Protein and Peptide Fingerprinting and Sequencing by Nanopore Translocation of Peptide-Oligonucleotide Complexes

20230039783 · 2023-02-09

    Inventors

    Cpc classification

    International classification

    Abstract

    A method for translocation of a peptide through a nanopore, wherein the method comprises translocating the peptide in the presence of an oligonucleotide translocase, wherein the peptide is comprised by a peptide-oligonucleotide complex, wherein the peptide is linked to an oligonucleotide, wherein the oligonucleotide translocase is associated to the oligonucleotide during at least part of the translocation.

    Claims

    1. A method for translocation of a peptide through a nanopore, wherein the method comprises translocating the peptide in the presence of an oligonucleotide translocase, wherein the peptide is comprised by a peptide-oligonucleotide complex wherein the peptide is linked to an oligonucleotide, wherein the oligonucleotide translocase is associated to the oligonucleotide during at least part of the translocation.

    2. The method according to claim 1, wherein the oligonucleotide comprises a DNA oligonucleotide, and wherein the oligonucleotide translocase comprises an enzyme selected from the group comprising a polymerase and a helicase.

    3. The method according to claim 1, wherein the method comprises providing the peptide and the oligonucleotide translocase to a cis side of the nanopore, wherein the nanopore is provided by a nanopore protein, wherein the nanopore protein comprises MspA or a mutant thereof, and wherein the oligonucleotide translocase comprises Hel308 or a mutant thereof.

    4. The method according to claim 1, wherein the method comprises providing the oligonucleotide translocase at a concentration sufficient to provide multi-loading of the peptide-oligonucleotide complex by the oligonucleotide translocase.

    5. The method according to claim 1, wherein the peptide has a first peptide end and a second peptide end, wherein the first peptide end is linked to the oligonucleotide, and wherein the second peptide end is linked to a negatively charged element, wherein the negatively charged element is selected from the group comprising a second oligonucleotide, a charged peptide, and a charged non-peptide chemical species.

    6. The method according to claim 1, wherein the nanopore comprises a constriction, wherein the constriction has a circular equivalent diameter d.sub.c selected from the range of 0.5-3 nm, and wherein the oligonucleotide translocase associates with the peptide-oligonucleotide complex at an anchor point, wherein a distance d.sub.1 between the constriction and the anchor point is at least 3 nm during at least part of the translocation.

    7. The method according to claim 1, wherein the nanopore is comprised by a membrane, wherein the method comprises providing a complementary oligonucleotide at least partially complementary to the oligonucleotide, wherein the complementary oligonucleotide is linked to a tag, wherein the tag is configured to associate with the membrane.

    8. The method according to claim 1, wherein the oligonucleotide translocase is selected from the group comprising non-nucleolytic enzymes.

    9. The method according to claim 1, wherein the method comprises a complex-formation step, wherein the complex-formation step comprises linking the peptide and the oligonucleotide thereby providing the peptide-oligonucleotide complex.

    10. The method according to claim 1, wherein the method comprises imposing a potential difference over the nanopore.

    11. The method according to claim 1, wherein the potential difference is selected from the range of 10-400 mV, and wherein the method comprises varying the potential difference between two consecutive steps of the oligonucleotide translocase along the oligonucleotide.

    12. An analysis method for analyzing a peptide, wherein the analysis method comprises the method according to claim 1, and wherein the analysis method comprises sensing a translocation related signal during the translocation.

    13. An analysis method for analyzing a peptide, wherein the analysis method comprises the method for translocation of a peptide through a nanopore, wherein the method for translocation comprises translocating the peptide in the presence of an oligonucleotide translocase, wherein the peptide is comprised by a peptide-oligonucleotide complex wherein the peptide is linked to an oligonucleotide, wherein the oligonucleotide translocase is associated to the oligonucleotide during at least part of the translocation, and wherein the analysis method comprises sensing a translocation related signal during the translocation, the analysis method comprises imposing the potential difference over the nanopore, and wherein the analysis method comprises sensing a translocation related signal during the translocation, the analysis method according to, claim 10, wherein the analysis method comprises measuring an electrical current through the nanopore and providing an electrical current signal, wherein the translocation-related signal comprises the electrical current signal.

