EFFICIENT, SCALABLE PRODUCTION OF HUMAN RETINAL PROGENITORS IN VITRO

20200362301 ยท 2020-11-19

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided herein are efficient, scalable methods for in vitro production of human retinal progenitor cells. In addition, provided herein are methods for isolating pure populations of in vitro produced human retinal progenitor cells as well as kits and compositions comprising such pure populations of human retinal progenitor cells.

    Claims

    1. A method of producing a substantially pure population of human retinal progenitor cells, the method comprising: (a) culturing human pluripotent stem cells (hPSCs) in suspension culture for about 6 days in a neural induction medium whereby embryoid bodies are formed, wherein the neural induction medium is supplemented with N2 supplement and Non-Essential Amino Acid (NEAA) cell culture supplement beginning on culturing day 3; (b) dissociating the embryoid bodies formed in step (a) into a single cell suspension; (c) culturing the single cell suspension as an adherent monolayer for about 15 to about 22 days in a retinal differentiation medium, whereby a substantially pure population comprising human retinal progenitor cells is obtained.

    2. The method of claim 1, further comprising sorting the cell population of (c) to isolate Pax6D-expressing human retinal progenitor cells from non-Pax6D-expressing cells.

    3. The method of claim 2, wherein Pax6D-expressing human retinal progenitor cells are selected and sorted based on expression of a Pax6D-reporter construct.

    4. The method of claim 1, wherein the neural induction medium is a chemically defined medium comprising DMEM/F-12.

    5. The method of claim 1, wherein the neural induction medium is E8 medium.

    6. The method of claim 1, wherein the retinal differentiation medium is a chemically defined medium comprising DMEM/F-12, B27 supplement, and NEAA cell culture supplement.

    7. The method of claim 1, further comprising introducing into the hPSCs an agent that reduces expression of WNT8B and increases expression of retinal progenitor-specific genes.

    8. The method of claim 7, wherein the agent is a WNT8B short hairpin interfering RNA (shRNA).

    9. A substantially pure population of human retinal progenitor cells comprising a nucleotide sequence encoding a detectable reporter operably linked to a nucleotide sequence encoding human pax6D.

    10. A method of testing a compound, the method comprising contacting a test compound to the human retinal progenitor cells of claim 9 and examining the effect of the compound on the cells.

    11. A substantially pure population of human retinal progenitor cells obtained according to the method of claim 1.

    12. A substantially pure population of human retinal progenitor cells obtained according to the method of claim 3.

    13. A kit for differentiating human pluripotent stem cells into human retinal progenitor cells, the kit comprising one or more of (i) a neural induction medium; (ii) a retinal differentiation medium; (iii) a PAX6D reporter construct; (iv) reagents for genetic modification of cells to achieve inducible expression of Pax6D; (v) an agent that reduces expression of WNT8B; and (vi) instructions describing a method for generating substantially pure populations of human retinal progenitor cells, the method employing one or more of the culture medium, the PAX6D reporter construct, the genetic modification reagents, and the agent.

    14. The kit of claim 13, wherein the agent is a WNT8B short hairpin interfering RNA (shRNA).

    15. The kit of claim 13, wherein the retinal differentiation medium is a chemically defined medium comprising DMEM/F-12, B27 supplement, and NEAA cell culture supplement.

    16. The kit of claim 13, wherein the neural induction medium is E8 medium.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0013] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

    [0014] The present invention will be better understood and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings, wherein:

    [0015] FIG. 1 is a schematic illustration of a protocol for directed differentiation of retinal progenitor cells.

    [0016] FIGS. 2A-2C demonstrate expression of PAX6 isoforms in forebrain and retinal development. Panel (A) provides a schematic diagram of the PAX6 isoforms in human. Panel (B) demonstrates Western blot detection of PAX6 isoforms in human fetal forebrain and retina. The antibody used targets the C terminus of PAX6 and can detect all the 3 isoforms at different molecular weight. The green arrow indicates the PAX6A&B isoforms. The red arrow indicates the PAX6D isoform. Panel (C) demonstrates Western blot detection of PAX6 isoforms in cells during forebrain and retina differentiation from hESCs. D10 indicates day 10 of differentiation.

    [0017] FIGS. 3A-3E demonstrate effects of PAX6 knockout on retinal differentiation. Panel (A) provides a schematic strategy for generating PAX6 knockout in hESCs. The exon 8 is shared by all the isoforms and was replaced by the PGK-Puromycin element. The primers indicated in the pane are used to detect the gene knockout. Panel (B) demonstrates qPCR quantification of PAX6 expression in Wildtype and PAX6 KO during retinal differentiation. All the data are presented as mean SD in figures. * indicates the p value is less than 0.05. ** indicates the p value is less than 0.01. *** indicates the p value is less than 0.001. Panel (C) demonstrates Western blot detection of PAX6 in Wildtype and PAX6 KO cells at day 20 of retinal differentiation. (D) Immunostaining of PAX6 in Wildtype and PAX6 KO cells reveals that C-PAX6 antibody detects PAX6A, B and D, while N-PAX6 antibody detects PAX6 A and B but not D. Scale bars indicate 50 m. Panel (E) demonstrates qPCR quantification of retinal related genes in Wildtype and PAX6 KO cells. Samples were collected at day 6, 10, 14 and 19 after the start of differentiation.

    [0018] FIGS. 4A-4J demonstrate generation of PAX6 isoform specific knockouts and their effects on retinal differentiation. (A) Schematic diagram for generating PAX6D knockout (PAX6D KO). The exon was replaced by PGK-Puromycin. Primers indicated in this panel are used to detect the PAX6D KO. (B) qPCR verification of PAX6D KO efficiency. PAX6A&B and PAX6D isoforms were also evaluated by qPCR with isoform specific primers. (C) Western blot detection of PAX6 isoforms in wildtype and PAX6D KO cells. (D) qPCR quantification of retinal gene VSX2 in PAX6D KO cells. (E) qPCR quantification of retinal gene SIX6 in PAX6D KO cells. (F) Immunostaining of VSX2 in wildtype and PAX6D KO cells. Scale bar indicates 100 m. (G) GO analysis of differentially expressed genes in PAX6 KO cells. Up-regulated genes and down-regulated genes are analyzed separately. The biological processes are ranked by p-value. Only top 15 terms were shown. (H) GO analysis of differentially expressed genes in PAX6D KO cells. Up-regulated genes and down-regulated genes are analyzed separately. The biological processes are ranked by p-value. Only the top 15 terms were shown. (I) Venn diagram shows the overlap of differentially regulated genes in PAX6 KO and PAX6D KO cells. The numbers indicate the number of genes in each area. (J) GO analysis of biological process for overlap genes in panel I. The numbers in the cycle are the ratio of genes. The GO terms are ranked by p-value in the clockwise direction.

    [0019] FIGS. 5A-5E demonstrate that PAX6A&B and PAX6D play different roles in retina differentiation. (A) Immunostaining of SOX1 and SOX2 in human fetal forebrain and retinal tissues. Scale bars indicate 50 m. (B) Flow cytometry analysis of day 7 cell cultures under retinal differentiation from wildtype, PAX6 KO, and PAX6D KO cell lines. (C) Flow cytometry analysis of day 20 cell cultures under retinal differentiation from wildtype, PAX6 KO, and PAX6D KO cell lines. (D) Quantification of SOX1.sup./SOX2.sup.+ ratio in panel C. (E) SOX1 mRNA level in wildtype, PAX6 KO, and PAX6D KO cell at day 20 of retinal differentiation.

    [0020] FIGS. 6A-6F demonstrate effects of PAX6A&B and PAX6D on RPC differentiation. (A) Schematic diagram for generating PAX6A (PAX6A TetOn in PAX6KO) and PAX6D (PAX6D TetOn in PAX6 KO) inducible cell lines in PAX6 KO hESCs. With this design, PAX6A or PAX6D is induced separately with the doxycycline (DOX) treatment. (B) qPCR quantification of PAX6A and PAX6D gene expression under the treatment of DOX. (C) Western blot analysis of PAX6A and PAX6D protein expression under the treatment of DOX. (D) qPCR quantification of SOX1 gene expression in the PAX6A TetOn and PAX6D TetOn cells. (E) Expression of retinal marker expression in PAX6D TetOn cells without DOX treatment. (F) Cell population composition analysis with SOX1 and SOX2 staining from flow cytometry. SOX1/SOX2 double positive cells represent the neuroepithelial fate while the SOX1 negative and SOX2 positive cells represent the neuroretinal fate.

    [0021] FIGS. 7A-7D demonstrate identification of PAX6D targets by ChIP-seq. (A) Experimental design for the ChIP samples. PAX6A TetOn and PAX6D TetOn cells were differentiated towards the retinal lineage. At day 6 the cells were treated with DOX to turn on PAX6A or PAX6D expression. After 3 days of treatment, the cells were collected at day 10 and used for ChIP experiment. (B) The fragment enrichment evaluated by SES plot. (C) GO analysis of the PAX6A targets and PAX6D targets identified by ChIP-Seq. PAX6A only, PAX6A and PAX6D shared, and PAX6D only targets are analyzed separately. (D) Verification of PAX6D target genes using PAX6D TetOn cells. Two sets of genes (neural and retinal) are directly regulated by PAX6D in opposite directions.

    [0022] FIGS. 8A-8E demonstrate retinal specification regulated by PAX6D is WNT dependent. (A) qPCR quantification of WNT8B in PAX6D KO cells at multiple time points during retinal differentiation. (B) qPCR quantification of retinal gene expression under the effect of WNT agonist CHIR99021 and WNT antagonist IWR1 on retinal differentiation. (C) qPCR quantification of retinal gene expression in PAX6D KO cells treated with WNT antagonist IWR1 to rescue the retinal differentiation. (D) qPCR quantification of retinal gene expression in PAX6D TetOn cells when PAX6D was induced by DOX in the presence of WNT agonist CHIR99021. (E) A model describing the role of a unique function for PAX6D isoform in regulating retinal specification. Data demonstrate that the choice between retinal versus forebrain fate is controlled by PAX6D via regulation of a set of neural and retinal genes.

    [0023] FIGS. 9A-9F present schematic diagrams of (A) primer design for PAX6 isoforms, (B) a human forebrain differentiation protocol from hPSC, and (C) a human retinal differentiation protocol from hPSC. Also demonstrated are (D) overall PAX6 gene expression during human forebrain and retinal differentiation, (E) PAX6A&B isoform expression during human forebrain and retinal differentiation, an (F) PAX6D isoform expression during human forebrain and retinal differentiation. All the data are presented as mean SD.

    [0024] FIGS. 10A-10C demonstrate (A) PCR genotyping of PAX6 KO candidate colonies after puromycin screening, (B) flow cytometry analysis of PAX6 expression in day 6 retinal differentiation cells from wildtype and PAX6 KO cells, and (C) immunostaining of VSX2 and PAX6 in differentiating retinal cells from wildtype and PAX6 KO.

    [0025] FIGS. 11A-11B demonstrate (A) PCR genotyping of PAX6D KO candidate colonies after puromycin screening, and (B) a Venn diagram showing the overlap of differentially regulated genes in PAX6 KO and PAX6D KO cells. 290 genes showed only in PAX6 KO/wildtype group were further analyzed by gene ontology enrichment. The GO terms were ranked by p-value in the clockwise direction.

    [0026] FIG. 12 demonstrates immunostaining of SOX1 and PAX6 in human fetal retinal and forebrain tissue. Scale bars indicate 50 m.

    [0027] FIG. 13A demonstrates immunostaining of SOX1 and PAX6 in retinal differentiating cells from PAX6A TetOn and PAX6D TetOn cell lines without DOX. Scale bars indicate 100 m.

    [0028] FIG. 13B demonstrates (B) Immunostaining of SOX2 and PAX6 in retinal differentiating cells from PAX6A TetOn and PAX6D TetOn cell lines without DOX. Scale bars indicate 100 m.

    [0029] FIG. 14 is a schematic illustrating construction of a PAX6D reporter line. PAX6D transcription is controlled by promoter alpha which contains the intron after exon4, exon and exon 5. PAX6D translation starts at exon 7. PAX6D coding sequence is replaced by tdTomato coding sequence, and the resulting construct is inserted in the AAVS1 site of the genome. tdTomato will be expressed in cells in which Pax6D is expressed.

    [0030] FIGS. 15A-15B demonstrate the effects on generation of retinal cells of repressing WNT8B expression in human pluripotent stem cells.

    DETAILED DESCRIPTION

    [0031] The methods and compositions provided herein are based at least in part on the inventors' development of efficient, scalable methods for generating highly enriched retinal progenitor cells (RPC) from human pluripotent stem cells (hPSCs). In particular, the inventors identified a PAX6 isoform, PAX6D, as being necessary and sufficient to guide differentiation of neural stem cells to produce RPCs. The inventors further uncovered the molecular pathways that are targeted by PAX6D. Existing methods for generating retinal progenitor cells (RPCs) is to induce human stem cells to neural stem cells (NSCs or neuroepithelia) first and then guide NSCs to RPCs. Because of the lack of knowledge and tool to turn NSCs to RPCs, the methods produce a mixture of cells that contain a small population of retinal cells and a much larger population of neural cells. It often requires manual selection of RPCs based on morphological criteria such as optic cup-like appearance. Even so, cell populations obtained by these conventional differentiation methods comprise less than 30% RPCs. In comparison, the methods and compositions of this disclosure are advantageous over conventional RPC differentiation methods. In particular, the methods and compositions described herein enable large-scale, standardized production of human retinal cells from hPSCs and neural stem cells for disease modeling, drug development, and cell therapies.

    I. Definitions

    [0032] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar to or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described herein.

    [0033] In describing the embodiments and claiming the invention, the following terminology will be used in accordance with the definitions set out below.

    [0034] As used herein, the term pluripotent stem cell (hPSC) means a cell capable of continued self-renewal and of capable, under appropriate conditions, of differentiating into cells of all three germ layers. hPSCs exhibit a gene expression profile that includes SOX2.sup.+ and OCT4.sup.+. Examples of human PSCs (hPSCs) include human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs). As used herein, iPS cells or iPSCs refer to cells that are substantially genetically identical to their respective differentiated somatic cell of origin and display characteristics similar to higher potency cells, such as ES cells, as described herein. The cells can be obtained by reprogramming non-pluripotent (e.g., multipotent or somatic) cells.

    [0035] The terms polypeptide, peptide and protein are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymer.

    [0036] The term chemically defined culture medium or chemically defined medium, as used herein, means that the molecular identity, chemical structure, and quantity of each medium ingredient is definitively known. The term ingredient, as used herein, refers to a component the molecular identity and quantity of which is known. In some cases, a chemically defined medium is made xeno-free, and incorporate human proteins, which can be produced using recombinant technology or derived from placenta or other human tissues in lieu of animal-derived proteins. In some embodiments, all proteins added to the medium are recombinant proteins.

    [0037] As used herein, a medium consisting essentially of means a medium that contains the specified ingredients and those that do not materially affect its basic characteristics.

    [0038] Supplemented, as used herein, refers to a composition, e.g., a medium comprising a supplemented component (e.g., B27, N2). For example a medium further supplemented with B27 or N2 supplement, refers to the medium comprising B27 or N2 supplement, and not to the act of introducing the B27 or N2 supplement to the medium.

    [0039] The terms purified or enriched cell populations are used interchangeably herein, and refer to cell populations, in vitro or ex vivo, that contain a higher proportion of a specified cell type or cells having a specified characteristic than are found in vivo (e.g., in a tissue).

    [0040] As used herein, serum-free means that a medium does not contain serum or serum replacement, or that it contains essentially no serum or serum replacement. For example, an essentially serum-free medium can contain less than about 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2% or 0.1% serum, wherein the culturing capacity of the medium is still observed.

    II. Methods

    [0041] Accordingly, in a first aspect, this disclosure provides in vitro methods for efficiently and robustly producing retinal progenitor cells (RPCs), preferably RPCs suitable for use in drug screening applications and for regenerative cell therapies. The methods enable scalable, industrial production of enriched or purified human RPCs.

    [0042] In certain embodiments, an in vitro method of producing human RPCs comprises or consists essentially of the following steps: (a) culturing human pluripotent stem cells (hPSCs) for about 6 days in a neural differentiation medium whereby embryoid bodies are formed, wherein the neural differentiation medium is supplemented with N-2 supplement and Non-Essential Amino Acid (NEAA) cell culture supplement beginning on culturing day 3; (b) dissociating the embryoid bodies formed in step (a) into a single cell suspension; and (c) culturing the single cell suspension in an adherent monolayer for between 15 days and 22 days in a retinal differentiation medium, whereby a cell population comprising human retinal progenitor cells is obtained.

    [0043] As used herein the term embryoid bodies (EBs) refers to three-dimensional multicellular aggregates of differentiated and undifferentiated cells derivatives of three embryonic germ layers. EBs can be obtained by any suitable method. In some cases, human pluripotent cells are cultured under conditions that promote the formation of stem cell aggregates and spontaneous formation of EBs, which contain a mixture of undifferentiated and differentiated cell types of the three primary germ layers. In some cases, hPSCs are cultured in low adhesion tissue culture dishes or in liquid suspension culture to promote aggregate formation. As used herein, the term suspension culture refers the low adhesion or liquid suspension culture conditions under which pluripotent stem cells are cultured to promote aggregation of the pluripotent stem cells and spontaneous formation of EBs from the aggregates.

    [0044] Upon formation, EBs are gradually transitioned from a chemically defined basal culture medium (e.g., E8 medium) to a neural induction medium (NIM) that comprises or consists essentially of DMEM/F12 (1:1), 1% N2 supplement, and 1 Non-Essential Amino Acid (NEAA) supplement, by replacing the chemically defined basal culture medium with a 3:1 ratio of E8 medium to NIM on retinal differentiation day 1, a ratio of 1:1 on day 2, and 100% NIM on day 3. EBs are cultured in NIM for another 4 days. On retinal differentiation day 7, EBs were seeded onto plates with NIM containing 5% fetal bovine serum (FBS). The medium was changed to serum-free NIM one day later, and the EBs were fed with fresh NIM every other day. On differentiation day 16, NIM was removed and replaced with retinal differentiation medium (RDM) that comprises or consists essentially of DMEM/F12 (3:1) supplemented with 2% B27 supplement (without vitamin A) and 1NEAA, with daily medium changes. On day 20 (after about 4 days of culture in RDM), cells were treated with trypsinLE to detach the cells and to obtain a single cell suspension.

    [0045] In some cases, the neural induction medium is a chemically defined medium. Neural induction medium, as used herein, refers to a medium capable of promoting and supporting differentiation of human pluripotent stem cells towards a neural lineage, e.g., towards neuroectoderm and neuroepithelium. A neural induction base medium can include, but is not limited to E6 medium, as described herein and in U.S. Patent Publication No. 2014/0134732. Preferably, the chemically defined medium comprises DMEM/F-12. In some cases, the neural induction medium is E8 medium. As used herein, the terms E8 culture medium and E8 are used interchangeably and refer to a chemically defined culture medium comprising or consisting essentially of DF3S supplemented by the addition of insulin (20 g/mL), transferrin (10.67 ng/mL), human FGF2 (100 ng/mL), and human TGF1 (Transforming Growth Factor Beta 1) (1.75 ng/mL). The medium can be prepared based on the formula in previous publication (Chen et al., (2011) Nature Methods. 8(4), 424-429). As an alternative, the medium is also available from Thermal Fisher/Life Technologies Inc. as Essential 8, or from Stem Cell Technologies as TeSR-E8.

    [0046] As used herein, the term N2 Supplement (also known as N-2 Supplement) refers to a chemically-defined, serum-free nutritional supplement. In some cases, N2 supplement is added to a basal culture medium such as DMEM. As used herein, the term B27 Supplement refers to a serum-free nutritional supplement that promotes long term survival of in vitro cultured neurons. N2 supplement and B27 supplement are available from various commercial vendors such as ThermoFisher.

    [0047] As used herein, pluripotent stem cells appropriate for use according to a method of the invention are cells having the capacity to differentiate into cells of all three germ layers. Suitable pluripotent cells for use herein include human embryonic stem cells (hESCs) and human induced pluripotent stem (iPS) cells. As used herein, embryonic stem cells or ESCs mean a pluripotent cell or population of pluripotent cells derived from an inner cell mass of a blastocyst. See Thomson et al., Science 282:1145-1147 (1998). These cells express Oct-4, SSEA-3, SSEA-4, TRA-1-60 and TRA-1-81, and appear as compact colonies having a high nucleus to cytoplasm ratio and prominent nucleolus. ESCs are commercially available from sources such as WiCell Research Institute (Madison, Wis.). As used herein, induced pluripotent stem cells or iPS cells mean a pluripotent cell or population of pluripotent cells that may vary with respect to their differentiated somatic cell of origin, that may vary with respect to a specific set of potency-determining factors and that may vary with respect to culture conditions used to isolate them, but nonetheless are substantially genetically identical to their respective differentiated somatic cell of origin and display characteristics similar to higher potency cells, such as ESCs, as described herein. See, e.g., Yu et al., Science 318:1917-1920 (2007).

    [0048] Induced pluripotent stem cells exhibit morphological properties (e.g., round shape, large nucleoli and scant cytoplasm) and growth properties (e.g., doubling time of about seventeen to eighteen hours) akin to ESCs. In addition, iPS cells express pluripotent cell-specific markers (e.g., Oct-4, SSEA-3, SSEA-4, Tra-1-60 or Tra-1-81, but not SSEA-1). Induced pluripotent stem cells, however, are not immediately derived from embryos. As used herein, not immediately derived from embryos means that the starting cell type for producing iPS cells is a non-pluripotent cell, such as a multipotent cell or terminally differentiated cell, such as somatic cells obtained from a post-natal individual.

    [0049] Subject-specific somatic cells for reprogramming into induced pluripotent stem cells can be obtained or isolated from a target tissue of interest by biopsy or other tissue sampling methods. In some cases, subject-specific cells are manipulated in vitro prior to use in a three-dimensional tissue construct of the invention. For example, subject-specific cells can be expanded, differentiated, genetically modified, contacted to polypeptides, nucleic acids, or other factors, cryo-preserved, or otherwise modified prior to differentiation into retinal progenitor cells according to the methods of this disclosure.

    [0050] Preferably, human pluripotent stem cells (e.g., human ESCs or iPS cells) are cultured in the absence of a feeder layer (e.g., a fibroblast layer), a conditioned medium, or a culture medium comprising poorly defined or undefined components. As used herein, the terms chemically defined medium and chemically defined cultured medium also refer to a culture medium containing formulations of fully disclosed or identifiable ingredients, the precise quantities of which are known or identifiable and can be controlled individually. As such, a culture medium is not chemically defined if (1) the chemical and structural identity of all medium ingredients is not known, (2) the medium contains unknown quantities of any ingredients, or (3) both. Standardizing culture conditions by using a chemically defined culture medium minimizes the potential for lot-to-lot or batch-to-batch variations in materials to which the cells are exposed during cell culture. Accordingly, the effects of various differentiation factors are more predictable when added to cells and tissues cultured under chemically defined conditions. As used herein, the term serum-free refers to cell culture materials that are free of or substantially free of serum obtained from animal (e.g., fetal bovine) blood.

    [0051] In some embodiments, any of the above-referenced cells are cultured in a xeno-free cell culture medium. Of central importance for clinical therapies is the absence of xenogeneic materials in the derived cell populations, i.e., no non-human cells, cell fragments, sera, proteins, and the like. Culturing cells or tissues in the absence of animal-derived materials (i.e., under conditions free of xenogeneic material) reduces or eliminates the potential for cross-species viral or prion transmission.

    [0052] Prior to culturing hPSCs (e.g., hESCs or hiPSCs) under suspension conditions that promote embryoid body formation, hPSCs can be cultured in the absence of a feeder layer (e.g., a fibroblast layer) on a substrate suitable for proliferation of hPSCs, e.g., Matrigel, vitronectin, a vitronectin fragment, or a vitronectin peptide, or Synthemax. In some cases, the hPSCs are passaged at least 1 time to at least about 5 times in the absence of a feeder layer. Suitable culture media for passaging and maintenance of hPSCs include, but are not limited to, mTeSR and E8 media. In some embodiments, the hPSCs are maintained and passaged under xeno-free conditions, where the cell culture medium is a chemically defined medium such as E8 or mTeSR, but the cells are maintained on a completely defined, xeno-free substrate such as human recombinant vitronectin protein or Synthemax (or another type-of self-coating substrate). In one embodiment, the hPSCs are maintained and passaged in E8 medium on human recombinant vitronectin or a fragment thereof, a human recombinant vitronectin peptide, or a chemically defined self-coating substrate such as Synthemax.

    [0053] Any appropriate method can be used to detect expression of biological markers characteristic of cell types described herein. For example, the presence or absence of one or more biological markers can be detected using, for example, RNA sequencing, immunohistochemistry, polymerase chain reaction, qRT-PCR, or other technique that detects or measures gene expression. Suitable methods for evaluating the above-markers are well known in the art and include, e.g., qRT-PCR, RNA-sequencing, and the like for evaluating gene expression at the RNA level. Differentiated cell identity is also associated with downregulation of pluripotency markers such as NANOG and OCT4 (relative to human ES cells or induced pluripotent stem cells). Quantitative methods for evaluating expression of markers at the protein level in cell populations are also known in the art. For example, flow cytometry is typically used to determine the fraction of cells in a given cell population that express (or do not express) a protein marker of interest (e.g., PAX6). In some cases, cell populations obtained by the RPC differentiation methods of this disclosure comprise at least 80%, 85%, 90%, 95% and preferably at least 98% RPCs.

    [0054] As used herein, gene expression refers to the relative levels of expression and/or pattern of expression of a gene in a biological sample, such as retinal progenitor cells, or population of cells comprising retinal progenitor cells. The expression of a gene, such as a biological marker (biomarker) of retinal differentiation (e.g., VSX2, HES5, LHX2, NR2E1, RAX, and VAX2), may be measured at the level of cDNA, RNA, mRNA, or combinations thereof. In some cases, altered expression a gene, such as a retinal progenitor biomarker such as VSX2, HES5, LHX2, NR2E1, RAX, and VAX2, is measured at the protein level. In some cases, the level of gene expression or protein expression of a biomarker of interest is multiple fold (e.g., 2, 3, 4, 5, 10, 20, 50, 100) higher or lower than in untreated cells or in cells treated with a control agent.

    [0055] In some cases, a Pax6D reporter construct is used to sort human RPCs from other cell types. For example, a reporter construct (such as a construct encoding a detectable protein or protein fragment) is operably linked to the human pax6D promoter, whereby the reporter construct is expressed under control of the pax6D promoter. Since Pax6D is uniquely expressed in retinal progenitor cells, expression of the reporter construct is indicative of a Pax6D-positive cell and, thus, a retinal progenitor cell. If the differentiation methods provided herein are performed using human pluripotent stem cells or neuroepithelial cells comprising the Pax6D reporter construct, the resulting cell population comprising retinal progenitor cells (RPCs) can be sorted on the basis of reporter expression. For example, the pax6d promoter is fused with tdTomato and mix cell populations can be detected and sorted on the basis of tdTomato expression in order to enrich for human retinal progenitors.

    [0056] As used herein, the term operably linked refers to the situation in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be in close proximity or contiguous and, where necessary to join two protein coding regions, in the same reading frame.

    [0057] In another aspect, provided herein are methods for promoting neuroepithelial cells to differentiate along the human retinal cell lineage, thereby producing a high proportion of retinal progenitor cells from precursors. The methods of this disclosure include genetic and non-genetic ways of manipulating Pax6D expression at the neuroepithelial stage to promote differentiation of RPCs. In some cases, neuroepithelial cells are genetically modified for inducible expression of Pax6D. In some cases, the RPCs express a detectable label or reporter for cell sorting. Retinal progenitor cells (the Pax6D-positive cells) are sorted from Pax6D-negative cells from a cell population produced according to the differentiation protocols provided herein in order to produce a pure or substantially pure population of RPCs. In this method, progenitor cells (e.g., human pluripotent stem cells, neuroepithelial cells) are genetically manipulated to express a reporter construct, for example a transgene that encodes a detectable marker such a Green Fluorescent Protein (GFP) or a Red Fluorescent Protein (RFP) (td-Tomato). Referring to FIG. 14, a PAX6D reporter line can be constructed by inserting a reporter construct such as tdTomato coding sequence upstream of the PAX6D translation start site in exon 7 of the human Pax6D gene. The resulting construct is inserted in the AAVS1 site of the genome.

    [0058] Referring to FIGS. 15A-15B, inhibition of expression of a downstream mediator of PAX6D signal transduction, and a resulting increase in expression of retinal progenitor biomarkers, can be achieved using RNA interference. In some cases, RNA interference is used to reduce expression of WNT8B. For example, one or more short hairpin interfering RNAs (shRNAs) configured to target WNT8B can be introduced into a cell (e.g., a human pluripotent stem cell) to reduce WNT8B expression. Such WNT8B shRNAs may be introduced into cells as synthetic shRNAs by a number of standard methods known in the art. Alternatively, shRNA sequences may be expressed from an expression vector, e.g., from a plasmid expression vector, a recombinant retrovirus, or a recombinant lentivirus. The expression of a biological marker (biomarker) of retinal differentiation (e.g., VSX2, HES5, LHX2, NR2E1, RAX, and VAX2), may be measured at the level of cDNA, RNA, mRNA, or combinations thereof. In some cases, altered expression a retinal progenitor biomarker such as VSX2, HES5, LHX2, NR2E1, RAX, and VAX2, is measured at the protein level. In some cases, the level of gene expression or protein expression of VSX2, HES5, LHX2, NR2E1, RAX, and VAX2 is multiple fold (e.g., 2, 3, 4, 5, 10, 20, 50, 100) higher than in cells not treated with an agent that reduces expression of WNT8B as described herein.

    [0059] The term detect or detection as used herein indicates the determination of the existence, presence or fact of a target or signal in a limited portion of space, including but not limited to a sample, a reaction mixture, a molecular complex and a substrate including a platform and an array. Detection is quantitative when it refers, relates to, or involves the measurement of quantity or amount of the target or signal (also referred as quantitation), which includes but is not limited to any analysis designed to determine the amounts or proportions of the target or signal. Detection is qualitative when it refers, relates to, or involves identification of a quality or kind of the target or signal in terms of relative abundance to another target or signal, which is not quantified. An optical detection indicates detection performed through visually detectable signals: fluorescence, spectra, or images from a target of interest or a label attached to the target.

    [0060] Establishment of stepwise and chemically defined culture systems for directed differentiation of human pluripotent stem cells to RPCs offers an unprecedented system for screening toxic and therapeutic agents. This system is preferable to conventional use of animals, animal cell cultures, or genetically abnormal human cell lines, particularly because human pluripotent stem cells and their differentiation to RPCs represent a normal process of human retinal development. Hence, the cell populations described herein will be amenable to screen agents that affect normal human retinal development or those that potentially result in abnormal retinal development, as well as those that may stimulate regeneration of RPCs in diseased conditions. In addition, the described system can be readily modified to mimic pathological processes that lead to death of RPCs, which may be effectively used to screen therapeutic agents that are designed to treat these diseases.

    [0061] Accordingly, in another aspect, provided herein are methods of screening in vitro generated human RPCs. For example, human RPCs obtained according to the methods of this disclosure can be exposed to a test compound and examined for changes in gene expression, developmental characteristics, or other characteristics relative to a control cell population that has not been exposed to the test compound. One could understand whether a particular test compound affected the cell population by examining characteristics of the culture and comparing them to known developmental characteristics contained within the present application.

    [0062] In some cases, using the genetic tagging and isolating methods described herein, pure populations of reporter-expressing RPCs can be screening to identify agents (e.g., small molecules, drugs, protein factors) that modulate Pax6D expression. Agents identified in the screen that increases Pax6D expression relative to controls can be used to promote Pax6D expression and, thus, RPC differentiation during retinal differentiation. For example, one may derive a small molecule cocktail to specifically activate PAX6D at particular stage of retinal cell differentiation.

    [0063] In some cases, it may be advantageous to genetically modify RPCs obtained according to the methods provided herein. For example, it can be advantageous in some instances to obtain recombinant and genetically-modified RPCs that produce recombinant cell products, growth factors, hormones, peptides or proteins for a continuous amount of time or as needed when biologically, chemically, or thermally signaled due to the conditions present in culture. In some cases, genetic modifications are produced using a form of gene editing. The term gene editing and its grammatical equivalents as used herein can refer to genetic engineering in which one or more nucleotides are inserted, replaced, or removed from a genome. For example, gene editing can be performed using a nuclease (e.g., a natural-existing nuclease or an artificially engineered nuclease). In some cases, gene editing is performed using a CRISPR/cas system (e.g., a type II CRISPR/cas system). In some cases, the protein expression of one or more endogenous genes is reduced using a CRISPR/cas system. In other cases, a CRISPR/Cas system can be used to perform site specific insertion. For example, a nick on an insertion site in the genome can be made by CRISPR/cas to facilitate the insertion of a transgene at the insertion site. Other methods of making genetic modifications suitable for use according to the methods provided herein include but are not limited to somatic cell nuclear transfer (SCNT) and introduction of a transgene. As used herein, the term transgene refers to a gene or genetic material that can be transferred into an organism or a cell thereof. Procedures for obtaining recombinant or genetically modified cells are generally known in the art, and are described in Sambrook et al, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), incorporated herein by reference.

    [0064] In another aspect, provided herein is a use of RPCs comprising a PAX6D reporter as described herein for drug screening, drug discovery, or drug response. For example, one could expose such cell populations provided herein to a test compound and compare the results of such exposure to a control cell population that has not been exposed to the test compound. One could understand whether a particular test compound affected the cell population by examining characteristics of the culture and comparing them to known developmental characteristics of retinal lineage cells. In some cases, screening comprises detecting a positive or negative change in a particular biological property or activity of a RPC. In some cases, detecting and/or measuring a positive or negative change in a level of expression of at least one gene following exposure (e.g., contacting) of a RPC to a test compound comprises whole transcriptome analysis using, for example, RNA sequencing. In such cases, gene expression is calculated using, for example, data processing software programs such as Light Cycle, RSEM (RNA-seq by Expectation-Maximization), Excel, and Prism. See Stewart et al., PLoS Comput. Biol. 9:e1002936 (2013). In some cases, detecting comprises performing a method such as RNA sequencing, gene expression profiling, transcriptome analysis, metabolome analysis, detecting reporter or sensor, protein expression profiling, Frster resonance energy transfer (FRET), metabolic profiling, and microdialysis.

    [0065] In another aspect, retinal progenitor cells obtained according to the disclosed methods may be further differentiated to other cell types such as photoreceptors, which could be used clinically to treat or prevent degenerative eye diseases.

    III. Articles of Manufacture

    [0066] In another aspect, provided herein is a kit for generating substantially pure populations of human retinal progenitor cells. In exemplary embodiments, the kit comprises one or more of (i) a culture medium suitable for differentiating human pluripotent stem cells into retinal progenitor cells; (ii) a PAX6D reporter construct; (iii) reagents for genetic modification of cells to achieve inducible expression of Pax6D; (iv) an agent that reduces expression of WNT8B; and (v) instructions describing a method for generating substantially pure populations of human retinal progenitor cells, the method employing one or more of the culture medium, the PAX6D reporter construct, the genetic modification reagents, and the agent.

    [0067] In some cases, the kit comprises one or more of (i) a neural induction medium; (ii) a retinal differentiation medium; (iii) a PAX6D reporter construct; (iv) reagents for genetic modification of cells to achieve inducible expression of Pax6D; (v) an agent that reduces expression of WNT8B; and (vi) instructions describing a method for generating substantially pure populations of human retinal progenitor cells, the method employing one or more of the neural induction medium, the retinal differentiation medium, the PAX6D reporter construct, the genetic modification reagents, and the agent.

    [0068] In some cases, the materials described above as well as other materials can be packaged together in any suitable combination as a kit useful for performing, or aiding in the performance of, a method provided herein. It is useful if the kit components in a given kit are designed and adapted for use together in the disclosed method. For example, disclosed herein are kits comprising genetically modified human RPCs produced by the disclosed methods.

    [0069] Nucleic acids and/or other constructs of the invention may be isolated. As used herein, isolated means to separate from at least some of the components with which it is usually associated whether it is derived from a naturally occurring source or made synthetically, in whole or in part. In some embodiments, kits also can contain a cell culture medium, labels, and/or other reagents for the cell culture and detection of biological markers, polypeptides, or nucleic acids of interest in the genetically modified RPCs.

    [0070] The terms protein, peptide, and polypeptide are used interchangeably herein and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long. A protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins. One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc. A protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex. A protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide. A protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof. A protein may comprise different domains, for example, a nucleic acid binding domain and a nucleic acid cleavage domain. In some embodiments, a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain.

    [0071] Nucleic acids, proteins, and/or other compositions (e.g., cell population) described herein may be purified. As used herein, purified means separate from the majority of other compounds or entities, and encompasses partially purified or substantially purified. Purity may be denoted by a weight by weight measure and may be determined using a variety of analytical techniques such as but not limited to mass spectrometry, HPLC, etc.

    [0072] In interpreting this disclosure, all terms should be interpreted in the broadest possible manner consistent with the context. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. It is understood that certain adaptations of the invention described in this disclosure are a matter of routine optimization for those skilled in the art, and can be implemented without departing from the spirit of the invention, or the scope of the appended claims.

    [0073] As used in this specification and the appended claims, the singular forms a, an, and the include plural references unless the context clearly dictates otherwise. Any reference to or herein is intended to encompass and/or unless otherwise stated.

    [0074] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

    [0075] The terms comprising, comprises and comprised of as used herein are synonymous with including, includes or containing, contains, and are inclusive or open-ended and do not exclude additional, non-recited members, elements, or method steps. The phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. The use of including, comprising, having, containing, involving, and variations thereof, is meant to encompass the items listed thereafter and additional items. Embodiments referenced as comprising certain elements are also contemplated as consisting essentially of and consisting of those elements. Use of ordinal terms such as first, second, third, etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed. Ordinal terms are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term), to distinguish the claim elements.

    [0076] The terms about and approximately shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Typical, exemplary degrees of error are within 10%, and preferably within 5% of a given value or range of values. Alternatively, and particularly in biological systems, the terms about and approximately may mean values that are within an order of magnitude, preferably within 5-fold and more preferably within 2-fold of a given value. Numerical quantities given herein are approximate unless stated otherwise, meaning that the term about or approximately can be inferred when not expressly stated.

    [0077] The invention will be more fully understood upon consideration of the following non-limiting Examples. It is specifically contemplated that the methods disclosed are suited for pluripotent stem cells generally. All papers and patents disclosed herein are hereby incorporated by reference as if set forth in their entirety.

    Example

    [0078] PAX6 Isoforms are Differentially Expressed in the Forebrain and Retinas

    [0079] PAX6 has 4 isoforms (PAX6A, PAX6B, PAX6C and PAX6D) in human (FIG. 2A) and 3 isoforms (Pax6, Pax6(5a) and Pax6PD) in mice. The protein sequences of PAX6A, PAX6B and PAX6D (homolog of Pax6, Pax6(5a) and Pax6PD, respectively) are highly conserved among species, indicating their important and conserved functions. Western blotting analysis on 12-week-old embryos revealed that PAX6 isoforms exhibited differential expression patterns in human fetal forebrain and retinas. PAX6D was expressed uniquely in human fetal retinal tissues while PAX6A&B isoforms were expressed in both human fetal forebrain and retinal tissues (FIG. 2B), suggesting a unique role of PAX6D in retinal development.

