Method for preparing L-aspartic acid with maleic acid by whole-cell biocatalysis
10837036 ยท 2020-11-17
Assignee
Inventors
- Zhemin ZHOU (Wuxi, CN)
- Long Yu (Wuxi, CN)
- Li ZHOU (Wuxi, CN)
- Wenjing CUI (Wuxi, CN)
- Zhongmei LIU (Wuxi, CN)
- Junling GUO (Wuxi, CN)
Cpc classification
C12Y403/01001
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to the technical field of bioengineering, and discloses a method for synthesizing L-aspartic acid with maleic acid by whole-cell biocatalysis. In the invention, a recombinant strain co-expressing maleate cis-trans isomerase and L-aspartate lyase is constructed, and engineered and optimized to produce L-aspartic acid from maleic acid with a high conversion rate by whole-cell catalyzing. Relatively inexpensive maleic acid is utilized by the recombinant strain to produce L-aspartic acid, where maleic acid is reacted completely in 40-120 min, there is almost no buildup of the intermediate fumaric acid, and the conversion rate is up to 98% or more.
Claims
1. A recombinant strain co-expressing maleate cis-trans isomerase and L-aspartate lyase, wherein the recombinant strain is produced by expressing, in Escherichia coli as a host, a recombinant expression vector pRSFDuet-1-maiA-aspA constructed with pRSFDuet-1 which is used as an expression vector.
2. The recombinant strain as claimed in claim 1, wherein the Escherichia coli is Escherichia coli BL21 (DE3) fumAC with fumA-fumC gene knockout from the genome.
3. The recombinant strain co-expressing maleate cis-trans isomerase and L-aspartate lyase as claimed in claim 1, wherein the gene encoding the maleate cis-trans isomerase has: a nucleotide sequence as shown in SEQ ID NO:2; or a nucleotide sequence as shown in SEQ ID NO:2 in which the glycine at position 27 is mutated into alanine and the glycine at position 171 is mutated into alanine; or a nucleotide sequence as shown in SEQ ID NO:2 in which the glycine at position 27 is mutated into alanine and the lysine at position 104 is mutated into arginine.
4. The recombinant strain co-expressing maleate cis-trans isomerase and L-aspartate lyase as claimed in claim 1, wherein the gene encoding the L-aspartate lyase has a nucleotide sequence as shown in SEQ ID NO:4.
5. The recombinant strain co-expressing maleate cis-trans isomerase and L-aspartate lyase as claimed in claim 4, wherein the Ribosome Binding Site (RBS) sequence in the gene encoding the L-aspartate lyase is replaced by the sequence as shown in SEQ ID NO:23, SEQ ID NO:24, or SEQ ID NO:25.
6. A method for preparing L-aspartic acid, comprising: culturing a recombinant strain co-expressing maleate cis-trans isomerase and L-aspartate lyase in a culture medium comprising maleic acid, wherein the recombinant strain is able to catalyze the substrate maleic acid in the culture medium to produce the L-aspartic acid, wherein the recombinant strain co-expressing maleate cis-trans isomerase and L-aspartate lyase is Escherichia coli which has been transformed with recombinant expression vector pRSFDuet-1-maiA-aspA constructed with pRSFDuet-1 that is an expression vector.
7. The method for preparing L-aspartic acid as claimed in claim 6, wherein the maleate cis-trans isomerase is derived from Serratia marcescens, and the L-aspartate lyase is derived from Escherichia coli.
8. The method for preparing L-aspartic acid as claimed in claim 7, wherein the Escherichia coli is Escherichia coli BL21 (DE3) fumAC with fumA-fumC gene knockout from the genome.
9. The method for preparing L-aspartic acid as claimed in claim 6, wherein the gene encoding the maleate cis-trans isomerase has: a nucleotide sequence as shown in SEQ ID NO:2; or a nucleotide sequence as shown in SEQ ID NO:2 in which the glycine at position 27 is mutated into alanine and the glycine at position 171 is mutated into alanine; or a nucleotide sequence as shown in SEQ ID NO:2 in which the glycine at position 27 is mutated into alanine and the lysine at position 104 is mutated into arginine.
10. The method for preparing L-aspartic acid as claimed in claim 6, wherein the gene encoding the L-aspartate lyase has a nucleotide sequence as shown in SEQ ID NO:4.