    14. The analysis method according to claim 1, wherein the analysis method further comprises an optical read-out of the translocation of the peptide through the nanopore and providing an optical read-out related signal, wherein the translocation-related signal comprises the optical read-out related signal.

    15. The analysis method according to claim 12, wherein the analysis method further comprises a characterization stage, wherein the characterization stage comprises characterizing the peptide based on the translocation-related signal.

    16. The analysis method according to claim 15, wherein the characterization stage comprises an identification stage, wherein the identification stage comprises identifying one or more amino acids in the peptide based on the translocation-related signal.

    17. Use of an oligonucleotide translocase to translocate a peptide-oligonucleotide complex through a nanopore.

    18. Use according to claim 17, wherein the oligonucleotide translocase comprises Hel308 or a mutant thereof.

    19. Use according to claim 17, wherein the nanopore is provided by a nanopore protein, wherein the nanopore protein comprises MspA or a mutant thereof.

    20. A kit of parts comprising an oligonucleotide translocase, a buffer comprising NTP, an oligonucleotide, and a linker suitable to link the oligonucleotide to a peptide.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0123] Embodiments of the invention will now be described, by way of example only, with reference to the accompanying schematic drawings in which corresponding reference symbols indicate corresponding parts, and in which: FIG. 1 schematically depicts an embodiment of the method. FIG. 2 schematically depicts another embodiment of the method. FIG. 3 schematically depicts experimental data obtained using an embodiment of the analysis method. FIG. 4 schematically depicts another embodiment of the method. FIG. 5 schematically depicts experimental data obtained using an embodiment of the analysis method. FIG. 6 schematically depicts experimental data obtained using an embodiment of the analysis method. The schematic drawings are not necessarily on scale.

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    [0124] FIG. 1 schematically depicts an embodiment of the method 100 for translocating a peptide 11 through a nanopore 50 in the presence of an oligonucleotide translocase 20. In the depicted embodiment, the peptide 11 is comprised by a peptide-oligonucleotide complex 10, wherein the peptide 11 is linked to an oligonucleotide 13. The oligonucleotide translocase 20 affects the translocating of the peptide-oligonucleotide complex 10 through the nanopore 50, especially the oligonucleotide translocase 20 moves the oligonucleotide 13 relative to the oligonucleotide translocase 20. In particular, the oligonucleotide translocase 20 pulls the oligonucleotide 13, and thereby the peptide-oligonucleotide complex 10, through the nanopore 50 towards the oligonucleotide translocase 20, especially towards the cis side 31 of the nanopore (or membrane), thereby translocating at least part of the peptide-oligonucleotide complex 10 through the nanopore 50.

    [0125] Specifically, FIG. 1 may depict an embodiment of the method wherein the peptide 11 is in the constriction 51 of the nanopore 50 while the oligonucleotide translocase 20 is walking along the oligonucleotide 13. The (sensitive) constriction is distanced from the anchoring oligonucleotide translocase by a distance d.sub.1. This may enable a scheme in which a peptide 11 (chain) is being moved through the constriction 51 while an oligonucleotide translocase 20 walks along a conjugated oligonucleotide 13 (a). First, on the left side of the image, the conjugated oligonucleotide 13 is arranged at the constriction 51, especially wherein the oligonucleotide 13 is read at the constriction 51. Next, on the right side of the image, as the oligonucleotide translocase 20 walks towards the peptide 11 of the peptide-oligonucleotide complex 10, the peptide 11 is translocated through from the trans side 32 of the nanopore 50 to the cis side 31 of the nanopore, especially via the constriction 51.

    [0126] In the depicted embodiment, the oligonucleotide 13 comprises a DNA oligonucleotide, and the oligonucleotide translocase 20 comprises an enzyme selected from the group comprising a polymerase and a helicase.

    [0127] In the depicted embodiment, the nanopore 50 comprises a constriction 51 and an translocase position 52. The constriction 51 may have a circular equivalent diameter d.sub.c selected from the range of 0.5-3 nm. The oligonucleotide translocase 20 may be arranged at the translocase position 52 during at least part of the oligonucleotide translocation.