    [0080] Human pluripotent stem cell differentiation in vitro provides an ideal model to study the early human neural development (Tao and Zhang, 2016). By differentiating H9 hESCs to forebrain and retinal cells (Wang et al., 2015; Zhong et al., 2014) (FIGS. 9B-9C), we found that overall PAX6 mRNA increased during the differentiation to both forebrain and retinal cells (FIG. 9D). Consistent with the previous gene profile study (Huang et al., 2016), we found that PAX6A and PAX6B increased in both forebrain and retinal differentiation (FIG. 9E). Interestingly, PAX6D isoform showed a differential expression pattern between forebrain and retinal differentiation. It was expressed only in retinal differentiation but not in the forebrain neuroepithelial differentiation (FIG. 2C & FIG. 9F). Western blotting using a PAX6 antibody targeting the C terminus, which can detect both PAX6A&B and PAX6D, validated the expression pattern of PAX6A&B and D isoforms. In particular, PAX6D was detected only in retinal differentiation. It began to express at day 12, reaching a peak at day 23, and then decreasing along differentiation (FIG. 2C). Thus, PAX6 isoforms are differentially expressed in forebrain neuroepithelia and retinas during development and hESC differentiation with PAX6D specifically in retinal progenitors.

    [0081] PAX6 KO Prevents hESCs from Entering the Neural Retinal Fate

    [0082] The differential expression pattern of PAX6 isoforms suggests their disparate roles in neural and retinal development. We firstly generated PAX6 KO hESC lines by targeting exon 8 which is shared by all the isoforms in H9 hESC line using CRISPR/CAS9 (FIG. 3A). The PAX6 KO line lose all the 3 isoforms after the exon 8 was replaced with the PGK-puromycin element (FIG. 10A). PAX6 mRNA levels were undetectable at multiple time points along retinal differentiation (FIG. 3B). Western blot showed that both the PAX6A&B and PAX6D isoforms were removed in PAX6 KO cells (FIG. 3C). Antibodies targeting the N-terminus and C-terminus failed to detect any PAX6 protein expression in the differentiating cells from the PAX6 KO line (FIG. 3D). These data demonstrate that our PAX6 KO line is loss of all the PAX6 isoforms.

    [0083] qRT-PCR analysis revealed that the expression of retinal lineage markers, including VSX2 (formerly Chx10), VAX2, HES5, SIX6, MAB21L2, NR2E1 and NR2F1, were dramatically lower in the PAX6 KO cells (FIG. 3E). Some of them (VSX2, VAX2, SIX6, NR2E1 and NR2F1) were not upregulated during the retinal differentiation process. In particular, VSX2, critical for retinal development, was absent in PAX6 KO cells (FIG. 3E), which was confirmed by immunostaining (FIG. 10C), indicating a failure in retinal specification.

    [0084] PAX6D is Required for NR Specification

    [0085] The requirement of PAX6 for human retinal fate specification and the differential expression pattern of PAX6 isoforms led us to hypothesize that PAX6D is required for retinal specification. We then generated a PAX6D isoform-specific knockout hESC line. All the PAX6D coding sequences (CDS) are shared by PAX6A and PAX6B (FIG. 2A). Deletion of any exons within the CDS will affect all the isoforms. However, PAX6 isoform transcription is controlled by separate promoters and PAX6D has an additional exon (exon alpha) in its 5-UTR (Kammandel et al., 1999; Lakowski et al., 2007; Marquardt et al., 2001). Based on the unique feature of PAX6D, we successfully generated PAX6D specific knockout by partially replacing Exon with the PGK-puromycin element using CRISPR/CAS9 (FIG. 4A, FIG. 12). We confirmed PAX6D KO by qPCR and western blot (FIGS. 4B-4C). PAX6D mRNA and protein were reduced to undetectable in PAX6D KO cells. Western blot also validated the isoform knockout specificity by using the PAX6 antibodies that recognize the PAX6 C-terminus, which detects both PAX6A&B and PAX6D. It showed that PAX6A&B was expressed at a similar level in the PAX6D KO cells (FIGS. 4B-4C), indicating only PAX6D was knocked out. Knockout of PAX6D in hESCs caused a similar phenotype as PAX6 KO cells. The key EFTFs such as VSX2 and SIX6 were not upregulated in PAX6D KO cells along the retinal differentiation (FIGS. 4D-4E). Immunostaining analysis showed the absence of VSX2 expression in PAX6D KO cells (FIG. 4F).

    [0086] To systematically analyze the gene profile of cells with PAX6D knockout, we performed RNA-Seq for wildtype, PAX6 KO and PAX6D KO cells (Table 2). Pairwise comparison of PAX6 KO with WT showed that 611 genes were differentially expressed (2 fold; p<0.05). Among them, 399 genes were down-regulated in PAX6 KO cells, which are highly related to retinal development or retinal function, including visual perception, melanin biosynthetic process and eye development (FIG. 4G). In addition, cell proliferation and neural tube patterning signaling pathways, such as WNT and BMP, were also down-regulated in PAX6 KO cells (FIG. 4G). These results are consistent with our findings above that PAX6 KO cells were defective in retinal fate specification and suggest a potential role of PAX6 in regulating retinal differentiation by modulating WNT or BMP pathway. Gene ontology (GO) analysis for the up-regulated 212 genes in PAX6 KO cells showed that negative regulation of cell proliferation, cell differentiation and nervous system development were among the top enriched biological processes, suggesting a role of PAX6 in regulating cell proliferation and neural fate determination.

    [0087] Deletion of PAX6D isoform was associated with altered gene expression in retinal development (FIG. 4H). There were 309 genes that were differentially expressed between wildtype and PAX6D KO cells. Among them, 151 were down-regulated in PAX6D KO cells, which were enriched in gene ontologies such as visual perception, lens development in camera-type eye, melanin biosynthetic process, WNT pathway and optical cup morphogenesis in camera-type eye development (FIG. 4H). This profile suggests a failure of retinal differentiation in PAX6D KO cells. The 158 up-regulated genes in PAX6D KO cells were enriched in biological processes such as anterior/posterior pattern specification, multicellular organism development, neuron migration, central nervous system development, positive regulation of cell differentiation and neuron fate specification. This profile highlights the tendency of the PAX6D KO cells towards neuroepithelia.

    [0088] Comparing the down-regulated genes between PAX6 KO and PAX6D KO cells, we found two-thirds (109 out of 151) of the differentially expressed genes in PAX6D KO cells are overlapped with those in PAX6 KO cells (FIG. 4I). GO analysis of the shared 109 genes highlights the role of PAX6D in retinal fate determination since the top GO terms are related to retinal functionality and optic cup morphogenesis (FIG. 4J). Among the shared down-regulated genes, 12% of the genes such as VSX2, VAX2 and PAX2 are in the visual perception category (FIG. 4J & Table 3). The 290 genes that are uniquely down-regulated in PAX6 KO cells but not in PAX6D KO cells would signal the function of other PAX6 isoforms. GO analysis of this set of genes showed that cell adhesion, negative regulation of Wnt signaling pathway and positive regulation of cell proliferation are the top affected biological processes (FIG. 11B & Table 3). This is consistent with the function of Pax6 and Pax6(5a) revealed in model animals (Jami et al., 2013; Jones et al., 2002; Klimova and Kozmik, 2014). Together, our RNA-Seq analysis further suggests that the failed retinal differentiation seen in PAX6 KO cells is essentially attributed to the loss of PAX6D function.

    [0089] At the cellular level, the retinal differentiation culture contains both neuroepithelia and retinal cells. The EFTFs, including PAX6, used to define the early retinal cells are also expressed in neuroepithelia. SOX1, a neuroepithelial marker, is absent in PAX6.sup.+ and SOX2.sup.+ early RPCs (Chen et al., 2017; Kamachi et al., 1998). Indeed, immunostaining of 12-week human fetal tissues indicated the expression of PAX6, SOX1, and SOX2 in the developing human forebrain but with lack of SOX1 in retinas (FIG. 5A, FIG. 12). Thus, we used SOX1 and SOX2 to monitor the retinal fate specification (SOX1.sup./SOX2.sup.+) from neuroepithelia (SOX1.sup.+/SOX2.sup.+). FACS analysis of retinal differentiation cultures at day 7 (before NR differentiation) indicated that more than 80% of the cells were neuroepithelial cells (SOX1.sup.+/SOX2.sup.+) among all lines (FIG. 5B). Few SOX1.sup./SOX2.sup.+ cells were present. At day 20, about 30% of the cells were SOX1.sup./SOX2.sup.+ in WT but only 0.3% and 3.5% in the PAX6 KO and PAX6D KO groups, respectively (FIGS. 5C-5D). Consistent with the reduced SOX1.sup./SOX2.sup.+ population in PAX6 KO and PAX6D KO cells, SOX1 mRNA levels support the trend. Its relative expression was much higher in PAX6 KO and PAX6D KO cells than WT (FIG. 5E). The absence of SOX1.sup./SOX2.sup.+ population demonstrates the defect in early retinal specification in both PAX6 KO and PAX6D KO cells.

    [0090] PAX6D is Sufficient for Retinal Specification from Neuroepithelia

    [0091] The observation that PAX6D KO results in the loss of retinal differentiation led us to hypothesize that PAX6D may be sufficient for retinal specification from neuroepithelia. To test his hypothesis, we introduced the PAX6D isoform into the PAX6 KO background by establishing the Tet-on inducible cell lines (FIG. 6A). We also made the PAX6A inducible cell lines as a control (FIG. 6A). As indicated by qPCR and Western blot, only PAX6A or PAX6D expression was induced in the respective cell line by doxycycline (DOX, 0.5 g/ml) (FIGS. 6B-6C).

    [0092] We then examined the retinal progenitor population when PAX6A or PAX6D was induced. We turned on PAX6A and PAX6D separately in PAX6 KO cells after neuroepithelial cells were generated at day 6 and monitored the retinal progenitor generation along retinal differentiation. Induction of PAX6D with DOX for 7 days from day 6 of retinal differentiation, resulted in the elevated expression of retinal lineage markers such as VSX2 (3-fold increase), VAX2 (2-fold increase) and SIX6 (FIG. 6E). The expression of the neuroepithelial gene SOX1 was downregulated at the mRNA (FIGS. 6D-6E) and cellular level (FIG. 13A). In contrast, induction of PAX6A upregulated SOX1 expression level (FIG. 6D). Correspondingly, the SOX1.sup./SOX2.sup.+ retinal progenitor population, assayed by flow cytometry, increased from 2.71% to 23.1% when PAX6D was induced whereas this population did not obviously change (from 2.45% to 2.22%) when PAX6A was induced (FIG. 6F). Thus, PAX6D but not PAX6A restores the PAX6 function in retinal specification.

    [0093] PAX6D Represses Neural while Activating Retinal Lineage Genes

    [0094] ChIP-Seq was performed to determine how PAX6D regulates retinal differentiation. Technically, there are no antibodies which can only detect PAX6D due to the identical C-terminus among PAX6A, PAX6B and PAX6D (FIG. 2A). To overcome this, we built PAX6A and PAX6D inducible cell lines under the PAX6 KO background with PAX6A and PAX6D tagged by 3Flag, respectively (FIG. 5A). We used PAX6 KO cells as our target to eliminate or minimize the influence of endogenous PAX6 isoforms, which may compete with the induced isoforms for binding sites. We applied DOX at day 6 of retinal differentiation for 3 days and harvested cells at day 10 for ChIP-Seq (FIG. 7A). We found that the IP strength in separate ChIP experiments for the FLAG antibody pull-down was similar for the replicates and the target DNA fragments were highly enriched (FIG. 7B). Analysis of the pull-down DNA fragments by ChIP-Seq revealed that PAX6A and PAX6D shared many downstream genes. There were 1281 genes predicted to be their common targets, which includes genes related to nervous system development such as DSCAM, APP, BDNF, DCX, DLG2 and NLGN1 (Table 3), genes for neuron migration such as SPOCK1, ADGRL3, PCM1, PEX7 and SEMA3A, and genes for cell adhesion such as ACTN2, CTNNA1, CTNNA3, COL28A1, DST, IBSP, ITGB3BP and OPCML. The result suggests that PAX6A and PAX6D have redundant roles in these biological processes.

    [0095] Gene ontology analysis of the unique genes targeted by PAX6A or PAX6D indicated that PAX6D was specifically involved in such biological processes as nervous system development and camera-type eye morphogenesis while PAX6A was associated with the cell functionality such as signal transduction and metabolic process (FIG. 7C & Table 4).

    [0096] Carefully analyzing PAX6D target genes, we identified a set of retinal lineage genes and a set of neural lineage genes that are regulated by PAX6D based on prediction from our ChIP-Seq data. By using the PAX6D TetOn cells, we confirmed that most of the genes were responsive to PAX6D induction (FIG. 7D). The retinal lineage genes upregulated by PAX6D induction include FGF5, highly expressed in primate retinal cells and rescues the retinal degeneration in animal models (Green et al., 2001; Kitaoka et al., 1994), FOXP2, uniquely expressed in and defines a subset of retinal ganglion cells (Rousso et al., 2016; Sato et al., 2017), TENM3, required for topography in the ipsilateral retino-collicular pathway and specifies morphological and functional connectivity of retinal ganglion cells (Antinucci et al., 2013; Dharmaratne et al., 2012; Glendining et al., 2017), YY1 predominantly expressed in optic vesicle and retinal cells (Bernard and Voisin, 2008; Kwon and Chung, 2003; Vuong et al., 2012) and required for normal eye development (Lorente et al., 2006), DMBX1, necessary for cell cycle exit in developing RPCs (Miles and Tropepe, 2016; Wong et al., 2015; Wong et al., 2010) and MBNL1 which regulates photoreceptor development (Huang et al., 2008). In contrast, the neural lineage genes repressed by PAX6D induction include MYT1L, sufficient to convert fetal and postnatal human fibroblasts into induced neuronal cells (Mall et al., 2017), WNT8B, restricted in dorsal forebrain (Lako et al., 1998) and inhibits retinal differentiation (Liu, 2012), NLGN, essential for presynaptic terminal maturation (Wittenmayer et al., 2009), and DCX, predominantly expressed in immature neurons (Capes-Davis et al., 2005; Couillard-Despres et al., 2005) (FIG. 7D). This result suggests that PAX6D regulates retinal differentiation by targeting retinal genes while repressing other neural genes.

    [0097] PAX6D Instructs a Retinal Fate by Regulating WNTs.

    [0098] The highly upregulated WNT-related GO terms in PAX6D KO cells revealed by RNA-Seq (FIGS. 4G-4H) and the identification of WNT8B as one of the PAX6D targets from ChIP-seq (FIG. 7D) suggest that PAX6D may regulate retinal specification by modulating WNT pathway. WNT8B has a restricted expression in the developing dorsal forebrain (Lako et al., 1998) and plays a repressive role in retinal fate specification (Liu et al., 2010). We found that WNT8B expression was much higher in PAX6D KO cells than wildtype cells at multiple time points along retinal differentiation (FIG. 8A). Given the direct connection between PAX6D and WNT8B, we hypothesized that PAX6D regulates retinal specification by repressing WNT8B transcription and thus WNT activity. Indeed, treatment with WNT agonist (CHIR99021, 3 M) in wildtype cells from day 0 to day 10 suppressed the expression EFTFs. In contrast, treatment with a WNT antagonist (IWR1, 2.5 M) in wildtype cells enhanced the expression of EFTFs (FIG. 8B). These results suggest that WNT signaling represses retinal specification from the neuroepithelia.

    [0099] We then asked if the failure of retinal specification in the PAX6D KO cells is rescued by regulating WNT signaling. Treatment of the PAX6D KO cells with IWR1 during retinal differentiation from day 0 to day 10 increased the expression of retinal related genes, including VSX2, LHX2, HES5, SIX3 and SIX6 (FIG. 8C). This result suggests that WNT signaling is indeed downstream of PAX6D function in retinal specification. To further corroborate the role of WNTs in mediating the function of PAX6D in retinal specification, we then activated WNT pathway signaling under PAX6D induction along retinal differentiation. As indicated by expression of retinal genes (VSX2, LHX2, SIX6, NR2F1 and VAX2) at day 10 of retinal differentiation, induction of PAX6D by DOX enhanced retinal differentiation. Such PAX6D-induced retinal differentiation was completely blocked by treatment with WNT agonist CHIR99021 from day 0 to day 10 (FIG. 8D). These results indicate that regulation of retinal differentiation by PAX6D is dependent on the canonical WNT pathway.

    [0100] We found that isoforms of PAX6 are differentially expressed in neuroepithelial and retinal tissues with PAX6D specifically expressed in retinal cells during human eye development and along hESC differentiation to retinal cells. Deletion of PAX6D down-regulates retinal gene profiles and blocks retinal differentiation, similar to that with complete PAX6 KO. Induced expression of PAX6D, but not PAX6A, restores the retinal differentiation capacity of the PAX6-null cells. These results indicate that PAX6D is necessary and sufficient for retinal lineage specification from neuroepithelia (FIG. 8E). By identifying the PAX6D targets and by regulating one of its targets, WNTs, we are able to rescue the retinal differentiation deficit in PAX6D KO cells and block retinal differentiation when PAX6D is induced, revealing how PAX6D regulates retinal specification (FIG. 8E).

    [0101] Genetic studies in multiple model organisms have firmly established that PAX6 is essential for retinal development (Collinson et al., 2000; Grindley et al., 1995; Hogan et al., 1986; Li et al., 2007; Quinn et al., 1996). PAX6 is also required for neuroectoderm development, especially the dorsal forebrain (Georgala et al., 2011; Jones et al., 2002; Zhang et al., 2010) from which the retinal is specified. This raises a question of how PAX6 instructs neuroepithelial cells to RPCs. Our present observation indicates that PAX6D is uniquely expressed in NR during human development and along hESC retinal differentiation. This is consistent with observations made in model animals that Pax6PD is expressed exclusively in NR but not the developing lens or cornea (Kim and Lauderdale, 2006, 2008) and that the promoter (exon ) controlling Pax6PD transcription also has a restricted distribution in NR (Kim and Lauderdale, 2008; Marquardt et al., 2001). However, the exact role of Pax6PD (or PAX6D in human) remains unknown (Shaham et al., 2012), possibly due to the lack of the Pax6PD loss of function animal model. This is probably because of the difficulty to create such a model with the traditional genetic tools, as Pax6PD shares all the coding sequences with other isoforms. By using CRISPR/CAS9 to target the exon which only exists in PAX6D 5 UTR, we generated the PAX6D specific knockout. This model enables us to learn the physiological function of PAX6D in retinal development. Indeed, knockout of PAX6D in hESC prevents the cells from becoming retinal cells. This is confirmed by the lack of SOX1.sup./SOX2.sup.+ retinal progenitors and the substantial down regulation of retinal lineage genes, revealed by RNA sequencing. This phenotype is very similar to complete PAX6 KO in which the differentiated cells remain as neuroepithelia. In contrast, introduction of PAX6D but not PAX6A into PAX6 KO neuroepithelial cells is sufficient to convert the neuroepithelial cells (SOX1.sup.+/SOX2.sup.+) to RPCs (SOX1.sup./SOX2.sup.+). Therefore, PAX6D is necessary and sufficient for specifying neuroepithelia to retinal cells.

    [0102] The question arises is how PAX6D converts neuroepithelia to RPCs. Our ChIP-seq revealed genes that are targeted by PAX6D, including a set of retinal genes and neural genes that are predicted based on the enrichment of peaks in genomic genes and validated by our transgenic analysis. The neuroectoderm genes repressed by PAX6D include critical transcription factors like MYT1L that is sufficient for neuronal fate reprogramming from fibroblast cells (Mall et al., 2017) and signaling molecules such as WNT8B which inhibits retinal differentiation (Liu, 2012). It is conceivable that repression of the neuroepithelial transcription factors and associated signaling endows the neuroepithelia with the potential to become RPCs. Then it is the retinal genes and related signaling activated by PAX6D that enable the conversion of the neuroepithelia to RPCs. Indeed, our Chip-Seq revealed retinal associated genes that are activated by PAX6D, such as FGF5, FOXP2, TENM3, YY1, DMBX1 and MBNL1. VSX2, a master regulator of RPCs (Burmeister et al., 1996), is also regulated by PAX6D (FIG. 6E). In our present study, we have shown that VSX2 is essentially absent when PAX6D is knocked out. In contrast, PAX6D induces VSX2 expression and retinal differentiation from hESCs even when PAX6 is deleted. Therefore, PAX6D specifies the retinal fate from neuroepithelia by repressing neuroectodermal genes, activating retinal genes and modulating related signaling molecules.

    [0103] One of the signaling pathways that mediates retinal specification and that is targeted by PAX6D is WNT8B. WNT8B is expressed in the dorsal forebrain (Lako et al., 1998) and antagonizes retinal specification (Cavodeassi et al., 2005). WNT activity is absent in distal optic vesicle (prospective NR) at the early stage of retinal fate specification (Liu et al., 2003; Liu et al., 2006), highlighting the requirement of Wnt8B suppression for retinal specification (Liu et al., 2010). Consistent with the phenomena observed in animals, WNT8B expression is upregulated in PAX6D KO cells, suggesting the role of WNTs in mediating the effect of PAX6D. Indeed, chemical inhibition of WNTs rescues retinal differentiation from neuroepithelia with PAX6D KO. In contrast, chemical activation of WNT signaling blocks retinal differentiation from neuroepithelia even when PAX6D is over expressed. Thus, one of the mechanisms by which PAX6D specifies forebrain neuroepithelia to RPCs is to regulate WNT activity.

    [0104] To further explore the role of WNT pathway signaling in retinal development, short hairpin RNAs (shRNA) were designed to target and knock down expression of WNT8B. Generally, nucleotide sequence encoding an shRNA is operably linked to an RNA polymerase promoter and are introduced into a cell via an expression vector such as a viral vector. Three shRNAs targeting WNT8B were designed and used in the following assay. The hairpin sequences of the 3 WNT8B shRNAs were:

    TABLE-US-00001 (SEQIDNO:1) GATCCCCATGAAACGCACGTGTAATTCAAGAGATTACACGTGCGTTTCAT GGTTTTT; (SEQIDNO:2) GATCCCCTAGCCTATCAACCCTTATTCAAGAGATAAGGGTTGATAGGCTA GGTTTTT; and (SEQIDNO:3) GATCCCTCTGGAGTGCTAACTTGATTCAAGAGATCAAGTTAGCACTCCAG AGTTTTT.
    All lentivirus expression constructs were produced by Santa Cruz Biotechnology (sc-41118). The control shRNA was obtained from Santa Cruz Biotechnology (sc-108080).

    [0105] The WNT8B shRNA was introduced by contacting human pluripotent stem cells to WNT8B shRNA viruses (or control viruses) at day 0. Following introduction, retinal differentiation was performed using the published protocol (Zhong et al., 2014). Expression of retinal progenitor markers was detected on day 10 of retinal differentiation. As shown in FIG. 15A, introduction of a WNT8B shRNA reduced WNT8B expression relative to expression in the presence of a control shRNA or in untreated cells. As shown in FIG. 15B, knocking down expression of WNT8B using the WNT8B shRNA increased expression of retinal progenitor markers such as VSX2, HES5, LHX2, NR2E1, RAX, and VAX2. These data further demonstrate that WNTs mediate the effect of PAX6D on retinal cell differentiation by modulating expression of such retinal associated genes.

    [0106] In summary, this example demonstrates a role for PAX6D in retinal specification. Deletion of PAX6D prevents neuroepithelia from differentiating to retinal cells whereas induction of PAX6D, but not PAX6A, enables retinal differentiation even when PAX6 is knocked out. Therefore, PAX6D is both necessary and sufficient for retinal specification from neuroepithelia. PAX6D specifies the retinal fate from neuroepithelia by repressing neuroectodermal genes, activating retinal genes and modulating signaling molecules. Our findings resolve the mystery how PAX6, expressed in both forebrain neuroepithelia and NR, instructs a retinal fate versus neural fate through the differential use of its isoforms. Our findings also open avenues to guide or convert neuroepithelia to highly enriched RPCs by inducing PAX6D expression or to isolate RPCs by targeting PAX6D.

    [0107] Materials and Methods

    [0108] hPSCs:

    [0109] H9 ESC and genetically modified cell lines derived from H9 (PAX6 KO, PAX6D KO, PAX6A TetOn, PAX6D TetOn) were either maintained on irradiated mouse embryonic fibroblast (MEF) feeder (Du et al., 2015) or feeder-free system with Matrigel or Vitronectin (Yuan et al., 2015). Briefly, cells maintained on MEF were passaged weekly by dispase (1 mg/ml) and plating on MEF (WiCell) with the hPSC culture medium consisting of DMEM/F12 basal medium, 20% KnockOut serum replacement, 0.1 mM -mercaptoethanol, 1 mM L-glutamine, nonessential amino acids (NEAA), and 4 ng/mL FGF-2. For cells maintained on Matrigel or Vitronectin, the cells were passaged every 4-5 days by EDTA. Rho Kinase Inhibitor (0.5 M) was added in E8 to help the survival of hPSCs.

    [0110] Human Subjects:

    [0111] The human fetal tissue used in this study was derived from patients who required termination of pregnancy. All procedures were approved by the Ethics Committee of Tongji Hospital affiliated to Tongji Medical College of Huazhong University of Science and Technology, with informed consent. And all human body materials are treated with special care in accordance with the requirements and regulations established by the Ethics Committee. Fetal tissues were obtained within 2 hours after abortion, and the developmental stages of these fetal specimens were determined based on clinical diagnosis and related examinations. After the fetal tissue was obtained, the tissue was preserved in 9% physiological saline, and the retina, lens, brain, and spinal cord in the tissue were separated under a stereo microscope (SZX12, Stereo Microscope, OLYMPUS, Japan) as soon as possible.

    [0112] Generation of PAX6 KO, PAX6D KO, PAX6A TetOn and PAX6D TetOn Cell Lines:

    [0113] PAX6 KO and PAX6D KO cell lines were designed by inserting the PGK-Puromycin in exon 8 and exon alpha of the PAX6 gene, respectively, which terminates the normal translation of PAX6 genes early and PAX6D isoform specifically. The PAX6 KO cells were then used to generate PAX6A TetOn and PAX6D TetOn by inserting the TetOn-PAX6A-3FLAG and TetOn-PAX6D-3FLAG into the AAVS1 site of PAX6 KO genome.

    [0114] Genome editing was performed using CRISPR/CAS9 following published method (Chen et al., 2015). Guide RNAs (gRNAs) were designed according to the protocol described by Feng Zhang's laboratory (available at crispr.mit.edu/on the World Wide Web). Briefly, Human H9 cells or H9 derived PAX6 KO cells were cultured in the hPSC medium with Rho Kinase Inhibitor (0.5 M) for 24 hours prior to electroporation. Cells were digested by TrypLE express Enzyme for 3-4 minutes and harvested in hPSC medium with Rho Kinase Inhibitor. Cells were dispersed into single cells, and 110.sup.7 cells were electroporated with appropriate combination of plasmids in 500 ul of DMEM/F12 medium using the Gene Pulser Xcell System (Bio-Rad) at 250 V, 500 F in 0.4-cm cuvettes. Cas9 plasmid (15 g), sgRNA plasmid (15 g) and donor plasmid (30 g) were used for electroporation. Cells were subsequently plated onto MEF in 6-well plates in MEF-conditioned hPSC medium with ROCK-inhibitor. The medium was changed to MEF-conditioned medium without ROCK-inhibitor 24 hours later. Three days later after electroporation, puromycin (0.5 g/ml) was added into the MEF-conditioned medium to select the positive clones for PAX6 KO and PAX6D KO for two weeks. G418 (50 g/ml) was used to select the positive clones for PAX6A TetOn and PAX6D TetOn derived from PAX6 KO cells. After drug selection, cells were treated with Rho Kinase Inhibitor for 24 hours, and then individual colonies were picked up, mechanically disaggregated and replated onto MEF in 24-well plates in MEF-conditioned hPSC medium with Rho Kinase Inhibitor for the first 24 hours. Positive colonies were identified by genomic PCR and replated onto MEF in 6-well plates with MEF-conditioned hPSC medium.

    [0115] Forebrain and Retinal Differentiation from hPSCs:

    [0116] Forebrain neuroepithelial differentiation from hPSCs was performed by dual SMAD inhibition (Chambers et al., 2009). Briefly, hESCs were treated with the neural differentiation medium comprised of DMEM/F12: neurobasal (1:1), 1N2, 1B27, 1 nonessential amino acids (NEAA), 1% GlutaMAX, 2 M SB431542 and 2 M DMH1 for 1 week. The culture medium was changed every other day. One day 7, cells were split and replated to fresh MEF in the same neural differentiation medium with Rho Kinase Inhibitor (0.5 M). Cells were maintained with forebrain differentiation medium by feeding every other day.

    [0117] Retinal differentiation from human pluripotent stem cells was performed using the published protocol (Zhong et al., 2014). Briefly, hESCs were passaged to Vitronectin-coated plates and cultured to 60-70% confluency. On day 0 of retinal differentiation, cells were enzymatically detached by dispase (1 mg/ml) and cultured in suspension with E8 medium to form embryoid bodies (EB). EBs were gradually transitioned into neural induction medium (NIM) containing DMEM/F12 (1:1), 1% N2 and 1NEAA by replacing the medium with a 3:1 ratio of E8/NIM on day 1, 1:1 on day 2, and 100% NIM on day 3. On day 7, EBs were seeded onto plates with NIM containing 5% FBS. The medium was changed to NIM one day later and fed with NIM every other day. On day 16 the medium was changed to RDM (retinal differentiation medium) containing DMEM/F12 (3:1) supplemented with 2% B27 (without vitamin A) and 1NEAA with daily medium change.

    [0118] qPCR Analysis:

    [0119] Total RNA was isolated with the RNeasy Plus Mini Kit according to the manufacturer's instructions. For quantitative PCR (qPCR), cDNA was synthesized using PrimeScrip RT Reagent Kit. qPCR was performed using iTaq Universal SYBR Green Supermix. GAPDH gene was used as an internal control to equalize cDNA.

    [0120] Immunocytochemistry, Western Blotting and Flow Cytometry:

    [0121] Immunocytochemistry and western blotting were performed as described previously (Huang et al., 2016). In brief, cells on coverslips were fixed in 4% neutral-buffered paraformaldehyde (PFA) for 10 minutes at room temperature. Following rinsing with PBS, they were incubated in 0.2% triton x-100 (in PBS) for 10 min followed by 10% donkey serum (in PBS) at room temperature for 1 hour. They were then incubated with primary antibodies diluted in 5% donkey serum in 0.1% triton x-100 (in PBS) at 4 C. overnight, followed by fluorescently conjugated secondary antibodies at room temperature for 30 minutes. The nuclei were stained with Hoechst. Images were collected with a Nikon A1 laser-scanning confocal microscope. For western blotting, cells were lysed in 1RIPA and 1 protease inhibitor cocktail. Proteins (15 g) in the supernatant were boiled in SDS-PAGE sample buffer and separated by 10% SDS-PAGE.

    [0122] Flow cytometry was performed using Transcription Factor Buffer Set which is designed for transcription factor staining following manufacturer's instruction. Briefly, single cells were prepared using TrypLE Express Enzyme and fixed in the fixation buffer provided by the kit at 2-8 C. for 45 min. After 3 washings with the permeable buffer, the primary antibodies (PE-SOX1, V450-SOX2) were added to cells for 45 min at 2-8 C. in a light-tight box. The cells were washed 3 times before analyzed by flow cytometry (BD LSR or BD LSRII). Data analysis was performed using FlowJo.

    [0123] RNA-Seq, ChIP-Seq and Data Analysis:

    [0124] RNAs were prepared as for qPCR. The RNA samples (2 g each) were processed by HiSeq at 1100 with 3 samples per lane. RNA-Seq was performed at DNA Sequencing Facility in the University of Wisconsin-Madison Biotechnology Center. RNA-Seq data were processed following quality control, mapping and analysis of transcripts using Galaxy following FastQC, HISAT2, Cufflinks and DESeq2 pipelines.

    [0125] ChIP-Seq samples were prepared by using Magnetic ChIP Kit following manufacturer's instruction. Briefly, the cultures were digested with TrypLE to become single cells and then were crosslinked using 1% formaldehyde provided by the kit. The cells were incubated at room temperature for 10 mins in a chemical fume hood. After incubation, the cells were treated with glycine solution for 5 mins at room temperature. After washing with cold PBS twice, the cells were lysed with the lysis buffer in the presence of protease inhibitors and MNase (provided by the kit to digest DNA). They were then sonicated (three 20-second pulses at 3 watts power) to yield DNA fragments of about 150 basepairs (bp) to 1000 bp. After taking 10 l samples as an INPUT the rest samples were incubated with 1 g FLAG antibody in 100 l IP buffer provided by the kit overnight at 2-8 C. The pull-downs were harvested by ChIP Grade Protein A/G Magnetic Beads. The DNAs recovered from the INPUTs and IPs were submitted to University of Wisconsin-Madison Biotechnology Center for sequencing using HiSeq at 1100 bp. The Seq data were processed using Galaxy following FastQC, Trimmomatic, Bowtie2 and MACS2 callpeak pipeline. The regional bed files were annotated by PAVIS.

    TABLE-US-00002 TABLE 1 Reagents and Resources REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies C-PAX6 Covance Cat# PRB-278P; RRID: AB_291612 N-PAX6 Santa Cruz Cat# sc-32766 X; Biotechnology RRID: AB_628107 Pax6 Alexa Fluor 488 BD Biosciences Cat# 561664 SOX2-V450 BD Biosciences Cat# 561610 SOX1-PE BD Biosciences Cat# 561592 VSX2 exalpha Cat# X1180P -Actin Sigma-Aldrich A1978; RRID: AB_476692 SOX2 R&D Systems AF2018; RRID: AB_355110 SOX1 R&D Systems AF3369; RRID: AB_2239879 Monoclonal ANTI-FLAG M2 antibody Sigma-Aldrich F1804; RRID: AB_262044 Alexa Fluor 488 donkey anti-goat IgG (H + L) Molecular Probes Cat# A11055; RRID: AB_142672 Alexa Fluor 546 Donkey Anti-Mouse IgG Molecular Probes Cat# A10036; RRID: AB_2534012 Alexa Fluor 488, Donkey anti-Rabbit IgG (H + L) Life Technologies Cat# A21206; RRID: AB_141708 Alexa Fluor 546 donkey anti-sheep IgG (H + L) Molecular Probes Cat# A21098; RRID: AB_1500708 Alexa Fluor 546 donkey anti-rabbit IgG (H + L) Life Technologies Cat# A10040; RRID: AB_2534016 Biological Samples Human embryo tissue Tongji Hospital (see english.tjh.com.cn on the World Wide Web (WWW)) Chemicals, Peptides, and Recombinant Proteins CHIR99021 Stemgent Cat# 04-0004-10 SB431542 Stemgent Cat# 04-0010-10 DMH1 Tocris Bioscience Cat# 4126 IWR1 Sigma-Aldrich Cat# I0161 protease inhibitor cocktail Sigma-Aldrich Cat# P8340 Rho Kinase Inhibitor MilliporeSigma Cat# 555550 Critical Commercial Assays Magnetic ChIP Kit Thermo Scientific Cat# 26157 Transcription Factor Buffer Set BD Biosciences Cat# 562574 RNeasy mini kit QIAGEN Cat# 74106 PrimeScrip RT Reagent Kit Clontech Cat# RR037A Deposited Data Experimental Models: Cell Lines H9 human embryonic stem cells WiCell Research WA09 Institute PAX6 KO cell line derived from H9 hESC This paper N/A PAX6D KO cell line derived from H9 hESC This paper N/A PAX6A TetOn cell line derived from PAX6 KO cell line This paper N/A PAX6D TetOn cell line derived from PAX6 KO cell line This paper N/A Oligonucleotides Recombinant DNA PL552 (Chen et al., 2015) Addgene: Plasmid #68407 PAX6-Exon8-puromycin donor plasmid This paper N/A PAX6A-3XFLAG-TETON donor plasmid This paper N/A PAX6D-3XFLAG-TETON donor plasmid This paper N/A Software and Algorithms FlowJo Available at RRID: SCR_008520 flowjo.com on the WWW Galaxy Galaxy (available at RRID: SCR_006281 usegalaxy.org/ on the WWW) PAVIS NIH (available at manticore.niehs.nih.go v/pavis2 on the WWW) Other E8 WiCell Research Institute Matrigel Coming Life Sciences Cat# 2014-06-03 Vitronectin StemCell Cat# 07180 Technologies N2 ThermoFisher Cat# 17502048 B27 ThermoFisher DMEM/F12 1:1 ThermoFisher Cat# 11330-057 Neurobasal ThermoFisher Dispase ThermoFisher Cat# 17105-041 NEAA ThermoFisher Cat# 11140050 GlutaMAX ThermoFisher Cat# 35050061 FBS RIPA Cell Signaling Cat# 9806S Technology TrypLE ThermoFisher Cat# 12604021

