 (RPM+1) values and genes with expression values >2 in at least one sample were defined as expression unless particularly indicated. Data processing (e.g., DEG identification) was performed by using the average of the biological replicates, with the exception of heat maps, clustering and PGA construction. The gplots package (heatmap.2) was used to create the heatmap. Gene Ontology (GO) analysis was performed using the DAVID 6.7 website (https://david.ncifcrf.gov) (Huang da et al, 2009).
Quantitatively (g) PCR
[0227] qPCR was performed using CFX384 (Bio-Rad) and Power SYBR Green (ABI, Foster City, Calif.) according to the manufacturer's instructions. Template cDNA was prepared as described in the Transcriptome analysis section and the primers used are listed in Primers.
Analysis of DNA Methylation of Promoter
[0228] Whole genome bisulfite sequencing (WGBS) data for ESCs, EpiLCs, and PGCLCs were obtained from a previous study of the present inventors (Shirane et al, 2016; Ohta et al, 2017) and those of KIT () and KIT (+) spermatogonia were obtained from a previous study (Kubo et al, 2015). Here, the present inventors defined the promoter as a region from 900 bp upstream to 400 bp downstream of the transcription start point (TSS), and calculated all percent 5 methylcytosine values (% 5 mC) from the average value of CpG. The read depth was 4-200, as previously described (Ishikura et al, 2016). In the analysis in this study, a promoter with at least one CpG site was used.
Primer
[0229] The primer sequences used in this study were as follows: Sex-typing:
TABLE-US-00002 Ubalforward: (SEQIDNO:1) TGGATGGTGTGGCCAATGCYCT reverse: (SEQIDNO:2) CCACCTGCACGTTGCCCTTKGTGCCCAG Dazl-tdTomatovectorconstruction: Dazlforward: (SEQIDNO:3) AGAATCTGGTCCACAGGAAAAGGGCCTGAT reverse: (SEQIDNO:4) AGGCTTAGCCCCTGAGCTGCTTGTTAACTG genotypeforward: (SEQIDNO:5) AATAGACCCTAACCAGTTGGTGCAT reverse: (SEQIDNO:6) AAGAGTAAGTGGAATCCATGTTGAAGGA randomincorporationcheckforward: (SEQIDNO:7) CCGGATGAATGTCAGCTACTGGGCTATCTG reverse: (SEQIDNO:8) TTCGGGGCGAAAACTCTCAAGGATCTTACC ForStra8knockoutcellgenerations: nickaselforward: (SEQIDNO:9) CACCgGAGATGGCGGCAGAGACAAT reverse: (SEQIDNO:10) AAACATTGTCTCTGCCGCCATCTCc knickers2forward: (SEQIDNO:11) CACCgCCTGTGGCAGACTCTCTCTG reverse: (SEQIDNO:12) AAACCAGAGAGAGTGCCACAGGc sequencecheckforward: (SEQIDNO:13) TAAGGCCAGGGGAAGGCAGAC reverse: (SEQIDNO:14) CGAAGGGCCATCTCACAGGGTC SouthernblotanalysisofDazl-tdTomatogenelocus: 5probeforward: (SEQIDNO:15) GGAGGCAAAGACAGGATCCTAAGCAAACTA reverse: (SEQIDNO:16) TCCCTAGTGCTCTATAAAATTGAGGTAATT tdTomatoprobeforward: (SEQIDNO:17) CCGCCGACATCCCCGATTAC reverse: (SEQIDNO:18) GCAGTTGCACGGGCTTCTTG 3probeforward: (SEQIDNO:19) ACCAGAAAACTAAGAAGTGTCCTGAA reverse: (SEQIDNO:20) AGACAGGACAGTAAGTCAGTGATGCT qPCRanalysis: Id1forward: (SEQIDNO:21) CAACAGAGCCTCACCCTCTC reverse: (SEQIDNO:22) AGAAATCCGAGAAGCACGAA Id2forward: (SEQIDNO:23) CACAAAGGTGGAGCGTGAATAC reverse: (SEQIDNO:24) GCATTCAGTAGGCTCGTGTCAA Ddx4forward: (SEQIDNO:25) CAGCTTCAGTAGCAGCACAAG reverse: (SEQIDNO:26) CATGACTCGTCATCAACTGGA Daz1forward: (SEQIDNO:27) GATGGACATGAGATCATTGGAC reverse: (SEQIDNO:28) ATACCAGGGAGCAATCCTGAC