    [0128] The position of first contact between the oligonucleotide translocase 20 and the oligonucleotide 13, as seen from the nanopore, may herein be referred to as the anchor point 21. In embodiments, a distance d.sub.1 between the constriction 51 and the anchor point 21 may be at least 3 nm. In particular, the distance d.sub.1 may refer to the distance between the constriction 51 and the anchor point 21 as the oligonucleotide translocase 20 is arranged at the translocase position 52.

    [0129] In the depicted embodiment, the nanopore 50 is comprised by and formed by a nanopore protein 55. In further embodiments, the nanopore protein may comprise MspA. MspA may provide a distance d.sub.1 of about 9 nm.

    [0130] In the depicted embodiment, the nanopore 50, especially the nanopore protein 55, is comprised by a membrane 30, especially a lipid membrane.

    [0131] FIG. 1 further schematically depicts the use of an oligonucleotide translocase 20 to translocate a peptide-oligonucleotide complex 10, especially through a nanopore 50. In further embodiments, the oligonucleotide translocase 20 may comprise Hel308 or a mutant thereof.

    [0132] FIG. 1 further schematically depicts the use of a nanopore 50 for characterizing a peptide-oligonucleotide complex 10. In particular, the nanopore 50 is provided by a nanopore protein 55. In further embodiments, the nanopore protein 55 comprises MspA or a mutant thereof.

    [0133] FIG. 2 schematically depicts another embodiment of the method 100. In the depicted embodiment, the method 100 comprises providing a complementary oligonucleotide 40 at least partially complementary to the oligonucleotide 13. Here, the complimentary oligonucleotide 40 comprises a complementary region depicted associated with the oligonucleotide 13 thereby forming a double-stranded helix, as well as a non-complimentary region, especially a poly-T region, not associated with the oligonucleotide 13. In the depicted embodiment, the complementary oligonucleotide 40, especially the non-complimentary region, is linked to a tag 42, especially via a linker indicated with the “−Z”, and especially wherein the tag 42 associates with the membrane 30 (not depicted). Thereby, the local concentration of the complementary oligonucleotide 40, and thereby of the peptide-oligonucleotide complex, can be increased close to the membrane 30, which may increase the rate at which the peptide-oligonucleotide complex 10 enters the nanopore 50.

    [0134] In the depicted embodiment, the peptide 11 is provided to a cis side 31 of the nanopore 50 and the oligonucleotide translocase 20 is provided to the cis side 31 of the nanopore 50. Thereby, the oligonucleotide translocase can associate with the oligonucleotide, especially the peptide-oligonucleotide complex, prior to the peptide entering the nanopore.

    [0135] In embodiments, the oligonucleotide translocase may be (selected to be) inefficient at processing, especially translocating, a double-stranded helix. As the peptide-oligonucleotide complex 10 enters the nanopore 50, the complementary oligonucleotide 40 may be sheared off, thereby exposing a single-stranded oligonucleotide 13 to the oligonucleotide translocase 20, resulting in (more efficient) processing of the oligonucleotide 13 by the oligonucleotide translocase 20.

    [0136] Hence, the complementary oligonucleotide 40 may provide both an increased local concentration, and may delay the translocating of the oligonucleotide by the oligonucleotide translocase until the peptide-oligonucleotide complex 10 has entered the nanopore 50.

    [0137] In further embodiments, the method 100 may comprise imposing a potential difference over the nanopore 50. In particular, by imposing the potential difference, the peptide-oligonucleotide complex 10 may be drawn into the nanopore 50. In further embodiments, the potential difference may be selected from the range of 10-400 mV, especially from the range of 100-200 mV, and the method 100 may comprise varying the potential difference between two consecutive steps of the oligonucleotide translocase 20.

    [0138] FIG. 3 schematically depicts experimental observations of the analysis method for analyzing a peptide 11. In particular, FIG. 3 depicts the translocation-related signal, especially the electrical current signal. The analysis method comprises the method 100.