    TABLE-US-00003 TABLE 2 PAX6KO VS WT tracking_id gene WT_1 WT_0 WT_2 KO_0 KO_1 KO_2 sample_1 XLOC_002465 KMO 5.58462 16.448 13.9268 0 0 0.007775 WT XLOC_014867 VSX2 24.0414 42.2013 44.5609 0.01864 0.034462 0.03074 WT XLOC_032376 CBR1 4.59249 2.70212 5.44573 0 0.02221 0 WT XLOC_051344 ALDH1A1 268.278 337.186 344.585 0.785441 0.99738 0.361109 WT XLOC_019330 HSD17B2 108.573 79.3757 74.2518 0.398511 0.219897 0.130751 WT XLOC_053625 XIST, 10.1235 32.7084 11.2266 0.126763 0.011328 0.027222 WT XIST_intron, Xist_exon4 XLOC_027099 IAH1 6.35612 26.3106 8.48768 0.019664 0 0.107888 WT XLOC_000776 FOXE3 14.8087 39.8849 41.069 0.132008 0.135586 0.064502 WT XLOC_023004 TBX2-AS1 8.78707 13.6519 21.7809 0 0.197674 0 WT XLOC_049879 TYRP1 235.705 54.4611 38.9429 0.425613 0.608062 0.466756 WT XLOC_021600 TBX2 6.63337 6.93052 16.2837 0.042118 0.107251 0 WT XLOC_017703 CYP19A1 0.203446 0.452523 0.301805 0 0.00595 0 WT XLOC_039936 BHMT 37.3323 111.92 120.503 1.15546 0.834651 0.47749 WT XLOC_014052 DCT 116.653 24.9895 9.93978 0.491043 0.44155 0.740795 WT XLOC_048042 CLVS1 24.3687 22.2627 29.6563 0.338402 0.408967 0.12562 WT XLOC_025713 ZNF667-AS1 4.73676 9.32947 4.82475 0 0.01833 0.202607 WT XLOC_036590 AC020636.2, 1.64049 4.57607 3.36258 0.066074 0.061078 0 WT CLRN1, MINDY4B XLOC_023764 CDH20 37.685 38.8728 33.3169 0.571475 0.836264 0.161578 WT XLOC_026995 ZNF667 1.0593 3.4673 1.3381 0.073367 0.015706 0 WT XLOC_002958 AL391650.1 15.5575 10.81 14.5734 0.326529 0.196753 0.116703 WT XLOC_006922 PITX3 1.52713 5.05783 6.0417 0.053264 0.098475 0.058559 WT XLOC_034614 SYNPR 15.8505 11.9411 10.1719 0.291191 0.115033 0.234572 WT XLOC_036565 CP 6.26707 50.9784 42.8121 0.244886 0.895046 0.645878 WT XLOC_018597 CLEC19A 23.9987 10.9556 18.88 0.693659 0.404247 0.026297 WT XLOC_030767 IQCA1 3.49601 1.23853 3.80359 0.157587 0.024472 0.019377 WT XLOC_008243 TYR 6.37815 2.43474 0.474991 0.042033 0.019445 0.159472 WT XLOC_024400 FAM69C 11.6468 9.87495 8.56703 0.138958 0.278207 0.306086 WT XLOC_048281 ERICH5 16.2999 41.7988 46.1951 0.503349 1.93694 0.239438 WT XLOC_033225 CRYBB3 1.85882 7.03654 4.079 0.079355 0.110033 0.174487 WT XLOC_050766 BARHL1 7.75494 3.28797 51.4482 0.367364 1.01455 0.516136 WT XLOC_027566 ATP6V1B1 4.78079 11.3255 5.64947 0.156006 0.278237 0.250328 WT XLOC_001908 PAPPA2 11.3668 17.3899 23.9001 0.554404 1.01577 0.198088 WT XLOC_040715 ZNF454 1.62015 1.23638 1.42324 0.040327 0.066599 0.040361 WT XLOC_005323 AL117339.1, 5.32891 7.22129 4.17298 0.202319 0.050182 0.360196 WT AL117339.2, AL117339.5, AL133217.1, HSD17B7P2, ZNF37A XLOC_025547 ZNF528 12.445 18.014 11.5862 0.671718 0.322339 0.603468 WT XLOC_041138 AC034238.1, 1.17155 1.49775 7.77941 0.09496 0.290675 0.043725 WT ESM1 XLOC_030921 LAMP5 3.28604 11.1172 8.30284 0.282797 0.420105 0.235206 WT XLOC_002728 MIR34A, 1.4038 120.464 2.53687 2.12085 1.40552 1.6788 WT MIR34AHG XLOC_025503 SIGLEC7 0.157275 0.423744 0.404266 0 0.019089 0.022702 WT XLOC_017273 AC015712.1, 61.8026 83.4586 50.6442 2.74631 2.67884 3.08856 WT AC015712.4, AC015712.5, AC015712.6, ALDH1A3 XLOC_048386 AC064802.1 0.102552 4.43215 0.158353 0.053631 0.099148 0.058961 WT XLOC_048495 AC104257.1 0.095814 8.87889 0.098629 0.24289 0.138958 0.055087 WT XLOC_005835 PAX2 1.3601 1.26266 2.89939 0.136754 0.064097 0.08609 WT XLOC_027327 QPCT 2.4727 4.20444 2.60496 0.237099 0.217064 0.037368 WT XLOC_041832 PPP2R2B, 370.411 12.3097 10.1457 6.91133 7.70502 6.19719 WT RNA5SP196 XLOC_021142 CCL2 271.652 422.61 418.085 20.6963 19.7372 19.511 WT XLOC_018051 CTXND1 0.289552 0.322075 0.439449 0.034945 0.025124 0 WT XLOC_014741 SIX6 11.7499 22.4652 21.0377 1.31962 0.754259 1.16286 WT XLOC_034205 HRH1 0.728556 2.35439 2.62183 0.083087 0.147918 0.10518 WT XLOC_043011 AL589740.1 2.83443 1.99495 3.03891 0.26232 0.141783 0.070279 WT XLOC_026261 AC011447.2, 1.23477 2.09424 1.04945 0.128454 0.047166 0.098661 WT AC011447.3 XLOC_005448 DKK1 13.6083 16.1791 24.6678 0.691665 2.20212 0.519121 WT XLOC_020429 ADAMTS18 20.9749 23.2548 27.0867 0.354768 3.82669 0.386582 WT XLOC_009925 CRYAB 366.654 1347.99 1734.04 50.3919 129.232 41.5954 WT XLOC_034818 ZPLD1 0.454756 0.348382 0.944384 0.019678 0.072604 0.021541 WT XLOC_009328 MS4A6A 4.13338 14.4128 33.2609 2.25501 0.751567 0.495463 WT XLOC_008373 GRIA4 4.46608 10.8139 10.2688 0.697804 0.619828 0.431725 WT XLOC_008341 CNTN5 2.87317 6.12486 6.60276 0.560839 0.381828 0.155141 WT XLOC_002706 TNFRSF9 0.955634 5.22558 3.9647 0.210562 0.179023 0.331729 WT XLOC_024733 ZNF440 2.88092 2.96653 2.67963 0.586055 0.03355 0.007167 WT XLOC_027565 VAX2 1.61982 2.62167 1.2574 0.166645 0.077023 0.18321 WT XLOC_049024 ZMAT4 5.32469 8.89905 5.09229 0.778776 0.299055 0.508701 WT XLOC_002386 TRIM67 0.166249 0.425185 1.14544 0.02324 0.061207 0.05832 WT XLOC_008662 GLB1L3 0.164977 0.385587 0.696593 0.039122 0.022422 0.043744 WT XLOC_039183 SFRP2 476.589 775.446 776.525 41.9701 59.0123 71.7994 WT XLOC_045037 AC004947.2 0.595058 0.301741 0.228407 0.042196 0.019503 0.034793 WT XLOC_030694 SPHKAP 0.108141 0.243771 0.44131 0.023598 0.036358 0.008647 WT XLOC_024166 KLHL14 5.4997 7.63757 10.9 0.689436 0.970581 0.514585 WT XLOC_007296 CCKBR 18.9483 29.6155 16.3185 1.23678 2.56527 2.18641 WT XLOC_050235 AL353608.3, 14.8368 9.57984 9.86534 0.437383 2.43281 0.394676 WT PGM5 XLOC_048391 SLC30A8 0.795451 0.053458 1.66155 0.121858 0.096619 0.024714 WT XLOC_053146 ANOS1 11.8847 12.3872 21.3149 1.53808 1.55263 1.35711 WT XLOC_030190 CYTIP 0.890241 0.76244 0.753724 0.079225 0.069089 0.088407 WT XLOC_012216 PMEL 380.885 280.488 177.492 27.7829 20.9788 34.3185 WT XLOC_053685 HDX 3.01945 3.40599 2.8989 0.231165 0.289983 0.403669 WT XLOC_049217 CPA6 0.274907 0.721336 0.287373 0.047606 0.029426 0.052338 WT XLOC_010972 LGR5 19.3417 19.2728 20.0357 1.79896 2.47391 1.65587 WT XLOC_029247 CYP1B1, 12.7944 15.2601 26.2721 1.77355 2.09612 1.72755 WT RMDN2-AS1 XLOC_019871 EIF3CL 2.88923 0.208908 0.197669 0.127808 0.126584 0.090328 WT XLOC_048112 KCNB2 1.51573 1.68034 1.73448 0.177006 0.291676 0.050766 WT XLOC_012370 CPM, 2.64187 6.95502 4.36488 0.20834 1.17347 0.089223 WT PRELID2P1 XLOC_040762 AC138035.1 0.275702 4.87749 0.33735 0.331399 0.112627 0.146464 WT XLOC_030742 AC064852.1, 12.6033 9.78836 10.0916 1.69547 1.00666 0.820057 WT KCNJ13 XLOC_030425 TMEFF2 40.0945 26.9503 23.8186 5.34252 3.27494 1.51246 WT XLOC_050331 NTRK2 4.07667 7.93482 8.77045 0.791528 0.741549 0.800643 WT XLOC_017031 CRABP1 1195.31 2227.35 1893.36 231.873 162.117 220.572 WT XLOC_020676 ZFP3 0.799269 1.24264 0.965845 0.223275 0.086397 0.051377 WT XLOC_002160 C1orf186 0.63685 6.86482 5.34159 0.746386 0.256596 0.552408 WT XLOC_030368 PDE1A 0.908066 2.7045 1.46131 0.280628 0.158035 0.176116 WT XLOC_037964 MAB21L2 47.595 42.199 40.2181 3.3336 8.70142 3.77638 WT XLOC_005996 AL133461.1, 69.0599 37.8241 76.9869 7.42752 8.09973 6.86225 WT INPP5F XLOC_041354 ANKRD34B 2.39566 1.69226 3.27724 0.257529 0.437512 0.221912 WT XLOC_010676 GPD1 1.08232 1.40149 1.99675 0.1406 0.265826 0.156384 WT XLOC_035638 WNT7A 5.38763 3.83589 5.53929 0.284464 1.24591 0.372312 WT XLOC_005857 ELOVL3 0.278393 1.08916 0.837677 0.156789 0.103525 0.024625 WT XLOC_016442 GABRG3 5.30885 4.53087 3.7671 0.686877 0.400254 0.677391 WT XLOC_011052 ALX1 3.42173 1.64595 6.05004 0.505257 0.661662 0.277741 WT XLOC_042581 MIR5004, 0.059656 0.074733 1.99489 0.069121 0.085339 0.122918 WT SYNGAP1, ZBTB9 XLOC_040023 NR2F1 121.883 94.1868 150.864 14.0297 20.7967 13.777 WT XLOC_050764 CFAP77 12.5485 8.31813 19.407 2.20781 1.96837 1.18565 WT XLOC_029134 POMC 5.43884 2.014 1.88963 0.193116 0.564571 0.497085 WT XLOC_010672 AQP5 1.44334 1.67927 2.11868 0.14677 0.213201 0.345772 WT XLOC_037612 SPP1 205.264 907.926 297.504 44.3401 110.052 36.3142 WT XLOC_027527 MEIS1 85.4694 87.4353 66.8553 9.0631 10.7953 12.6073 WT XLOC_027038 ZNF132 0.683199 0.526368 0.67917 0.13304 0.078323 0.055072 WT XLOC_028175 THSD7B 2.67226 1.08222 1.82101 0.435101 0.319927 0.035385 WT XLOC_037904 IL15 0.085657 0.318399 0.490296 0.026534 0.077714 0.023108 WT XLOC_032052 APCDD1L 2.60783 2.44671 2.12832 0.112974 0.77579 0.151569 WT XLOC_002049 CRB1 2.30468 4.54208 3.18978 0.47868 0.516588 0.469603 WT XLOC_041731 SPOCK1 145.596 162.91 145.988 20.6471 29.0646 16.7045 WT XLOC_021787 SPHK1 23.2995 23.0011 37.1734 2.73315 5.2386 4.32917 WT XLOC_039364 LINC02365 0.869773 2.04544 1.84125 0.29988 0.182768 0.219795 WT XLOC_013274 PCDH17 3.06463 3.95002 5.43705 0.404765 1.05807 0.381317 WT XLOC_012994 FGF9 3.59168 3.87117 4.71782 1.09445 0.542489 0.198115 WT XLOC_046363 DGKB 2.01428 2.09315 4.62416 0.214465 0.618696 0.489471 WT XLOC_024736 ZNF69 4.05827 3.56241 2.67414 0.928156 0.208263 0.47991 WT XLOC_045760 FOXP2 5.88623 4.84709 5.1874 0.929759 0.946861 0.631826 WT XLOC_051664 TNC 213.252 360.119 156.583 27.0482 82.8707 7.52532 WT XLOC_043359 PPP1R14C 2.46775 7.44666 9.84518 1.11001 1.47113 0.617525 WT XLOC_009884 SLN 37.5379 17.253 7.92598 2.14181 7.40106 0.728843 WT XLOC_002245 PROX1 2.4965 5.75226 8.62622 0.853275 0.655323 1.27477 WT XLOC_013601 GJA3 0.317404 0.736926 0.633042 0.098558 0.095901 0.085543 WT XLOC_037491 AMBN 13.1172 21.3811 6.3971 2.37706 1.81575 2.70325 WT XLOC_043013 POU3F2 3.49554 4.31769 5.55051 0.672322 1.03239 0.555893 WT XLOC_026854 HAS1 0.300599 0.742958 0.50416 0.01383 0.126367 0.121737 WT XLOC_049110 OPRK1 0.32442 0.271044 0.25725 0.070695 0.048264 0.025511 WT XLOC_005951 ADRB1 0.676098 0.543138 0.695966 0.049108 0.190659 0.086383 WT XLOC_041015 SLC45A2 1.66043 0.787502 0.837097 0.270953 0.169311 0.119558 WT XLOC_007768 P2RX3 11.4484 5.26939 10.4009 1.91682 2.05662 0.67398 WT XLOC_052548 POU3F4 0.385523 0.485639 0.341154 0.021223 0.163484 0.023332 WT XLOC_013946 PCDH9 2.76325 2.87375 3.69818 0.498438 0.778085 0.332542 WT XLOC_008890 SCUBE2 13.2784 5.16013 8.37681 1.11418 1.9466 1.56159 WT XLOC_039304 HPGD 3.95569 6.09741 1.37806 0.628612 1.17793 0.172886 WT XLOC_015380 SLC7A8 121.946 126.791 162.96 27.4085 23.3139 21.0448 WT XLOC_006001 PLPP4 7.78586 3.5804 4.4459 0.314801 1.86296 0.59 WT XLOC_045083 GHRHR 1.17316 0.501402 2.24275 0.175292 0.324078 0.192718 WT XLOC_034738 EPHA3 6.93189 6.01915 5.04062 1.26215 1.38313 0.634421 WT XLOC_051434 LINC01508 1.16349 1.82433 1.59586 0.681035 0.119913 0.035654 WT XLOC_002251 KCNK2 2.34228 3.29868 2.04425 0.363569 0.661815 0.37967 WT XLOC_017507 GJD2 1.86204 3.68614 4.5392 0.232546 1.48683 0.127831 WT XLOC_020114 CBLN1 2.041 5.46001 6.42341 1.36519 1.08027 0.118286 WT XLOC_003943 AC239809.3 0.428285 0.493307 0.192264 0.044778 0.097086 0.063295 WT XLOC_012012 AMIGO2 3.45442 4.11641 4.20926 0.662173 0.973802 0.548318 WT XLOC_027037 AC012313.5 0.258241 0.461412 0.454127 0.101289 0.03121 0.086611 WT XLOC_037223 LINC02506 6.23974 51.9183 13.6307 7.62237 2.99343 2.90291 WT XLOC_025549 ZNF578 0.415504 0.660463 0.38739 0.128756 0.078826 0.070702 WT XLOC_003160 COL9A2 66.9667 40.0417 68.2401 9.52235 12.0478 12.0696 WT XLOC_032087 GATA5 0.416305 0.300992 0.128562 0.054428 0.060376 0.047871 WT XLOC_018083 HOMER2 58.9068 72.7643 58.6159 14.1783 11.8055 10.6426 WT XLOC_006181 GATA3-AS1 0.309749 0.111203 0.606512 0.025918 0.108609 0.064331 WT XLOC_036866 SST 95.6846 43.2791 93.8272 20.2596 22.4615 2.39652 WT XLOC_001171 VCAM1 8.95852 10.043 10.7981 1.87309 1.34404 2.55954 WT XLOC_041413 LINC00461, 25.0832 13.5245 14.908 2.10078 6.15445 2.12843 WT MIR9-2 XLOC_036625 AC108729.3, 27.0835 230.605 21.8681 15.8527 23.2701 15.1243 WT PLCH1 XLOC_027645 AC011754.1, 51.0326 63.5114 84.49 13.8058 10.4825 14.3959 WT CTNNA2 XLOC_032532 U2AF1L5 40.9568 0.70273 16.055 1.15162 0.449138 9.77284 WT XLOC_043065 NR2E1 8.03942 8.30737 5.79257 1.04822 1.67724 1.67425 WT XLOC_038190 ZFP42 4.22012 5.08016 0.303557 0.217735 1.37515 0.31579 WT XLOC_049746 MAFA 0.615728 1.59732 0.741452 0.206569 0.146021 0.240463 WT XLOC_001567 SPRR3 1.80877 2.14418 0.038401 0.201684 0.528135 0.073914 WT XLOC_038812 SNCA 120.444 90.172 102.326 24.1095 22.0605 17.3679 WT XLOC_051436 DIRAS2 1.58807 0.610146 0.494273 0.142896 0.336471 0.075135 WT XLOC_042949 HTR1E 3.93668 0.968023 0.721655 0.197415 0.899408 0.062011 WT XLOC_025172 AC020928.1 2.74776 3.61071 2.65458 0.654476 0.736452 0.466231 WT XLOC_004746 SUSD4 3.80688 5.08067 6.9578 0.657414 1.50561 1.13032 WT XLOC_046915 SEMA3E 16.2428 10.2963 8.49356 0.847081 5.80519 0.668985 WT XLOC_012705 TBX3 3.01063 1.33223 3.04844 0.229944 1.23852 0.082164 WT XLOC_004935 GREM2 0.745461 0.730919 0.535223 0.157251 0.230156 0.036017 WT XLOC_044557 MOXD1 6.29193 9.72216 8.92068 2.24031 2.22334 0.881091 WT XLOC_021148 TMEM132E 1.40988 0.486328 0.913432 0.177407 0.362391 0.073125 WT XLOC_030096 NXPH2 3.28156 2.97772 2.0694 0.40198 1.08618 0.339954 WT XLOC_035763 HSPD1P6 3.67747 0.422261 0.017363 0.15878 0.594349 0.155168 WT XLOC_000763 DMBX1 0.399692 0.713761 0.602804 0.136058 0.224676 0.021369 WT XLOC_008424 NCAM1 33.6777 64.3546 60.4432 10.2619 15.6837 10.8451 WT XLOC_019146 LRRC36 0.082067 1.9616 0.160277 0.044185 0.218009 0.251872 WT XLOC_049099 PXDNL 0.175017 0.236865 0.356232 0.069786 0.046767 0.063936 WT XLOC_030539 FZD5 6.3426 16.7834 14.869 2.12749 1.91867 4.93247 WT XLOC_031027 SYNDIG1 1.17031 1.60609 1.62468 0.258288 0.581328 0.208485 WT XLOC_003694 VAV3 7.82057 7.47898 7.65401 1.78451 1.96246 1.73747 WT XLOC_051965 STS 2.61304 1.7908 2.56444 0.64114 0.824413 0.203329 WT XLOC_037731 EGF 6.09219 7.1877 11.2359 2.36871 1.34669 2.1663 WT XLOC_001154 PALMD 4.296 3.60518 3.41303 1.18303 1.43369 0.098937 WT XLOC_038913 COL25A1 2.676 4.13148 6.52599 0.782579 1.57097 0.861524 WT XLOC_039460 ADAMTS16 3.25299 8.01238 12.5486 1.5952 3.13699 1.03624 WT XLOC_047896 C8orf4 40.6436 47.2069 50.5633 6.11582 21.9563 5.52496 WT XLOC_023770 TNFRSF11A 0.265996 0.364042 0.518576 0.084356 0.078018 0.118104 WT XLOC_049601 HAS2 3.02918 1.83986 1.75799 0.573686 0.783415 0.272354 WT XLOC_014587 LRFN5 0.98166 0.563432 5.00363 0.472748 0.853526 0.284234 WT XLOC_023424 APCDD1 46.322 33.9943 47.0792 9.35286 18.6627 3.39273 WT XLOC_009539 FGF19 0.90998 1.37229 1.03953 0.127677 0.525744 0.178652 WT XLOC_015770 SLC8A3 0.091533 0.567282 0.479065 0.173045 0.058317 0.054261 WT XLOC_009129 CHRM4 2.88468 0.323874 0.491631 0.29972 0.480236 0.175741 WT XLOC_043180 HEY2 3.19684 2.59449 1.69281 0.530738 0.927716 0.485845 WT XLOC_050369 C9orf47, 10.2433 24.3117 16.6353 4.7981 4.99107 3.58054 WT S1PR3 XLOC_046916 SEMA3A 52.7525 42.2479 39.8948 8.52092 16.726 10.0119 WT XLOC_048409 COL14A1 2.59648 2.10468 3.61912 0.460902 1.45697 0.257723 WT XLOC_002599 AL645608.1 2.45427 1.86025 2.54578 0.488773 1.13383 0.173673 WT XLOC_003586 BARHL2 0.477336 0.364019 2.26894 0.205578 0.434366 0.177582 WT XLOC_048138 PI15 0.068439 1.31193 1.01489 0.314169 0.099225 0.218654 WT XLOC_027354 PKDCC 58.0919 68.659 69.506 11.9625 20.0005 19.9681 WT XLOC_038957 NDST4 3.22527 4.07553 4.92237 1.7951 1.11636 0.347472 WT XLOC_049191 AC022639.1 8.38118 4.04769 7.61059 0.648089 2.11512 2.60208 WT XLOC_041939 EBF1 2.97424 1.79056 3.44582 0.773864 0.942278 0.494704 WT XLOC_006501 VSTM4 0.979693 1.27858 1.48134 0.443312 0.329921 0.236163 WT XLOC_008690 MIR210HG 6.51315 6.97106 7.4745 2.77394 2.69544 0.191988 WT XLOC_044977 AC019117.2, 19.6648 19.1669 25.2133 5.04766 7.82262 4.5123 WT AC019117.3, AHR XLOC_003656 PLPPR5 1.28076 0.491917 0.886722 0.188502 0.288333 0.248451 WT XLOC_038031 AC098679.1, 3.11484 5.06845 3.68229 1.74153 0.921543 0.575133 WT TMEM144 XLOC_003193 AC099795.1, 302.092 424.578 349.152 124.511 114.662 56.2061 WT SLC2A1 XLOC_034650 MITF 15.5231 10.5048 6.80536 3.73951 1.97018 3.37833 WT XLOC_039653 SLC1A3 27.2071 12.7288 10.1635 2.6237 9.54537 1.71148 WT XLOC_013909 CNMD 1.06774 1.95535 1.94698 0.433365 0.300449 0.643193 WT XLOC_045036 AC004540.1 14.9465 10.2668 11.4451 2.86409 4.07977 3.27308 WT XLOC_038757 AC067942.1, 8.80269 4.40508 5.31176 1.83023 2.31706 1.03181 WT TMEM150C XLOC_036882 CLDN1 50.106 58.8008 66.9105 18.1049 21.5352 9.55423 WT XLOC_003759 KCND3 0.403729 0.196148 0.198671 0.06339 0.103425 0.059519 WT XLOC_050248 MAMDC2 13.1192 37.5715 35.6402 8.35042 7.5923 8.6863 WT XLOC_050264 ANXA1 182.386 241.636 170.57 44.5624 84.8142 41.0541 WT XLOC_017955 STRA6 14.5523 9.21717 8.73985 2.94136 4.71492 1.6847 WT XLOC_013753 SMAD9 9.16316 9.65936 15.792 2.85978 3.42595 3.77105 WT XLOC_019804 CRYM 6.70859 2.20224 6.2092 2.11623 1.02934 1.24895 WT XLOC_038358 NKX3-2 1.22611 0.343896 1.52837 0.430815 0.305628 0.165224 WT XLOC_035320 NLGN1 10.4027 13.5132 20.5439 3.90659 3.78384 5.30042 WT XLOC_005819 CNNM1 1.38068 1.36346 0.935558 0.300308 0.548339 0.227938 WT XLOC_051394 C9orf64 0.322402 1.69626 1.4076 0.255813 0.322465 0.424607 WT XLOC_047676 SLC7A2 2.4262 2.09633 1.88957 0.553976 0.924381 0.39956 WT XLOC_031614 BFSP1 1.78674 1.53542 1.82098 0.410567 0.68674 0.413244 WT XLOC_028345 DLX1 2.18658 2.13871 1.68289 0.511862 0.908125 0.34467 WT XLOC_004684 AC011700.1, 0.984624 0.548826 0.787837 0.262949 0.276082 0.143138 WT PROX1-AS1 XLOC_044494 MAN1A1 11.7561 8.84561 8.97651 2.55425 3.32955 2.83191 WT XLOC_036549 PLSCR1 20.3379 23.2319 15.3891 6.33228 7.30574 3.81245 WT XLOC_052577 PCDH11X 2.09792 1.4106 1.91599 0.489946 0.58398 0.538911 WT XLOC_006438 CXCL12 14.1143 5.72239 6.24446 2.08741 4.14918 1.52762 WT XLOC_034437 ZNF501 4.15659 3.97023 3.78555 1.24516 1.39296 0.928463 WT XLOC_013669 SHISA2 13.3832 15.9522 8.82117 3.79089 4.16529 3.55388 WT XLOC_011800 LMO3 33.4883 20.0635 30.1137 5.48863 9.67963 10.0803 WT XLOC_044069 RCAN2 8.89083 14.0988 16.9536 4.0152 4.82664 3.21937 WT XLOC_009023 LGR4 79.6971 89.8947 100.005 21.699 36.8237 23.3668 WT XLOC_038688 CXCL5 0.309223 0.935753 1.82205 0.267663 0.103094 0.564018 WT XLOC_040718 ZNF354C 3.56214 4.4131 3.65209 1.48631 1.10653 0.9596 WT XLOC_035875 CSPG5 6.19783 7.13338 5.1209 2.08813 3.11037 0.440654 WT XLOC_003270 FOXD2-AS1 0.669449 1.16293 1.43382 0.429154 0.323629 0.248324 WT XLOC_005547 COL13A1 8.17538 6.57123 11.3643 2.21423 3.93888 1.86529 WT XLOC_020764 USP43 2.19927 2.23353 2.45209 0.506672 0.926482 0.682065 WT XLOC_019328 AC099524.1, 3.7346 2.84576 1.96519 0.957443 1.18674 0.482154 WT PLCG2, RN7SKP176 XLOC_039480 ADCY2 21.3065 25.7335 32.2693 7.23576 11.0972 6.3124 WT XLOC_004455 FAM129A 3.98387 3.30211 2.84975 1.57121 1.15706 0.441431 WT XLOC_027332 CYP1B1-AS1, 0.754595 0.634051 0.475692 0.099235 0.311183 0.17336 WT RPL7P12 XLOC_002198 MIR205, 134.681 25.2045 1.12706 4.0217 39.4582 7.92563 WT MIR205HG XLOC_010645 WNT1 2.32214 3.56237 12.7121 2.68864 1.65239 1.60969 WT XLOC_034696 ROBO2 36.7143 29.1239 32.3251 9.79255 8.79265 12.8319 WT XLOC_000241 CLCN6, 104.284 9.35444 11.6016 9.38111 15.0175 16.2436 WT NPPA-AS1, NPPA-AS1_1, NPPA-AS1_2, NPPA-AS1_3 XLOC_039386 AC018709.1, 0.737531 1.38922 1.7777 0.385704 0.404767 0.477051 WT F11-AS1, MTNR1A XLOC_053212 RAI2 2.66474 2.35815 3.02092 0.555775 1.29099 0.765886 WT XLOC_052663 PLP1 101.388 65.3794 58.1229 21.2014 33.8691 17.9833 WT XLOC_039466 LINC01018 1.13458 1.0697 0.850288 0.206416 0.488893 0.297852 WT XLOC_017654 GATM 12.517 16.0119 17.134 5.22856 5.40735 4.24186 WT XLOC_047223 GPR37 6.98319 5.81067 5.38903 1.12652 3.11552 1.68518 WT XLOC_003629 ABCA4 3.30242 0.849506 0.930069 0.585848 0.76658 0.308843 WT XLOC_010433 PDE3A 4.82166 3.41033 3.47629 0.845054 2.31846 0.671227 WT XLOC_026186 CPAMD8 18.8752 17.1836 30.3108 6.43773 8.12333 7.33791 WT XLOC_038828 UNC5C 4.8716 3.9903 5.9887 1.83955 2.05809 1.01298 WT XLOC_006249 CUBN 0.43488 0.614983 0.773097 0.159042 0.177646 0.268887 WT XLOC_034292 LRRC3B 5.47996 5.31703 7.38437 1.18094 2.98884 1.88691 WT XLOC_053223 ADGRG2 0.329738 0.394517 0.52786 0.091997 0.207805 0.11795 WT XLOC_011232 WSCD2 0.548137 1.06166 1.80662 0.3877 0.569676 0.18264 WT XLOC_037288 LIMCH1 15.1102 26.4054 23.2633 4.80342 5.6498 11.3906 WT XLOC_024145 DSC3 7.46024 5.82594 7.47786 0.914163 4.28711 1.81923 WT XLOC_037647 BMPR1B 5.4436 6.14906 5.56825 1.96289 1.80047 2.06573 WT XLOC_002435 GPR137B 14.2021 16.6504 17.7312 4.28355 7.38344 4.86428 WT XLOC_007098 TCERG1L 7.90809 7.59907 9.50597 2.31325 3.95575 2.28896 WT XLOC_039218 FAM198B 12.132 23.6829 21.6214 5.08216 10.7467 3.86605 WT XLOC_050847 UAP1L1 2.26919 2.88792 1.83242 0.719446 0.574443 1.13204 WT XLOC_049164 CA8 6.18118 9.56937 12.5402 3.07264 2.60219 4.1673 WT XLOC_011248 FAM222A 4.12358 5.19282 4.7307 1.46199 2.24513 1.23364 WT XLOC_028509 PLCL1 0.336936 1.68793 1.59929 0.40633 0.383856 0.486403 WT XLOC_038748 RASGEF1B 3.3694 4.66104 3.63024 1.32815 1.49526 1.28724 WT XLOC_049806 DMRT3 33.7659 21.6655 28.0668 12.7937 9.80345 6.84585 WT XLOC_044981 HDAC9 32.5955 34.5943 28.1826 8.1358 10.736 14.9456 WT XLOC_034156 BHLHE40 28.7412 23.1729 21.563 6.4183 14.7712 5.06271 WT XLOC_012486 LUM 55.1738 29.3758 34.8269 7.63191 28.7091 6.42993 WT XLOC_017508 ACTC1 244.194 242.898 338.343 37.584 210.993 47.443 WT XLOC_023287 NOTUM 2.79202 1.27364 1.8554 0.582345 0.961031 0.602072 WT XLOC_047196 TSPAN12 11.4086 19.9723 13.6718 4.51696 5.83577 5.98992 WT XLOC_028947 AC079779.3 0.430747 0.227429 0.527458 0.342024 0.063659 0.028894 WT XLOC_015553 LINC00648 3.59956 2.56034 3.75192 1.60875 0.960154 1.10362 WT XLOC_003678 OLFM3 26.1028 18.3198 18.3622 7.96972 4.76296 10.5544 WT XLOC_031529 RASSF2 6.40228 6.28884 5.08508 2.0242 2.82447 1.78624 WT XLOC_007421 LDHA 347.627 1058.17 681.095 344.764 216.675 218.737 WT XLOC_004771 AL117348.1, 5.19131 11.1679 5.11138 2.10458 4.92555 1.03457 WT LEFTY2 XLOC_018419 IL32, 8.52227 24.9515 18.2384 3.80855 9.37305 6.42134 WT RNU1-125P XLOC_044600 MAP7 6.74022 5.61752 4.8171 2.22027 2.97163 1.36232 WT XLOC_011113 SOCS2 27.709 22.6784 24.1992 9.6694 10.5514 8.41716 WT XLOC_029655 FOXI3 3.17654 6.6982 4.35328 2.12156 1.2951 2.0464 WT XLOC_025709 ZNF542P 10.593 16.7723 11.3415 4.3728 5.83969 4.84302 WT XLOC_035892 PFKFB4, 31.7161 45.5772 39.6038 22.5264 15.1506 7.79895 WT UCN2 XLOC_045084 ADCYAP1R1 0.799808 0.711924 0.849815 0.246107 0.420302 0.253653 WT XLOC_054143 GABRA3 11.2281 6.73985 7.95941 3.24652 4.51821 2.35408 WT XLOC_008272 NAALAD2 12.4697 6.18758 8.54354 3.37622 3.82636 3.43264 WT XLOC_044991 ITGB8 2.96968 3.55486 5.29928 1.22536 1.7833 1.6292 WT XLOC_054197 MPP1 5.29993 5.48431 5.71707 2.4062 2.59479 1.49679 WT XLOC_042802 FAM83B 4.43091 1.89135 1.16619 0.368648 2.1339 0.453543 WT XLOC_001178 S1PR1 64.1762 39.7235 53.4509 16.0314 27.8809 18.2603 WT XLOC_048061 MIR124-2HG 2.57438 2.21446 2.93261 0.876443 1.1928 0.982823 WT XLOC_049026 SFRP1 151.711 117.435 97.2726 33.3748 62.8436 48.9459 WT XLOC_049157 TOX 16.1585 21.7295 21.9477 6.26663 9.02873 8.47557 WT XLOC_016660 WDR76 11.088 15.245 10.4123 7.49297 5.27396 1.83107 WT XLOC_034147 CNTN4 15.5597 9.57895 10.8966 4.68208 6.66433 3.00201 WT XLOC_030666 SCG2 16.4828 3.08644 2.8295 3.75284 4.169 1.02544 WT XLOC_006553 RHOBTB1 21.4776 19.1662 28.446 7.49639 13.3863 6.86625 WT XLOC_028877 ACKR3 135.064 81.1788 72.4411 25.9663 63.9494 26.5325 WT XLOC_043536 TUBB2A 58.1457 108.694 84.0267 31.8392 42.4562 27.0697 WT XLOC_036181 DCBLD2 109.374 184.897 157.895 55.3599 73.8355 54.1726 WT XLOC_001874 SUCO 30.9669 40.0632 47.0039 15.7845 18.9654 13.3222 WT XLOC_048183 AC015522.1 23.893 16.9284 17.7133 7.23568 14.5014 2.13915 WT XLOC_048884 STC1 20.3656 24.8686 37.6981 17.2469 9.99402 6.77039 WT XLOC_027617 HK2 18.6123 27.2675 32.8217 17.2275 8.62266 6.46639 WT XLOC_007792 FAM111B 3.37129 4.88065 2.38837 2.55485 1.44491 0.383996 WT XLOC_006019 HTRA1 82.0626 110.945 168.516 43.3549 66.0043 40.1356 WT XLOC_024146 DSC2 33.3603 31.4661 27.7113 10.736 15.8787 11.7608 WT XLOC_011021 SYT1 21.0069 24.2448 21.1858 6.77428 7.73422 13.2987 WT XLOC_048829 MTUS1 10.4964 5.65363 4.1125 2.9256 4.05888 1.50429 WT XLOC_014133 EFNB2 120.975 80.3742 100.888 34.8005 55.8196 36.7636 WT XLOC_000084 AL645608.3, 3.69182 3.41905 3.57084 1.64182 1.66391 1.21103 WT AL645608.5 XLOC_005777 PLCE1 1.7972 3.12194 4.2477 1.23436 1.12803 1.53664 WT XLOC_023843 TSHZ1 4.84742 3.26612 4.05506 2.05507 2.22777 0.905298 WT XLOC_040879 CTNND2 120.806 99.3195 145.827 42.6494 50.8711 62.7772 WT XLOC_031878 MAFB 5.94784 5.82267 9.32437 5.04695 1.84655 2.23201 WT XLOC_046371 SOSTDC1 6.21325 5.41999 7.58281 3.49217 2.62015 2.22095 WT XLOC_013777 LHFPL6 42.1751 40.9514 39.9569 13.7108 24.8934 15.0136 WT XLOC_025056 AC011504.1, 4.70552 4.95074 4.79504 1.35452 2.38753 2.55534 WT ZNF536 XLOC_026645 AC245748.1, 8.96518 10.3917 7.79196 3.94586 3.89789 4.05486 WT AC245748.2, ZNF112, ZNF229, ZNF285 XLOC_038883 CXXC4 13.0536 14.411 17.3101 5.97946 8.61889 5.04901 WT XLOC_040599 GABRP 112.341 8.14752 0.311498 0.818228 51.5757 0.690326 WT XLOC_036879 P3H2 92.3843 144.675 162.79 60.5479 57.382 58.1662 WT XLOC_053052 DUSP9 4.17997 3.20362 3.76154 1.46141 2.09033 1.38697 WT XLOC_004061 S100A6 42.6249 137.51 92.1337 31.4031 50.2319 39.2016 WT XLOC_010923 HMGA2 152.861 173.045 160.431 71.7923 79.1206 65.2216 WT XLOC_051104 CNTFR 96.1047 80.3847 90.7169 25.9832 44.0011 48.7749 WT XLOC_000284 EFHD2 36.94 33.3531 33.7508 13.5763 19.0367 13.7297 WT XLOC_006336 JCAD 1.88659 0.991218 1.77873 0.380901 1.37374 0.321158 WT XLOC_004451 COLGALT2 18.8059 26.6688 34.1965 12.3101 10.3728 12.8618 WT XLOC_023416 RAB31 39.4445 54.2819 58.6251 23.1114 30.7347 14.4563 WT XLOC_039312 GPM6A 142.331 112.945 123.321 43.4944 59.2376 67.203 WT XLOC_004870 SIPA1L2 18.0438 20.8893 22.3521 7.37544 10.4743 9.66297 WT XLOC_028224 LYPD6B 13.0726 7.89584 6.28749 4.33828 4.85202 3.10465 WT XLOC_005776 SLC35G1 12.0153 14.9362 16.9652 7.15247 5.82505 6.86676 WT XLOC_042028 STC2 39.4103 108.815 94.6436 38.0803 34.8066 37.3934 WT XLOC_003817 VTCN1 27.6071 6.08625 0.933748 0.635095 14.6027 0.54317 WT XLOC_044280 ME1 1.86822 2.88857 2.22209 1.06733 1.38128 0.749188 WT XLOC_054067 SOX3 38.6166 35.9208 45.9488 18.2425 14.315 22.6855 WT XLOC_002921 ID3 364.53 373.319 384.034 205.614 166.384 142.731 WT XLOC_003395 KANK4 14.5551 7.01567 9.79076 4.66697 7.34944 2.43661 WT XLOC_022130 GAS7 20.1311 18.4577 28.9587 7.17824 14.8447 9.18089 WT XLOC_051379 TLE1 71.3807 56.8456 47.3123 25.3284 35.7639 20.0236 WT XLOC_009139 LRP4 28.067 23.2697 24.7974 12.7122 12.4672 10.0552 WT XLOC_042929 PRSS35 9.9522 9.68062 11.5052 3.93552 4.98336 5.51723 WT XLOC_003035 FABP3 39.2522 53.8655 39.3438 15.6095 20.9996 24.8469 WT XLOC_009886 SLC35F2 10.758 2.90873 1.26999 0.868084 4.87141 1.19852 WT XLOC_031273 AL121776.1, 20.1298 13.4078 10.5815 6.29469 8.33691 5.90384 WT EYA2 XLOC_027092 ID2 373.105 325.418 419.779 205.248 192.706 122.606 WT XLOC_007077 ADAM12 1.32462 1.23995 2.57228 0.912305 1.02765 0.454177 WT XLOC_007101 BNIP3 116.414 159.143 193.044 96.4058 67.7156 54.3568 WT XLOC_006989 AFAP1L2 8.82838 5.41901 8.72423 2.93265 4.89531 2.90856 WT XLOC_011223 BTBD11, 2.48152 2.91672 4.6216 1.3548 2.35844 0.981648 WT Y_RNA XLOC_036975 ZNF595 6.35102 7.28331 6.95044 3.03907 3.38489 3.23104 WT XLOC_028204 TEX41 0.040081 2.34675 0.378411 0.659828 0.257957 0.380668 WT XLOC_048252 ESRP1 15.7248 8.69141 0.520227 1.83753 7.89879 2.02362 WT XLOC_001688 IFI16 3.77043 7.85987 4.36094 2.47178 3.34622 1.72406 WT XLOC_044959 ARL4A 17.9735 17.0069 14.9066 6.98548 7.51579 9.06534 WT XLOC_006957 SORCS1 8.62962 10.8838 14.1475 5.93184 5.45304 4.71167 WT XLOC_040308 TGFBI 200.093 29.0639 14.9265 7.35185 104.66 5.53227 WT XLOC_040646 MSX2 31.0896 24.3893 33.8733 15.8631 17.3248 9.90947 WT XLOC_048007 LYN 7.32157 10.3433 8.41474 3.87391 5.15716 3.70487 WT XLOC_012876 TMEM132D 5.48048 5.53652 9.67775 3.3135 4.61815 2.24926 WT XLOC_037005 FGFR3 44.4408 26.2556 44.8459 9.20196 18.6645 28.9767 WT XLOC_039416 PLEKHG4B 28.082 30.4153 29.5133 14.1691 13.2916 15.9762 WT XLOC_031885 EMILIN3 13.65 11.6531 15.0838 8.61827 6.86967 4.52668 WT XLOC_025480 MYH14 17.9398 12.3933 8.72256 3.7543 10.287 5.38826 WT XLOC_053141 PUDP 29.7026 20.9633 33.8383 15.2146 14.4205 12.463 WT XLOC_011663 SLC2A3 464.036 227.674 184.273 72.7496 286.109 78.3052 WT XLOC_015234 KIF26A 3.85465 3.16346 4.29761 3.79642 10.6498 8.18542 WT XLOC_011044 TMTC2 8.37129 7.04274 6.2335 9.05075 12.5765 21.8112 WT XLOC_052987 AFF2 9.11706 7.77758 12.4398 16.8524 18.2056 23.9891 WT XLOC_052880 PHF6 54.5569 51.5495 52.6784 103.632 96.5019 119.661 WT XLOC_038761 SCD5 54.105 32.4238 43.8686 86.6284 80.5695 95.8552 WT XLOC_026220 JUND 76.9367 58.9676 95.3929 83.3279 122.113 262.524 WT XLOC_023877 NFATC1 4.83723 3.43985 4.79764 6.71892 6.71465 13.0217 WT XLOC_024463 CDC34 72.5812 73.4232 90.1597 133.151 131.689 213.41 WT XLOC_054058 FGF13 23.3113 23.436 25.4074 38.3834 48.0407 60.0019 WT XLOC_054039 MMGT1 10.6187 11.1085 10.8511 22.3967 21.0978 22.6986 WT XLOC_020149 AC007906.2 3.04474 4.98234 10.8918 19.1593 11.206 8.08555 WT XLOC_000135 PRDM16 14.4241 11.5181 14.8482 24.2037 28.4051 30.7423 WT XLOC_034496 KLHDC8B 89.2608 66.6087 95.6019 128.112 173.384 213.239 WT XLOC_030700 DNER 19.8836 12.5189 11.532 22.448 36.9702 30.6572 WT XLOC_021959 RTN4RL1 6.41516 4.7094 7.14963 12.6978 12.1662 12.9241 WT XLOC_053962 ELF4 7.2023 4.58935 6.3294 9.36416 17.4292 10.7778 WT XLOC_036851 DGKG, 19.0948 15.8323 26.6101 20.7874 41.7254 65.1184 WT ETV5 XLOC_007351 ADM 5.22835 9.08988 