Stra8forward: (SEQIDNO:29) GCCGGAGAAGGAGGAGATTAAA reverse: (SEQIDNO:30) AGCAGCCTTTCTCAATGAGTCT Sycp3forward: (SEQIDNO:31) GTGTTGCAGCAGTGGGAAC reverse: (SEQIDNO:32) GCTTTCATTCTCTGGCTCTGA Prdm9forward: (SEQIDNO:33) CCTGGCTACAAATTCTCATTTTC reverse: (SEQIDNO:34) TGTTTTTGTTTGTTTTGTTTTGGGA Spo11forward: (SEQIDNO:35) AGCATGAAGTGTCTCACTAGCA reverse: (SEQIDNO:36) CATTAACAGGGCAAGGCACCTA Nanos2forward: (SEQIDNO:37) AGAGAAGAATGCCAGTTGGGTT reverse: (SEQIDNO:38) ACAACGCTTTATTCAGCAGCAG Dnmt31forward: (SEQIDNO:39) TCGGGTTTCTCTCCTGTTTG reverse: (SEQIDNO:40) GTTATCCCACCGGGAACTTG Ppiaforward: (SEQIDNO:41) TTACCCATCAAACCATTCCTTCT reverse: (SEQIDNO:42) AACCCAAAGAACTTCAGTGAGAGC Rp1p0forward: (SEQIDNO:43) CAAAGCTGAAGCAAAGGAAGAG reverse: (SEQIDNO:44) AATTAAGCAGGCTGACTTGGTTG Pou5f1forward: (SEQIDNO:45) GATGCTGTGAGCCAAGGCAAG reverse: (SEQIDNO:46) GGCTCCTGATCAACAGCATCAC
Accession NO.
[0230] The accession numbers of the data used in this study are as follows: RNA-seq data of E10.5 and E11.5 PGC and E13.5 female germ cells in
<Results>
System to Analyze Sex Determination Mechanism of Germ Cells
[0231] As described in detail in [I] above, the present inventors developed a system to grow PGCLCs up to 50-fold during 7 days of culture on m220 feeder cells in the presence of stem cell factor (SCF) and cAMP signaling forskolin and loripram stimulating factor (
[0232] The present inventors investigated this possibility by focusing on differentiation into a female pathway characterized by entry into early meiosis. One prerequisite for PGCLC differentiation into the female pathway is the acquisition of late PGC property characterized by the expression of genes such as Daz1 and Ddx4 [also known as mouse vasa homolog (mVH)], both of which are expressed at low levels in PGCLC/migratory PGC and show progressive up-regulation in germ cells up to E13.5 (
[0233] The present inventors first induced BVSCDT ESC(XY) into PGCLC and isolated BV-positive (+) day 4 (d4) PGCLCs by fluorescence-activated cell sorting (FACS) for growth culture. At day 3 (c3) of culture, when PGCLCs were growing exponentially, cultures were given a panel of cytokines that may affect sex determination in the presence or absence of RA, and at c7, their effects on BV or DT expression were assessed by FACS (forskolin, loripram, and SCF were given throughout the culture) (
[0234] Bmp2 is strongly expressed in response to the important feminizing factor Wnt4 in anterior granule membrane cells, which can guide the fate of female germ cells (Yao et al, 2004; Jameson et al, 2012). Therefore, the present inventors next investigated whether RA and BMP2 also elevated VR in cultured PGCLCs induced from BVSCVR ESC (XX). The present inventors cultured BV(+)d4 PGCLCs with varying concentrations of RA and BMP2 at c3 and examined their effects on BVSCVR expression at c9 (