    [0139] In particular, the depicted results were obtained using an embodiment of the method 100 wherein a peptide-oligonucleotide complex, consisting of an oligonucleotide 13 linked at the 5′ via copper free click chemistry to the C-terminus of a negatively charged peptide 11. The oligonucleotide-translocase may bind to a loading site of the oligonucleotide, and the peptide 11 may feed into the nanopore 50. The peptide-oligonucleotide complex 10, especially the oligonucleotide 13, may be bound to a complementary oligonucleotide 40, which may serve two purposes. Firstly, the oligonucleotide translocase, here especially Hel308, may not efficiently initiate unwinding at single-stranded to double-stranded junctions, so the complementary oligonucleotide may function as a blocker, preventing unwinding of the double-stranded helix. Secondly, a tag 40, here especially a cholesterol tag, at the 3′ end of the complementary oligonucleotide 40 may associate with a lipid membrane 30, increasing the local concentration of the peptide-oligonucleotide complex 10 and improving the rate of capture by the nanopore 50. When the peptide-oligonucleotide complex 10 is pulled into the nanopore 50, the force may shear off the complementary oligonucleotide 40, leaving only the peptide-oligonucleotide complex 10 and the oligonucleotide translocase 20 at the nanopore 50, and enabling the oligonucleotide translocase 20 to begin walking 3′ to 5′, pulling the peptide-oligonucleotide complex up half a nucleotide at a time. The analysis method further comprises measuring the translocation of the peptide 11 through the nanopore 50 to provide a translocation-related signal. In particular, for the depicted embodiment, the analysis method comprised imposing a potential difference over the nanopore 50, and measuring an electrical current through the nanopore 50 and providing an electrical current signal, wherein the translocation-related signal comprises the electrical current signal.

    EXAMPLES

    [0140] Proteins—the experimental procedures were performed using the M2-NNN-MspA mutant (see above) and with the Hel308 helicase enzyme from Thermococcus gammatolerans EJ3 (NCBI accession number WP_015858487.1).

    [0141] Peptide-oligonucleotide complex—the peptide-oligonucleotide complex comprised a peptide linked to an oligonucleotide via either copper-free click chemistry or maleimide-thiol linkage (as specified). The peptide-oligonucleotide complex was associated with a complementary oligonucleotide linked to a cholesterol tag. The cholesterol tag at the 5′ end of the complementary oligonucleotide may anchor the peptide-oligonucleotide complex into a lipid (bilayer) membrane, thereby increasing the local concentration near the pore and increasing the capture rate.

    [0142] Nanopore experiments—experiments were performed with a device made from Teflon that contains two ˜50 μL chambers (cis and trans). The two chambers are connected by a Teflon heat-shrink “u-tube”, ˜30 μL in volume. The cis side of the u-tube narrows into a horizontal ˜20 μm aperture. Both chambers and the u-tube were filled with the operating buffers. The cis chamber was connected to ground via an Ag/AgCl electrode, while the trans-side Ag/AgCl electrode was connected to an integrating patch clamp amplifier that also supplied the positive driving voltage. A lipid bilayer was formed across the aperture using 1,2-diphytanoyl-sn-glycero-3-phosphocholine (DPhPC). Following bilayer formation, M2-NNN-MspA was added to the cis chamber to a final concentration of ˜2.5 ng/mL. A single pore insertion into the bilayer was recognized by a characteristic increase in the conductance. Upon single pore insertion, the cis chamber buffer was perfused out and replaced with MspA-free buffer to prevent the insertion of additional pores. The Hel308 motor enzyme was added to the cis chamber to a final concentration of ˜1 μM, and the peptide-oligonucleotide complex was added to a final concentration of ˜500 μM. Hel308 loads onto the overhanging 3′ end of the oligonucleotide 13 of the peptide-oligonucleotide complex 10 at the single-stranded/double-stranded junction. The peptide 11 of the peptide-oligonucleotide complex 10 is captured by the nanopore 50, and the complementary oligonucleotide 40 is sheared off as the template strand is pulled through the nanopore 50. Hel308 is too large to fit through MspA, and arrests the peptide-oligonucleotide 10 translocation once the complementary oligonucleotide has been sheared off. Now unblocked, Hel308 proceeds as a translocase from 3′ to 5′ along the peptide-oligonucleotide complex, incrementally pulling the oligonucleotide out of the nanopore 50 towards the cis side 31.