10.8682 18.6967 14.872 18.9515 WT XLOC_030393 TFPI 28.0628 49.8402 72.3747 114.022 69.8086 130.292 WT XLOC_045032 NFE2L3 21.9362 16.2081 18.861 44.3013 42.6996 32.1673 WT XLOC_008588 PKNOX2 36.5336 25.577 38.1836 63.1011 87.0611 59.6187 WT XLOC_048193 CA2 46.3375 65.5845 84.7922 154.768 110.287 147.189 WT XLOC_053815 MORC4 9.62064 9.91422 10.367 17.9793 22.3333 22.4979 WT XLOC_040597 KCNIP1 8.63696 4.44387 11.0611 16.3806 24.6756 9.69929 WT XLOC_031446 PPDPF 171.891 130.648 197.12 307.787 249.93 500.784 WT XLOC_001360 NBPF26 3.82194 3.14481 5.75055 7.10454 9.49809 10.3706 WT XLOC_053006 MAMLD1 3.23 2.36486 3.42337 5.65034 8.46834 5.01126 WT XLOC_035138 C3orf58 11.0446 13.1223 13.3748 19.4027 25.8112 34.5008 WT XLOC_035718 EOMES 1.89088 4.26007 1.36317 5.18376 8.41972 2.41592 WT XLOC_041572 CDO1 54.537 58.1313 81.2553 117.738 123.911 172.199 WT XLOC_053840 CAPN6 53.7524 50.2521 35.7015 80.8738 122.236 95.2684 WT XLOC_052847 OCRL 17.3435 19.6148 23.3017 41.2117 38.7067 49.3023 WT XLOC_024713 LDLR, 26.8963 32.2207 30.3653 35.251 49.3324 107.334 WT MIR6886 XLOC_050476 GALNT12 22.4471 13.5945 26.3889 52.9317 48.0713 34.5528 WT XLOC_051615 LPAR1 8.88699 4.56556 6.04646 18.0084 12.243 12.2431 WT XLOC_038678 ADAMTS3 1.41731 2.18983 2.41307 5.50186 4.4331 3.30322 WT XLOC_043700 HIST1H1C 7.05921 6.86671 12.4486 10.1674 12.6994 35.3308 WT XLOC_008078 FOLR1 6.36364 7.46499 8.31793 18.0765 11.7625 19.1518 WT XLOC_046906 SEMA3C 55.9545 36.8157 81.8943 155.247 164.452 66.6996 WT XLOC_002145 CNTN2 3.65929 3.05096 2.60199 10.3732 6.17839 4.12765 WT XLOC_005982 AL354863.1 39.2131 25.4606 20.3032 88.0046 52.2735 48.8231 WT XLOC_002143 NFASC 2.18191 1.86701 2.09763 5.3183 5.62301 2.77272 WT XLOC_004604 BLACAT1, 31.3434 36.2722 22.3452 62.4107 88.9478 49.5512 WT LEMD1 XLOC_023130 BTBD17 4.75019 2.78016 3.04609 9.30145 8.5229 5.83836 WT XLOC_053821 TSC22D3 22.2958 24.1012 24.4761 45.6652 50.2699 63.2403 WT XLOC_000957 GADD45A 21.0363 31.0184 26.6929 42.5988 33.7499 102.592 WT XLOC_045574 GNG11 1.86665 2.82708 3.10673 6.40457 5.52396 5.86769 WT XLOC_052690 FRMPD3 1.1497 0.932159 1.3669 1.80633 2.93777 3.14082 WT XLOC_052629 TCEAL2 19.9932 6.70028 21.5307 41.2382 32.9835 36.1429 WT XLOC_046843 CLDN3 9.13919 5.96728 9.35964 13.4217 15.7968 27.0659 WT XLOC_052878 CCDC160 13.1492 9.10177 12.0863 21.0438 23.8397 34.1269 WT XLOC_025629 PRKCG 3.95921 2.16936 3.70145 6.22587 6.35995 10.1207 WT XLOC_042340 HIST1H2BD 9.99424 9.24429 18.8462 10.5886 29.9465 47.5109 WT XLOC_028258 GALNT5 2.93333 0.900819 1.33843 3.68405 6.51704 1.88076 WT XLOC_036012 IL17RD 23.3246 20.3603 38.1309 69.8297 46.7799 75.4779 WT XLOC_002280 C1orf115 2.89723 2.57253 3.35716 8.55616 6.14166 6.19987 WT XLOC_054123 AC244197.2, 64.5571 43.8138 70.3316 128.204 143.547 152.639 WT AC244197.3, IDS, LINC00893 XLOC_045653 NYAP1 5.51019 4.72303 6.63899 8.98153 10.5585 20.7961 WT XLOC_047007 TMEM130 15.3733 9.12391 22.0796 21.1394 35.76 54.809 WT XLOC_042338 HIST1H2AC 3.77259 5.18168 5.23739 5.53757 9.43995 19.1058 WT XLOC_054062 ATP11C 9.00299 7.13128 8.40206 20.4838 21.2517 17.3818 WT XLOC_031168 NNAT 142.051 244.295 98.5143 460.313 487.265 222.813 WT XLOC_049732 LYNX1, 4.41757 4.93709 5.28431 11.8904 10.2397 13.2654 WT SLURP2 XLOC_046218 INSIG1 22.6961 31.755 31.0139 32.6581 42.0509 133.821 WT XLOC_040610 FGF18 0.978869 1.15747 1.82814 3.20313 3.92089 2.5889 WT XLOC_044277 UBE3D 13.258 12.0643 17.6985 14.563 34.8525 56.1947 WT XLOC_005833 WNT8B 133.599 49.4232 130.886 307.123 281.806 181.85 WT XLOC_033519 FBLN1 116.331 62.4759 55.5671 208.747 209.518 158.837 WT XLOC_036029 FAM107A 13.7191 9.12034 5.94778 16.0175 40.5482 14.337 WT XLOC_032423 PCP4 9.13445 19.093 16.0801 54.1004 21.3556 33.681 WT XLOC_052071 SAT1 56.3048 77.4788 73.6709 160.181 170.499 182.884 WT XLOC_048551 ADGRB1 2.22192 1.66561 2.13119 3.87596 6.34666 4.70261 WT XLOC_007003 VAX1 3.77645 7.98793 7.35952 21.586 13.9139 12.3501 WT XLOC_030738 ECEL1 9.3731 3.88375 9.07631 13.783 29.7727 12.7174 WT XLOC_026026 COL5A3 0.796907 1.31037 1.24016 3.61755 1.82847 2.9932 WT XLOC_017540 AC023908.2, 2.62604 4.25401 5.21893 11.7612 9.04747 9.71639 WT FSIP1, GPR176 XLOC_033561 PIM3 13.3732 14.059 17.7079 19.3155 21.0904 73.5991 WT XLOC_030077 TMEM163 1.18136 1.45792 1.12487 2.57937 3.44166 3.51647 WT XLOC_010023 C1QTNF5, 6.28492 4.45959 6.78377 12.2525 17.6149 14.5641 WT MFRP XLOC_048928 DUSP4 6.90588 10.7838 10.1329 16.7994 17.1467 36.6906 WT XLOC_048992 RAB11FIP1 18.2559 17.6462 23.3217 35.1087 29.3611 86.7308 WT XLOC_005542 TSPAN15 43.5694 28.2963 42.6198 116.925 86.9998 91.7988 WT XLOC_054006 FAM122B 11.0814 14.8125 13.16 35.6611 25.4969 39.926 WT XLOC_038088 PALLD 91.1424 95.3422 111.917 188.823 173.813 410.679 WT XLOC_026199 BST2 18.6328 41.7776 25.707 60.773 45.88 116.923 WT XLOC_009683 FAM181B 2.06403 1.75194 4.16686 8.95673 8.8737 3.01097 WT XLOC_054131 CXorf40B 13.2865 12.8844 13.002 28.8197 30.2012 43.2512 WT XLOC_032441 ABCG1 3.54189 2.29292 2.82606 8.16075 9.58416 4.93166 WT XLOC_003976 HIST2H2BE 6.59545 6.66469 10.7701 7.48744 13.3224 42.238 WT XLOC_053841 DCX 15.4712 8.76769 15.4486 22.941 41.4257 41.2549 WT XLOC_005843 KAZALD1 5.29693 3.61388 4.57153 13.1899 13.7831 8.97227 WT XLOC_012477 DUSP6 32.578 35.9242 57.5001 72.4462 125.635 140.899 WT XLOC_014816 SMOC1 20.1662 23.7982 10.5509 46.2095 64.3087 36.9327 WT XLOC_040656 HRH2 0.837311 0.634602 1.32313 1.99127 1.62424 3.94527 WT XLOC_006803 FGFBP3 33.6678 77.1798 49.4306 109.801 167.569 158.38 WT XLOC_052691 PRPS1 183.224 189.988 179.066 453.895 545.065 502.77 WT XLOC_005775 AL157396.1, 69.2823 68.8436 93.8269 203.796 192.153 238.139 WT LGI1 XLOC_052372 MAGEH1 24.0826 19.4032 28.612 57.957 68.7396 71.5261 WT XLOC_000088 ISG15 6.21447 6.95642 6.98725 11.8814 10.3321 33.5355 WT XLOC_024612 TNFSF9 0.717224 3.03131 1.10745 3.94731 1.3869 8.28667 WT XLOC_026219 KIAA1683 0.87993 0.708561 1.21511 1.36168 2.4304 4.0732 WT XLOC_053827 COL4A6 115.036 99.1192 130.266 346.703 285.01 335.723 WT XLOC_053972 IGSF1 6.52065 3.54768 6.49959 15.8002 17.7319 13.0285 WT XLOC_013498 MYO16 0.221357 0.355848 0.495329 1.484 0.945527 0.623607 WT XLOC_031173 VSTM2L 9.62772 8.65123 17.2476 34.2098 27.5505 39.8025 WT XLOC_052853 RAB33A 2.68172 3.10035 2.85824 6.57785 9.1093 9.52405 WT XLOC_043236 EYA4 10.4845 5.94823 8.2757 23.4297 25.1694 23.9862 WT XLOC_046163 LRRC61 0.86421 1.6791 1.53381 1.73302 3.93292 6.32881 WT XLOC_053995 GPC3 356.448 305.126 420.88 937.281 973.583 1280.35 WT XLOC_016656 CKMT1A 0.195764 0.252631 0.065192 0.61273 0.535787 0.367446 WT XLOC_035032 TRH 41.0091 27.1132 39.3515 81.1771 106.609 131.166 WT XLOC_007911 AP003774.1 0.396296 0.267346 0.587915 1.13377 1.32979 1.28669 WT XLOC_009044 DCDC1 1.4494 1.47018 2.47011 5.69078 6.21219 4.51809 WT XLOC_025875 SMIM24 3.74159 5.42114 11.6057 12.6931 23.5603 27.0304 WT XLOC_051389 FRMD3 1.83018 2.1865 4.43258 8.30475 5.60456 11.875 WT XLOC_028631 UNC80 0.217954 0.44451 0.425888 1.89622 0.598572 0.881806 WT XLOC_035814 CCK 4.32176 1.89858 1.00456 1.6504 2.01784 18.8127 WT XLOC_028335 GAD1 3.76327 2.3603 2.71097 8.06297 9.04451 11.0829 WT XLOC_042640 PIM1 22.8367 25.5602 29.2301 33.1164 54.0663 161.469 WT XLOC_037275 RHOH 0.617003 1.02472 1.41109 4.20766 3.06835 2.5333 WT XLOC_022915 CA10 1.19926 1.0558 2.24358 9.02446 4.47401 1.0871 WT XLOC_014449 DHRS2 0.207272 0.738887 0.203989 2.33486 0.275137 1.13645 WT XLOC_006704 SFTPA2 0.501864 0.437923 0.852414 0.787377 2.13541 2.93168 WT XLOC_004924 LINC01139 3.24003 2.89495 3.70155 15.9453 7.33362 9.19588 WT XLOC_032387 SIM2 1.88357 2.09546 7.89405 19.4132 12.1409 7.74329 WT XLOC_017398 ATP10A 0.36411 0.211242 0.194995 0.847112 1.28466 0.423302 WT XLOC_052195 MAOA 3.36078 2.21257 3.23231 9.66039 7.3758 12.227 WT XLOC_037118 AC097493.4 21.2395 19.5519 12.6137 49.5568 58.4472 70.4522 WT XLOC_053014 GPR50 2.08277 3.44278 4.40543 10.3401 8.1101 14.8621 WT XLOC_015083 AL117190.1, 0.407776 1.35024 0.252559 2.45727 1.99503 2.35652 WT MEG3, MEG3_2, MEG8, MEG81, MEG8_2, SNORD112, SNORD113, SNORD113-4, SNORD114-10, SNORD114-26 XLOC_022019 ALOX15 0.436382 0.489093 0.472337 2.86337 1.17703 0.71001 WT XLOC_051724 NR5A1 1.70203 0.836837 1.68223 2.71166 8.61071 3.14169 WT XLOC_000121 GABRD 0.080031 0.380221 0.258136 0.779533 0.894608 0.821325 WT XLOC_000327 PADI3 0.191586 0.357198 0.171492 0.984504 0.4349 1.10153 WT XLOC_039801 RGS7BP 0.488525 0.345355 0.943862 1.95493 3.47323 0.808829 WT XLOC_045580 PEG10 180.739 195.875 173.401 548.084 687.495 700.931 WT XLOC_014868 VRTN 0.388638 1.2995 0.156878 2.46285 2.00403 2.08552 WT XLOC_014085 SLC15A1 0.24021 0.076908 0.217821 0.546709 0.621361 0.78827 WT XLOC_023568 TTR 7.64744 5.28695 9.74179 4.19376 76.4427 3.12691 WT XLOC_037820 SPRY1 9.82548 9.72238 17.1053 45.8217 47.4373 42.2053 WT XLOC_025948 CD70 0.393748 4.95025 1.24036 7.43782 0.82236 16.5319 WT XLOC_016521 GREM1 0.234164 0.121837 0.408728 1.12876 0.984358 0.772676 WT XLOC_037153 CD38 0.097742 0.579579 0.551301 2.28771 1.65186 0.730318 WT XLOC_034645 PSMC1P1 0.44804 0.848938 0.461207 1.2887 2.64245 2.80786 WT XLOC_037405 LINC02380 0.481051 0.329814 1.9498 4.40254 5.40685 0.864318 WT XLOC_045797 FEZF1-AS1 66.8407 70.4759 66.7804 241.268 249.816 298.805 WT XLOC_004325 F5 0.759453 0.634342 0.089888 4.71328 0.607308 0.434241 WT XLOC_051882 AL355987.1, 0.110907 0.044809 0.219375 0.165498 1.1634 0.16398 WT LCN10, LCN6 XLOC_017869 MEGF11 0.422346 0.071042 0.22406 1.2853 1.17064 0.430566 WT XLOC_030369 FRZB 18.0479 17.487 17.9293 35.2304 89.8978 91.2878 WT XLOC_047511 VIPR2 0.192779 0.079507 0.089813 0.434345 0.670121 0.415995 WT XLOC_046984 PDK4 0.375952 0.154405 0.948847 2.17342 2.13958 1.93709 WT XLOC_007385 SPON1 9.90189 10.394 7.00568 28.4848 43.7573 43.3548 WT XLOC_025926 FUT3 0.790168 0.206398 1.19875 0.669821 2.65624 6.11659 WT XLOC_040637 C5orf47 0.150548 0.230716 0.224914 0.747187 0.650913 1.23161 WT XLOC_012724 TESC 0.606087 0.714566 0.419522 2.66894 2.93782 2.12762 WT XLOC_006913 FGF8 8.06329 8.99878 18.6454 50.3332 64.3412 47.0516 WT XLOC_049314 PAG1 2.12542 2.18011 2.94257 14.4441 7.45301 11.0131 WT XLOC_016027 RTL1 0.168161 0.888182 0.294915 2.2409 2.72784 1.16737 WT XLOC_015082 DLK1 108.58 445.412 155.099 1060.44 1117.53 1048.09 WT XLOC_015979 GSC 0.896664 1.92959 3.30342 9.3785 7.02679 11.5861 WT XLOC_024337 RNF152 6.17501 2.53135 6.97134 18.5501 28.2161 26.9696 WT XLOC_035303 CLDN11 0.31711 0.409501 0.916247 2.76374 2.30665 2.72639 WT XLOC_003362 FYB2 1.2895 1.05917 1.41076 6.16659 5.3411 6.53754 WT XLOC_032392 RIPPLY3 3.3058 2.73499 3.88712 20.8166 16.3022 13.4339 WT XLOC_052942 LINC00632 2.86458 2.34239 6.29908 12.5445 13.613 32.7025 WT XLOC_036567 TM4SF18 0.324446 0.551776 1.09341 4.26705 3.42361 2.49461 WT XLOC_045798 AC004594.1 0.265679 0.267242 0 0.966884 1.09454 0.701641 WT XLOC_047230 GRM8 3.54174 2.7208 3.39742 17.0717 23.1995 12.4775 WT XLOC_052560 DACH2 1.33421 1.73229 1.11884 6.14873 7.13163 9.59335 WT XLOC_003458 RPE65 0.08274 0.113455 0.170342 0.930307 0.599978 0.475714 WT XLOC_034204 SLC6A1 0.060979 0.156361 0.214192 0.730038 1.09308 0.544853 WT XLOC_049383 CALB1 4.01979 4.37203 4.07709 21.985 44.1714 2.57769 WT XLOC_005163 SLC39A12 0.28621 0.163049 0.445538 1.63096 2.30924 1.03106 WT XLOC_054060 MCF2 0.132052 0.237883 0.098161 1.39861 0.465809 0.758701 WT XLOC_049559 KCNV1 0.26381 0.0548 0.176721 1.23458 1.30239 0.29791 WT XLOC_022729 MEOX1 3.91054 1.09259 2.46675 20.9349 19.2186 3.91746 WT XLOC_023335 ADCYAP1 0.465905 0.567205 0.929481 4.02343 2.71566 4.87488 WT XLOC_043927 CUTA 0.293006 0.233478 0.509997 5.54604 0.452025 0.247716 WT XLOC_028901 TWIST2 0.208211 0.186875 0.21433 1.41554 0.583798 1.70933 WT XLOC_021584 CA4 1.61206 1.2634 1.32575 6.48404 5.48449 13.6196 WT XLOC_031893 PTPRT 0.28729 0.205393 0.316373 1.54923 1.668 1.71211 WT XLOC_047531 MYOM2 0.149096 0.298459 0.211717 0.156465 3.86903 0.162238 WT XLOC_030352 ZNF385B 9.47793 14.9801 18.3758 70.8253 56.3005 146.728 WT XLOC_047205 FEZF1 41.7884 48.1114 40.6682 268.798 232.235 337.644 WT XLOC_037406 AC013724.1 1.26243 0.607775 2.7783 12.1569 16.1201 1.9022 WT XLOC_036569 TM4SF1 5.40712 3.62359 7.60791 31.4867 28.7339 51.5129 WT XLOC_024906 GDF15 4.30613 12.7602 12.9116 44.6215 16.8273 147.763 WT XLOC_027347 SLC8A1-AS1 0.103871 0.072015 0 0.606054 0.349679 0.281893 WT XLOC_000114 MMP23B 0.103909 0 0.161306 0.352486 0.419838 1.10201 WT XLOC_013839 SIAH3 0.123135 0.19503 0.111841 1.38261 1.37262 0.487249 WT XLOC_001202 NTNG1 1.08523 0.722204 1.30259 9.20546 9.03608 5.6575 WT XLOC_049751 EEF1D 1.81141 1.32743 1.88277 1.65909 1.42378 37.2556 WT XLOC_050257 GDA 0.014489 0.033737 0.097653 0.63289 0.190831 0.394516 WT XLOC_026965 AC008735.6 0.045967 0.458412 0.023659 0.961576 0.999984 2.56362 WT XLOC_051526 GABBR2 0.457344 0.648445 0.400772 0.548775 6.17456 7.34725 WT XLOC_025815 SBNO2 0.11578 0.079897 0.108348 2.2357 0.217395 0.490183 WT XLOC_000992 LHX8 0.079931 0.510155 0.032912 2.20661 3.15652 0.683668 WT XLOC_017767 ALDH1A2 0.994996 0.891748 1.23284 11.8578 6.66132 12.7266 WT XLOC_017689 HDC 0.89838 0.989162 0.752232 10.9699 11.0578 5.70934 WT XLOC_014541 INSM2 0.017707 0.256047 0.054682 1.12048 1.94313 0.529398 WT XLOC_035850 SLC6A20 0.014771 0.035495 0.111345 0.596965 1.15708 0.24817 WT XLOC_022342 AC005697.1, 20.6119 30.5279 25.7636 334.055 213.318 425.604 WT LYRM9, NOS2 XLOC_015003 AL110118.2, 0.009336 0.982384 0.169714 0.074207 14.1377 0.487161 WT TMEM251, UBR7 XLOC_036088 PROK2 0.122643 0.307396 0.133767 1.93546 3.6817 2.57632 WT XLOC_054232 AKAP17A 0.037678 0.033052 0.038786 0.065554 1.56317 0.136579 WT XLOC_047719 FGF17 0.181709 0.709779 1.50313 19.5062 14.7706 4.55528 WT XLOC_053187 PIGA 9.98582 10.5065 9.63516 17.4441 644.333 18.5628 WT XLOC_052734 HTR2C 0.700825 1.81764 1.30142 30.2338 34.0218 44.1372 WT XLOC_030000 RAB6C-AS1 0.089992 0.033102 0.031389 0.096716 20.4848 0.035065 WT XLOC_025431 AC026803.1 0 0 0 0.758489 0.350571 1.66778 WT XLOC_036777 AC109779.1 0 0 0 0.61836 0.131894 0.23794 WT XLOC_027001 ZNF835 0.053623 0.658148 0.340527 0 0 0 WT XLOC_025714 ZNF471 0.682554 1.15445 0.470161 0 0 0 WT XLOC_045348 ZNF736 0.624218 1.92792 0.552082 0 0 0 WT XLOC_006399 AL132657.1, 0.863026 4.17081 1.05968 0 0 0 WT ZNF248 XLOC_050265 AL451127.1 0.422805 0.421643 0.373054 0 0 0 WT XLOC_032449 CRYAA 0.53568 0.400657 1.15799 0 0 0 WT XLOC_051343 LINC01474 0.179453 0.190138 0.39052 0 0 0 WT XLOC_031712 AL035252.2 0.597144 0.151676 0.438592 0 0 0 WT XLOC_033655 PRODH 0 0 3.55524 0 0 0 WT XLOC_010032 AP001360.2 0.213455 0.496694 0.146485 0 0 0 WT XLOC_050737 AL136141.1 0.636613 0.634865 0.491491 0 0 0 WT XLOC_049474 RGS22 0.417502 0.237326 0.261315 0 0 0 WT XLOC_053524 ZXDA 0.413137 0.088739 0.510333 0 0 0 WT XLOC_027708 THNSL2 0.347969 0.618049 0.70932 0 0 0 WT XLOC_040716 AC104117.3 0.5384 0.483229 0.332533 0 0 0 WT XLOC_031042 AL390198.1 0.456256 0.910005 0.234832 0 0 0 WT XLOC_050453 AL589843.1 0.351823 0.818665 0.241441 0 0 0 WT XLOC_024731 ZNF441 2.82232 2.53353 2.82785 0 0 0 WT signif- tracking_id sample_2 value_1 value_2 log2(fold_change) test_stat p_value q_value icant XLOC_002465 KO 12.1058 0.002618 12.1752 0.17692 5.00E05 0.002735 yes XLOC_014867 KO 37.3025 0.028226 10.368 9.698 0.00025.sup. 0.010784 yes XLOC_032376 KO 4.28914 0.007477 9.16397 0.54615 0.0002.sup. 0.008981 yes XLOC_051344 KO 319.839 0.721764 8.7916 8.20366 5.00E05 0.002735 yes XLOC_019330 KO 88.2719 0.252207 8.4512 5.25973 0.0001.sup. 0.005033 yes XLOC_053625 KO 18.1989 0.055653 8.35318 0.70916 5.00E05 0.002735 yes XLOC_027099 KO 13.8546 0.042941 8.3338 0.59415 5.00E05 0.002735 yes XLOC_000776 KO 32.2388 0.111802 8.17171 9.87898 5.00E05 0.002735 yes XLOC_023004 KO 14.8868 0.066548 7.80542 0.94361 0.0012.sup. 0.037051 yes XLOC_049879 KO 110.799 0.505128 7.77708 4.1145 5.00E05 0.002735 yes XLOC_021600 KO 10.0484 0.050286 7.64259 1.6683 0.0009.sup. 0.029595 yes XLOC_017703 KO 0.322438 0.002003 7.33062 0.04206 5.00E05 0.002735 yes XLOC_039936 KO 90.8139 0.830727 6.77239 5.80423 5.00E05 0.002735 yes XLOC_014052 KO 51.0324 0.563355 6.50123 7.32949 5.00E05 0.002735 yes XLOC_048042 KO 25.6828 0.293896 6.44935 1.00648 5.00E05 0.002735 yes XLOC_025713 KO 6.35971 0.07438 6.41791 2.20203 5.00E05 0.002735 yes XLOC_036590 KO 3.22484 0.042806 6.23527 1.28538 5.00E05 0.002735 yes XLOC_023764 KO 36.99 0.528318 6.12959 8.72795 5.00E05 0.002735 yes XLOC_026995 KO 1.97436 0.029986 6.04093 1.37314 5.00E05 0.002735 yes XLOC_002958 KO 13.7831 0.215454 5.99938 1.97937 0.00025.sup. 0.010784 yes XLOC_006922 KO 4.25081 0.070798 5.90789 4.46714 0.0001.sup. 0.005033 yes XLOC_034614 KO 12.7807 0.215727 5.88862 3.90651 5.00E05 0.002735 yes XLOC_036565 KO 33.6845 0.601204 5.80809 1.83522 5.00E05 0.002735 yes XLOC_018597 KO 18.1238 0.378467 5.58158 5.5681 5.00E05 0.002735 yes XLOC_030767 KO 2.87445 0.067814 5.40557 2.46073 5.00E05 0.002735 yes XLOC_008243 KO 3.12687 0.074384 5.39358 3.86149 0.0001.sup. 0.005033 yes XLOC_024400 KO 10.1296 0.243486 5.37859 6.01904 5.00E05 0.002735 yes XLOC_048281 KO 35.1109 0.902144 5.28242 6.55776 5.00E05 0.002735 yes XLOC_033225 KO 4.36783 0.1225 5.15606 4.02057 0.00025.sup. 0.010784 yes XLOC_050766 KO 21.0381 0.638988 5.04107 7.07495 5.00E05 0.002735 yes XLOC_027566 KO 7.32415 0.230465 4.99004 1.02362 0.0001.sup. 0.005033 yes XLOC_001908 KO 17.7272 0.595294 4.89622 3.51223 5.00E05 0.002735 yes XLOC_040715 KO 1.44082 0.049585 4.86083 2.19002 5.00E05 0.002735 yes XLOC_005323 KO 5.62995 0.206268 4.77053 2.63121 5.00E05 0.002735 yes XLOC_025547 KO 14.1547 0.537814 4.71803 3.33463 5.00E05 0.002735 yes XLOC_041138 KO 3.51763 0.144547 4.605 1.64935 5.00E05 0.002735 yes XLOC_030921 KO 7.64404 0.315819 4.59717 6.26788 5.00E05 0.002735 yes XLOC_002728 KO 41.8801 1.75235 4.57891 8.46904 5.00E05 0.002735 yes XLOC_025503 KO 0.331699 0.014069 4.55928 0.51132 0.0007.sup. 0.02448 yes XLOC_017273 KO 65.9526 2.86618 4.52423 5.23236 5.00E05 0.002735 yes XLOC_048386 KO 1.57989 0.071283 4.47012 1.73879 0.0001.sup. 0.005033 yes XLOC_048495 KO 3.05449 0.147096 4.3761 3.00176 5.00E05 0.002735 yes XLOC_005835 KO 1.85907 0.0966 4.26641 1.87816 5.00E05 0.002735 yes XLOC_027327 KO 3.12486 0.165476 4.2391 3.03169 5.00E05 0.002735 yes XLOC_041832 KO 132.265 7.00698 4.2385 11.3056 5.00E05 0.002735 yes XLOC_021142 KO 374.477 20.1806 4.21383 10.2 5.00E05 0.002735 yes XLOC_018051 KO 0.353852 0.020222 4.12912 3.88113 5.00E05 0.002735 yes XLOC_014741 KO 18.6011 1.08966 4.09343 6.72095 5.00E05 0.002735 yes XLOC_034205 KO 1.92053 0.113179 4.08483 4.04539 5.00E05 0.002735 yes XLOC_043011 KO 2.64893 0.159703 4.05195 2.64303 5.00E05 0.002735 yes XLOC_026261 KO 1.47403 0.092338 3.9967 0.61431 0.0006.sup. 0.021697 yes XLOC_005448 KO 18.3327 1.14897 3.996 3.06836 5.00E05 0.002735 yes XLOC_020429 KO 24.0091 1.53786 3.96459 2.15827 0.0004.sup. 0.015799 yes XLOC_009925 KO 1161.01 74.4747 3.96248 8.12613 5.00E05 0.002735 yes XLOC_034818 KO 0.588316 0.038319 3.94045 2.45388 0.00015.sup. 0.007086 yes XLOC_009328 KO 17.4411 1.17897 3.88689 3.67756 5.00E05 0.002735 yes XLOC_008373 KO 8.60107 0.588929 3.86835 3.3272 5.00E05 0.002735 yes XLOC_008341 KO 5.25207 0.369581 3.82892 2.63127 5.00E05 0.002735 yes XLOC_002706 KO 3.41564 0.242834 3.81411 2.45042 5.00E05 0.002735 yes XLOC_024733 KO 2.8707 0.211004 3.76606 2.60337 5.00E05 0.002735 yes XLOC_027565 KO 1.85122 0.14371 3.68724 3.58858 5.00E05 0.002735 yes XLOC_049024 KO 6.50282 0.534113 3.60585 3.36237 5.00E05 0.002735 yes XLOC_002386 KO 0.584725 0.048063 3.60475 2.73747 5.00E05 0.002735 yes XLOC_008662 KO 0.419861 0.035446 3.56623 1.21575 5.00E05 0.002735 yes XLOC_039183 KO 682.925 58.1679 3.55343 10.4794 5.00E05 0.002735 yes XLOC_045037 KO 0.378811 0.032484 3.54366 2.94724 0.0015.sup. 0.04365 yes XLOC_030694 KO 0.267042 0.023095 3.53139 1.12835 0.0008.sup. 0.027077 yes XLOC_024166 KO 8.09229 0.732091 3.46645 5.96158 5.00E05 0.002735 yes XLOC_007296 KO 21.8429 2.01605 3.43756 6.09094 5.00E05 0.002735 yes XLOC_050235 KO 11.5413 1.09914 3.39236 3.4741 5.00E05 0.002735 yes XLOC_048391 KO 0.845173 0.081871 3.36782 1.30179 5.00E05 0.002735 yes XLOC_053146 KO 15.3471 1.49738 3.35745 4.94741 5.00E05 0.002735 yes XLOC_030190 KO 0.810134 0.079693 3.34563 1.13004 5.00E05 0.002735 yes XLOC_012216 KO 282.411 27.9694 3.33588 4.85247 5.00E05 0.002735 yes XLOC_053685 KO 3.1391 0.311345 3.33376 2.21131 0.0002.sup. 0.008981 yes XLOC_049217 KO 0.432132 0.043553 3.31064 1.28478 0.00025.sup. 0.010784 yes XLOC_010972 KO 19.745 1.99594 3.30634 6.19126 5.00E05 0.002735 yes XLOC_029247 KO 18.2894 1.88433 3.27888 4.79568 5.00E05 0.002735 yes XLOC_019871 KO 1.10959 0.116052 3.25718 3.55328 5.00E05 0.002735 yes XLOC_048112 KO 1.6599 0.174874 3.24671 4.02046 5.00E05 0.002735 yes XLOC_012370 KO 4.70027 0.495232 3.24657 0.77627 0.00015.sup. 0.007086 yes XLOC_040762 KO 1.84837 0.198791 3.21693 2.7891 5.00E05 0.002735 yes XLOC_030742 KO 10.9357 1.18576 3.20517 1.40992 0.00025.sup. 0.010784 yes XLOC_030425 KO 30.5899 3.41028 3.16509 2.38833 5.00E05 0.002735 yes XLOC_050331 KO 6.99633 0.785658 3.15462 6.34637 5.00E05 0.002735 yes XLOC_017031 KO 1789.66 206.895 3.11271 8.17714 5.00E05 0.002735 yes XLOC_020676 KO 1.01258 0.121548 3.05843 3.73207 5.00E05 0.002735 yes XLOC_002160 KO 4.32369 0.523629 3.04565 2.71452 0.00015.sup. 0.007086 yes XLOC_030368 KO 1.70813 0.206968 3.04494 1.73896 5.00E05 0.002735 yes XLOC_037964 KO 43.7695 5.323 3.03961 3.04785 5.00E05 0.002735 yes XLOC_005996 KO 61.9017 7.53754 3.03781 3.54682 5.00E05 0.002735 yes XLOC_041354 KO 2.47954 0.308697 3.00581 3.72353 5.00E05 0.002735 yes XLOC_010676 KO 1.50841 0.189473 2.99296 1.95847 5.00E05 0.002735 yes XLOC_035638 KO 4.97002 0.640552 2.95586 4.39647 5.00E05 0.002735 yes XLOC_005857 KO 0.742394 0.095926 2.95219 2.54529 0.0006.sup. 0.021697 yes XLOC_016442 KO 4.58084 0.594035 2.94699 2.77007 5.00E05 0.002735 yes XLOC_011052 KO 3.74288 0.486352 2.94408 3.69824 5.00E05 0.002735 yes XLOC_042581 KO 0.716836 0.093381 2.94045 0.19716 5.00E05 0.002735 yes XLOC_040023 KO 123.531 16.3626 2.9164 6.98086 5.00E05 0.002735 yes XLOC_050764 KO 13.5584 1.80508 2.90905 4.76345 5.00E05 0.002735 yes XLOC_029134 KO 3.14525 0.422426 2.8964 2.9707 5.00E05 0.002735 yes XLOC_010672 KO 1.76451 0.237593 2.89271 3.03246 5.00E05 0.002735 yes XLOC_037612 KO 474.91 64.2023 2.88696 3.3835 5.00E05 0.002735 yes XLOC_027527 KO 80.7168 10.9298 2.88461 3.75531 5.00E05 0.002735 yes XLOC_027038 KO 0.635858 0.089697 2.82558 2.69339 5.00E05 0.002735 yes XLOC_028175 KO 1.87705 0.266095 2.81845 2.0512 5.00E05 0.002735 yes XLOC_037904 KO 0.301087 0.042875 2.81198 0.70888 0.00015.sup. 0.007086 yes XLOC_032052 KO 2.41816 0.350235 2.78752 2.84646 5.00E05 0.002735 yes XLOC_002049 KO 3.37884 0.493156 2.77641 2.75377 5.00E05 0.002735 yes XLOC_041731 KO 153.008 22.3593 2.77466 3.96717 5.00E05 0.002735 yes XLOC_021787 KO 28.1021 4.14117 2.76256 2.97761 0.00015.sup. 0.007086 yes XLOC_039364 KO 1.60128 0.236481 2.75943 2.01375 0.00175.sup. 0.049136 yes XLOC_013274 KO 4.19194 0.620843 2.75531 2.31599 5.00E05 0.002735 yes XLOC_012994 KO 4.1007 0.617778 2.73071 2.30382 0.0011.sup. 0.034628 yes XLOC_046363 KO 2.93954 0.445272 2.72283 1.41 0.0015.sup. 0.04365 yes XLOC_024736 KO 3.46582 0.544143 2.67114 2.63657 0.00045.sup. 0.017298 yes XLOC_045760 KO 5.35983 0.84448 2.66605 2.6947 5.00E05 0.002735 yes XLOC_051664 KO 245.742 39.5382 2.63582 2.59316 5.00E05 0.002735 yes XLOC_043359 KO 6.65213 1.07684 2.62701 4.13675 5.00E05 0.002735 yes XLOC_009884 KO 21.1143 3.45803 2.6102 3.6504 5.00E05 0.002735 yes XLOC_002245 KO 5.68103 0.937036 2.59998 2.27507 5.00E05 0.002735 yes XLOC_013601 KO 0.56806 0.094264 2.59127 3.12484 5.00E05 0.002735 yes XLOC_037491 KO 13.7676 2.32159 2.56809 4.67039 5.00E05 0.002735 yes XLOC_043013 KO 4.49898 0.761045 2.56354 4.64282 5.00E05 0.002735 yes XLOC_026854 KO 0.521044 0.088182 2.56285 1.6689 0.0006.sup. 0.021697 yes XLOC_049110 KO 0.287072 0.048636 2.5613 1.83311 5.00E05 0.002735 yes XLOC_005951 KO 0.644767 0.1098 2.5539 2.68709 0.00015.sup. 0.007086 yes XLOC_041015 KO 1.10594 0.188466 2.55289 1.84408 0.0004.sup. 0.015799 yes XLOC_007768 KO 9.12975 1.56458 2.5448 2.42375 0.00085.sup. 0.028328 yes XLOC_052548 KO 0.408133 0.070038 2.54283 2.3707 0.00165.sup. 0.0471 yes XLOC_013946 KO 3.14275 0.5417 2.53646 2.33541 5.00E05 0.002735 yes XLOC_008890 KO 9.02766 1.55615 2.53638 2.35921 5.00E05 0.002735 yes XLOC_039304 KO 3.84835 0.666384 2.52981 2.4045 5.00E05 0.002735 yes XLOC_015380 KO 138.6 24.1608 2.52019 5.78785 5.00E05 0.002735 yes XLOC_006001 KO 5.32332 0.931784 2.51426 2.89723 0.0001.sup. 0.005033 yes XLOC_045083 KO 1.3188 0.232995 2.50085 1.31698 0.0002.sup. 0.008981 yes XLOC_034738 KO 6.05702 1.10413 2.4557 4.4028 5.00E05 0.002735 yes XLOC_051434 KO 1.54312 0.281644 2.4539 2.18811 0.0008.sup. 0.027077 yes XLOC_002251 KO 2.58726 0.473019 2.45146 1.79353 0.00065.sup. 0.023143 yes XLOC_017507 KO 3.39596 0.621874 2.44913 3.29809 5.00E05 0.002735 yes XLOC_020114 KO 4.68771 0.863093 2.44129 2.18362 0.00035.sup. 0.014242 yes XLOC_003943 KO 0.374986 0.069068 2.44075 0.63106 0.00075.sup. 0.025855 yes XLOC_012012 KO 3.96584 0.735353 2.43112 3.54944 5.00E05 0.002735 yes XLOC_027037 KO 0.395158 0.073764 2.42143 2.31832 0.00145.sup. 0.042686 yes XLOC_037223 KO 24.1676 4.55112 2.40878 3.72524 5.00E05 0.002735 yes XLOC_025549 KO 0.492645 0.093686 2.39465 1.26382 0.0009.sup. 0.029595 yes XLOC_003160 KO 58.9989 11.325 2.38118 5.06659 5.00E05 0.002735 yes XLOC_032087 KO 0.284765 0.054765 2.37844 2.16421 0.0013.sup. 0.039328 yes XLOC_018083 KO 64.0612 12.3305 2.37722 1.17307 0.00015.sup. 0.007086 yes XLOC_006181 KO 0.345905 0.066947 2.36929 1.0104 0.00145.sup. 0.042686 yes XLOC_036866 KO 78.3712 15.189 2.36729 4.63835 5.00E05 0.002735 yes XLOC_001171 KO 10.0322 1.94475 2.36699 4.51053 5.00E05 0.002735 yes XLOC_041413 KO 18.0166 3.49572 2.36566 3.08834 5.00E05 0.002735 yes XLOC_036625 KO 94.1119 18.2626 2.36549 5.07047 5.00E05 0.002735 yes XLOC_027645 KO 67.006 13.0232 2.3632 5.39545 5.00E05 0.002735 yes XLOC_032532 KO 19.4305 3.82899 2.34328 3.13535 5.00E05 0.002735 yes XLOC_043065 KO 7.45336 1.48119 2.33114 4.10649 5.00E05 0.002735 yes XLOC_038190 KO 3.23318 0.642567 2.33104 3.0731 5.00E05 0.002735 yes XLOC_049746 KO 0.994641 0.199654 2.31667 2.23615 0.0002.sup. 0.008981 yes XLOC_001567 KO 1.34371 0.270581 2.31209 1.91751 0.0006.sup. 0.021697 yes XLOC_038812 KO 105.354 21.3903 2.30022 2.53955 0.0001.sup. 0.005033 yes XLOC_051436 KO 0.906457 0.186676 2.2797 1.5455 0.00145.sup. 0.042686 yes XLOC_042949 KO 1.89419 0.390128 2.27956 2.47285 0.00015.sup. 0.007086 yes XLOC_025172 KO 3.03429 0.625222 2.27892 2.43247 0.00025.sup. 0.010784 yes XLOC_004746 KO 5.33443 1.10872 2.26644 2.09819 5.00E05 0.002735 yes XLOC_046915 KO 11.7941 2.46475 2.25855 2.59082 5.00E05 0.002735 yes XLOC_012705 KO 2.48835 0.522027 2.25299 2.65756 5.00E05 0.002735 yes XLOC_004935 KO 0.677219 0.142548 2.24818 2.6221 5.00E05 0.002735 yes XLOC_044557 KO 8.39441 1.79933 2.22197 4.11767 5.00E05 0.002735 yes XLOC_021148 KO 0.945894 0.206344 2.19663 1.71145 0.00075.sup. 0.025855 yes XLOC_030096 KO 2.80391 0.615444 2.18774 2.51092 0.00025.sup. 0.010784 yes XLOC_035763 KO 1.38609 0.305784 2.18044 1.87038 0.0011.sup. 0.034628 yes XLOC_000763 KO 0.577785 0.128637 2.16723 2.2213 0.00125.sup. 0.038196 yes XLOC_008424 KO 53.3514 12.3858 2.10684 3.62016 5.00E05 0.002735 yes XLOC_019146 KO 0.741948 0.173064 2.10002 1.0304 0.0005.sup. 0.018851 yes XLOC_049099 KO 0.25859 0.060763 2.08941 1.37344 0.00115.sup. 0.035883 yes XLOC_030539 KO 12.7911 3.0227 2.08123 5.23097 5.00E05 0.002735 yes XLOC_031027 KO 1.48165 0.352849 2.07008 2.39076 0.00035.sup. 0.014242 yes XLOC_003694 KO 7.72747 1.84636 2.06531 2.57245 5.00E05 0.002735 yes XLOC_051965 KO 2.34593 0.561837 2.06193 3.55348 5.00E05 0.002735 yes XLOC_037731 KO 8.25338 1.9801 2.05941 2.31193 5.00E05 0.002735 yes XLOC_001154 KO 3.80901 0.914235 2.05878 2.71511 0.0001.sup. 0.005033 yes XLOC_038913 KO 4.48878 1.08237 2.05213 2.1674 5.00E05 0.002735 yes XLOC_039460 KO 8.01707 1.94197 2.04555 1.38561 5.00E05 0.002735 yes XLOC_047896 KO 46.5979 11.3107 2.04258 5.04385 5.00E05 0.002735 yes XLOC_023770 KO 0.386687 0.094425 2.03393 1.29814 0.00025.sup. 0.010784 yes XLOC_049601 KO 2.23105 0.548564 2.02399 3.08791 5.00E05 0.002735 yes XLOC_014587 KO 2.20468 0.542186 2.02371 1.75118 0.0014.sup. 0.041595 yes XLOC_023424 KO 42.8887 10.5738 2.02011 3.23999 5.00E05 0.002735 yes XLOC_009539 KO 1.1183 0.280123 1.99718 2.28459 0.00025.sup. 0.010784 yes XLOC_015770 KO 0.383069 0.096156 1.99416 1.48569 0.0012.sup. 0.037051 yes XLOC_009129 KO 1.24572 0.32174 1.95302 1.99375 0.0015.sup. 0.04365 yes XLOC_043180 KO 2.51959 0.654558 1.9446 2.75987 5.00E05 0.002735 yes XLOC_050369 KO 17.2334 4.50098 1.93689 4.90384 5.00E05 0.002735 yes XLOC_046916 KO 45.4135 11.8701 1.93579 3.21121 5.00E05 0.002735 yes XLOC_048409 KO 2.80108 0.732425 1.93523 2.15143 0.00035.sup. 0.014242 yes XLOC_002599 KO 2.30957 0.604726 1.93327 2.33816 5.00E05 0.002735 yes XLOC_003586 KO 1.0471 0.275225 1.92772 2.06343 0.00075.sup. 