[0235] By immunofluorescence (IF) analysis, the present inventors analyzed the expression of DDX4 and SCP3 (also known as SYCP3) (Yuan et al., 2000), an important component of the synaptonem complex and a marker of early meiosis, at c9 in cultured PGCLC with RA and BMP2 [Yuan et al., 2000], which were induced from BVSC ESC (XX) to secure one fluorescent channel]. BV or SC-positive (sometimes abbreviated as BV/SC(+) in the present text) cells expressed DDX4 and SCP3 in a very similar fashion to E15.5 protoplasts: DDX4 localized specifically to the cytoplasm and SCP3 showed a distinct pattern of localization indicating synaptonem complex formation. Furthermore, DDX4/SCP3(+) cells appeared to be interconnected, reminiscent of the formation of oocyte cysts (
BMP and RA Commit PGCLC to Female Fate
[0236] The present inventors further investigated the effects of RA and BMP signaling on PGCLC induced from BVSCVR ESC (XX), since VR shows a more specific response to RA and BMP (
[0237] IF analysis showed that PGCLCs cultured with RA and BMP2 initiated expression of the important mitogenic factor STRA8 (Baltus et al, 2006; Anderson et al, 2008; Dokshin et al, 2013; Soh et al, 2015) early in c5 [40.7%/SC (+) cells], while the majority (91.7%) of SC (+) cells expressed STRA8 in c7, some of which (27.1%) were SCP3 (+) (
[0238] Entry of meiosis is characterized by pre-meiotic DNA replication and arrest in the quadruple chromosome (4C) state (Baltus et al., 2006). In the presence of RA and BMP2, BV/SC(+) cells showed an enhancement of proliferation up to c5, stopped proliferation by c7, and decreased to about half of the peak number thereof by c9 (
[0239] Under the conditions adopted by the present inventors, RA alone was insufficient to induce female germ cell fate. PGCLC cultured with RA activated DT/DAZL to some extent and up-regulated STRA8 [77.7% of BV/SC(+) cells expressed STRA8], but RA did not activate VR/DDX4 or SCP3 (
BMP and RA Commit PGC to Female Fate
[0240] The present inventors next examined the role of RA and BMP signaling in female sex determination in PGC. The present inventors isolated PGC at E11.5 from Stella-EGFP (SG) transgenic embryo (Payer et al., 2006; Seki et al., 2007) by FACS and cultured same with RA, BMP2, or both for 4 days (
[0241] The present inventors performed culture of whole embryonic ovaries at E11.5 to investigate the effects of RA or inhibitors of BMP signal transduction on the induction of germ cell fate in female. The results showed that both types of inhibitors inhibited the progression to germ cell fate in female, as shown by the expression of SCP3 (
Transcriptional Dynamics of PGCLC/PGC in Determination of Female Sex
[0242] Next, the present inventors analyzed the kinetics of transcription during sex determination in PGC/PGCLC females. For this purpose, the present inventors isolated total RNA from PGC [Stella-EGFP(+) cells at E9.5, E10.5, E11.5, E12.5 (female) and E12.5 (male)] (Kagiwada et al, 2013), fetal primary oocytes [Stella-EGFP(+) at E13.5, DDX4-RFP(+) at E14.5 and E15.5], PSG [Stella-EGFP(+) at E13.5 (Kagiwada et al, 2013), DDX4-RFP(+) at E14.5 and E15.5], PGCLCs cultured under control conditions (d4/c0, c3, c5, c7 and c9), PGCLCs cultured with RA since c3 (c5 RB2, c7 RA2 and c9 RA2), PGCLCs cultured with RA since c3 (c5 RAB2, c7 RAB2 and c9 RAB2) and BMP2, and analyzed its transcriptome by RNA sequencing (RNA-seq) (Nakamura et al., 2015).