    [0143] Operating buffers—the experiments were conducted using an identical first electrolyte and second electrolyte, wherein both the first electrolyte and second electrolyte comprised 400 mM KCl with 10 mM HEPES at pH 8.00±0.05, 10 mM MgCl.sub.2, and 1000 μM ATP. The ATP-containing buffer was re-perfused at the cis side approximately once per hour to prevent depletion of ATP and accumulation of ADP. Experiments were performed at room temperature, ˜21° C.

    [0144] Data acquisition and Analysis—Experiments were controlled and data were acquired with custom acquisition software written in LabView (National Instruments, version 2019) at a sampling rate of 50 kHz. The ionic current signal was low pass filtered at 10 kHz using the Bessel filter onboard the patch clamp amplifier. Ionic current traces were analyzed using custom programs written in Matlab (Mathworks, version 2019a). Reads were filtered using a custom compression filter to eliminate transient fluctuations in ionic current unrelated to translocating DNA sequence. Enzyme-controlled DNA translocation events were detected with a thresholding algorithm. The open pore ionic current value was determined for the data, and an event start was identified whenever the ionic current drops below 75% of the open pore value. The event end was identified when the ionic current returns to greater than 94% of the open pore value. Events with duration shorter than 1 s, or with an average ionic current less than 10% or greater than 70% of the open pore value were discarded. Small variations in temperature, salt concentration, and electrode potentials from day-to-day, pore-to-pore, and read-to-read may cause changes in both the overall magnitude of the observed ion currents (an “offset”) as well as the relative magnitudes of adjacent states (a “scale”). Each read was calibrated to the ensemble average prior to analysis using a scale and an offset calculated specifically for that read.

    [0145] The examples specified below were performed according to the experimental procedures outlined hereabove unless specified otherwise.

    Example 1

    [0146] The measured peptide-oligonucleotide complex 10 is the peptide-oligonucleotide complex 10 depicted in FIG. 2. Specifically, the peptide-oligonucleotide complex 10 comprises DDEDEEEDDDEDEDEEDDEDEDEEEEDDDDcustom-characterCTXXTGTAGTCGTCGTTGTGCAG TCGTTCGTAGCC, wherein the oligonucleotide 13 comprises CTXXTGTAGTCGTCGTTGTGCAGTCGTTCGTAGCC, wherein the peptide 11 comprises DDEDEEEDDDEDEDEEDDEDEDEEEEDDDD, and wherein custom-character is the linker 12, and wherein the linker is provided via click chemistry. Specifically, the linker is a connection between DBCO-C5 and Orn(N3), wherein DBCO-C5 refers to dibenzocyclooctyne connected by a 5-carbon spacer to the 5′ phosphate of the DNA, and wherein Orn(N3) refers to 2-amino-5-azido-n-pentanoic acid, on the C-terminal end of the protein. The oligonucleotide 13 comprises two abasic sites (marked “X”) shortly before the linker 12, consisting only of the DNA backbone. These abasic sites were included because of the recognizable ion current signal they cause, much higher than when only DNA bases are in the constriction 51. This may facilitate identification within each read of the end of the oligonucleotide 11 and the beginning of the linker 12 and peptide 11. Hence, in embodiments, the oligonucleotide may comprise one or more abasic sites, especially 1-3 abasic sites, arranged near the linker, especially at least partially arranged within 10 bases from the linker, especially at least partially arranged within 5 bases from the linker.

    [0147] FIG. 3 depicts the measured electrical current signal of four independent reads aligned to one another, wherein I indicates the ionic current as a fraction of the open state of the nanopore (without the peptide-oligonucleotide complex 10 at the constriction 51), and P indicates the position of the peptide-oligonucleotide complex expressed in steps of the oligonucleotide translocase. In particular, P=5-P=32 roughly corresponds to the oligonucleotide being arranged at the constriction 51, wherein P=26-P=32 roughly corresponds to the abasic sites being arranged at the constriction 51. P=33-P=37 roughly corresponds to the linker being arranged at the constriction. P=38-P55 roughly corresponds to the peptide being arranged at the constriction 51, wherein P=38-P=46 roughly corresponds to the first four amino acids (DDDD) being arranged at the constriction and P=47-P=55 roughly corresponds to the next four amino acids (EEEE) being arranged at the constriction 51.