0.025855 yes XLOC_048138 KO 0.806364 0.212782 1.92206 2.05689 0.00095.sup. 0.030847 yes XLOC_027354 KO 66.0711 17.4829 1.91807 4.01842 5.00E05 0.002735 yes XLOC_038957 KO 4.115 1.09713 1.90716 2.90982 5.00E05 0.002735 yes XLOC_049191 KO 6.74647 1.80626 1.90113 2.21047 0.0008.sup. 0.027077 yes XLOC_041939 KO 2.76418 0.744292 1.89291 1.73006 0.00045.sup. 0.017298 yes XLOC_006501 KO 1.25896 0.339818 1.8894 2.56666 5.00E05 0.002735 yes XLOC_008690 KO 7.05588 1.90592 1.88834 2.13602 0.0008.sup. 0.027077 yes XLOC_044977 KO 21.5612 5.85194 1.88145 2.50564 5.00E05 0.002735 yes XLOC_003656 KO 0.895315 0.244172 1.8745 1.83209 0.00055.sup. 0.020318 yes XLOC_038031 KO 3.9946 1.09015 1.87352 0.8676 0.0012.sup. 0.037051 yes XLOC_003193 KO 362.181 99.4405 1.8648 5.45065 5.00E05 0.002735 yes XLOC_034650 KO 11.0536 3.05952 1.85314 2.77236 5.00E05 0.002735 yes XLOC_039653 KO 16.8665 4.67297 1.85175 2.13999 5.00E05 0.002735 yes XLOC_013909 KO 1.6732 0.463576 1.85173 2.13849 0.00055.sup. 0.020318 yes XLOC_045036 KO 12.3413 3.43959 1.84319 2.53212 0.00025.sup. 0.010784 yes XLOC_038757 KO 6.23477 1.74357 1.83829 3.22673 5.00E-05 0.002735 yes XLOC_036882 KO 59.19 16.5615 1.83752 5.15489 5.00E05 0.002735 yes XLOC_003759 KO 0.268839 0.076196 1.81895 2.00925 0.00025.sup. 0.010784 yes XLOC_050248 KO 29.0636 8.29148 1.80951 4.88885 5.00E05 0.002735 yes XLOC_050264 KO 200.172 57.3764 1.80271 5.1028 5.00E05 0.002735 yes XLOC_017955 KO 10.9445 3.14469 1.79922 2.14123 0.00015.sup. 0.007086 yes XLOC_013753 KO 11.6532 3.38567 1.78321 2.51568 5.00E05 0.002735 yes XLOC_019804 KO 5.09031 1.47943 1.78271 1.97354 0.0007.sup. 0.02448 yes XLOC_038358 KO 1.0431 0.30355 1.78087 2.18074 0.00035.sup. 0.014242 yes XLOC_035320 KO 14.9677 4.37344 1.77501 3.07021 5.00E05 0.002735 yes XLOC_005819 KO 1.23879 0.362438 1.77313 2.27118 0.00015.sup. 0.007086 yes XLOC_051394 KO 1.15346 0.337627 1.77247 1.7974 0.0015.sup. 0.04365 yes XLOC_047676 KO 2.15868 0.63221 1.77167 3.28716 5.00E05 0.002735 yes XLOC_031614 KO 1.73147 0.508535 1.76758 2.12415 0.0003.sup. 0.012524 yes XLOC_028345 KO 2.02269 0.594081 1.76754 1.73029 0.00075.sup. 0.025855 yes XLOC_004684 KO 0.781482 0.229655 1.76674 0.43377 5.00E05 0.002735 yes XLOC_044494 KO 9.95773 2.93419 1.76285 4.29488 5.00E05 0.002735 yes XLOC_036549 KO 19.8488 5.87479 1.75645 2.93158 5.00E05 0.002735 yes XLOC_052577 KO 1.82621 0.54297 1.74991 2.59037 0.00015.sup. 0.007086 yes XLOC_006438 KO 8.7805 2.61387 1.74812 2.6046 5.00E05 0.002735 yes XLOC_034437 KO 4.01038 1.20071 1.73985 2.00304 5.00E05 0.002735 yes XLOC_013669 KO 12.8456 3.87492 1.72904 3.91062 5.00E05 0.002735 yes XLOC_011800 KO 28.1667 8.50007 1.72844 2.00598 0.0004.sup. 0.015799 yes XLOC_044069 KO 13.4471 4.06047 1.72758 3.82443 5.00E05 0.002735 yes XLOC_009023 KO 90.7614 27.5685 1.71906 1.77635 0.0011.sup. 0.034628 yes XLOC_038688 KO 1.03253 0.314697 1.71414 1.96261 0.00135.sup. 0.040437 yes XLOC_040718 KO 3.9144 1.19594 1.71064 3.37438 5.00E05 0.002735 yes XLOC_035875 KO 6.21201 1.89845 1.71024 2.85077 5.00E05 0.002735 yes XLOC_003270 KO 1.09958 0.337027 1.70602 2.10497 0.00055.sup. 0.020318 yes XLOC_005547 KO 8.79043 2.69944 1.70328 2.21258 0.00045.sup. 0.017298 yes XLOC_020764 KO 2.31784 0.7121 1.70263 2.14435 0.0009.sup. 0.029595 yes XLOC_019328 KO 2.87693 0.884168 1.70214 0.95366 0.0006.sup. 0.021697 yes XLOC_039480 KO 26.7 8.297 1.68618 1.86175 0.00135.sup. 0.040437 yes XLOC_004455 KO 3.41227 1.0671 1.67704 3.10681 5.00E05 0.002735 yes XLOC_027332 KO 0.627643 0.196532 1.67518 0.34345 0.0003.sup. 0.012524 yes XLOC_002198 KO 54.2074 17.306 1.64722 2.72479 0.00015.sup. 0.007086 yes XLOC_010645 KO 6.26065 2.00333 1.64391 2.32636 0.00035.sup. 0.014242 yes XLOC_034696 KO 33.0474 10.5767 1.64364 2.52373 5.00E05 0.002735 yes XLOC_000241 KO 42.1639 13.6825 1.62368 4.36818 5.00E05 0.002735 yes XLOC_039386 KO 1.31445 0.426718 1.62311 1.48548 0.00125.sup. 0.038196 yes XLOC_053212 KO 2.708 0.879563 1.62237 2.24753 0.0004.sup. 0.015799 yes XLOC_052663 KO 75.7113 24.5939 1.62221 3.04523 5.00E05 0.002735 yes XLOC_039466 KO 1.02834 0.334353 1.62087 1.83078 0.0008.sup. 0.027077 yes XLOC_017654 KO 15.3727 5.00867 1.61787 2.12866 0.0008.sup. 0.027077 yes XLOC_047223 KO 6.1214 1.99544 1.61716 3.08689 5.00E05 0.002735 yes XLOC_003629 KO 1.71092 0.559275 1.61314 1.05619 0.0004.sup. 0.015799 yes XLOC_010433 KO 3.94169 1.29099 1.61034 2.61798 5.00E05 0.002735 yes XLOC_026186 KO 22.3438 7.3724 1.59967 2.32535 5.00E05 0.002735 yes XLOC_038828 KO 4.99956 1.65319 1.59655 2.2868 0.0002.sup. 0.008981 yes XLOC_006249 KO 0.613709 0.20387 1.58991 1.19609 0.0015.sup. 0.04365 yes XLOC_034292 KO 6.12088 2.03902 1.58586 2.43569 5.00E05 0.002735 yes XLOC_053223 KO 0.421532 0.140638 1.58365 1.75284 0.0003.sup. 0.012524 yes XLOC_011232 KO 1.15015 0.383792 1.58343 1.11315 0.00075.sup. 0.025855 yes XLOC_037288 KO 21.8081 7.35384 1.56829 2.21847 5.00E05 0.002735 yes XLOC_024145 KO 6.99037 2.3635 1.56445 2.28907 5.00E05 0.002735 yes XLOC_037647 KO 5.77732 1.96239 1.55779 2.1471 0.00035.sup. 0.014242 yes XLOC_002435 KO 16.356 5.56534 1.55528 2.33608 0.00055.sup. 0.020318 yes XLOC_007098 KO 8.42084 2.88108 1.54735 3.12138 5.00E05 0.002735 yes XLOC_039218 KO 19.3362 6.63039 1.54413 3.40354 5.00E05 0.002735 yes XLOC_050847 KO 2.35306 0.816701 1.52666 2.35945 5.00E05 0.002735 yes XLOC_049164 KO 9.52422 3.3134 1.52329 2.79672 5.00E05 0.002735 yes XLOC_011248 KO 4.72903 1.66333 1.50747 2.67397 5.00E05 0.002735 yes XLOC_028509 KO 1.22008 0.42977 1.50534 1.74354 0.00105.sup. 0.03336 yes XLOC_038748 KO 3.92563 1.38387 1.50421 2.18318 5.00E05 0.002735 yes XLOC_049806 KO 28.1104 9.91212 1.50384 3.7685 5.00E05 0.002735 yes XLOC_044981 KO 32.1077 11.3848 1.49581 2.92334 5.00E05 0.002735 yes XLOC_034156 KO 24.7366 8.83794 1.48487 3.8475 5.00E05 0.002735 yes XLOC_012486 KO 40.1892 14.3991 1.48083 2.86755 5.00E05 0.002735 yes XLOC_017508 KO 277.888 99.6569 1.47946 2.58013 5.00E05 0.002735 yes XLOC_023287 KO 1.99338 0.722277 1.4646 1.88344 0.00055.sup. 0.020318 yes XLOC_047196 KO 15.1672 5.50184 1.46297 2.86786 5.00E05 0.002735 yes XLOC_028947 KO 0.399154 0.146302 1.448 0.555 5.00E05 0.002735 yes XLOC_015553 KO 3.33689 1.23637 1.43239 1.09507 0.00115.sup. 0.035883 yes XLOC_003678 KO 21.137 7.8397 1.4309 3.52603 5.00E05 0.002735 yes XLOC_031529 KO 5.98448 2.23368 1.4218 3.25278 5.00E05 0.002735 yes XLOC_007421 KO 702.559 262.65 1.41948 3.20587 5.00E05 0.002735 yes XLOC_004771 KO 7.22815 2.71502 1.41266 2.24459 5.00E05 0.002735 yes XLOC_018419 KO 17.409 6.59944 1.39942 1.99618 0.0009.sup. 0.029595 yes XLOC_044600 KO 5.78204 2.20651 1.38981 2.54026 0.0001.sup. 0.005033 yes XLOC_011113 KO 25.1101 9.64113 1.381 2.41814 5.00E05 0.002735 yes XLOC_029655 KO 4.78991 1.83917 1.38095 2.49374 0.0001.sup. 0.005033 yes XLOC_025709 KO 13.0308 5.06852 1.36229 1.76943 0.00135.sup. 0.040437 yes XLOC_035892 KO 39.354 15.3097 1.36207 2.18675 0.0002.sup. 0.008981 yes XLOC_045084 KO 0.795032 0.309744 1.35994 1.42356 0.00115.sup. 0.035883 yes XLOC_054143 KO 8.72867 3.40655 1.35745 1.72119 0.0006.sup. 0.021697 yes XLOC_008272 KO 9.15741 3.5804 1.35482 1.78976 0.00125.sup. 0.038196 yes XLOC_044991 KO 3.98056 1.56136 1.35017 2.71689 5.00E05 0.002735 yes XLOC_054197 KO 5.55527 2.18751 1.34457 1.67642 0.00135.sup. 0.040437 yes XLOC_042802 KO 2.52107 0.995187 1.341 1.98022 0.0016.sup. 0.045919 yes XLOC_001178 KO 52.9734 20.9307 1.33964 2.76855 5.00E05 0.002735 yes XLOC_048061 KO 2.59948 1.0275 1.33909 1.87764 0.00105.sup. 0.03336 yes XLOC_049026 KO 123.358 48.8704 1.33582 4.20545 5.00E05 0.002735 yes XLOC_049157 KO 20.144 8.00261 1.33181 3.63713 5.00E05 0.002735 yes XLOC_016660 KO 12.3705 4.91447 1.33179 2.08266 0.0016.sup. 0.045919 yes XLOC_034147 KO 12.1316 4.83047 1.32853 1.81676 5.00E05 0.002735 yes XLOC_030666 KO 7.54085 3.01214 1.32394 2.44532 5.00E05 0.002735 yes XLOC_006553 KO 23.2596 9.34184 1.31605 1.6284 5.00E05 0.002735 yes XLOC_028877 KO 97.1879 39.2029 1.30982 3.05022 5.00E05 0.002735 yes XLOC_043536 KO 84.4552 34.1251 1.30735 3.84165 5.00E05 0.002735 yes XLOC_036181 KO 152.224 61.7318 1.30211 1.98636 0.00085.sup. 0.028328 yes XLOC_001874 KO 39.7368 16.1837 1.29594 3.42486 5.00E05 0.002735 yes XLOC_048183 KO 19.7062 8.03804 1.29373 2.03513 0.0012.sup. 0.037051 yes XLOC_048884 KO 27.9196 11.45 1.28593 3.24215 5.00E05 0.002735 yes XLOC_027617 KO 26.4953 10.8795 1.28412 3.31733 5.00E05 0.002735 yes XLOC_007792 KO 3.58211 1.47581 1.27931 2.14108 0.00035.sup. 0.014242 yes XLOC_006019 KO 121.709 50.3282 1.27399 3.67188 5.00E05 0.002735 yes XLOC_024146 KO 31.1534 12.9193 1.26986 3.78622 5.00E05 0.002735 yes XLOC_011021 KO 22.3665 9.36143 1.25654 2.03252 0.0007.sup. 0.02448 yes XLOC_048829 KO 6.82158 2.85779 1.25521 1.90499 5.00E05 0.002735 yes XLOC_014133 KO 101.751 42.8844 1.24651 3.93452 5.00E05 0.002735 yes XLOC_000084 KO 3.59607 1.52059 1.24179 2.07865 0.00045.sup. 0.017298 yes XLOC_005777 KO 3.08606 1.31263 1.23331 2.03421 5.00E05 0.002735 yes XLOC_023843 KO 4.09666 1.74661 1.22989 2.10578 0.0002.sup. 0.008981 yes XLOC_040879 KO 123.201 52.6185 1.22737 1.9734 0.00145.sup. 0.042686 yes XLOC_031878 KO 7.10173 3.07214 1.20893 2.55301 5.00E05 0.002735 yes XLOC_046371 KO 6.46922 2.80543 1.20537 2.12413 0.00095.sup. 0.030847 yes XLOC_013777 KO 41.4369 18.0507 1.19886 3.37099 5.00E05 0.002735 yes XLOC_025056 KO 4.86512 2.12005 1.19838 1.9063 0.00025.sup. 0.010784 yes XLOC_026645 KO 9.13983 4.00573 1.1901 1.83082 0.00015.sup. 0.007086 yes XLOC_038883 KO 15.0737 6.61438 1.18835 1.48691 0.0004.sup. 0.015799 yes XLOC_040599 KO 40.6696 17.8712 1.18631 1.4713 0.0007.sup. 0.02448 yes XLOC_036879 KO 134.611 59.2836 1.18309 2.1043 5.00E05 0.002735 yes XLOC_053052 KO 3.75209 1.66264 1.17422 1.94954 0.0012.sup. 0.037051 yes XLOC_004061 KO 91.66 40.6803 1.17196 2.84108 5.00E05 0.002735 yes XLOC_010923 KO 163.728 72.7628 1.17003 3.60833 5.00E05 0.002735 yes XLOC_051104 KO 89.957 39.981 1.16992 3.55585 5.00E05 0.002735 yes XLOC_000284 KO 35.0271 15.6015 1.16678 3.30325 5.00E05 0.002735 yes XLOC_006336 KO 1.56767 0.698831 1.1656 1.99677 0.00055.sup. 0.020318 yes XLOC_004451 KO 26.8217 11.9663 1.16443 3.43778 5.00E05 0.002735 yes XLOC_023416 KO 51.2899 22.9943 1.1574 1.50185 0.00015.sup. 0.007086 yes XLOC_039312 KO 127.457 57.2095 1.15569 2.23865 5.00E05 0.002735 yes XLOC_004870 KO 20.632 9.26229 1.15544 2.53388 5.00E05 0.002735 yes XLOC_028224 KO 9.17595 4.13915 1.14852 1.87923 0.00105.sup. 0.03336 yes XLOC_005776 KO 14.7848 6.68067 1.14605 2.62459 5.00E05 0.002735 yes XLOC_042028 KO 81.7624 37.1264 1.13899 1.92487 0.0008.sup. 0.027077 yes XLOC_003817 KO 11.6577 5.31277 1.13375 2.00654 0.001.sup. 0.032108 yes XLOC_044280 KO 2.34947 1.07655 1.12592 1.85318 0.0013.sup. 0.039328 yes XLOC_054067 KO 40.5625 18.5979 1.12501 3.19935 5.00E05 0.002735 yes XLOC_002921 KO 377.689 173.286 1.12405 3.56475 5.00E05 0.002735 yes XLOC_003395 KO 10.5582 4.86568 1.11764 2.49284 5.00E05 0.002735 yes XLOC_022130 KO 22.7403 10.5049 1.11419 1.42844 0.00095.sup. 0.030847 yes XLOC_051379 KO 59.0964 27.3081 1.11374 1.98619 0.00065.sup. 0.023143 yes XLOC_009139 KO 25.6311 11.8619 1.11156 2.66798 5.00E05 0.002735 yes XLOC_042929 KO 10.4828 4.85999 1.109 2.4495 5.00E05 0.002735 yes XLOC_003035 KO 44.5938 20.6895 1.10795 2.27019 0.00045.sup. 0.017298 yes XLOC_009886 KO 5.02865 2.33572 1.1063 1.79174 0.0008.sup. 0.027077 yes XLOC_031273 KO 14.8531 6.91336 1.1033 1.8769 0.00105.sup. 0.03336 yes XLOC_027092 KO 376.484 175.249 1.10318 3.02031 5.00E05 0.002735 yes XLOC_007077 KO 1.72936 0.805994 1.10139 1.28393 0.00175.sup. 0.049136 yes XLOC_007101 KO 157.757 73.5517 1.10088 2.99542 5.00E05 0.002735 yes XLOC_006989 KO 7.73359 3.61451 1.09734 1.93991 0.00025.sup. 0.010784 yes XLOC_011223 KO 3.37324 1.58056 1.0937 1.74645 0.00085.sup. 0.028328 yes XLOC_036975 KO 6.92999 3.2504 1.09223 2.08058 0.0005.sup. 0.018851 yes XLOC_028204 KO 0.930909 0.437129 1.09058 0.45143 5.00E05 0.002735 yes XLOC_048252 KO 8.3951 3.95905 1.08439 1.84487 0.00105.sup. 0.03336 yes XLOC_001688 KO 5.3835 2.53907 1.08424 1.69198 0.00175.sup. 0.049136 yes XLOC_044959 KO 16.7948 7.93382 1.08193 2.00541 0.0013.sup. 0.039328 yes XLOC_006957 KO 11.3322 5.41898 1.06433 1.91703 0.00015.sup. 0.007086 yes XLOC_040308 KO 82.1743 39.5718 1.05421 2.18327 5.00E05 0.002735 yes XLOC_040646 KO 30.0811 14.5089 1.05192 2.8137 5.00E05 0.002735 yes XLOC_048007 KO 8.77985 4.28762 1.03402 2.01858 0.00045.sup. 0.017298 yes XLOC_012876 KO 6.96702 3.42746 1.0234 2.53986 5.00E05 0.002735 yes XLOC_037005 KO 38.8983 19.1366 1.02338 2.09803 0.0002.sup. 0.008981 yes XLOC_039416 KO 29.6293 14.6233 1.01876 1.8837 0.00105.sup. 0.03336 yes XLOC_031885 KO 13.5965 6.73801 1.01284 2.48442 5.00E05 0.002735 yes XLOC_025480 KO 13.1484 6.54108 1.00729 2.54596 5.00E05 0.002735 yes XLOC_053141 KO 28.449 14.1725 1.00528 2.4841 5.00E05 0.002735 yes XLOC_011663 KO 294.908 147.174 1.00274 2.00927 5.00E05 0.002735 yes XLOC_015234 KO 3.80952 7.61908 1.00001 2.61342 5.00E05 0.002735 yes XLOC_011044 KO 7.2878 14.6238 1.00476 2.36644 5.00E05 0.002735 yes XLOC_052987 KO 9.87566 19.8785 1.00926 2.6223 5.00E05 0.002735 yes XLOC_052880 KO 53.456 107.661 1.01007 2.43261 5.00E05 0.002735 yes XLOC_038761 KO 43.8994 88.5581 1.01242 3.21263 5.00E05 0.002735 yes XLOC_026220 KO 77.868 157.543 1.01664 3.04357 5.00E05 0.002735 yes XLOC_023877 KO 4.40171 8.90632 1.01676 2.05122 0.0002.sup. 0.008981 yes XLOC_024463 KO 79.5062 161.005 1.01797 2.06394 0.00025.sup. 0.010784 yes XLOC_054058 KO 24.2914 49.2951 1.021 2.68099 5.00E05 0.002735 yes XLOC_054039 KO 10.9677 22.2842 1.02276 2.39519 5.00E05 0.002735 yes XLOC_020149 KO 6.36915 12.9446 1.02318 2.08145 0.0003.sup. 0.012524 yes XLOC_000135 KO 13.7324 28.0606 1.03096 2.04272 5.00E05 0.002735 yes XLOC_034496 KO 84.6598 173.288 1.03342 2.8 5.00E05 0.002735 yes XLOC_030700 KO 14.7909 30.3244 1.03576 3.00311 5.00E05 0.002735 yes XLOC_021959 KO 6.15215 12.7215 1.04811 2.70824 5.00E05 0.002735 yes XLOC_053962 KO 6.1006 12.6485 1.05195 2.71416 5.00E05 0.002735 yes XLOC_036851 KO 20.7169 42.9678 1.05244 1.73382 0.0014.sup. 0.041595 yes XLOC_007351 KO 8.47914 17.6812 1.06022 1.99481 0.0007.sup. 0.02448 yes XLOC_030393 KO 50.5917 105.751 1.06369 2.05265 0.0007.sup. 0.02448 yes XLOC_045032 KO 19.1913 40.1185 1.06382 1.74262 0.0002.sup. 0.008981 yes XLOC_008588 KO 33.7648 70.6238 1.06463 1.93305 0.00165.sup. 0.0471 yes XLOC_048193 KO 66.2249 138.784 1.0674 2.68073 5.00E05 0.002735 yes XLOC_053815 KO 10.0667 21.1455 1.07076 2.49548 5.00E05 0.002735 yes XLOC_040597 KO 8.1276 17.0871 1.07201 2.16635 0.0004.sup. 0.015799 yes XLOC_031446 KO 168.214 356.35 1.083 3.26649 5.00E05 0.002735 yes XLOC_001360 KO 4.28137 9.08067 1.08473 1.89544 0.00155.sup. 0.04486 yes XLOC_053006 KO 3.03606 6.44019 1.0849 2.27783 0.00025.sup. 0.010784 yes XLOC_035138 KO 12.6386 26.8364 1.08635 2.73585 5.00E05 0.002735 yes XLOC_035718 KO 2.52965 5.39302 1.09216 1.9143 0.00165.sup. 0.0471 yes XLOC_041572 KO 65.2856 139.324 1.09361 2.67672 5.00E05 0.002735 yes XLOC_053840 KO 47.033 100.451 1.09474 3.47853 5.00E05 0.002735 yes XLOC_052847 KO 20.2869 43.5028 1.10056 3.12745 5.00E05 0.002735 yes XLOC_024713 KO 30.1247 64.6101 1.10081 2.33619 5.00E05 0.002735 yes XLOC_050476 KO 21.0177 45.6355 1.11855 2.10784 0.0008.sup. 0.027077 yes XLOC_051615 KO 6.56452 14.306 1.12385 2.71612 5.00E05 0.002735 yes XLOC_038678 KO 2.02673 4.45669 1.13682 2.13386 0.0002.sup. 0.008981 yes XLOC_043700 KO 8.87916 19.5925 1.14181 1.89003 0.0014.sup. 0.041595 yes XLOC_008078 KO 7.45577 16.493 1.14542 2.19163 0.00025.sup. 0.010784 yes XLOC_046906 KO 58.8022 130.083 1.14549 2.04206 0.0006.sup. 0.021697 yes XLOC_002145 KO 3.13504 6.96175 1.15097 1.63792 0.0002.sup. 0.008981 yes XLOC_005982 KO 28.6082 63.6617 1.154 2.09932 0.0004.sup. 0.015799 yes XLOC_002143 KO 2.06928 4.6169 1.15779 1.48046 0.0017.sup. 0.048164 yes XLOC_004604 KO 30.2858 67.6373 1.15918 1.96696 0.0005.sup. 0.018851 yes XLOC_023130 KO 3.56065 7.96616 1.16174 2.18367 0.0003.sup. 0.012524 yes XLOC_053821 KO 23.8599 53.5873 1.1673 2.89986 5.00E05 0.002735 yes XLOC_000957 KO 26.5108 60.2415 1.18418 3.04613 5.00E05 0.002735 yes XLOC_045574 KO 2.62606 5.99118 1.18994 2.41286 0.00015.sup. 0.007086 yes XLOC_052690 KO 1.16105 2.6545 1.19301 2.30912 5.00E05 0.002735 yes XLOC_052629 KO 16.2352 37.1548 1.19443 2.78829 5.00E05 0.002735 yes XLOC_046843 KO 8.23671 18.9484 1.20194 2.51911 5.00E05 0.002735 yes XLOC_052878 KO 11.5599 26.5993 1.20225 2.78574 5.00E05 0.002735 yes XLOC_025629 KO 3.30936 7.64425 1.20782 2.5271 5.00E05 0.002735 yes XLOC_042340 KO 12.8215 29.6412 1.20904 2.2655 0.0002.sup. 0.008981 yes XLOC_028258 KO 1.74141 4.06742 1.22386 2.15101 0.00025.sup. 0.010784 yes XLOC_036012 KO 27.5439 64.6672 1.2313 2.76425 5.00E05 0.002735 yes XLOC_002280 KO 2.97165 7.03531 1.24335 2.68067 5.00E05 0.002735 yes XLOC_054123 KO 60.1616 142.873 1.24782 1.29666 0.00045.sup. 0.017298 yes XLOC_045653 KO 5.68015 13.5794 1.25742 3.00513 5.00E05 0.002735 yes XLOC_047007 KO 15.6805 37.6073 1.26204 2.4299 0.0001.sup. 0.005033 yes XLOC_042338 KO 4.7777 11.4744 1.26403 2.42558 0.0001.sup. 0.005033 yes XLOC_054062 KO 8.26034 19.9021 1.26865 3.23466 5.00E05 0.002735 yes XLOC_031168 KO 163.23 394.018 1.27135 3.37261 5.00E05 0.002735 yes XLOC_049732 KO 4.9283 11.9161 1.27375 1.83503 0.001.sup. 0.032108 yes XLOC_046218 KO 28.7723 70.2028 1.28685 3.11403 5.00E05 0.002735 yes XLOC_040610 KO 1.33467 3.2699 1.29277 1.96742 0.0015.sup. 0.04365 yes XLOC_044277 KO 14.4832 35.5543 1.29564 2.82827 0.00025.sup. 0.010784 yes XLOC_005833 KO 105.68 259.486 1.29595 3.98504 5.00E05 0.002735 yes XLOC_033519 KO 78.9043 194.284 1.29999 3.88223 5.00E05 0.002735 yes XLOC_036029 KO 9.69148 23.8698 1.3004 3.28336 5.00E05 0.002735 yes XLOC_032423 KO 14.9163 36.7415 1.30052 2.5059 5.00E05 0.002735 yes XLOC_052071 KO 69.8407 172.894 1.30775 3.9905 5.00E05 0.002735 yes XLOC_048551 KO 2.02625 5.02466 1.31022 1.76829 0.00075.sup. 0.025855 yes XLOC_007003 KO 6.43813 16.1089 1.32315 2.7716 5.00E05 0.002735 yes XLOC_030738 KO 7.51868 18.9446 1.33324 2.26785 0.0002.sup. 0.008981 yes XLOC_026026 KO 1.12693 2.8411 1.33405 2.47726 5.00E05 0.002735 yes XLOC_017540 KO 4.07318 10.2764 1.33511 1.99525 5.00E05 0.002735 yes XLOC_033561 KO 15.1967 38.3805 1.33661 3.51652 5.00E05 0.002735 yes XLOC_030077 KO 1.26723 3.21085 1.34128 1.98788 0.00075.sup. 0.025855 yes XLOC_010023 KO 5.90104 14.9581 1.34189 1.96949 0.0008.sup. 0.027077 yes XLOC_048928 KO 9.36661 23.7803 1.34417 3.90375 5.00E05 0.002735 yes XLOC_048992 KO 19.9381 50.9025 1.35221 3.17818 5.00E05 0.002735 yes XLOC_005542 KO 38.5425 99.5566 1.36907 3.29681 5.00E05 0.002735 yes XLOC_054006 KO 13.1477 34.0304 1.37201 2.67697 5.00E05 0.002735 yes XLOC_038088 KO 100.459 260.341 1.3738 2.8337 5.00E05 0.002735 yes XLOC_026199 KO 28.9917 75.2681 1.3764 3.22416 5.00E05 0.002735 yes XLOC_009683 KO 2.68748 7.01635 1.38447 2.97624 5.00E05 0.002735 yes XLOC_054131 KO 13.1878 34.4304 1.38448 2.66963 5.00E05 0.002735 yes XLOC_032441 KO 2.91575 7.63418 1.3886 2.64816 5.00E05 0.002735 yes XLOC_003976 KO 8.08992 21.2254 1.3916 3.21685 5.00E05 0.002735 yes XLOC_053841 KO 13.3611 35.5581 1.41214 3.06779 5.00E05 0.002735 yes XLOC_005843 KO 4.53894 12.1011 1.41472 1.9081 0.0005.sup. 0.018851 yes XLOC_012477 KO 42.4195 114.119 1.42775 3.06511 5.00E05 0.002735 yes XLOC_014816 KO 18.3529 49.6401 1.4355 2.11039 0.00055.sup. 0.020318 yes XLOC_040656 KO 0.940972 2.54538 1.43566 2.42751 5.00E05 0.002735 yes XLOC_006803 KO 53.9582 146.698 1.44293 4.46487 5.00E05 0.002735 yes XLOC_052691 KO 185.928 505.565 1.44316 3.8742 5.00E05 0.002735 yes XLOC_005775 KO 78.0884 213.469 1.45085 3.08272 5.00E05 0.002735 yes XLOC_052372 KO 24.2723 66.7327 1.45908 4.07862 5.00E05 0.002735 yes XLOC_000088 KO 6.78636 18.7682 1.46758 2.41851 0.0001.sup. 0.005033 yes XLOC_024612 KO 1.63477 4.58554 1.488 2.15573 0.00055.sup. 0.020318 yes XLOC_026219 KO 0.943851 2.64789 1.48821 2.06279 5.00E05 0.002735 yes XLOC_053827 KO 115.952 325.692 1.48998 3.69007 5.00E05 0.002735 yes XLOC_053972 KO 5.57773 15.6749 1.4907 2.85032 5.00E05 0.002735 yes XLOC_013498 KO 0.361074 1.02785 1.50926 1.3166 0.0014.sup. 0.041595 yes XLOC_031173 KO 11.9603 34.1916 1.5154 3.90307 5.00E05 0.002735 yes XLOC_052853 KO 2.90881 8.48748 1.54491 2.54431 0.0002.sup. 0.008981 yes XLOC_043236 KO 8.31831 24.4362 1.55466 2.93167 5.00E05 0.002735 yes XLOC_046163 KO 1.37258 4.0381 1.55679 2.26618 0.0001.sup. 0.005033 yes XLOC_053995 KO 364.416 1074.34 1.55979 3.77603 5.00E05 0.002735 yes XLOC_016656 KO 0.172902 0.510356 1.56155 1.16971 0.00165.sup. 0.0471 yes XLOC_035032 KO 36.1819 107.377 1.56935 4.68112 5.00E05 0.002735 yes XLOC_007911 KO 0.421347 1.26254 1.58325 2.00489 0.00145.sup. 0.042686 yes XLOC_009044 KO 1.81447 5.52823 1.60727 1.99538 0.00045.sup. 0.017298 yes XLOC_025875 KO 6.9918 21.3048 1.60744 2.63403 5.00E05 0.002735 yes XLOC_051389 KO 2.8445 8.68041 1.60959 2.37565 5.00E05 0.002735 yes XLOC_028631 KO 0.366398 1.13674 1.63342 1.7807 5.00E05 0.002735 yes XLOC_035814 KO 2.43234 7.56835 1.63763 2.06284 0.0007.sup. 0.02448 yes XLOC_028335 KO 2.97422 9.49043 1.67396 2.44973 5.00E05 0.002735 yes XLOC_042640 KO 26.1336 83.71 1.67949 3.34677 5.00E05 0.002735 yes XLOC_037275 KO 1.02775 3.30235 1.68401 1.63491 5.00E05 0.002735 yes XLOC_022915 KO 1.5145 4.91028 1.69696 2.60539 0.0001.sup. 0.005033 yes XLOC_014449 KO 0.387198 1.26125 1.70372 1.50627 0.00095.sup. 0.030847 yes XLOC_006704 KO 0.603357 1.97094 1.7078 1.64241 0.0002.sup. 0.008981 yes XLOC_004924 KO 3.31154 10.9328 1.72309 3.11148 5.00E05 0.002735 yes XLOC_032387 KO 3.99715 13.2296 1.72673 2.84469 5.00E05 0.002735 yes XLOC_017398 KO 0.259344 0.860178 1.72977 1.15779 0.0002.sup. 0.008981 yes XLOC_052195 KO 2.9645 9.85161 1.73257 2.35485 0.0001.sup. 0.005033 yes XLOC_037118 KO 17.9792 60.0782 1.74051 2.03774 0.00125.sup. 0.038196 yes XLOC_053014 KO 3.34332 11.2148 1.74605 3.38868 5.00E05 0.002735 yes XLOC_015083 KO 0.676862 2.29222 1.75981 0.614236 5.00E05 0.002735 yes XLOC_022019 KO 0.470582 1.59924 1.76487 1.58847 0.00025.sup. 0.010784 yes XLOC_051724 KO 1.42107 4.86941 1.77677 2.87987 5.00E05 0.002735 yes XLOC_000121 KO 0.241846 0.840111 1.79649 1.25909 0.0017.sup. 0.048164 yes XLOC_000327 KO 0.242484 0.848684 1.80734 2.1924 0.0005.sup. 0.018851 yes XLOC_039801 KO 0.598491 2.09971 1.81079 2.51873 5.00E05 0.002735 yes XLOC_045580 KO 185.166 651.936 1.81591 3.07949 5.00E05 0.002735 yes XLOC_014868 KO 0.621126 2.2059 1.82841 2.50044 0.0001.sup. 0.005033 yes XLOC_014085 KO 0.180093 0.658612 1.87069 2.0777 0.00075.sup. 0.025855 yes XLOC_023568 KO 7.63411 28.1995 1.88514 2.84838 5.00E05 0.002735 yes XLOC_037820 KO 12.3395 45.6047 1.8859 4.08253 5.00E05 0.002735 yes XLOC_025948 KO 2.21661 8.34637 1.91279 2.4035 0.00065.sup. 0.023143 yes XLOC_016521 KO 0.257452 0.971515 1.91593 2.09525 0.0005.sup. 0.018851 yes XLOC_037153 KO 0.413618 1.57214 1.92636 1.28723 0.00065.sup. 0.023143 yes XLOC_034645 KO 0.5919 2.26873 1.93846 2.36179 0.00025.sup. 0.010784 yes XLOC_037405 KO 0.929399 3.59335 1.95096 2.16965 0.0013.sup. 0.039328 yes XLOC_045797 KO 68.7105 265.92 1.95239 3.58335 5.00E05 0.002735 yes XLOC_004325 KO 0.499493 1.93738 1.95557 1.51517 0.0011.sup. 0.034628 yes XLOC_051882 KO 0.126278 0.502587 1.99277 0.782285 5.00E05 0.002735 yes XLOC_017869 KO 0.241538 0.971756 2.00834 1.17849 0.0009.sup. 0.029595 yes XLOC_030369 KO 17.9991 72.8577 2.01716 5.9886 5.00E05 0.002735 yes XLOC_047511 KO 0.121904 0.511871 2.07003 1.8145 0.0002.sup. 0.008981 yes XLOC_046984 KO 0.497986 2.10412 2.07904 2.40101 5.00E05 0.002735 yes XLOC_007385 KO 9.19124 38.9163 2.08204 5.8176 5.00E05 0.002735 yes XLOC_025926 KO 0.739075 3.17893 2.10475 1.96094 0.0005.sup. 0.018851 yes XLOC_040637 KO 0.204073 0.885306 2.11709 2.3131 0.00015.sup. 0.007086 yes XLOC_012724 KO 0.58584 2.60382 2.15205 1.90326 0.0002.sup. 0.008981 yes XLOC_006913 KO 12.0212 54.4459 2.17925 4.21676 5.00E05 0.002735 yes XLOC_049314 KO 2.44012 11.0794 2.18285 1.90716 5.00E05 0.002735 yes XLOC_016027 KO 0.454901 2.06575 2.18304 2.84692 5.00E05 0.002735 yes XLOC_015082 KO 238.716 1086.07 2.18575 5.44884 5.00E05 0.002735 yes XLOC_015979 KO 2.06358 9.42343 2.1911 3.30441 5.00E05 0.002735 yes XLOC_024337 KO 5.27805 24.8236 2.23363 2.72284 5.00E05 0.002735 yes XLOC_035303 KO 0.553078 2.62482 2.24667 2.66454 5.00E05 0.002735 yes XLOC_003362 KO 1.26564 6.07502 2.26302 3.30599 5.00E05 0.002735 yes XLOC_032392 KO 3.34231 17.0188 2.34822 4.7306 5.00E05 0.002735 yes XLOC_052942 KO 3.87359 19.8155 2.35489 3.39603 5.00E05 0.002735 yes XLOC_036567 KO 0.663086 3.42892 2.37049 2.09127 0.00015.sup. 0.007086 yes XLOC_045798 KO 0.179411 0.9302 2.37427 0.396793 0.00085.sup. 0.028328 yes XLOC_047230 KO 3.2521 17.7581 2.44903 3.67184 5.00E05 0.002735 yes XLOC_052560 KO 1.40902 7.70056 2.45027 3.91713 5.00E05 0.002735 yes XLOC_003458 KO 0.123397 0.675328 2.45229 2.68551 5.00E05 0.002735 yes XLOC_034204 KO 0.145277 0.797188 2.45612 1.49544 0.0001.sup. 0.005033 yes XLOC_049383 KO 4.19774 23.1397 2.46269 3.89288 5.00E05 0.002735 yes XLOC_005163 KO 0.301241 1.6736 2.47396 3.15373 5.00E05 0.002735 yes XLOC_054060 KO 0.157586 0.883085 2.48641 2.27535 5.00E05 0.002735 yes XLOC_049559 KO 0.166759 0.954374 2.51679 2.98061 0.0001.sup. 0.005033 yes XLOC_022729 KO 2.51482 14.8367 2.56064 4.00418 5.00E05 0.002735 yes XLOC_023335 KO 0.660718 3.9099 2.56502 2.62295 5.00E05 0.002735 yes XLOC_043927 KO 0.348939 2.10265 2.59117 1.61414 5.00E05 0.002735 yes XLOC_028901 KO 0.205164 1.24854 2.60539 2.73024 0.00015.sup. 0.007086 yes XLOC_021584 KO 1.41437 8.61438 2.60659 3.66797 5.00E05 0.002735 yes XLOC_031893 KO 0.272375 1.65949 2.60707 2.44215 5.00E05 0.002735 yes XLOC_047531 KO 0.221946 1.40983 2.66724 1.58133 5.00E05 0.002735 yes XLOC_030352 KO 14.4202 92.1945 2.67659 4.82284 5.00E05 0.002735 yes XLOC_047205 KO 43.9565 282.345 2.68331 5.56708 5.00E05 0.002735 yes XLOC_037406 KO 1.56496 10.16 2.6987 3.4056 5.00E05 0.002735 yes XLOC_036569 KO 5.60152 37.6157 2.74744 5.87658 5.00E05 0.002735 yes XLOC_024906 KO 10.0921 70.4324 2.80301 3.39614 5.00E05 0.002735 yes XLOC_027347 KO 0.059214 0.416652 2.81484 0.191488 5.00E05 0.002735 yes XLOC_000114 KO 0.089288 0.631005 2.82112 0.337765 0.0017.sup. 0.048164 yes XLOC_013839 KO 0.144764 1.09159 2.91466 4.01475 5.00E05 0.002735 yes XLOC_001202 KO 1.04701 8.04572 2.94194 4.55678 5.00E05 0.002735 yes XLOC_049751 KO 1.69057 13.5802 3.00593 1.59705 0.00065.sup. 0.023143 yes XLOC_050257 KO 0.049111 0.410124 3.06195 1.31082 5.00E05 0.002735 yes XLOC_026965 KO 0.177762 1.52343 3.0993 2.70468 0.0003.sup. 0.012524 yes XLOC_051526 KO 0.507191 4.73696 3.22336 2.5458 5.00E05 0.002735 yes XLOC_025815 KO 0.102352 0.990864 3.27514 1.26515 0.0002.sup. 0.008981 yes XLOC_000992 KO 0.209731 2.03568 3.2789 3.16275 5.00E05 0.002735 yes XLOC_017767 KO 1.05023 10.519 3.32422 2.84592 5.00E05 0.002735 yes XLOC_017689 KO 0.888696 9.33779 3.39332 3.92041 5.00E05 0.002735 yes XLOC_014541 KO 0.110567 1.20961 3.45154 3.44299 5.00E05 0.002735 yes XLOC_035850 KO 0.054407 0.674055 3.631 1.00843 0.00135.sup. 0.040437 yes XLOC_022342 KO 25.8899 327.557 3.66129 9.12956 5.00E05 0.002735 yes XLOC_015003 KO 0.390992 4.94855 3.66179 2.8336 5.00E05 0.002735 yes XLOC_036088 KO 0.189807 2.75838 3.86122 3.81947 5.00E05 0.002735 yes XLOC_054232 KO 0.036869 0.594302 4.01071 2.84046 5.00E05 0.002735 yes XLOC_047719 KO 0.806157 13.073 4.01938 5.27775 5.00E05 0.002735 yes XLOC_053187 KO 10.1426 229.041 4.4971 8.80028 5.00E05 0.002735 yes XLOC_052734 KO 1.28598 36.491 4.8266 9.40326 5.00E05 0.002735 yes XLOC_030000 KO 0.052009 6.94072 7.06019 1.201 0.00025.sup. 0.010784 yes XLOC_025431 KO 0 0.934836 inf #NAME? 0.00075.sup. 0.025855 yes XLOC_036777 KO 0 0.332679 inf #NAME? 0.0008.sup. 0.027077 yes XLOC_027001 KO 0.354255 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_025714 KO 0.776716 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_045348 KO 1.04504 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_006399 KO 2.05138 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_050265 KO 0.40988 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_032449 KO 0.705069 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_051343 KO 0.255896 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_031712 KO 0.399756 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_033655 KO 1.1969 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_010032 KO 0.288388 0 #NAME? #NAME? 0.0001.sup. 0.005033 yes XLOC_050737 KO 0.593515 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_049474 KO 0.308428 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_053524 KO 0.340771 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_027708 KO 0.56401 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_040716 KO 0.455888 0 #NAME? #NAME? 5.00E05 0.002735 yes XLOC_031042 KO 0.539013 0 #NAME? #NAME? 0.00075.sup. 0.025855 yes XLOC_050453 KO 0.475329 0 #NAME? #NAME? 0.0001.sup. 0.005033 yes XLOC_024731 KO 2.7551 0 #NAME? #NAME? 5.00E05 0.002735 yes