[0243] The Unsupervised Hierarchical Clustering (UHC) revealed that sex undifferentiated PGCs up to E11.5 clustered close to d4 PGCLCs, followed by c3-c9 PGCLCs, and RA or RAB2-stimulated PGCLCs at c5 (c5 RA, c5 RAB2) (
[0244] To facilitate the understanding of the dynamics of gene expression during germ cell/PGCLC sex differentiation, the present inventors defined a set of four classes of genes, early PGC genes (318 genes), late germ cell genes (254 genes), fetal oocyte genes (476 genes) and PSG genes (323 genes), that characterize the developmental stages of these cells (
[0245] As shown in
[0246] The present inventors identified a gene that was up-regulated in c9 RA cells compared to c9 RAB2 cells (323 gene: RA gene). Such gene was also up-regulated compared to fetal primary oocytes at E14.5/E15.5 and enriched for cell adhesion/vascular development/embryonic organogenesis (Hoxa5, Hesx1, Pax6, Lmx1b, Pitx2, Dnmt3b, etc.). Thus, BMP signaling is important not only to strongly drive the female pathway, but also to suppress RA-induced inappropriate developmental programs.
Role of STRA8 in Development of Fetal Primary Oocytes
[0247] The present inventors next evaluated the effects of loss of StraB during fetal primary oocyte differentiation from PGCLC. The present inventors generated Stra8-Knockout BVSC ESCs (XY) of several strains using the CRISPR/Cas9 system (Ran et al, 2013a, b) and confirmed the frameshift deletion and loss of STRA8 expression in the target exon in these strains. Since the three independent strains (StraB-knockout (SK) 1, 2, 3) showed essentially identical phenotype, the results are presented using the representative strain SK1. Different from wild-type PGCLC, SK1 cells cultured with RAB2 continued to retain robust BVSC expression until c7 and only showed mild down-regulation of BVSC at c9 (
[0248] The present inventors determined the transcriptome of SK1 cells. PGA revealed that SK1 RAB2 cells progressed along the female pathway for a long time and acquired at c9 the properties similar to those of wild-type c7 cells which are closer to fetal primary oocytes at E13.5 (
[0249] However, it is noteworthy that c9 SK1 cells up-regulated 32.1% of fetal oocyte genes (153/476 genes) in a relatively normal manner, including those associated with oocyte development, such as Ybx2 and Soh1h2 (
Cell Competence to Induce Female Fate in Response to RA and BMP
[0250] Signaling of osteogenic proteins determines the fate of ectoderm/EpiLCs to PGC/PGCLC, but does not directly induce them to the fate of female (Hayashi et al, 2011). Therefore, the present inventors attempted to clarify the status of cells that result in female fate in response to RA and BMP signaling. The present inventors cultured PGCLCs of d4/c0 or c7 with RA and BMP2 for 2 days and evaluated their responses by examining their transcriptases (
[0251] The present inventors reasoned that DNA demethylation of important genes for meiosis during amplification culture may be the basis for PGCLC acquisition of competence to respond to RA and BMP2. The present inventors analyzed the relationship between the level of 5-methylcytosine (5mC) in the promoter and the expression level of a gene classified as being involved in meiosis [GO term: meiosis GO: 0007126]. Of such 152 genes, 42 genes, including Stra8, Spo11, Sycp3, Dpep3, Daz1, Ddx4 and Piwi12, showed >20% promoter demethylation between d4/c0 and c7. In contrast, 110 genes did not show significant changes in the promoter 5mC level during culture (<20%) and consisted of those involved in general processes such as DNA repair and response to DNA damage stimuli (e.g., M1h1, Brca2, Fanca, Cdc20, Plk1) (
[0252] To test the relevance of this concept to germplasm development in vivo, the present inventors compared the difference in the expression of 152 genes in PGCs between E9.5 and E11.5 with the difference in the expression of these genes i in PGCLCs between d4/c0 and c7; the present inventors then compared the differential expression of 152 genes between E11.5 PGCs and E13.5 fetal primary oocytes, and the differential expression between c7 PGCLCs and c7 PGCLC stimulated for 2 days by BMP2 and RA. As shown in
[III] Expansion of PGC/PGCLC by Cyclosporine A and Combination of the Drug with PDE4 Inhibitor and Forskolin
<Materials and Methods>
[0253] The mouse and feeder cell described in Example [I] were used. Purification of PGC/PGCLC, immunostaining, transplantation of PGCLC into mouse testes and analysis thereof, as well as RNA-seq and analysis thereof, were performed in the same way as in Example [I], from the generation of ESC to the induction of differentiation into PGCLC.