    [0148] FIG. 4 schematically depicts an embodiment of the method (100) with multi-loading. Left: Multiple different oligonucleotide translocases 20, 20a, 20b may bind to the peptide-oligonucleotide complex 10, especially at high concentrations of the oligonucleotide translocase 20. Center: The frontmost oligonucleotide translocase 20, 20a can't walk along the linker 12 or peptide 11, and dissociates from the peptide-oligonucleotide complex 10, especially when a nucleotide binding site of the oligonucleotide translocase 20 encounters the linker 12. Right: The force induced by the potential difference pulls the peptide-oligonucleotide complex 10 down, whereupon the queued oligonucleotide translocase 20, 20b arrests the motion of the peptide-oligonucleotide complex 10, and the translocation begins again, having, in the depicted example, re-wound by approximately 18 amino acids. Hence, in embodiments, the oligonucleotide translocase 20 may be provided at a concentration sufficient to provide multi-loading of the peptide-oligonucleotide complex 10 by the oligonucleotide translocase.

    [0149] In the depicted embodiment, the peptide 11 has a first peptide end and a second peptide end. The first peptide end is linked to the oligonucleotide 13, especially via the linker 12. The second peptide end is linked to a negatively charged element 15, especially via a second linker 14. In further embodiments, the negatively charged element may be selected from the group comprising a second oligonucleotide, a charged peptide, and a charged non-peptide chemical species.

    [0150] Hence, due to an imposed potential difference, the peptide-oligonucleotide complex 10 may start moving from the cis side 31 of the nanopore to the trans side 32 of the nanopore. In embodiments, a complementary oligonucleotide 40 may be sheared of as the oligonucleotide 13 enters the nanopore 50. Once the oligonucleotide translocase 20 reaches the translocase position 52, especially once the complementary oligonucleotide 40 is fully sheared off, the oligonucleotide translocase 20 may start processing the oligonucleotide 13, thereby translocating the peptide-oligonucleotide complex 10 from the trans side 32 to the cis side 31. Once the oligonucleotide translocase 20 reaches the linker 12 (or the peptide 11), the oligonucleotide translocase 20 may dissociate, thereby allowing the peptide-oligonucleotide complex 10 to move towards the trans side 32 (due to the imposed voltage) as it is no longer anchored by the oligonucleotide translocase 20. In further embodiments, a queued oligonucleotide translocase 20, 20b may arrest the motion of the peptide-oligonucleotide complex 10, i.e., it may anchor the peptide-oligonucleotide complex 10 again. In particular, the queued oligonucleotide translocase 20, 20b may start processing the oligonucleotide 13, thereby again translocating the peptide-oligonucleotide complex 10 from the trans side 32 to the cis side 31. Hence, the same (part of the) peptide may pass the constriction 51 multiple times, and may thereby, for example, modulate a measurable current signal through the constriction multiple times.

    Example 2

    [0151] Example 2 relates to the same peptide-oligonucleotide complex as example 1.

    [0152] FIG. 5 schematically depicts experimental data obtained with an embodiment of the analysis method, wherein the analysis method comprises an embodiment of the method 100 wherein the oligonucleotide translocase 20 is provided at a concentration sufficient to provide multi-loading of the peptide-oligonucleotide complex 10 by the oligonucleotide translocase. In particular, the oligonucleotide translocase was provided at a concentration of 300 nM.

    [0153] In particular, FIG. 5 depicts the translocation-related signal, especially the electrical current signal: the observed ion current (in pA) over time t in seconds. As can be seen by the repeated structure with an about 4 seconds median duration from about the 300 second mark till the end of the event, multi-loading of the peptide-oligonucleotide complex 10 occurs, allowing for multiple reading of the same (part of the) peptide.