    TABLE-US-00004 SUPPLEMENTARY TABLE 1.B PAX6DKO VS WT tracking_id gene WT_1 WT_0 WT_2 DKO_0 DKO_1 DKO_2 gene XLOC_027099 IAH1 6.35612 26.3106 8.48768 0.018812 0.113338 0 IAH1 XLOC_044162 AL021368.4, 2.2691 3.09331 8.54334 0 0.065594 0 AL021368.4, GUSBP4, GUSBP4, LINC00680 LINC00680 XLOC_033655 PRODH 0 0 3.55524 0 0 0.017005 PRODH XLOC_014867 VSX2 24.0414 42.2013 44.5609 0.436724 0.009159 0.15957 VSX2 XLOC_049453 NIPAL2, 0.540427 1.67815 169.136 0.418319 1.11934 0.338185 NIPAL2, RNU6-914P RNU6-914P XLOC_028271 DAPL1, 77.5916 125.672 120.717 3.67888 0.989218 1.47695 DAPL1, OR7E28P, OR7E28P, OR7E89P OR7E89P XLOC_039936 BHMT 37.3323 111.92 120.503 1.69085 1.44365 2.45093 BHMT XLOC_000776 FOXE3 14.8087 39.8849 41.069 0.631188 0.619772 1.46708 FOXE3 XLOC_044161 AL021368.2 0.709032 0.298226 0.769589 0.009649 0.01983 0.02273 AL021368.2 XLOC_012702 TBX5 1.94744 0.731017 5.94325 0.014702 0.015108 0.253743 TBX5 XLOC_002160 C1orf186 0.63685 6.86482 5.34159 0.10146 0.342507 0.0258 C1orf186 XLOC_012591 PAH 0.066411 1.6998 3.42992 0.110606 0.006534 0.105655 PAH XLOC_009482 CTSF 2.91724 14.9852 7.31819 0.015297 0.584739 0.574229 CTSF XLOC_002728 MIR34A, 1.4038 120.464 2.53687 1.97198 1.36587 2.79904 MIR34A, MIR34AHG MIR34AHG XLOC_027566 ATP6V1B1 4.78079 11.3255 5.64947 0.65953 0.139568 0.343879 ATP6V1B1 XLOC_025026 ZNF726, 1.61892 1.56815 0.946504 0.077959 0.068264 0.073718 ZNF726, ZNF92P3 ZNF92P3 XLOC_018597 CLEC19A 23.9987 10.9556 18.88 0.86652 0.875949 1.17152 CLEC19A XLOC_036565 CP 6.26707 50.9784 42.8121 1.08762 0.47466 4.23101 CP XLOC_040762 AC138035.1 0.275702 4.87749 0.33735 0.148363 0.065456 0.10979 AC138035.1 XLOC_006922 PITX3 1.52713 5.05783 6.0417 0.203747 0.173092 0.377088 PITX3 XLOC_033225 CRYBB3 1.85882 7.03654 4.079 0.227666 0.233945 0.32182 CRYBB3 XLOC_002465 KMO 5.58462 16.448 13.9268 1.0157 0.515373 0.796776 KMO XLOC_048453 ZNF572 0.412887 0.750842 0.300014 0.024293 0.041605 0.053412 ZNF572 XLOC_005226 GAD2 0.329415 1.20134 1.25571 0.113463 0.013539 0.108748 GAD2 XLOC_019871 EIF3CL 2.88923 0.208908 0.197669 0.087299 0.080736 0.115168 EIF3CL XLOC_030539 FZD5 6.3426 16.7834 14.869 1.75585 0.902139 0.784099 FZD5 XLOC_041832 PPP2R2B, 370.411 12.3097 10.1457 12.964 12.9812 10.2564 PPP2R2B, RNA5SP196 RNA5SP196 XLOC_024322 RAX 9.60122 8.87129 16.2795 0.827653 1.63647 0.855323 RAX XLOC_030921 LAMP5 3.28604 11.1172 8.30284 0.678143 0.739653 0.765154 LAMP5 XLOC_008341 CNTN5 2.87317 6.12486 6.60276 0.887016 0.287429 0.337658 CNTN5 XLOC_038319 HMX1 2.73849 4.31346 5.84262 0.235902 0.27271 0.75775 HMX1 XLOC_041731 SPOCK1 145.596 162.91 145.988 15.7719 13.4086 15.6346 SPOCK1 XLOC_009925 CRYAB 366.654 1347.99 1734.04 124.208 103.316 125.801 CRYAB XLOC_048642 CSMD1 17.263 0.301447 0.798707 0.47554 1.03686 0.37402 CSMD1 XLOC_001908 PAPPA2 11.3668 17.3899 23.9001 1.75662 2.06159 1.907 PAPPA2 XLOC_034205 HRH1 0.728556 2.35439 2.62183 0.134182 0.204387 0.299929 HRH1 XLOC_010676 GPD1 1.08232 1.40149 1.99675 0.172709 0.11047 0.227419 GPD1 XLOC_031377 APCDD1L-AS1 1.25226 2.13926 1.38036 0.139581 0.434297 0.022103 APCDD1L-AS1 XLOC_038358 NKX3-2 1.22611 0.343896 1.52837 0.057486 0.206751 0.14445 NKX3-2 XLOC_027565 VAX2 1.61982 2.62167 1.2574 0.318721 0.109171 0.350383 VAX2 XLOC_051344 ALDH1A1 268.278 337.186 344.585 45.5472 35.4898 55.3302 ALDH1A1 XLOC_036590 AC020636.2, 1.64049 4.57607 3.36258 0.771193 0.15853 0.463221 AC020636.2, CLRN1, CLRN1, MINDY4B MINDY4B XLOC_036625 AC108729.3, 27.0835 230.605 21.8681 12.2886 14.8895 13.5729 AC108729.3, PLCH1 PLCH1 XLOC_017273 AC015712.1, 61.8026 83.4586 50.6442 10.5314 6.87879 11.3318 AC015712.1, AC015712.4, AC015712.4, AC015712.5, AC015712.5, AC015712.6, AC015712.6, ALDH1A3 ALDH1A3 XLOC_016033 DIO3OS, 3.35376 3.63927 4.21183 0.199066 0.480621 0.97296 DIO3OS, MIR1247 MIR1247 XLOC_029247 CYP1B1, 12.7944 15.2601 26.2721 3.0588 2.10553 2.94246 CYP1B1, RMDN2-AS1 RMDN2-AS1 XLOC_018711 EIF3C 2.87618 34.5653 31.8651 4.72684 3.15636 2.47979 EIF3C XLOC_032052 APCDD1L 2.60783 2.44671 2.12832 0.293242 0.570942 0.246149 APCDD1L XLOC_019330 HSD17B2 108.573 79.3757 74.2518 11.3214 9.48488 19.7587 HSD17B2 XLOC_005448 DKK1 13.6083 16.1791 24.6678 2.34378 2.91815 3.17139 DKK1 XLOC_014052 DCT 116.653 24.9895 9.93978 10.1663 6.90676 8.14239 DCT XLOC_002706 TNFRSF9 0.955634 5.22558 3.9647 0.95628 0.267551 0.486885 TNFRSF9 XLOC_044950 AC004160.1 0.053175 0.764147 0.924094 0 0.096271 0.202499 AC004160.1 XLOC_042581 MIR5004, 0.059656 0.074733 1.99489 0.232952 0.098403 0.049351 MIR5004, SYNGAP1, SYNGAP1, ZBTB9 ZBTB9 XLOC_012370 CPM, 2.64187 6.95502 4.36488 0.870542 0.80487 0.84699 CPM, PRELID2P1 PRELID2P1 XLOC_015185 DIO3 3.26808 6.67527 3.70188 0.853295 0.553079 1.15041 DIO3 XLOC_008373 GRIA4 4.46608 10.8139 10.2688 1.75957 1.17946 1.92112 GRIA4 XLOC_021142 CCL2 271.652 422.61 418.085 80.2066 49.6472 84.926 CCL2 XLOC_005951 ADRB1 0.676098 0.543138 0.695966 0.08453 0.250934 0.035401 ADRB1 XLOC_020429 ADAMTS18 20.9749 23.2548 27.0867 4.17636 5.37847 4.26227 ADAMTS18 XLOC_002055 LHX9 3.70858 1.54463 3.77319 0.872661 0.252278 0.660088 LHX9 XLOC_007296 CCKBR 18.9483 29.6155 16.3185 4.54304 4.3604 4.49649 CCKBR XLOC_050766 BARHL1 7.75494 3.28797 51.4482 0.45201 2.47151 10.3857 BARHL1 XLOC_030190 CYTIP 0.890241 0.76244 0.753724 0.150365 0.293362 0.07193 CYTIP XLOC_024400 FAM69C 11.6468 9.87495 8.56703 2.08273 2.59406 1.91915 FAM69C XLOC_039183 SFRP2 476.589 775.446 776.525 112.159 165.839 168.877 SFRP2 XLOC_034614 SYNPR 15.8505 11.9411 10.1719 3.28918 1.98699 3.27429 SYNPR XLOC_017031 CRABP1 1195.31 2227.35 1893.36 477.443 378.147 379.316 CRABP1 XLOC_043011 AL589740.1 2.83443 1.99495 3.03891 0.423911 0.413746 0.999699 AL589740.1 XLOC_035457 CLDN16 0.459136 0.442408 0.865385 0.070995 0.155026 0.186995 CLDN16 XLOC_003488 CRYZ 18.4011 18.1655 19.5315 2.13505 4.87919 6.20487 CRYZ XLOC_049746 MAFA 0.615728 1.59732 0.741452 0.26726 0.191048 0.262786 MAFA XLOC_013669 SHISA2 13.3832 15.9522 8.82117 2.92263 2.65672 3.73375 SHISA2 XLOC_015082 DLK1 108.58 445.412 155.099 116.197 31.0653 30.0931 DLK1 XLOC_047097 RELN 8.19846 15.0825 15.7761 2.35415 1.98371 5.5128 RELN XLOC_029306 SIX3-AS1 5.17672 6.65778 12.9058 2.80865 1.72649 1.76511 SIX3-AS1 XLOC_037223 LINC02506 6.23974 51.9183 13.6307 10.4812 2.98631 4.98306 LINC02506 XLOC_019146 LRRC36 0.082067 1.9616 0.160277 0.261932 0.143079 0.162177 LRRC36 XLOC_005835 PAX2 1.3601 1.26266 2.89939 0.372508 0.486074 0.576677 PAX2 XLOC_002251 KCNK2 2.34228 3.29868 2.04425 0.750383 0.787665 0.463977 KCNK2 XLOC_029304 LINC01833 18.4764 41.3797 38.9724 11.1224 6.64704 8.07079 LINC01833 XLOC_018083 HOMER2 58.9068 72.7643 58.6159 20.1414 15.1953 15.6611 HOMER2 XLOC_027327 QPCT 2.4727 4.20444 2.60496 0.392047 0.790209 1.32658 QPCT XLOC_002049 CRB1 2.30468 4.54208 3.18978 1.5315 0.60078 0.689177 CRB1 XLOC_023764 CDH20 37.685 38.8728 33.3169 9.58835 13.0342 8.27094 CDH20 XLOC_048281 ERICH5 16.2999 41.7988 46.1951 11.1174 4.84185 13.7767 ERICH5 XLOC_027527 MEIS1 85.4694 87.4353 66.8553 28.7246 17.1714 22.4992 MEIS1 XLOC_013601 GJA3 0.317404 0.736926 0.633042 0.10417 0.142725 0.238386 GJA3 XLOC_008880 LMO1 6.80765 8.85465 4.16178 2.45708 1.88068 1.41516 LMO1 XLOC_018419 IL32, 8.52227 24.9515 18.2384 5.3936 4.73932 4.90601 IL32, RNU1-125P RNU1-125P XLOC_036882 CLDN1 50.106 58.8008 66.9105 13.5883 15.0468 23.5422 CLDN1 XLOC_051664 TNC 213.252 360.119 156.583 73.7033 108.252 34.7334 TNC XLOC_024388 CBLN2 0.291008 2.26125 0.966416 0.430244 0.154044 0.480505 CBLN2 XLOC_041354 ANKRD34B 2.39566 1.69226 3.27724 0.314782 1.49788 0.420214 ANKRD34B XLOC_002245 PROX1 2.4965 5.75226 8.62622 1.71467 1.61718 1.81632 PROX1 XLOC_043359 PPP1R14C 2.46775 7.44666 9.84518 2.26365 1.3536 2.51865 PPP1R14C XLOC_053790 TCEAL5 11.4788 35.8439 10.9339 2.77939 6.19258 9.30113 TCEAL5 XLOC_039957 RASGRF2 5.12876 3.6573 5.43401 0.997472 1.78609 1.89001 RASGRF2 XLOC_015824 LTBP2 12.0873 10.9274 10.0768 2.89807 5.10566 3.04485 LTBP2 XLOC_041138 AC034238.1, 1.17155 1.49775 7.77941 0.650085 0.550149 2.40026 AC034238.1, ESM1 ESM1 XLOC_039386 AC018709.1, 0.737531 1.38922 1.7777 0.609106 0.284264 0.453301 AC018709.1, F11-AS1, F11-AS1, MTNR1A MTNR1A XLOC_027382 SIX3 26.4761 43.6453 49.5259 18.0016 12.0784 13.6248 SIX3 XLOC_034342 ARPP21 0.498718 1.92141 1.34695 0.521731 0.179582 0.6858 ARPP21 XLOC_022663 KRT17 95.5863 29.2402 2.37791 11.1458 33.3079 2.61583 KRT17 XLOC_044494 MAN1A1 11.7561 8.84561 8.97651 3.99183 3.59782 3.41598 MAN1A1 XLOC_050369 C9orf47, 10.2433 24.3117 16.6353 6.53462 6.42303 6.12603 C9orf47, S1PR3 S1PR3 XLOC_004771 AL117348.1, 5.19131 11.1679 5.11138 3.81669 2.39961 1.80643 AL117348.1, LEFTY2 LEFTY2 XLOC_012012 AMIGO2 3.45442 4.11641 4.20926 1.19783 1.44253 1.78408 AMIGO2 XLOC_053069 TKTL1 2.95503 5.38513 3.74899 1.99216 1.65393 1.0042 TKTL1 XLOC_011248 FAM222A 4.12358 5.19282 4.7307 1.51599 1.40564 2.48574 FAM222A XLOC_013946 PCDH9 2.76325 2.87375 3.69818 0.904305 1.35518 1.34963 PCDH9 XLOC_030425 TMEFF2 40.0945 26.9503 23.8186 10.8991 10.3532 14.1006 TMEFF2 XLOC_001972 LAMC2 18.2713 9.66125 4.30548 3.20981 7.36387 1.98432 LAMC2 XLOC_038812 SNCA 120.444 90.172 102.326 33.7833 32.2981 56.3382 SNCA XLOC_031027 SYNDIG1 1.17031 1.60609 1.62468 0.579908 0.60694 0.546443 SYNDIG1 XLOC_050268 RORB 1.59684 2.26923 1.99551 1.11116 0.7857 0.426796 RORB XLOC_050235 AL353608.3, 14.8368 9.57984 9.86534 3.35358 5.24648 5.16355 AL353608.3, PGM5 PGM5 XLOC_049879 TYRP1 235.705 54.4611 38.9429 59.2856 26.1865 48.6274 TYRP1 XLOC_035875 CSPG5 6.19783 7.13338 5.1209 3.51239 2.12591 2.0641 CSPG5 XLOC_047896 C8orf4 40.6436 47.2069 50.5633 13.5105 31.6952 12.6026 C8orf4 XLOC_048409 COL14A1 2.59648 2.10468 3.61912 1.07687 1.56109 0.85661 COL14A1 XLOC_010972 LGR5 19.3417 19.2728 20.0357 7.97384 8.60957 8.1073 LGR5 XLOC_050248 MAMDC2 13.1192 37.5715 35.6402 12.7504 9.82286 14.0674 MAMDC2 XLOC_004451 COLGALT2 18.8059 26.6688 34.1965 11.2487 9.74781 12.9374 COLGALT2 XLOC_026186 CPAMD8 18.8752 17.1836 30.3108 7.77265 10.4191 10.2379 CPAMD8 XLOC_004455 FAM129A 3.98387 3.30211 2.84975 1.89095 1.25215 1.20355 FAM129A XLOC_023416 RAB31 39.4445 54.2819 58.6251 18.3149 23.4672 23.8651 RAB31 XLOC_027383 AC012354.1 2.27649 4.02042 4.51128 1.78547 1.59765 1.28546 AC012354.1 XLOC_051679 BRINP1 2.92763 3.40757 2.76609 1.55953 1.22748 1.28975 BRINP1 XLOC_002264 TGFB2, 45.5307 68.4717 84.3122 30.2041 32.3378 28.2233 TGFB2, TGFB2-OT1 TGFB2-OT1 XLOC_006249 CUBN 0.43488 0.614983 0.773097 0.219685 0.238769 0.378187 CUBN XLOC_034650 MITF 15.5231 10.5048 6.80536 4.89256 3.1139 7.07399 MITF XLOC_030257 LRP2 27.3764 34.6716 38.5213 13.4993 17.2224 15.633 LRP2 XLOC_017507 GJD2 1.86204 3.68614 4.5392 1.48254 1.51391 1.70258 GJD2 XLOC_017508 ACTC1 244.194 242.898 338.343 121.789 166.507 101.795 ACTC1 XLOC_000284 EFHD2 36.94 33.3531 33.7508 15.2872 16.4366 17.5493 EFHD2 XLOC_027354 PKDCC 58.0919 68.659 69.506 27.3853 31.4243 34.6239 PKDCC XLOC_003193 AC099795.1, 302.092 424.578 349.152 176.956 184.007 151.787 AC099795.1, SLC2A1 SLC2A1 XLOC_027319 CRIM1 28.1111 39.825 54.7239 19.0044 18.1419 21.6203 CRIM1 XLOC_048183 AC015522.1 23.893 16.9284 17.7133 6.62867 11.233 10.8486 AC015522.1 XLOC_012216 PMEL 380.885 280.488 177.492 123.798 90.577 199.36 PMEL XLOC_034156 BHLHE40 28.7412 23.1729 21.563 12.1994 14.1307 10.3034 BHLHE40 XLOC_047196 TSPAN12 11.4086 19.9723 13.6718 7.21286 9.09143 6.16548 TSPAN12 XLOC_030171 RPRM 5.40098 4.65882 5.19447 8.53696 10.2919 11.89 RPRM XLOC_038414 LGI2 3.34797 2.21911 3.12553 3.90375 5.02253 8.64864 LGI2 XLOC_044149 BMP5 3.02977 1.71237 2.09512 3.95214 4.59264 5.41114 BMP5 XLOC_015662 RTN1 9.13956 9.31148 8.33665 14.1267 16.4955 24.1101 RTN1 XLOC_004016 CELF3 3.94652 6.17983 4.15166 7.71013 7.3096 14.2807 CELF3 XLOC_035933 CAMKV 3.09309 3.67909 2.58475 4.5568 5.55017 9.23923 CAMKV XLOC_041385 HAPLN1 57.6882 39.4065 34.4343 82.0823 102.661 87.9429 HAPLN1 XLOC_004282 LMX1A 33.4135 21.9197 49.0861 70.9296 71.3898 75.9027 LMX1A XLOC_028427 ITGA4 2.05187 1.25071 2.62518 2.11168 3.59207 6.87503 ITGA4 XLOC_053428 SYP 2.5879 3.11914 2.16079 5.13716 4.68135 7.29417 SYP XLOC_010398 PTPRO 4.68262 3.8616 4.0351 15.7455 7.02845 4.65822 PTPRO XLOC_033238 SEZ6L 1.77989 2.12385 1.38471 2.7291 3.26834 5.54343 SEZ6L XLOC_051389 FRMD3 1.83018 2.1865 4.43258 5.52025 5.27143 7.91202 FRMD3 XLOC_031307 SNAI1 4.02313 3.05522 3.24031 4.44491 6.83397 11.7402 SNAI1 XLOC_030989 INSM1 1.6489 2.00348 1.96073 2.57814 3.52584 6.53783 INSM1 XLOC_050669 LMX1B 3.02009 1.22639 2.83911 2.88407 3.57748 9.73892 LMX1B XLOC_052629 TCEAL2 19.9932 6.70028 21.5307 45.2251 34.9479 31.9153 TCEAL2 XLOC_006747 GRID1, 1.16152 0.89719 1.76359 1.27619 1.29953 6.46301 GRID1, uc_338 uc_338 XLOC_052734 HTR2C 0.700825 1.81764 1.30142 5.75477 1.86245 1.56679 HTR2C XLOC_047751 NEFM 17.7394 20.2093 27.1897 27.2862 42.1514 90.5211 NEFM XLOC_042079 COL23A1 3.01085 2.66369 4.69091 4.21772 5.63487 15.6218 COL23A1 XLOC_048890 NEFL 10.1258 15.8403 16.4345 24.3631 25.7532 54.1677 NEFL XLOC_018031 CHRNB4 1.2344 0.980568 0.904825 1.21408 2.39138 4.14531 CHRNB4 XLOC_004935 GREM2 0.745461 0.730919 0.535223 1.14036 1.4873 2.46793 GREM2 XLOC_042770 TFAP2B 30.3385 5.0023 8.23905 15.8348 47.749 48.956 TFAP2B XLOC_030899 CHGB 1.56999 1.76668 1.1029 2.7693 3.48896 5.28896 CHGB XLOC_052372 MAGEH1 24.0826 19.4032 28.612 63.5455 64.074 60.3462 MAGEH1 XLOC_043938 GRM4 0.475366 0.356607 0.357952 0.610677 1.08307 1.4304 GRM4 XLOC_026219 KIAA1683 0.87993 0.708561 1.21511 0.87429 2.28624 4.25022 KIAA1683 XLOC_009683 FAM181B 2.06403 1.75194 4.16686 5.45181 5.16281 10.627 FAM181B XLOC_022915 CA10 1.19926 1.0558 2.24358 2.89383 2.37375 6.802 CA10 XLOC_041742 GFRA3 0.651745 0.624342 0.936448 1.26301 1.29785 3.37587 GFRA3 XLOC_032857 ERVH48-1 2.30878 2.91941 0.336689 6.00408 4.66685 4.27947 ERVH48-1 XLOC_032392 RIPPLY3 3.3058 2.73499 3.88712 9.4948 6.18763 10.994 RIPPLY3 XLOC_045787 CPED1, 3.8268 0.805165 4.70118 3.95265 5.94346 15.7302 CPED1, HMGN1P18 HMGN1P18 XLOC_048897 EBF2 1.08758 1.07544 1.13791 1.58855 2.89245 4.63734 EBF2 XLOC_004252 MPZ 7.07102 4.30449 8.68341 7.3039 15.9612 32.4706 MPZ XLOC_037044 MSX1 17.6647 15.2965 18.4083 41.1999 31.0716 70.4766 MSX1 XLOC_028714 CDK5R2 0.615729 0.570948 0.555986 1.40459 1.42113 2.04639 CDK5R2 XLOC_000794 ELAVL4 5.55111 9.7948 6.60765 12.4444 20.7901 28.7352 ELAVL4 XLOC_029809 RNF149, 10.09 7.77506 11.1104 8.96474 61.4119 11.7368 RNF149, SNORD89 SNORD89 XLOC_003798 NHLH2 0.487362 0.637494 0.669737 1.15678 1.74957 2.21569 NHLH2 XLOC_047230 GRM8 3.54174 2.7208 3.39742 11.7384 7.85823 8.20732 GRM8 XLOC_021373 ADAM11 5.84158 3.45392 3.89677 7.41243 9.9017 20.6655 ADAM11 XLOC_017731 WDR72 0.650121 0.732428 1.04974 2.27034 1.79787 2.96327 WDR72 XLOC_031394 PHACTR3 1.68606 0.475005 1.2944 1.70091 3.66888 4.66095 PHACTR3 XLOC_004924 LINC01139 3.24003 2.89495 3.70155 12.1761 7.4302 9.3553 LINC01139 XLOC_038929 PITX2 4.66547 1.82763 4.11564 9.09252 9.39538 12.8157 PITX2 XLOC_024906 GDF15 4.30613 12.7602 12.9116 37.6506 18.5757 32.9894 GDF15 XLOC_048154 STMN2 69.4526 63.3122 60.4211 126.499 196.35 255.076 STMN2 XLOC_041939 EBF1 2.97424 1.79056 3.44582 4.15686 7.83243 12.7996 EBF1 XLOC_004283 RXRG 1.54887 1.02803 2.97637 2.8608 4.18203 9.86821 RXRG XLOC_007091 EBF3 2.91282 2.9235 5.21086 6.21312 9.81381 17.7005 EBF3 XLOC_005825 ABCC2 1.04029 0.159979 0.460372 0.450145 2.01261 2.65277 ABCC2 XLOC_025095 CHST8 0.69729 1.04306 0.824119 1.48245 2.77272 3.77663 CHST8 XLOC_015674 SIX1 3.84063 2.32059 6.29803 7.51272 10.717 21.5869 SIX1 XLOC_034818 ZPLD1 0.454756 0.348382 0.944384 0.59692 0.94142 4.06766 ZPLD1 XLOC_026209 UNC13A 0.310463 0.385926 0.358126 0.661015 0.941611 1.78312 UNC13A XLOC_047719 FGF17 0.181709 0.709779 1.50313 3.01003 1.14096 3.5756 FGF17 XLOC_008137 TPBGL 0.221 0.24914 0.18793 0.326765 0.612302 1.18635 TPBGL XLOC_045774 MIR6132, 21.369 19.6749 37.513 195.309 26.2393 32.2836 MIR6132, ST7, ST7, ST7-AS1_2, ST7-AS1_2, ST7-OT3_1, ST7-OT3_1, ST7-OT3_2, ST7-OT3_2, ST7-OT3_3, ST7-OT3_3, ST7-OT4, ST7-OT4, ST7-OT4_1, ST7-OT4_1, ST7-OT4_2, ST7-OT4_2, ST7-OT4_3, ST7-OT4_3, ST7-OT4_4 ST7-OT4_4 XLOC_010779 NEUROD4 0.855001 0.535386 0.545815 0.841925 2.15946 3.29204 NEUROD4 XLOC_030738 ECEL1 9.3731 3.88375 9.07631 21.1135 21.0309 30.5115 ECEL1 XLOC_028834 CHRND 0.133893 0.162252 0.169808 0.210794 0.282629 1.04517 CHRND XLOC_038132 AC078881.1 0.483632 0.609226 0.537148 1.26026 1.68745 2.51901 AC078881.1 XLOC_003734 KCNA2 0.119848 0.114483 0.121454 0.196014 0.357263 0.641855 KCNA2 XLOC_016656 CKMT1A 0.195764 0.252631 0.065192 0.744312 0.751534 0.271323 CKMT1A XLOC_023042 CSHL1, 0.147814 0.083878 0.086755 0.105186 0.444118 0.546804 CSHL1, GH1 GH1 XLOC_021365 RUNDC3A 3.05171 3.43395 1.7738 7.60929 6.82062 14.3788 RUNDC3A XLOC_037406 AC013724.1 1.26243 0.607775 2.7783 2.30769 5.23486 8.90323 AC013724.1 XLOC_031942 TNNC2 1.19843 0.597568 0.616824 0.948961 3.5413 4.04744 TNNC2 XLOC_007768 P2RX3 11.4484 5.26939 10.4009 17.4595 29.3766 49.982 P2RX3 XLOC_033962 SOX10 12.2156 5.89624 15.1764 13.7585 33.604 72.0709 SOX10 XLOC_023568 TTR 7.64744 5.28695 9.74179 44.2219 26.8182 11.0765 TTR XLOC_001718 NHLH1 6.836 6.19652 5.38626 13.3689 16.7953 36.7185 NHLH1 XLOC_049809 DMRT2 0.060428 0.144392 0.05972 0.425798 0.402112 0.132896 DMRT2 XLOC_018647 HS3ST2 0.464535 0.258888 0.307657 0.687753 1.01603 2.07308 HS3ST2 XLOC_030682 COL4A4 0.304637 0.135306 0.181829 0.652932 0.405197 1.22085 COL4A4 XLOC_001956 CACNA1E 0.17295 0.115689 0.13369 0.440042 0.452217 0.658248 CACNA1E XLOC_004290 FAM78B 0.345477 0.279269 0.333669 0.646977 0.982876 1.90918 FAM78B XLOC_028175 THSD7B 2.67226 1.08222 1.82101 4.0935 6.58361 10.0276 THSD7B XLOC_031081 XKR7 0.94844 0.508548 0.484812 1.11108 2.39362 3.70723 XKR7 XLOC_021148 TMEM132E 1.40988 0.486328 0.913432 1.32051 2.89112 6.25745 TMEM132E XLOC_006505 DRGX 0.451418 0.137073 0.333515 0.540105 1.09737 1.95555 DRGX XLOC_016464 APBA2 0.147763 0.102978 0.116272 0.621117 0.30874 0.50119 APBA2 XLOC_023046 ICAM2 0.049211 0 0.154296 0.289586 0.187764 0.322514 ICAM2 XLOC_005844 TLX1 0.807038 0.347483 0.883956 1.03245 3.05458 3.94125 TLX1 XLOC_005701 SNCG 13.499 10.2857 11.1359 24.9947 39.0555 73.5977 SNCG XLOC_039723 ISL1 3.80905 1.01111 1.95895 3.02885 9.21573 14.5762 ISL1 XLOC_024513 ONECUT3 0.073395 0.085392 0.116475 0.113174 0.295455 0.685975 ONECUT3 XLOC_007448 SLC17A6 0.54407 0.608742 0.758128 1.27419 2.06446 4.30237 SLC17A6 XLOC_053775 BEX5 1.27132 0.998891 1.58627 6.6662 4.7515 4.21188 BEX5 XLOC_019423 CDH15 0.360616 0.084472 0.334736 0.218565 0.870598 2.08424 CDH15 XLOC_000925 FOXD3 1.2178 0.699633 1.34897 1.61526 3.91824 7.85973 FOXD3 XLOC_001202 NTNG1 1.08523 0.722204 1.30259 4.82741 2.79911 5.15245 NTNG1 XLOC_036925 APOD 0.174434 0.268206 0.139212 0.378946 0.715705 1.3068 APOD XLOC_041716 NEUROG1 2.45398 1.73346 1.21042 2.01133 7.79432 12.5119 NEUROG1 XLOC_036866 SST 95.6846 43.2791 93.8272 173.63 389.789 428.784 SST XLOC_030364 CERKL, 3.11322 2.10865 2.06817 4.77815 9.36537 17.3522 CERKL, NEUROD1 NEUROD1 XLOC_041120 AC010478.1 0.670449 0.335633 0.558476 1.1048 2.14114 3.58328 AC010478.1 XLOC_042144 FOXQ1 0.13011 0.176936 0.133934 0.556044 0.340398 1.03676 FOXQ1 XLOC_033193 PCAT14 0.347555 3.34943 0.356329 9.4583 3.31814 5.48905 PCAT14 XLOC_002873 PLA2G2A 0.33933 11.6496 0.232865 34.2602 7.99949 13.8025 PLA2G2A XLOC_051150 PAX5 0.041797 0.070755 0.110252 0.054935 0.794357 0.183891 PAX5 XLOC_046221 EN2 0.077904 0.038845 0.216523 0.405189 0.280246 0.888435 EN2 XLOC_045087 PPP1R17 7.65666 2.80618 6.70317 9.32798 28.1052 44.2009 PPP1R17 XLOC_050747 PRDM12 0.602529 0.15295 0.304479 0.273935 1.8128 2.99427 PRDM12 XLOC_007587 AC087521.3, 0.470656 0.343695 0.236177 0.746018 1.47777 3.00638 AC087521.3, C11orf96 C11orf96 XLOC_042003 AC091980.2 0.125791 0.048248 0.229093 0.377453 0.447536 1.18557 AC091980.2 XLOC_003769 LINC01356 1.61564 14.0389 2.64513 61.8663 13.3663 16.6268 LINC01356 XLOC_044934 NXPH1 0.387357 0.155816 0.277031 0.776078 0.911533 2.50384 NXPH1 XLOC_027613 TLX2 0.535173 0.465132 0.599038 0.839251 2.06084 5.2989 TLX2 XLOC_022838 HOXB2 1.07836 0.403277 0.378429 2.09591 2.64729 4.9233 HOXB2 XLOC_028330 SP5 2.12602 0.923064 1.94033 3.68214 5.66955 16.8732 SP5 XLOC_031003 PAX1 0.088564 0.112961 0.078424 0.236148 0.449801 0.803336 PAX1 XLOC_001608 CHRNB2 0.554063 0.657415 0.285777 0.782043 3.97458 3.69563 CHRNB2 XLOC_003403 FOXD3-AS1 2.73328 2.74194 3.39322 7.61602 13.3845 30.4011 FOXD3-AS1 XLOC_015958 ITPK1 0.193583 0.201487 0.219044 0.281163 3.02305 0.256659 ITPK1 XLOC_009251 APLNR 1.01519 0.570663 0.285534 2.03327 4.7726 4.06639 APLNR XLOC_038240 CPLX1 0.337301 0.41944 0.337179 0.959054 1.89178 3.5133 CPLX1 XLOC_037482 ODAM 0.189997 0.456696 0.130386 1.23694 0.990273 2.52954 ODAM XLOC_045014 GPNMB 4.09897 2.67489 9.39444 20.0764 15.4035 64.2422 GPNMB XLOC_047629 GATA4 0.154121 0.397169 0.267523 2.25432 1.15064 1.80146 GATA4 XLOC_037508 AFP 0.377022 0.440999 0.232247 1.07117 3.97382 1.70775 AFP XLOC_022839 AC103702.1, 0.352998 0.148958 0.209501 0.520492 1.21586 2.93308 AC103702.1, HOXB3, HOXB3, HOXB4, HOXB4, HOXB6 HOXB6 XLOC_021627 KCNH6 0.19152 0.116356 0.088714 0.504774 0.817851 1.40296 KCNH6 XLOC_028833 PRSS56 0.765201 0.190726 0.485575 1.51774 1.82147 6.57563 PRSS56 XLOC_013913 LINC00458 0.145233 0.796138 0.082385 4.77692 1.01213 1.83404 LINC00458 XLOC_040604 TLX3 0.774906 0.115917 0.797678 1.51139 3.60394 7.50428 TLX3 XLOC_038604 TECRL 0.179064 0.047349 0.048874 1.02139 0.545223 0.655368 TECRL XLOC_034414 KLHL40 0.215201 0.064383 0.099686 0.247534 1.0838 1.79501 KLHL40 XLOC_024084 GATA6-AS1 0.032246 0.052996 0.524759 3.21282 0.866333 1.05875 GATA6-AS1 XLOC_052291 PAGE4 0.093019 0.271256 0.280021 1.179 1.99725 2.29819 PAGE4 XLOC_050257 GDA 0.014489 0.033737 0.097653 0.602566 0.318894 0.400425 GDA XLOC_032924 SPATC1L 0.051189 0.118893 0.105387 1.7402 0.815051 0.02236 SPATC1L XLOC_004239 ITLN2 0.079323 0.184579 0.221167 1.27032 0.733759 2.56027 ITLN2 XLOC_019449 IL9RP3, 0.136845 0.287302 0.3649 3.12169 1.35714 3.95977 IL9RP3, WASH4P, WASH4P, Z84723.1 Z84723.1 XLOC_018543 NOMO1 0.027914 0.983765 0.259636 0.307088 0.11189 18.7616 NOMO1 XLOC_053103 AJ271736.1, 0.055779 0.043502 0.420968 0.125549 8.17491 0.229129 AJ271736.1, IL9R, IL9R, WASH6P WASH6P XLOC_015003 AL110118.2, 0.009336 0.982384 0.169714 18.721 0.249948 0.075754 AL110118.2, TMEM251, TMEM251, UBR7 UBR7 XLOC_021436 HOXB-AS1, 0.742093 0.109409 0.167643 2.17336 5.49078 9.27938 HOXB-AS1, HOXB-AS3 HOXB-AS3 XLOC_047531 MYOM2 0.149096 0.298459 0.211717 0.149216 0.192236 10.8701 MYOM2 XLOC_022539 SYNRG 0.076614 0.015469 0.18385 0.304336 0.088185 4.70465 SYNRG XLOC_001584 INTS3, 0.145904 0.037429 0.24386 0.250705 8.01942 0.053786 INTS3, SLC27A3 SLC27A3 XLOC_030625 IHH 0.027396 0.054641 0.028201 0.671339 0.464598 1.07154 IHH XLOC_025815 SBNO2 0.11578 0.079897 0.108348 0.140676 6.62508 0.297605 SBNO2 XLOC_031698 CST1 1.8543 12.9097 0.923864 166.671 79.0722 125.455 CST1 XLOC_018539 BFAR 0.203068 0.200661 0.115413 0.392574 13.2101 0.357776 BFAR XLOC_042579 KIFC1 0.019888 0.049667 0.061418 4.95185 0.048665 0.009372 KIFC1 XLOC_013689 CDX2 0.100395 0.080095 0.041338 1.45376 3.82786 7.68326 CDX2 XLOC_031669 AL121722.1, 0.011317 0.089115 0.011004 2.03396 1.72079 3.13084 AL121722.1, FOXA2, FOXA2, LINC00261 LINCO0261 XLOC_022563 PIP4K2B 0.165703 0.09556 0.02213 0.240704 0.039356 20.7652 PIP4K2B XLOC_030000 RAB6C-AS1 0.089992 0.033102 0.031389 0.011065 22.0506 0.043111 RAB6C-AS1 XLOC_019729 NTAN1 0 0 0.05628 8.25715 0 0.051527 NTAN1 XLOC_022262 AC004448.4 0 0 0 7.24031 7.20388 0 AC004448.4 XLOC_008457 APOC3 0 0 0 0.385105 0.902871 0.213859 APOC3 XLOC_030866 GNRH2 0 0 0 0.353917 0.363679 0.249198 GNRH2 XLOC_048664 DEFA6 0 0 0 1.45633 0.598601 1.46378 DEFA6 XLOC_026995 ZNF667 1.0593 3.4673 1.3381 0 0 0 ZNF667 XLOC_050265 AL451127.1 0.422805 0.421643 0.373054 0 0 0 AL451127.1 XLOC_053024 MAGEA4 0.35109 0.384778 0.181792 0 0 0 MAGEA4 XLOC_025713 ZNF667-AS1 4.73676 9.32947 4.82475 0 0 0 ZNF667-AS1 XLOC_027001 ZNF835 0.053623 0.658148 0.340527 0 0 0 ZNF835 XLOC_025714 ZNF471 0.682554 1.15445 0.470161 0 0 0 ZNF471 XLOC_045348 ZNF736 0.624218 1.92792 0.552082 0 0 0 ZNF736 XLOC_006399 AL132657.1, 0.863026 4.17081 1.05968 0 0 0 AL132657.1, ZNF248 ZNF248 signif- tracking_id sample_1 sample_2 status value_1 value_2 log2(fold_change) test_stat p_value q_value icant XLOC_027099 WT PAX6DKO OK 13.8546 0.044489 8.2827 0.62237 0.00005 0.002735 yes XLOC_044162 WT PAX6DKO OK 4.68145 0.022083 7.72791 0.68483 0.00005 0.002735 yes XLOC_033655 WT PAX6DKO OK 1.1969 0.005725 7.70782 0.24225 0.00005 0.002735 yes XLOC_014867 WT PAX6DKO OK 37.3025 0.203829 7.51577 9.25545 0.00005 0.002735 yes XLOC_049453 WT PAX6DKO OK 57.6877 0.631516 6.5133 4.41408 0.00005 0.002735 yes XLOC_028271 WT PAX6DKO OK 109.069 2.06876 5.72033 7.62692 0.00005 0.002735 yes XLOC_039936 WT PAX6DKO OK 90.8139 1.88038 5.59382 5.77908 0.00005 0.002735 yes XLOC_000776 WT PAX6DKO OK 32.2388 0.915053 5.1388 8.24877 0.00005 0.002735 yes XLOC_044161 WT PAX6DKO OK 0.598192 0.017576 5.0889 4.59663 0.00015 0.007086 yes XLOC_012702 WT PAX6DKO OK 2.90257 0.095462 4.92627 3.09453 0.00005 0.002735 yes XLOC_002160 WT PAX6DKO OK 4.32369 0.15815 4.7729 2.4677 0.00005 0.002735 yes XLOC_012591 WT PAX6DKO OK 1.74929 0.075006 4.54363 0.74023 0.00005 0.002735 yes XLOC_009482 WT PAX6DKO OK 8.49054 0.395327 4.42474 4.22442 0.00005 0.002735 yes XLOC_002728 WT PAX6DKO OK 41.8801 2.06603 4.34133 8.6155 0.00005 0.002735 yes XLOC_027566 WT PAX6DKO OK 7.32415 0.384791 4.25052 0.98028 0.0002 0.008981 yes XLOC_025026 WT PAX6DKO OK 1.3916 0.074045 4.23221 2.49309 0.00005 0.002735 yes XLOC_018597 WT PAX6DKO OK 18.1238 0.981018 4.20747 4.07109 0.00005 0.002735 yes XLOC_036565 WT PAX6DKO OK 33.6845 1.95037 4.11027 2.15162 0.00005 0.002735 yes XLOC_040762 WT PAX6DKO OK 1.84837 0.108945 4.08458 2.94393 0.00005 0.002735 yes XLOC_006922 WT PAX6DKO OK 4.25081 0.253816 4.06588 4.43349 0.00005 0.002735 yes XLOC_033225 WT PAX6DKO OK 4.36783 0.263748 4.04968 3.96378 0.00005 0.002735 yes XLOC_002465 WT PAX6DKO OK 12.1058 0.783686 3.94928 1.30593 0.00005 0.002735 yes XLOC_048453 WT PAX6DKO OK 0.492774 0.040166 3.61687 3.4056 0.0001 0.005033 yes XLOC_005226 WT PAX6DKO OK 0.938073 0.079367 3.56309 1.53774 0.0006 0.021697 yes XLOC_019871 WT PAX6DKO OK 1.10959 0.095342 3.54077 3.77585 0.00005 0.002735 yes XLOC_030539 WT PAX6DKO OK 12.7911 1.1588 3.46444 7.53615 0.00005 0.002735 yes XLOC_041832 WT PAX6DKO OK 132.265 12.1875 3.43996 10.1016 0.00005 0.002735 yes XLOC_024322 WT PAX6DKO OK 11.6995 1.11752 3.38808 3.55778 0.00005 0.002735 yes XLOC_030921 WT PAX6DKO OK 7.64404 0.734907 3.3787 4.87076 0.00005 0.002735 yes XLOC_008341 WT PAX6DKO OK 5.25207 0.509058 3.36698 2.30725 0.00005 0.002735 yes XLOC_038319 WT PAX6DKO OK 4.34103 0.426332 3.34799 3.86927 0.00005 0.002735 yes XLOC_041731 WT PAX6DKO OK 153.008 15.0873 3.3422 4.69609 0.00005 0.002735 yes XLOC_009925 WT PAX6DKO OK 1161.01 118.95 3.28696 7.33262 0.00005 0.002735 yes XLOC_048642 WT PAX6DKO OK 6.18229 0.635076 3.28314 2.33246 0.00005 0.002735 yes XLOC_001908 WT PAX6DKO OK 17.7272 1.92744 3.20121 2.68441 0.00005 0.002735 yes XLOC_034205 WT PAX6DKO OK 1.92053 0.214956 3.15939 3.47113 0.00005 0.002735 yes XLOC_010676 WT PAX6DKO OK 1.50841 0.171897 3.13341 2.10811 0.00005 0.002735 yes XLOC_031377 WT PAX6DKO OK 1.60647 0.200641 3.00121 1.85466 0.00025 0.010784 yes XLOC_038358 WT PAX6DKO OK 1.0431 0.137588 2.92245 3.24058 0.00005 0.002735 yes XLOC_027565 WT PAX6DKO OK 1.85122 0.262012 2.82077 2.93627 0.0001 0.005033 yes XLOC_051344 WT PAX6DKO OK 319.839 45.909 2.8005 7.23473 0.00005 0.002735 yes XLOC_036590 WT PAX6DKO OK 3.22484 0.468944 2.78174 2.30445 0.00005 0.002735 yes XLOC_036625 WT PAX6DKO OK 94.1119 13.7191 2.77819 6.1448 0.00005 0.002735 yes XLOC_017273 WT PAX6DKO OK 65.9526 9.67621 2.76891 4.34404 0.00005 0.002735 yes XLOC_016033 WT PAX6DKO OK 3.77219 0.556379 2.76126 2.49978 0.00005 0.002735 yes XLOC_029247 WT PAX6DKO OK 18.2894 2.72921 2.74445 4.43616 0.00005 0.002735 yes XLOC_018711 WT PAX6DKO OK 23.3321 3.48877 2.74153 3.66123 0.00005 0.002735 yes XLOC_032052 WT PAX6DKO OK 2.41816 0.373801 2.69357 3.46766 0.00005 0.002735 yes XLOC_019330 WT PAX6DKO OK 88.2719 13.6565 2.69236 5.75902 0.00005 0.002735 yes XLOC_005448 WT PAX6DKO OK 18.3327 2.83914 2.69089 3.58048 0.00005 0.002735 yes XLOC_014052 WT PAX6DKO OK 51.0324 8.48895 2.58776 5.30577 0.00005 0.002735 yes XLOC_002706 WT PAX6DKO OK 3.41564 0.575923 2.56821 2.78288 0.00005 0.002735 yes XLOC_044950 WT PAX6DKO OK 0.58625 0.100584 2.54311 0.40351 0.00025 0.010784 yes XLOC_042581 WT PAX6DKO OK 0.716836 0.128166 2.48362 0.22491 0.00005 0.002735 yes XLOC_012370 WT PAX6DKO OK 4.70027 0.849185 2.46859 0.65345 0.0002 0.008981 yes XLOC_015185 WT PAX6DKO OK 4.59371 0.860763 2.41597 3.59669 0.00005 0.002735 yes XLOC_008373 WT PAX6DKO OK 8.60107 1.63621 2.39416 2.38418 0.00005 0.002735 yes XLOC_021142 WT PAX6DKO OK 374.477 72.3072 2.37267 6.92448 0.00005 0.002735 yes XLOC_005951 WT PAX6DKO OK 0.644767 0.124854 2.36853 2.43987 0.0004 0.015799 yes XLOC_020429 WT PAX6DKO OK 24.0091 4.65163 2.36778 3.85529 0.00005 0.002735 yes XLOC_002055 WT PAX6DKO OK 3.03883 0.600941 2.33822 1.98223 0.00005 0.002735 yes XLOC_007296 WT PAX6DKO OK 21.8429 4.51119 2.27559 4.5159 0.00005 0.002735 yes XLOC_050766 WT PAX6DKO OK 21.0381 4.48071 2.23121 3.75951 0.00005 0.002735 yes XLOC_030190 WT PAX6DKO OK 0.810134 0.173599 2.2224 1.07744 0.00175 0.049136 yes XLOC_024400 WT PAX6DKO OK 10.1296 2.22057 2.18958 3.49985 0.00005 0.002735 yes XLOC_039183 WT PAX6DKO OK 682.925 150.444 2.1825 6.55481 0.00005 0.002735 yes XLOC_034614 WT PAX6DKO OK 12.7807 2.87857 2.15054 3.40514 0.00005 0.002735 yes XLOC_017031 WT PAX6DKO OK 1789.66 415.74 2.10593 5.7299 0.00005 0.002735 yes XLOC_043011 WT PAX6DKO OK 2.64893 0.618562 2.09842 1.99805 0.0015 0.04365 yes XLOC_035457 WT PAX6DKO OK 0.594849 0.139045 2.09697 1.54422 0.00075 0.025855 yes XLOC_003488 WT PAX6DKO OK 18.8858 4.45033 2.08532 2.39096 0.00005 0.002735 yes XLOC_049746 WT PAX6DKO OK 0.994641 0.242762 2.03464 1.9756 0.0003 0.012524 yes XLOC_013669 WT PAX6DKO OK 12.8456 3.13533 2.03459 4.43719 0.00005 0.002735 yes XLOC_015082 WT PAX6DKO OK 238.716 59.7075 1.99931 4.78287 0.00005 0.002735 yes XLOC_047097 WT PAX6DKO OK 13.1487 3.31631 1.98727 2.24776 0.00135 0.040437 yes XLOC_029306 WT PAX6DKO OK 8.32896 2.12102 1.97338 2.42373 0.0001 0.005033 yes XLOC_037223 WT PAX6DKO OK 24.1676 6.21149 1.96006 3.17172 0.00005 0.002735 yes XLOC_019146 WT PAX6DKO OK 0.741948 0.190948 1.95814 1.09518 0.00105 0.03336 yes XLOC_005835 WT PAX6DKO OK 1.85907 0.483192 1.94391 2.02822 0.0001 0.005033 yes XLOC_002251 WT PAX6DKO OK 2.58726 0.673995 1.94062 2.36786 0.00005 0.002735 yes XLOC_029304 WT PAX6DKO OK 33.271 8.6993 1.93529 2.49815 0.00005 0.002735 yes XLOC_018083 WT PAX6DKO OK 64.0612 17.1688 1.89966 1.27121 0.0012 0.037051 yes XLOC_027327 WT PAX6DKO OK 3.12486 0.844622 1.88741 1.90915 0.00175 0.049136 yes XLOC_002049 WT PAX6DKO OK 3.37884 0.949859 1.83074 2.20655 0.0008 0.027077 yes XLOC_023764 WT PAX6DKO OK 36.99 10.4005 1.83048 4.96708 0.00005 0.002735 yes XLOC_048281 WT PAX6DKO OK 35.1109 10.0108 1.81036 3.73645 0.00005 0.002735 yes XLOC_027527 WT PAX6DKO OK 80.7168 23.0257 1.80962 2.72362 0.00005 0.002735 yes XLOC_013601 WT PAX6DKO OK 0.56806 0.163374 1.79786 2.24658 0.0005 0.018851 yes XLOC_008880 WT PAX6DKO OK 6.67388 1.93676 1.78488 2.32845 0.00045 0.017298 yes XLOC_018419 WT PAX6DKO OK 17.409 5.06296 1.78178 2.77842 0.00005 0.002735 yes XLOC_036882 WT PAX6DKO OK 59.19 17.5659 1.75257 5.16907 0.00005 0.002735 yes XLOC_051664 WT PAX6DKO OK 245.742 72.9495 1.75218 1.8673 0.0004 0.015799 yes XLOC_024388 WT PAX6DKO OK 1.18456 0.358471 1.72442 1.24752 0.0014 0.041595 yes XLOC_041354 WT PAX6DKO OK 2.47954 0.751713 1.72182 2.696 0.00005 0.002735 yes XLOC_002245 WT PAX6DKO OK 5.68103 1.73317 1.71274 2.04898 0.00005 0.002735 yes XLOC_043359 WT PAX6DKO OK 6.65213 2.0657 1.68719 2.96494 0.00005 0.002735 yes XLOC_053790 WT PAX6DKO OK 19.6122 6.1518 1.67267 3.15806 0.00005 0.002735 yes XLOC_039957 WT PAX6DKO OK 4.7873 1.5734 1.60533 2.23791 0.0005 0.018851 yes XLOC_015824 WT PAX6DKO OK 11.1405 3.71958 1.5826 3.56596 0.00005 0.002735 yes XLOC_041138 WT PAX6DKO OK 3.51763 1.21214 1.53704 1.60527 0.0004 0.015799 yes XLOC_039386 WT PAX6DKO OK 1.31445 0.453366 1.53571 1.43606 0.00175 0.049136 yes XLOC_027382 WT PAX6DKO OK 40.2798 14.7135 1.45292 4.10509 0.00005 0.002735 yes XLOC_034342 WT PAX6DKO OK 1.26819 0.466983 1.44133 0.88485 0.00025 0.010784 yes XLOC_022663 WT PAX6DKO OK 42.825 15.8462 1.43431 2.72198 0.00005 0.002735 yes XLOC_044494 WT PAX6DKO OK 9.95773 3.70512 1.4263 3.61353 0.00005 0.002735 yes XLOC_050369 WT PAX6DKO OK 17.2334 6.42465 1.42351 3.8051 0.00005 0.002735 yes XLOC_004771 WT PAX6DKO OK 7.22815 2.7009 1.42019 1.72971 0.00005 0.002735 yes XLOC_012012 WT PAX6DKO OK 3.96584 1.48953 1.41277 2.31021 0.00015 0.007086 yes XLOC_053069 WT PAX6DKO OK 4.06986 1.56555 1.37831 1.46478 0.00055 0.020318 yes XLOC_011248 WT PAX6DKO OK 4.72903 1.82043 1.37726 2.48377 0.0001 0.005033 yes XLOC_013946 WT PAX6DKO OK 3.14275 1.21504 1.37103 2.05781 0.00005 0.002735 yes XLOC_030425 WT PAX6DKO OK 30.5899 11.9018 1.36187 1.63676 0.00045 0.017298 yes XLOC_001972 WT PAX6DKO OK 10.8533 4.22773 1.36017 3.15697 0.00005 0.002735 yes XLOC_038812 WT PAX6DKO OK 105.354 41.2136 1.35406 1.9301 0.0013 0.039328 yes XLOC_031027 WT PAX6DKO OK 1.48165 0.583525 1.34434 1.7836 0.0016 0.045919 yes XLOC_050268 WT PAX6DKO OK 1.97333 0.782273 1.33489 1.94623 0.0012 0.037051 yes XLOC_050235 WT PAX6DKO OK 11.5413 4.63363 1.31659 2.06184 0.0002 0.008981 yes XLOC_049879 WT PAX6DKO OK 110.799 45.1455 1.29529 1.60085 0.0012 0.037051 yes XLOC_035875 WT PAX6DKO OK 6.21201 2.59306 1.2604 2.26997 0.00015 0.007086 yes XLOC_047896 WT PAX6DKO OK 46.5979 19.4616 1.25964 3.43478 0.00005 0.002735 yes XLOC_048409 WT PAX6DKO OK 2.80108 1.17647 1.25152 1.87145 0.001 0.032108 yes XLOC_010972 WT PAX6DKO OK 19.745 8.31231 1.24816 2.88655 0.00005 0.002735 yes XLOC_050248 WT PAX6DKO OK 29.0636 12.3354 1.23641 3.46933 0.00005 0.002735 yes XLOC_004451 WT PAX6DKO OK 26.8217 11.4241 1.23132 3.69478 0.00005 0.002735 yes XLOC_026186 WT PAX6DKO OK 22.3438 9.57108 1.22312 1.78212 0.0001 0.005033 yes XLOC_004455 WT PAX6DKO OK 3.41227 1.46333 1.22148 2.40389 0.00005 0.002735 yes XLOC_023416 WT PAX6DKO OK 51.2899 22.1006 1.21459 1.69767 0.00005 0.002735 yes XLOC_027383 WT PAX6DKO OK 3.63863 1.57171 1.21106 2.03937 0.00085 0.028328 yes XLOC_051679 WT PAX6DKO OK 3.064 1.37247 1.15865 1.98142 0.00035 0.014242 yes XLOC_002264 WT PAX6DKO OK 66.7636 30.5567 1.12757 2.58715 0.00005 0.002735 yes XLOC_006249 WT PAX6DKO OK 0.613709 0.281662 1.12359 1.32247 0.0014 0.041595 yes XLOC_034650 WT PAX6DKO OK 11.0536 5.07696 1.12248 1.93694 0.00065 0.023143 yes XLOC_030257 WT PAX6DKO OK 33.8572 15.6057 1.11739 1.88201 0.00005 0.002735 yes XLOC_017507 WT PAX6DKO OK 3.39596 1.58196 1.1021 1.90966 0.00135 0.040437 yes XLOC_017508 WT PAX6DKO OK 277.888 131.327 1.08134 2.14047 0.0001 0.005033 yes XLOC_000284 WT PAX6DKO OK 35.0271 16.5882 1.07832 3.0893 0.00005 0.002735 yes XLOC_027354 WT PAX6DKO OK 66.0711 31.4551 1.07072 2.4031 0.00005 0.002735 yes XLOC_003193 WT PAX6DKO OK 362.181 172.621 1.0691 3.17841 0.00005 0.002735 yes XLOC_027319 WT PAX6DKO OK 41.2941 19.7842 1.06159 1.94693 0.00005 0.002735 yes XLOC_048183 WT PAX6DKO OK 19.7062 9.66554 1.02773 1.76888 0.0017 0.048164 yes XLOC_012216 WT PAX6DKO OK 282.411 139.287 1.01973 2.01013 0.00105 0.03336 yes XLOC_034156 WT PAX6DKO OK 24.7366 12.3329 1.00413 2.52425 0.00005 0.002735 yes XLOC_047196 WT PAX6DKO OK 15.1672 7.5646 1.00362 2.02233 0.0004 0.015799 yes XLOC_030171 WT PAX6DKO OK 5.13546 10.3417 1.00991 1.94489 0.0005 0.018851 yes XLOC_038414 WT PAX6DKO OK 2.92644 5.91675 1.01566 1.4877 0.0014 0.041595 yes XLOC_044149 WT PAX6DKO OK 2.30183 4.69837 1.02938 2.13182 0.0004 0.015799 yes XLOC_015662 WT PAX6DKO OK 9.01825 18.4261 1.03083 1.8448 0.0013 0.039328 yes XLOC_004016 WT PAX6DKO OK 4.80676 9.86422 1.03714 2.3304 0.00015 0.007086 yes XLOC_035933 WT PAX6DKO OK 3.15007 6.51306 1.04795 1.74582 0.00135 0.040437 yes XLOC_041385 WT PAX6DKO OK 44.2804 91.8018 1.05186 1.99707 0.00075 0.025855 yes XLOC_004282 WT PAX6DKO OK 35.1536 73.4661 1.06341 2.81571 0.00005 0.002735 yes XLOC_028427 WT PAX6DKO OK 1.99563 4.23476 1.08544 1.63442 0.0015 0.04365 yes XLOC_053428 WT PAX6DKO OK 2.64875 5.76112 1.12104 2.03743 0.00035 0.014242 yes XLOC_010398 WT PAX6DKO OK 4.23492 9.2352 1.12481 1.77959 0.0013 0.039328 yes XLOC_033238 WT PAX6DKO OK 1.78039 3.88533 1.12585 1.66333 0.0007 0.02448 yes XLOC_051389 WT PAX6DKO OK 2.8445 6.29675 1.14643 1.71262 0.001 0.032108 yes XLOC_031307 WT PAX6DKO OK 3.47386 7.74958 1.15758 2.11251 0.0006 0.021697 yes XLOC_030989 WT PAX6DKO OK 1.88969 4.25598 1.17134 2.12288 0.00055 0.020318 yes XLOC_050669 WT PAX6DKO OK 2.38543 5.45404 1.19307 2.65481 0.00005 0.002735 yes XLOC_052629 WT PAX6DKO OK 16.2352 37.7353 1.21679 2.84303 0.00005 0.002735 yes XLOC_006747 WT PAX6DKO OK 1.28681 3.04298 1.24169 1.86443 0.00155 0.04486 yes XLOC_052734 WT PAX6DKO OK 1.28598 3.09185 1.2656 2.16144 0.0005 0.018851 yes XLOC_047751 WT PAX6DKO OK 21.9292 53.8516 1.29613 2.82541 0.00005 0.002735 yes XLOC_042079 WT PAX6DKO OK 3.4896 8.57621 1.29728 2.57594 0.00005 0.002735 yes XLOC_048890 WT PAX6DKO OK 14.2743 35.1081 1.29838 3.37409 0.00005 0.002735 yes XLOC_018031 WT PAX6DKO OK 1.0503 2.60937 1.3129 1.95059 0.00045 0.017298 yes XLOC_004935 WT PAX6DKO OK 0.677219 1.71548 1.34091 2.11038 0.00055 0.020318 yes XLOC_042770 WT PAX6DKO OK 14.6718 37.8875 1.36868 2.06195 0.00085 0.028328 yes XLOC_030899 WT PAX6DKO OK 1.49461 3.88747 1.37906 2.32225 0.0001 0.005033 yes XLOC_052372 WT PAX6DKO OK 24.2723 63.28 1.38244 3.86078 0.00005 0.002735 yes XLOC_043938 WT PAX6DKO OK 0.400598 1.05177 1.3926 1.62064 0.0008 0.027077 yes XLOC_026219 WT PAX6DKO OK 0.943851 2.4949 1.40235 2.0374 0.00005 0.002735 yes XLOC_009683 WT PAX6DKO OK 2.68748 7.15116 1.41192 3.05202 0.00005 0.002735 yes XLOC_022915 WT PAX6DKO OK 1.5145 4.06333 1.42382 2.14183 0.0002 0.008981 yes XLOC_041742 WT PAX6DKO OK 0.744865 1.99865 1.42398 1.90038 0.00145 0.042686 yes XLOC_032857 WT PAX6DKO OK 1.87345 5.03315 1.42577 2.49258 0.0001 0.005033 yes XLOC_032392 WT PAX6DKO OK 3.34231 8.98084 1.42601 2.74364 0.00005 0.002735 yes XLOC_045787 WT PAX6DKO OK 3.1421 8.62736 1.45719 1.10044 0.00175 0.049136 yes XLOC_048897 WT PAX6DKO OK 1.11128 3.06977 1.46591 2.23328 0.0002 0.008981 yes XLOC_004252 WT PAX6DKO OK 6.753 18.764 1.47436 3.08096 0.00005 0.002735 yes XLOC_037044 WT PAX6DKO OK 17.2939 48.0574 1.47449 3.84479 0.00005 0.002735 yes XLOC_028714 WT PAX6DKO OK 0.586679 1.64024 1.48326 2.0213 0.0008 0.027077 yes XLOC_000794 WT PAX6DKO OK 7.39076 20.8626 1.49713 2.19203 0.00045 0.017298 yes XLOC_029809 WT PAX6DKO OK 9.75481 27.6441 1.50278 3.01748 0.00005 0.002735 yes XLOC_003798 WT PAX6DKO OK 0.604159 1.72438 1.51308 2.02515 0.00105 0.03336 yes XLOC_047230 WT PAX6DKO OK 3.2521 9.3604 1.5252 2.16529 0.0005 0.018851 yes XLOC_021373 WT PAX6DKO OK 4.44129 12.7862 1.52553 3.58304 0.00005 0.002735 yes XLOC_017731 WT PAX6DKO OK 0.818844 2.36721 1.53152 2.25864 0.00005 0.002735 yes XLOC_031394 WT PAX6DKO OK 1.16332 3.37693 1.53746 2.16234 0.0006 0.021697 yes XLOC_004924 WT PAX6DKO OK 3.31154 9.75013 1.55792 2.79598 0.00005 0.002735 yes XLOC_038929 WT PAX6DKO OK 3.57154 10.5386 1.56107 1.96682 0.0017 0.048164 yes XLOC_024906 WT PAX6DKO OK 10.0921 30.0351 1.57342 1.752 0.00095 0.030847 yes XLOC_048154 WT PAX6DKO OK 65.0374 194.563 1.5809 3.55432 0.00005 0.002735 yes XLOC_041939 WT PAX6DKO OK 2.76418 8.34542 1.59413 1.75806 0.0007 0.02448 yes XLOC_004283 WT PAX6DKO OK 1.86955 5.69326 1.60656 2.55355 0.00005 0.002735 yes XLOC_007091 WT PAX6DKO OK 3.7191 11.3546 1.61025 2.08594 0.0008 0.027077 yes XLOC_005825 WT PAX6DKO OK 0.559078 1.72219 1.62312 1.9006 0.0003 0.012524 yes XLOC_025095 WT PAX6DKO OK 0.863342 2.70398 1.64708 2.28107 0.00015 0.007086 yes XLOC_015674 WT PAX6DKO OK 4.19451 13.4046 1.67616 3.22236 0.00005 0.002735 yes XLOC_034818 WT PAX6DKO OK 0.588316 1.88732 1.68167 2.35027 0.00015 0.007086 yes XLOC_026209 WT PAX6DKO OK 0.355009 1.13984 1.68291 1.63427 0.00005 0.002735 yes XLOC_047719 WT PAX6DKO OK 0.806157 2.60122 1.69005 2.0028 0.0013 0.039328 yes XLOC_008137 WT PAX6DKO OK 0.221543 0.715542 1.69145 1.9544 0.00135 0.040437 yes XLOC_045774 WT PAX6DKO OK 26.4467 85.4535 1.69205 2.07728 0.00005 0.002735 yes XLOC_010779 WT PAX6DKO OK 0.651839 2.11874 1.70062 2.60841 0.00005 0.002735 yes XLOC_030738 WT PAX6DKO OK 7.51868 24.4602 1.70188 3.01336 0.00005 0.002735 yes XLOC_028834 WT PAX6DKO OK 0.156866 0.517984 1.72337 1.34856 0.00165 0.0471 yes XLOC_038132 WT PAX6DKO OK 0.54875 1.84042 1.74581 2.32617 0.0001 0.005033 yes XLOC_003734 WT PAX6DKO OK 0.119777 0.402352 1.7481 0.962856 0.00115 0.035883 yes XLOC_016656 WT PAX6DKO OK 0.172902 0.594928 1.78276 1.33988 0.0004 0.015799 yes XLOC_023042 WT PAX6DKO OK 0.107208 0.369015 1.78326 0.676355 0.0012 0.037051 yes XLOC_021365 WT PAX6DKO OK 2.7806 9.69871 1.8024 2.08758 0.00135 0.040437 yes XLOC_037406 WT PAX6DKO OK 1.56496 5.53663 1.82288 2.20517 0.0009 0.029595 yes XLOC_031942 WT PAX6DKO OK 0.812301 2.87429 1.82312 1.97116 0.00095 0.030847 yes XLOC_007768 WT PAX6DKO OK 9.12975 32.5947 1.83599 2.6328 0.00005 0.002735 yes XLOC_033962 WT PAX6DKO OK 11.2068 40.2084 1.84312 2.40779 0.00055 0.020318 yes XLOC_023568 WT PAX6DKO OK 7.63411 27.645 1.85649 2.99161 0.00005 0.002735 yes XLOC_001718 WT PAX6DKO OK 6.20081 22.5167 1.86047 4.47011 0.00005 0.002735 yes XLOC_049809 WT PAX6DKO OK 0.089058 0.323461 1.86078 1.25404 0.00045 0.017298 yes XLOC_018647 WT PAX6DKO OK 0.347122 1.27152 1.87303 2.25569 0.0002 0.008981 yes XLOC_030682 WT PAX6DKO OK 0.209325 0.767239 1.87393 2.72322 0.00005 0.002735 yes XLOC_001956 WT PAX6DKO OK 0.142181 0.521991 1.8763 2.0694 0.00005 0.002735 yes XLOC_004290 WT PAX6DKO OK 0.322658 1.19145 1.88464 2.2972 0.00005 0.002735 yes XLOC_028175 WT PAX6DKO OK 1.87705 6.97041 1.89278 1.70293 0.0003 0.012524 yes XLOC_031081 WT PAX6DKO OK 0.653725 2.42796 1.89299 3.52866 0.00005 0.002735 yes XLOC_021148 WT PAX6DKO OK 0.945894 3.52452 1.89768 2.00343 0.0002 0.008981 yes XLOC_006505 WT PAX6DKO OK 0.310403 1.20963 1.96235 2.38315 0.00005 0.002735 yes XLOC_016464 WT PAX6DKO OK 0.123558 0.481772 1.96316 1.25874 0.00005 0.002735 yes XLOC_023046 WT PAX6DKO OK 0.068513 0.26928 1.97466 0.368828 0.00095 0.030847 yes XLOC_005844 WT PAX6DKO OK 0.686272 2.70279 1.9776 1.85024 0.0003 0.012524 yes XLOC_005701 WT PAX6DKO OK 11.7563 46.3404 1.97884 3.27062 0.00005 0.002735 yes XLOC_039723 WT PAX6DKO OK 2.28227 9.02946 1.98417 3.60708 0.00005 0.002735 yes XLOC_024513 WT PAX6DKO OK 0.092669 0.368509 1.99155 2.46564 0.0002 0.008981 yes XLOC_007448 WT PAX6DKO OK 0.64333 2.57242 1.9995 2.96906 0.00005 0.002735 yes XLOC_053775 WT PAX6DKO OK 1.29831 5.2618 2.01892 2.51909 0.00005 0.002735 yes XLOC_019423 WT PAX6DKO OK 0.262537 1.06836 2.02481 2.24821 0.0001 0.005033 yes XLOC_000925 WT PAX6DKO OK 1.09966 4.50896 2.03573 2.55158 0.00015 0.007086 yes XLOC_001202 WT PAX6DKO OK 1.04701 4.30213 2.03877 3.2984 0.00005 0.002735 yes XLOC_036925 WT PAX6DKO OK 0.195883 0.808472 2.04521 1.55 0.0015 0.04365 yes XLOC_041716 WT PAX6DKO OK 1.81723 7.51343 2.04773 3.19824 0.00005 0.002735 yes XLOC_036866 WT PAX6DKO OK 78.3712 334.033 2.0916 5.81836 0.00005 0.002735 yes XLOC_030364 WT PAX6DKO OK 2.45425 10.6033 2.11116 3.89638 0.00005 0.002735 yes XLOC_041120 WT PAX6DKO OK 0.526723 2.29912 2.12596 2.66651 0.00005 0.002735 yes XLOC_042144 WT PAX6DKO OK 0.148458 0.65083 2.13223 2.3216 0.0004 0.015799 yes XLOC_033193 WT PAX6DKO OK 1.36454 6.14919 2.17199 2.48166 0.00035 0.014242 yes XLOC_002873 WT PAX6DKO OK 4.1144 18.8736 2.19762 2.85284 0.00005 0.002735 yes XLOC_051150 WT PAX6DKO OK 0.075008 0.347829 2.21326 0.638108 0.00005 0.002735 yes XLOC_046221 WT PAX6DKO OK 0.112199 0.529858 2.23955 2.31334 0.00115 0.035883 yes XLOC_045087 WT PAX6DKO OK 5.77911 27.4829 2.24962 3.02589 0.00005 0.002735 yes XLOC_050747 WT PAX6DKO OK 0.356847 1.71057 2.2611 2.71887 0.00005 0.002735 yes XLOC_007587 WT PAX6DKO OK 0.353669 1.76078 2.31575 2.48798 0.00005 0.002735 yes XLOC_042003 WT PAX6DKO OK 0.135718 0.676873 2.31827 2.46951 0.00005 0.002735 yes XLOC_003769 WT PAX6DKO OK 6.16053 30.9249 2.32764 3.62326 0.00005 0.002735 yes XLOC_044934 WT PAX6DKO OK 0.27613 1.41109 2.35339 1.88149 0.0002 0.008981 yes XLOC_027613 WT PAX6DKO OK 0.53843 2.76027 2.35798 1.8376 0.0002 0.008981 yes XLOC_022838 WT PAX6DKO OK 0.62621 3.25431 2.37763 2.23104 0.00055 0.020318 yes XLOC_028330 WT PAX6DKO OK 1.67974 8.82888 2.394 1.3508 0.00045 0.017298 yes XLOC_031003 WT PAX6DKO OK 0.094246 0.501382 2.4114 1.50172 0.0013 0.039328 yes XLOC_001608 WT PAX6DKO OK 0.504059 2.84553 2.49703 2.56798 0.00005 0.002735 yes XLOC_003403 WT PAX6DKO OK 2.98562 17.3049 2.53508 2.49491 0.0003 0.012524 yes XLOC_015958 WT PAX6DKO OK 0.206745 1.19879 2.53565 1.70275 0.0005 0.018851 yes XLOC_009251 WT PAX6DKO OK 0.630021 3.66024 2.53847 3.45081 0.00005 0.002735 yes XLOC_038240 WT PAX6DKO OK 0.368274 2.14254 2.54047 2.03383 0.00005 0.002735 yes XLOC_037482 WT PAX6DKO OK 0.261605 1.60141 2.61387 1.97763 0.00015 0.007086 yes XLOC_045014 WT PAX6DKO OK 5.44318 33.5724 2.62475 5.6374 0.00005 0.002735 yes XLOC_047629 WT PAX6DKO OK 0.275656 1.75278 2.6687 2.59232 0.00005 0.002735 yes XLOC_037508 WT PAX6DKO OK 0.353579 2.27336 2.68472 1.88461 0.00015 0.007086 yes XLOC_022839 WT PAX6DKO OK 0.239519 1.57201 2.7144 1.6182 0.00005 0.002735 yes XLOC_021627 WT PAX6DKO OK 0.133515 0.917594 2.78085 3.00406 0.00005 0.002735 yes XLOC_028833 WT PAX6DKO OK 0.485298 3.33793 2.78201 3.45453 0.00005 0.002735 yes XLOC_013913 WT PAX6DKO OK 0.344646 2.56635 2.89653 2.28732 0.00025 0.010784 yes XLOC_040604 WT PAX6DKO OK 0.568453 4.24851 2.90185 3.58871 0.00005 0.002735 yes XLOC_038604 WT PAX6DKO OK 0.092679 0.748044 3.01281 1.10653 0.00175 0.049136 yes XLOC_034414 WT PAX6DKO OK 0.127686 1.05251 3.04317 3.24623 0.00005 0.002735 yes XLOC_024084 WT PAX6DKO OK 0.205361 1.7297 3.07429 1.86385 0.0007 0.02448 yes XLOC_052291 WT PAX6DKO OK 0.216904 1.84302 3.08694 1.83488 0.00035 0.014242 yes XLOC_050257 WT PAX6DKO OK 0.049111 0.445021 3.17976 1.34396 0.00005 0.002735 yes XLOC_032924 WT PAX6DKO OK 0.092738 0.867763 3.22607 2.67967 0.00065 0.023143 yes XLOC_004239 WT PAX6DKO OK 0.1633 1.53663 3.23417 2.83008 0.00005 0.002735 yes XLOC_019449 WT PAX6DKO OK 0.265636 2.84092 3.41884 2.93252 0.00045 0.017298 yes XLOC_018543 WT PAX6DKO OK 0.427984 6.45736 3.91531 1.20815 0.00015 0.007086 yes XLOC_053103 WT PAX6DKO OK 0.175146 2.87155 4.0352 2.15261 0.00005 0.002735 yes XLOC_015003 WT PAX6DKO OK 0.390992 6.41213 4.03559 3.09823 0.00005 0.002735 yes XLOC_021436 WT PAX6DKO OK 0.34311 5.7042 4.05528 1.45322 0.00005 0.002735 yes XLOC_047531 WT PAX6DKO OK 0.221946 3.77451 4.08801 2.49886 0.00005 0.002735 yes XLOC_022539 WT PAX6DKO OK 0.092896 1.71602 4.20732 1.67582 0.00005 0.002735 yes XLOC_001584 WT PAX6DKO OK 0.143819 2.8023 4.28429 2.11615 0.00005 0.002735 yes XLOC_030625 WT PAX6DKO OK 0.037112 0.743167 4.32373 3.49567 0.00115 0.035883 yes XLOC_025815 WT PAX6DKO OK 0.102352 2.37793 4.53809 1.95084 0.00005 0.002735 yes XLOC_031698 WT PAX6DKO OK 5.28127 124.966 4.56451 6.94681 0.00005 0.002735 yes XLOC_018539 WT PAX6DKO OK 0.174772 4.69986 4.74907 3.08367 0.00005 0.002735 yes XLOC_042579 WT PAX6DKO OK 0.044093 1.68659 5.25744 2.10568 0.00005 0.002735 yes XLOC_013689 WT PAX6DKO OK 0.07468 4.36475 5.86904 3.75178 0.00005 0.002735 yes XLOC_031669 WT PAX6DKO OK 0.037515 2.31809 5.94935 2.0074 0.00005 0.002735 yes XLOC_022563 WT PAX6DKO OK 0.095407 7.08516 6.21456 3.36088 0.00005 0.002735 yes XLOC_030000 WT PAX6DKO OK 0.052009 7.44173 7.16075 1.21812 0.00055 0.020318 yes XLOC_019729 WT PAX6DKO OK 0.018947 2.79714 7.20584 0.529428 0.00005 0.002735 yes XLOC_022262 WT PAX6DKO OK 0 4.8627 inf #NAME? 0.00005 0.002735 yes XLOC_008457 WT PAX6DKO OK 0 0.505603 inf #NAME? 0.00005 0.002735 yes XLOC_030866 WT PAX6DKO OK 0 0.325478 inf #NAME? 0.00005 0.002735 yes XLOC_048664 WT PAX6DKO OK 0 1.1846 inf #NAME? 0.00005 0.002735 yes XLOC_026995 WT PAX6DKO OK 1.97436 0 #NAME? #NAME? 0.00005 0.002735 yes XLOC_050265 WT PAX6DKO OK 0.40988 0 #NAME? #NAME? 0.00005 0.002735 yes XLOC_053024 WT PAX6DKO OK 0.308936 0 #NAME? #NA ME? 0.00005 0.002735 yes XLOC_025713 WT PAX6DKO OK 6.35971 0 #NAME? #NAME? 0.00005 0.002735 yes XLOC_027001 WT PAX6DKO OK 0.354255 0 #NAME? #NAME? 0.00005 0.002735 yes XLOC_025714 WT PAX6DKO OK 0.776716 0 #NAME? #NAME? 0.00005 0.002735 yes XLOC_045348 WT PAX6DKO OK 1.04504 0 #NAME? #NAME? 0.00005 0.002735 yes XLOC_006399 WT PAX6DKO OK 2.05138 0 #NAME? #NAME? 0.00005 0.002735 yes