[0254] Expansion culture of PGC/PGCLC to investigate the combined effect of cyclosporin A (CsA) was performed as in Example [I], except that 5 M CsA was added to the medium in addition to 10 M forskolin and 10 M loripram (FR10).
[0255] In the experiment to investigate the promoting effect of CsA alone on the expansion of PGCLCs and the mechanism of the promoting effect, PGCLC was maintained and cultured in the same way as in Example [I] except for the addition of various concentrations (10, 5, 1, and 0 M) of CsA or FK506 (tacrolimus) to the medium in place of FR10.
Cell Cycle Analysis
[0256] The analysis was performed as in Example [I] except that EdU (10 M) was used in place of BrdU, and Click-iT Plus EdU Alexa Fluor 647 Flow Cytometry Assay Kit (Thermo Fisher Scientific) was used for detection of EdU uptake.
Detection of Apoptotic Cell
[0257] d4c7 PGCLC cultured in FR10 or FR10+CsA was dispersed in single cells by TrypLE treatment, and stained using Annexin V Apoptosis Detection Kit APC (eBioscience) according to the manufacturer's instructions. The stained samples were analyzed using BD FACSAriaIII (BD) with FACSDiva (BD) software, and PGCLC was identified by BV fluorescence. Three biological replicates were analyzed for each sample.
Intracytoplasmic Sperm Injection (ICSI)
[0258] Spermatozoons were collected from the mouse testis that received transplantation of PGCLC by the method described in Example [I], and directly injected with a micromanipulator into the ovum collected from BDF1 females that were superovulated by injecting PMSG and hCG. The obtained 2-cell embryos were transferred to the fallopian tube of pseudopregnant ICR females 0.5 days after pregnancy (dpc). Pups were delivered by cesarean section at 18.5 dpc.
<Results>
Effect of CsA on the Culture System of PGCLC
[0259] To find compounds that support PGCLC proliferation in addition to forskolin and PDE4 inhibitors, the results of the compound library screening performed in Example [I] were analyzed in detail. As a result, three CsAs were contained in the screening data, and two of which exceeded +3SD (
[0260] To investigate the effect of CsA on the culture system of PGCLCs, cell cycle analysis (
[0261] CsA is a known immunosuppressive compound, and it is also known to act on mitochondria to suppress apoptosis. To investigate which causes the PGCLC proliferation effect of CsA, influence of FK506 on PGCLC was analyzed. FK506 is a compound known to exert immunosuppressive effects by action mechanism similar to that of CsA, but with no effect on mitochondria. The results showed that FK506 did not have a proliferative effect on PGCLCs (
Transcriptional and Epigenetic Properties of PGCLCs in Amplified Culture by CsA and Effect of CsA on In Vivo PGC
[0262] Next, the detailed transcriptional properties of PGCLCs in amplification culture with CsA were determined using the same method as in Example [I] (
[0263] To test whether CsA can support in vivo PGC growth, PGC of E9.5 was recovered and cultured in vitro. The results showed that the addition of CsA to FR10 could amplify the in vivo PGC to about 16-fold (
Spermatogenesis Ability of PGCLCs Amplified by CsA
[0264] Next, whether PGCLCs amplified by FR10+CsA would retain their function as PGCLCs was assessed. For this purpose, d4c7 PGCLCs amplified with FR10+CsA were transplanted into the testes of neonatal W/W.sup.v mice lacking endogenous germ cells. Analysis of the testes 10 weeks after implantation showed that they contained numerous deferents with evidence of spermatogenesis and indeed produced abundant sperm (
INDUSTRIAL APPLICABILITY
[0265] According to the present invention, there is a possibility that ovum can be produced in vitro from PGC/PGCLC. Therefore, the present invention is expected to be applied to basic research relating to infertility and assisted reproductive medicine, and is extremely useful.
[0266] This application is based on a patent application No. 2017-231294 filed in Japan (filing date: Nov. 30, 2017), the contents of which are incorporated in full herein by reference.