    Example 3

    [0154] FIG. 6 schematically depicts experimental data obtained using an embodiment of the analysis method. The experiment was performed as outlined above but with a different peptide-oligonucleotide complex. Specifically, the peptide-oligonucleotide complex 10 comprised: GCTGATGTAGTCTGCCAAGCTT-M-CDDDDEEEEWEDEDDEEDEDEDD, wherein the oligonucleotide 13 comprises GCTGATGTAGTCTGCCAAGCTT, wherein the peptide 11 comprises CDDDDEEEEWEDEDDEEDEDEDD, and wherein M is the linker 12, and wherein the linker 12 is provided via maleimide-thiol chemistry. The experimentally measured values are aligned with the corresponding nucleotides and amino acids of the peptide oligonucleotide complex 10. In particular, a clear low-level blockage can be observed at the position of the tryptophan (W), which may be expected as W is much larger than the other amino acids.

    [0155] The term “plurality” refers to two or more. Furthermore, the terms “a plurality of” and “a number of” may be used interchangeably.

    [0156] The terms “substantially” or “essentially” herein, and similar terms, will be understood by the person skilled in the art. The terms “substantially” or “essentially” may also include embodiments with “entirely”, “completely”, “all”, etc. Hence, in embodiments the adjective substantially or essentially may also be removed. Where applicable, the term “substantially” or the term “essentially” may also relate to 90% or higher, such as 95% or higher, especially 99% or higher, even more especially 99.5% or higher, including 100%. Moreover, the terms “about” and “approximately” may also relate to 90% or higher, such as 95% or higher, especially 99% or higher, even more especially 99.5% or higher, including 100%. For numerical values it is to be understood that the terms “substantially”, “essentially”, “about”, and “approximately” may also relate to the range of 90%-110%, such as 95%-105%, especially 99%-101% of the values(s) it refers to.

    [0157] The term “comprise” includes also embodiments wherein the term “comprises” means “consists of”.

    [0158] The term “and/or” especially relates to one or more of the items mentioned before and after “and/or”. For instance, a phrase “item 1 and/or item 2” and similar phrases may relate to one or more of item 1 and item 2. The term “comprising” may in an embodiment refer to “consisting of” but may in another embodiment also refer to “containing at least the defined species and optionally one or more other species”.

    [0159] Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

    [0160] The devices, apparatus, or systems may herein amongst others be described during operation. As will be clear to the person skilled in the art, the invention is not limited to methods of operation, or devices, apparatus, or systems in operation.

    [0161] The term “further embodiments” and similar terms may refer to embodiments comprising the features of the previously discussed embodiments, but may also refer to alternative embodiments.

    [0162] It should be noted that the above-mentioned embodiments illustrate rather than limit the invention, and that those skilled in the art will be able to design many alternative embodiments without departing from the scope of the appended claims.

    [0163] In the claims, any reference signs placed between parentheses shall not be construed as limiting the claim.

    [0164] Use of the verb “to comprise” and its conjugations does not exclude the presence of elements or steps other than those stated in a claim. Unless the context clearly requires otherwise, throughout the description and the claims, the words “comprise”, “comprising”, “include”, “including”, “contain”, “containing” and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of “including, but not limited to”.

    [0165] The article “a” or “an” preceding an element does not exclude the presence of a plurality of such elements.

    [0166] The invention may be implemented by means of hardware comprising several distinct elements, and by means of a suitably programmed computer. In a device claim, or an apparatus claim, or a system claim, enumerating several means, several of these means may be embodied by one and the same item of hardware. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage.

    [0167] The invention also provides a control system that may control the device, apparatus, or system, or that may execute the herein described method or process. Yet further, the invention also provides a computer program product, when running on a computer which is functionally coupled to or comprised by the device, apparatus, or system, controls one or more controllable elements of such device, apparatus, or system.

    [0168] The invention further applies to a device, apparatus, or system comprising one or more of the characterizing features described in the description and/or shown in the attached drawings. The invention further pertains to a method or process comprising one or more of the characterizing features described in the description and/or shown in the attached drawings. Moreover, if a method or an embodiment of the method is described being executed in a device, apparatus, or system, it will be understood that the device, apparatus, or system is suitable for or configured for (executing) the method or the embodiment of the method respectively.

    [0169] The various aspects discussed in this patent can be combined in order to provide additional advantages. Further, the person skilled in the art will understand that embodiments can be combined, and that also more than two embodiments can be combined. Furthermore, some of the features can form the basis for one or more divisional applications.