    TABLE-US-00005 TABLE 3 290 genes (PAX6 KO only) 109 genes (shared) 42 genes (PAX6D KO only) CBR1 KMO AL021368.4, GUSBP4, LINC00680 XIST, XIST_intron, Xist_exon4 VSX2 NIPAL2, RNU6-914P TBX2-AS1 ALDH1A1 DAPL1, OR7E28P, OR7E89P TBX2 HSD17B2 AL021368.2 CYP19A1 IAH1 TBX5 CLVS1 FOXE3 PAH AL391650.1 TYRP1 CTSF IQCA1 BHMT ZNF726, ZNF92P3 TYR DCT ZNF572 ZNF454 ZNF667-AS1 GAD2 AL117339.1, AL117339.2, AL117339.5, AL133217.1, AC020636.2, CLRN1, MINDY4B RAX HSD17B7P2, ZNF37A ZNF528 CDH20 HMX1 SIGLEC7 ZNF667 CSMD1 AC064802.1 PITX3 APCDD1L-AS1 AC104257.1 SYNPR DIO3OS, MIR1247 CTXND1 CP EIF3C SIX6 CLEC19A AC004160.1 AC011447.2, AC011447.3 FAM69C DIO3 ZPLD1 ERICH5 LHX9 MS4A6A CRYBB3 CLDN16 ZNF440 BARHL1 CRYZ ZMAT4 ATP6V1B1 DLK1 TRIM67 PAPPA2 RELN GLB1L3 AC034238.1, ESM1 SIX3-AS1 AC004947.2 LAMP5 LINC01833 SPHKAP MIR34A, MIR34AHG LMO1 KLHL14 AC015712.1, AC015712.4, AC015712.5, CBLN2 ACO15712.6, ALDH1A3 SLC30A8 PAX2 TCEAL5 ANOS1 QPCT RASGRF2 HDX PPP2R2B, RNA5SP196 LTBP2 CPA6 CCL2 SIX3 KCNB2 HRH1 ARPP21 AC064852.1, KCNJ13 AL589740.1 KRT17 NTRK2 DKK1 TKTL1 ZFP3 ADAMTS18 LAMC2 PDE1A CRYAB RORB MAB21L2 GRIA4 AC012354.1 AL133461.1, INPP5F CNTN5 BRINP1 WNT7A TNFRSF9 TGFB2, TGFB2-OT1 ELOVL3 VAX2 LRP2 GABRG3 SFRP2 CRIM1 ALX1 CCKBR MAGEA4 NR2F1 AL353608.3, PGM5 CFAP77 CYTIP POMC PMEL AQP5 LGR5 SPP1 CYP1B1, RMDN2-AS1 ZNF132 EIF3CL THSD7B CPM, PRELID2P1 IL15 AC138035.1 SPHK1 TMEFF2 LINC02365 CRABP1 PCDH17 C1orf186 FGF9 ANKRD34B DGKB GPD1 ZNF69 MIR5004, SYNGAP1, ZBTB9 FOXP2 MEIS1 SLN APCDD1L AMBN CRB1 POU3F2 SPOCK1 HAS1 TNC OPRK1 PPP1R14C SLC45A2 PROX1 P2RX3 GJA3 POU3F4 ADRB1 SCUBE2 PCDH9 HPGD KCNK2 SLC7A8 GJD2 PLPP4 AMIGO2 GHRHR LINC02506 EPHA3 HOMER2 LINC01508 AC108729.3, PLCH1 CBLN1 MAFA AC239809.3 SNCA AC012313.5 LRRC36 ZNF578 FZD5 COL9A2 SYNDIG1 GATA5 C8orf4 GATA3-AS1 C9orf47, S1PR3 SST COL14A1 VCAM1 PKDCC LINC00461, MIR9-2 AC099795.1, SLC2A1 AC011754.1, CTNNA2 MITF U2AF1L5 CLDN1 NR2E1 MAMDC2 ZFP42 NKX3-2 SPRR3 MAN1A1 DIRAS2 SHISA2 HTR1E CSPG5 AC020928.1 FAM129A SUSD4 AC018709.1, F11-AS1, MTNR1A SEMA3E CPAMD8 TBX3 CUBN GREM2 FAM222A MOXD1 BHLHE40 TMEM132E ACTC1 NXPH2 TSPAN12 HSPD1P6 AL117348.1, LEFTY2 DMBX1 IL32, RNU1-125P NCAM1 AC015522.1 PXDNL EFHD2 VAV3 COLGALT2 STS RAB31 EGF ZNF835 PALMD ZNF471 COL25A1 ZNF736 ADAMTS16 AL132657.1, ZNF248 TNFRSF11A AL451127.1 HAS2 PRODH LRFN5 109 genes (shared) APCDD1 KMO FGF19 VSX2 SLC8A3 ALDH1A1 CHRM4 HSD17B2 HEY2 IAH1 SEMA3A FOXE3 AL645608.1 TYRP1 BARHL2 BHMT PI15 DCT NDST4 ZNF667-AS1 AC022639.1 AC020636.2, CLRN1, MINDY4B EBF1 CDH20 VSTM4 ZNF667 MIR210HG PITX3 AC019117.2, AC019117.3, AHR SYNPR PLPPR5 CP AC098679.1, TMEM144 CLEC19A SLC1A3 FAM69C CNMD ERICH5 AC004540.1 CRYBB3 AC067942.1, TMEM150C BARHL1 KCND3 ATP6V1B1 ANXA1 PAPPA2 STRA6 AC034238.1, ESM1 SMAD9 LAMP5 CRYM MIR34A, MIR34AHG NLGN1 AC015712.1, AC015712.4, AC015712.5, AC015712.6, ALDH1A3 CNNM1 PAX2 C9orf64 QPCT SLC7A2 PPP2R2B, RNA5SP196 BFSP1 CCL2 DLX1 HRH1 AC011700.1, PROX1-AS1 AL589740.1 PLSCR1 DKK1 PCDH11X ADAMTS18 CXCL12 CRYAB ZNF501 GRIA4 LMO3 CNTN5 RCAN2 TNFRSF9 LGR4 VAX2 CXCL5 SFRP2 ZNF354C CCKBR FOXD2-AS1 AL353608.3, PGM5 COL13A1 CYTIP USP43 PMEL AC099524.1, PLCG2, RN7SKP176 LGR5 ADCY2 CYP1B1, RMDN2-AS1 CYP1B1-AS1, RPL7P12 EIF3CL MIR205, MIR205HG CPM, PRELID2P1 WNT1 AC138035.1 ROBO2 TMEFF2 CLCN6, NPPA-AS1, NPPA-AS1_1, NPPA-AS1_2, CRABP1 NPPA-AS1_3 RAI2 C1orf186 PLP1 ANKRD34B LINC01018 GPD1 GATM MIR5004, SYNGAP1, ZBTB9 GPR37 MEIS1 ABCA4 APCDD1L PDE3A CRB1 UNC5C SPOCK1 LRRC3B TNC ADGRG2 PPP1R14C WSCD2 PROX1 LIMCH1 GJA3 DSC3 ADRB1 BMPR1B PCDH9 GPR137B KCNK2 TCERG1L GJD2 FAM198B AMIGO2 UAP1L1 LINC02506 CA8 HOMER2 PLCL1 AC108729.3, PLCH1 RASGEF1B MAFA DMRT3 SNCA HDAC9 LRRC36 LUM FZD5 NOTUM SYNDIG1 AC079779.3 C8orf4 LINC00648 C9orf47, S1PR3 OLFM3 COL14A1 RASSF2 PKDCC LDHA AC099795.1, SLC2A1 MAP7 MITF SOCS2 CLDN1 FOXI3 MAMDC2 ZNF542P NKX3-2 PFKFB4, UCN2 MAN1A1 ADCYAP1R1 SHISA2 GABRA3 CSPG5 NAALAD2 FAM129A ITGB8 AC018709.1, F11-AS1, MTNR1A MPP1 CPAMD8 FAM83B CUBN S1PR1 FAM222A MIR124-2HG BHLHE40 SFRP1 ACTC1 TOX TSPAN12 WDR76 AL117348.1, LEFTY2 CNTN4 IL32, RNU1-125P SCG2 AC015522.1 RHOBTB1 EFHD2 ACKR3 COLGALT2 TUBB2A RAB31 DCBLD2 ZNF835 SUCO ZNF471 STC1 ZNF736 HK2 AL132657.1, ZNF248 FAM111B AL451127.1 HTRA1 PRODH DSC2 109 genes (shared) SYT1 KMO MTUS1 VSX2 EFNB2 ALDH1A1 AL645608.3, AL645608.5 HSD17B2 PLCE1 IAH1 TSHZ1 FOXE3 CTNND2 TYRP1 MAFB BHMT SOSTDC1 DCT LHFPL6 ZNF667-AS1 AC011504.1, ZNF536 AC020636.2, CLRN1, MINDY4B AC245748.1, AC245748.2, ZNF112, ZNF229, CDH20 ZNF285 CXXC4 ZNF667 GABRP PITX3 P3H2 SYNPR DUSP9 CP S100A6 CLEC19A HMGA2 FAM69C CNTFR ERICH5 JCAD CRYBB3 GPM6A BARHL1 SIPA1L2 ATP6V1B1 LYPD6B PAPPA2 SLC35G1 AC034238.1, ESM1 STC2 LAMP5 VTCN1 MIR34A, MIR34AHG ME1 AC015712.1, AC015712.4, AC015712.5, AC015712.6, ALDH1A3 SOX3 PAX2 ID3 QPCT KANK4 PPP2R2B, RNA5SP196 GAS7 CCL2 TLE1 HRH1 LRP4 AL589740.1 PRSS35 DKK1 FABP3 ADAMTS18 SLC35F2 CRYAB AL121776.1, EYA2 GRIA4 ID2 CNTN5 ADAM12 TNFRSF9 BNIP3 VAX2 AFAP1L2 SFRP2 BTBD11, Y_RNA CCKBR ZNF595 AL353608.3, PGM5 TEX41 CYTIP ESRP1 PMEL IFI16 LGR5 ARL4A CYP1B1, RMDN2-AS1 SORCS1 EIF3CL TGFBI CPM, PRELID2P1 MSX2 AC138035.1 LYN TMEFF2 TMEM132D CRABP1 FGFR3 C1orf186 PLEKHG4B ANKRD34B EMILIN3 GPD1 MYH14 MIR5004, SYNGAP1, ZBTB9 PUDP MEIS1 SLC2A3 APCDD1L CRYAA CRB1 LINC01474 SPOCK1 AL035252.2 TNC AP001360.2 PPP1R14C AL136141.1 PROX1 RGS22 GJA3 ZXDA ADRB1 THNSL2 PCDH9 AC104117.3 KCNK2 AL390198.1 GJD2 AL589843.1 AMIGO2 ZNF441 LINC02506

    REFERENCES

    [0126] 1. Antinucci, P., Nikolaou, N., Meyer, M. P., and Hindges, R. (2013). Teneurin-3 specifies morphological and functional connectivity of retinal ganglion cells in the vertebrate visual system. Cell Rep 5, 582-592. [0127] Ashery-Padan, R., Marquardt, T., Zhou, X., and Gruss, P. (2000). Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye. Genes Dev 14, 2701-2711. [0128] Bernard, M., and Voisin, P. (2008). Photoreceptor-specific expression, light-dependent localization, and transcriptional targets of the zinc-finger protein Yin Yang 1 in the chicken retina. J Neurochem 105, 595-604. [0129] Burmeister, M., Novak, J., Liang, M. Y., Basu, S., Ploder, L., Hawes, N. L., Vidgen, D., Hoover, F., Goldman, D., Kalnins, V. I., et al. (1996). Ocular retardation mouse caused by Chx10 homeobox null allele: impaired retinal progenitor proliferation and bipolar cell differentiation. Nat Genet 12, 376-384. [0130] Capes-Davis, A., Tolhurst, O., Dunn, J. M., and Jeffrey, P. L. (2005). Expression of doublecortin (DCX) and doublecortin-like kinase (DCLK) within the developing chick brain. Dev Dyn 232, 457-467. [0131] Capowski, E. E., Wright, L. S., Liang, K., Phillips, M. J., Wallace, K., Petelinsek, A., Hagstrom, A., Pinilla, I., Borys, K., Lien, J., et al. (2016). Regulation of WNT Signaling by VSX2 During Optic Vesicle Patterning in Human Induced Pluripotent Stem Cells. Stem Cells 34, 2625-2634. [0132] Cavodeassi, F., Carreira-Barbosa, F., Young, R. M., Concha, M. L., Allende, M. L., Houart, C., Tada, M., and Wilson, S. W. (2005). Early stages of zebrafish eye formation require the coordinated activity of Wnt11, Fz5, and the Wnt/beta-catenin pathway. Neuron 47, 43-56. [0133] Chambers, S. M., Fasano, C. A., Papapetrou, E. P., Tomishima, M., Sadelain, M., and Studer, L. (2009). Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol 27, 275-280. [0134] Chen, J., Ma, L., Wang, S., Wang, X., Sun, Y., Gao, L., Li, J., and Zhou, G. (2017). Analysis of expression of transcription factors in early human retina. Int J Dev Neurosci 60, 94-102. [0135] Chen, Y., Cao, J., Xiong, M., Petersen, A. J., Dong, Y., Tao, Y., Huang, C. T., Du, Z., and Zhang, S. C. (2015). Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell 17, 233-244. [0136] Collinson, J. M., Hill, R. E., and West, J. D. (2000). Different roles for Pax6 in the optic vesicle and facial epithelium mediate early morphogenesis of the murine eye. Development 127, 945-956. [0137] Couillard-Despres, S., Winner, B., Schaubeck, S., Aigner, R., Vroemen, M., Weidner, N., Bogdahn, U., Winkler, J., Kuhn, H. G., and Aigner, L. (2005). Doublecortin expression levels in adult brain reflect neurogenesis. Eur J Neurosci 21, 1-14. [0138] Dharmaratne, N., Glendining, K. A., Young, T. R., Tran, H., Sawatari, A., and Leamey, C. A. (2012). Ten-m3 is required for the development of topography in the ipsilateral retinocollicular pathway. PLoS One 7, e43083. [0139] Du, Z. W., Chen, H., Liu, H., Lu, J., Qian, K., Huang, C. L., Zhong, X., Fan, F., and Zhang, S. C. (2015). Generation and expansion of highly pure motor neuron progenitors from human pluripotent stem cells. Nat Commun 6, 6626. [0140] Epstein, J. A., Glaser, T., Cai, J., Jepeal, L., Walton, D. S., and Maas, R. L. (1994). Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev 8, 2022-2034. [0141] Georgala, P. A., Carr, C. B., and Price, D. J. (2011). The role of Pax6 in forebrain development. Dev Neurobiol 71, 690-709. [0142] Glaser, T., Walton, D. S., and Maas, R. L. (1992). Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat Genet 2, 232-239. [0143] Glendining, K. A., Liu, S. C., Nguyen, M., Dharmaratne, N., Nagarajah, R., Iglesias, M. A., Sawatari, A., and Leamey, C. A. (2017). Downstream mediators of Ten-m3 signalling in the developing visual pathway. BMC Neurosci 18, 78. [0144] Green, E. S., Rendahl, K. G., Zhou, S., Ladner, M., Coyne, M., Srivastava, R., Manning, W. C., and Flannery, J. G. (2001). Two animal models of retinal degeneration are rescued by recombinant adeno-associated virus-mediated production of FGF-5 and FGF-18. Mol Ther 3, 507-515. [0145] Grindley, J. C., Davidson, D. R., and Hill, R. E. (1995). The role of Pax-6 in eye and nasal development. Development 121, 1433-1442. [0146] Heavner, W., and Pevny, L. (2012). Eye development and retinogenesis. Cold Spring Harb Perspect Biol 4. [0147] Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Hanson, I. M., Prosser, J., Jordan, T., Hastie, N. D., and van Heyningen, V. (1991). Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354, 522-525. [0148] Hogan, B. L., Hirst, E. M., Horsburgh, G., and Hetherington, C. M. (1988). Small eye (Sey): a mouse model for the genetic analysis of craniofacial abnormalities. Development 103 Suppl, 115-119. [0149] Hogan, B. L., Horsburgh, G., Cohen, J., Hetherington, C. M., Fisher, G., and Lyon, M. F. (1986). Small eyes (Sey): a homozygous lethal mutation on chromosome 2 which affects the differentiation of both lens and nasal placodes in the mouse. J Embryol Exp Morphol 97, 95-110. [0150] Horsford, D. J., Nguyen, M. T., Sellar, G. C., Kothary, R., Arnheiter, H., and McInnes, R. R. (2005). Chx10 repression of Mitf is required for the maintenance of mammalian neuroretinal identity. Development 132, 177-187. [0151] Huang, C. T., Tao, Y., Lu, J., Jones, J. R., Fowler, L., Weick, J. P., and Zhang, S. C. (2016). Time-Course Gene Expression Profiling Reveals a Novel Role of Non-Canonical WNT Signaling During Neural Induction. Sci Rep 6, 32600. [0152] Huang, H., Wahlin, K. J., McNally, M., Irving, N. D., and Adler, R. (2008). Developmental regulation of muscleblind-like (MBNL) gene expression in the chicken embryo retina. Dev Dyn 237, 286-296. [0153] Jami, A., Gadi, J., Lee, M. J., Kim, E. J., Lee, M. J., Jung, H. S., Kim, H. H., and Lim, S. K. (2013). Pax6 expressed in osteocytes inhibits canonical Wnt signaling. Mol Cells 35, 305-312. [0154] Jones, L., Lopez-Bendito, G., Gruss, P., Stoykova, A., and Molnar, Z. (2002). Pax6 is required for the normal development of the forebrain axonal connections. Development 129, 5041-5052. [0155] Kamachi, Y., Uchikawa, M., Collignon, J., Lovell-Badge, R., and Kondoh, H. (1998). Involvement of Sox1, 2 and 3 in the early and subsequent molecular events of lens induction. Development 125, 2521-2532. [0156] Kammandel, B., Chowdhury, K., Stoykova, A., Aparicio, S., Brenner, S., and Gruss, P. (1999). Distinct cis-essential modules direct the time-space pattern of the Pax6 gene activity. Dev Biol 205, 79-97. [0157] Kim, J., and Lauderdale, J. D. (2006). Analysis of Pax6 expression using a BAC transgene reveals the presence of a paired-less isoform of Pax6 in the eye and olfactory bulb. Dev Biol 292, 486-505. [0158] Kim, J., and Lauderdale, J. D. (2008). Overexpression of pairedless Pax6 in the retina disrupts corneal development and affects lens cell survival. Dev Biol 313, 434-454. [0159] Kitaoka, T., Aotaki-Keen, A. E., and Hjelmeland, L. M. (1994). Distribution of FGF-5 in the rhesus macaque retina. Invest Ophthalmol Vis Sci 35, 3189-3198. [0160] Kleinjan, D. A., Seawright, A., Childs, A. J., and van Heyningen, V. (2004). Conserved elements in Pax6 intron 7 involved in (auto)regulation and alternative transcription. Dev Biol 265, 462-477. [0161] Klimova, L., and Kozmik, Z. (2014). Stage-dependent requirement of neuroretinal Pax6 for lens and retina development. Development 141, 1292-1302. [0162] Kwon, H. J., and Chung, H. M. (2003). Yin Yang 1, a vertebrate polycomb group gene, regulates antero-posterior neural patterning. Biochem Biophys Res Commun 306, 1008-1013. [0163] Lad, E. M., Cheshier, S. H., and Kalani, M. Y. (2009). Wnt-signaling in retinal development and disease. Stem Cells Dev 18, 7-16. [0164] Lako, M., Lindsay, S., Bullen, P., Wilson, D. I., Robson, S. C., and Strachan, T. (1998). A novel mammalian wnt gene, WNT8B, shows brain-restricted expression in early development, with sharply delimited expression boundaries in the developing forebrain. Hum Mol Genet 7, 813-822. [0165] Lakowski, J., Majumder, A., and Lauderdale, J. D. (2007). Mechanisms controlling Pax6 isoform expression in the retina have been conserved between teleosts and mammals. Dev Biol 307, 498-520. [0166] Li, S., Goldowitz, D., and Swanson, D. J. (2007). The requirement of pax6 for postnatal eye development: evidence from experimental mouse chimeras. Invest Ophthalmol Vis Sci 48, 3292-3300. [0167] Liu, H., Mohamed, O., Dufort, D., and Wallace, V. A. (2003). Characterization of Wnt signaling components and activation of the Wnt canonical pathway in the murine retina. Dev Dyn 227, 323-334. [0168] Liu, H., Thurig, S., Mohamed, O., Dufort, D., and Wallace, V. A. (2006). Mapping canonical Wnt signaling in the developing and adult retina. Invest Ophthalmol Vis Sci 47, 5088-5097. [0169] Liu, W. (2012). Focus on molecules: Wnt8b: a suppressor of early eye and retinal progenitor formation. Exp Eye Res 101, 113-114. [0170] Liu, W., Lagutin, O., Swindell, E., Jamrich, M., and Oliver, G. (2010). Neuroretina specification in mouse embryos requires Six3-mediated suppression of Wnt8b in the anterior neural plate. J Clin Invest 120, 3568-3577. [0171] Lorente, M., Perez, C., Sanchez, C., Donohoe, M., Shi, Y., and Vidal, M. (2006). Homeotic transformations of the axial skeleton of YY1 mutant mice and genetic interaction with the Polycomb group gene Ring1/Ring1A. Mech Dev 123, 312-320. [0172] Mall, M., Kareta, M. S., Chanda, S., Ahlenius, H., Perotti, N., Zhou, B., Grieder, S. D., Ge, X., Drake, S., Euong Ang, C., et al. (2017). Mytll safeguards neuronal identity by actively repressing many non-neuronal fates. Nature 544, 245-249. [0173] Marquardt, T., Ashery-Padan, R., Andrejewski, N., Scardigli, R., Guillemot, F., and Gruss, P. (2001). Pax6 is required for the multipotent state of retinal progenitor cells. Cell 105, 43-55. [0174] Meyer, J. S., Howden, S. E., Wallace, K. A., Verhoeven, A. D., Wright, L. S., Capowski, E. E., Pinilla, I., Martin, J. M., Tian, S., Stewart, R., et al. (2011). Optic vesicle-like structures derived from human pluripotent stem cells facilitate a customized approach to retinal disease treatment. Stem Cells 29, 1206-1218. [0175] Meyer, J. S., Shearer, R. L., Capowski, E. E., Wright, L. S., Wallace, K. A., McMillan, E. L., Zhang, S. C., and Gamm, D. M. (2009). Modeling early retinal development with human embryonic and induced pluripotent stem cells. Proc Natl Acad Sci USA 106, 16698-16703. [0176] Miles, A., and Tropepe, V. (2016). Coordinating progenitor cell cycle exit and differentiation in the developing vertebrate retina. Neurogenesis (Austin) 3, e1161697. [0177] Phillips, M. J., Perez, E. T., Martin, J. M., Reshel, S T., Wallace, K. A., Capowski, E. E., Singh, R., Wright, L. S., Clark, E. M., Barney, P. M., et al. (2014). Modeling human retinal development with patient-specific induced pluripotent stem cells reveals multiple roles for visual system homeobox 2. Stem Cells 32, 1480-1492. [0178] Quinn, J. C., West, J. D., and Hill, R. E. (1996). Multiple functions for Pax6 in mouse eye and nasal development. Genes Dev 10, 435-446. [0179] Raviv, S., Bharti, K., Rencus-Lazar, S., Cohen-Tayar, Y., Schyr, R., Evantal, N., Meshorer, E., Zilberberg, A., Idelson, M., Reubinoff, B., et al. (2014). PAX6 regulates melanogenesis in the retinal pigmented epithelium through feed-forward regulatory interactions with MITF. PLoS Genet 10, e1004360. [0180] Romm, E., Nielsen, J. A., Kim, J. G., and Hudson, L. D. (2005). Mytl family recruits histone deacetylase to regulate neural transcription. J Neurochem 93, 1444-1453. [0181] Rousso, D. L., Qiao, M., Kagan, R. D., Yamagata, M., Palmiter, R. D., and Sanes, J. R. (2016). Two Pairs of ON and OFF Retinal Ganglion Cells Are Defined by Intersectional Patterns of Transcription Factor Expression. Cell Rep 15, 1930-1944. [0182] Sato, C., Iwai-Takekoshi, L., Ichikawa, Y., and Kawasaki, H. (2017). Cell type-specific expression of FoxP2 in the ferret and mouse retina. Neurosci Res 117, 1-13. [0183] Shaham, O., Menuchin, Y., Farhy, C., and Ashery-Padan, R. (2012). Pax6: a multi-level regulator of ocular development. Prog Retin Eye Res 31, 351-376. [0184] Tao, Y., and Zhang, S. C. (2016). Neural Subtype Specification from Human Pluripotent Stem Cells. Cell Stem Cell 19, 573-586. [0185] Vasconcelos, F. F., Sessa, A., Laranjeira, C., Raposo, A., Teixeira, V., Hagey, D. W., Tomaz, D. M., Muhr, J., Broccoli, V., and Castro, D. S. (2016). MyTI Counteracts the Neural Progenitor Program to Promote Vertebrate Neurogenesis. Cell Rep 17, 469-483. [0186] Vuong, L., Brobst, D. E., Saadi, A., Ivanovic, I., and Al-Ubaidi, M. R. (2012). Pattern of expression of p53, its family members, and regulators during early ocular development and in the post-mitotic retina. Invest Ophthalmol Vis Sci 53, 4821-4831. [0187] Wang, X., Xiong, K., Lin, C., Lv, L., Chen, J., Xu, C., Wang, S., Gu, D., Zheng, H., Yu, H., et al. (2015). New medium used in the differentiation of human pluripotent stem cells to retinal cells is comparable to fetal human eye tissue. Biomaterials 53, 40-49. [0188] Wittenmayer, N., Korber, C., Liu, H., Kremer, T., Varoqueaux, F., Chapman, E. R., Brose, N., Kuner, T., and Dresbach, T. (2009). Postsynaptic Neuroligin1 regulates presynaptic maturation. Proc Natl Acad Sci USA 106, 13564-13569. [0189] Wong, L., Power, N., Miles, A., and Tropepe, V. (2015). Mutual antagonism of the paired-type homeobox genes, vsx2 and dmbxl, regulates retinal progenitor cell cycle exit upstream of ccndl expression. Dev Biol 402, 216-228. [0190] Wong, L., Weadick, C. J., Kuo, C., Chang, B. S., and Tropepe, V. (2010). Duplicate dmbxl genes regulate progenitor cell cycle and differentiation during zebrafish midbrain and retinal development. BMC Dev Biol 10, 100. [0191] Yuan, F., Fang, K. H., Cao, S. Y., Qu, Z. Y., Li, Q., Krencik, R., Xu, M., Bhattacharyya, A., Su, Y. W., Zhu, D. Y., et al. (2015). Efficient generation of region-specific forebrain neurons from human pluripotent stem cells under highly defined condition. Sci Rep 5, 18550. [0192] Zhang, X., Huang, C. T., Chen, J., Pankratz, M. T., Xi, J., Li, J., Yang, Y., Lavaute, T. M., Li, X. J., Ayala, M., et al. (2010). Pax6 is a human neuroectoderm cell fate determinant. Cell Stem Cell 7, 90-100. [0193] Zhong, X., Gutierrez, C., Xue, T., Hampton, C., Vergara, M. N., Cao, L. H., Peters, A., Park, T. S., Zambidis, E. T., Meyer, J. S., et al. (2014). Generation of three-dimensional retinal tissue with functional photoreceptors from human iPSCs. Nat Commun 5, 4047.