11. The method for preparing L-aspartic acid as claimed in claim 10, wherein the Ribosome Binding Site (RBS) sequence in the gene encoding the L-aspartate lyase is replaced by the sequence as shown in SEQ ID NO:23, SEQ ID NO:24, or SEQ ID NO:25.
12. The method for preparing L-aspartic acid as claimed in claim 6, wherein a 2 M maleic acid solution of pH 8.0 is used as a substrate, and a resting cell suspension of the recombinant strain having a cell concentration with OD.sub.600 of 40 is added for catalyzing, in which the volume ratio of the resting cell suspension to the maleic acid solution is 2:8.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(9) The invention will be further illustrated in more detail with reference to the accompanying drawings and embodiments. It is noted that, the following embodiments only are intended for purposes of illustration, but are not intended to limit the scope of the present invention.
(10) Detection Methods for Maleic Acid, Fumaric Acid, and L-Aspartic Acid:
(11) The concentrations of maleic acid, fumaric acid, and L-aspartic acid are all detected by high-performance liquid chromatography (HPLC). The detection conditions for maleic acid and fumaric acid by HPLC include: chromatographic column: Prevail Organic Acid (250 mm4.6 mm, 5 m; Grace Davison Discovery Sciences); mobile phase: pH 2.5, 25 mM K.sub.2HPO.sub.4 solution, flow rate 1 mL/min; column temperature: 40 C.; wavelength of UV detector: 210 nm; and injection volume: 10 L. The detection of L-aspartic acid comprises derivatization with phenyl isothiocyanate (PITC) to attach a phenyl ring to the amino terminus for convenient separation. The method of derivatization comprises adding 250 L of 1 M triethyl amine-acetonitrile solution and 250 L of 0.1 M PITC-acetonitrile solution to 500 L of the reaction solution, mixing uniformly by shaking, and reacting for 1 h in the dark. After derivatization, the residual derivatization reagent is extracted out with 700 L of n-hexane by shaking for 30 s, and the reaction solution is allowed to stand. After the reaction solution was obviously layered, the lower solution was pipetted and filtered with a 0.22 m needle-type organic filter. Detection conditions by HPLC: chromatographic column: La Chrom C18 (5 m, 4.6 mm250 mm), and gradient elution with a mobile phase A of 80% acetonitrile solution and a mobile phase B of 0.1 M sodium acetate-acetonitrile solution (97:3); gradient elution conditions: gradient from 95% to 65% of mobile phase B over 0-35 min; gradient from 65% to 95% of mobile phase B over 35-40 min; 95% of mobile phase B over 40-45 min; detection temperature 40 C., and detection wavelength 254 nm.
Embodiment 1
(12) Construction of a Recombinant Strain Co-Expressing Maleate Cis-Trans Isomerase and L-Aspartate Lyase
(13) 1) The maleate cis-trans isomerase has an amino acid sequence as shown in SEQ ID NO:1, and the gene encoding the maleate cis-trans isomerase has a nucleotide sequence as shown in SEQ ID NO:2. The L-aspartate lyase has an amino acid sequence as shown in SEQ ID NO:3, and the gene encoding the L-aspartate lyase has a nucleotide sequence as shown in SEQ ID NO:4. According to the target gene and the vector, the cleavage sites were selected and the primers were designed (see Table 1).
(14) TABLE-US-00001 TABLE1 Designofadapterprimerforcleavage Cleavage Gene Primer Primersequence(5---3) site maiA P1 TTTGGATCCGATGAGCAACCACTACCGC BamHI ATCG P2 TTTAAGCTTTCAATAAGCGCCGGACAGCAG HindIII P3 TTTCATATGAGCAACCACTACCGCATCG NdeI P4 TTTCTCGAGTCAATAAGCGCCGGACAGCAG XhoI P5 TTTAAGCTTATGAGCAACCACTACCGCATCG HindIII aspA P6 TTTGGATCCGATGTCAAACAACATTCGTA BamHI TCGAAG P7 TTTAAGCTTTTACTGTTCGCTTTCATCAG HindIII TATAGCGT P8 TTTCATATGTCAAACAACATTCGTATCGA NdeI AGAAG P9 TTTCTCGAGTTACTGTTCGCTTTCATCAG XhoI TATAGCGT P10 TTTAAGCTTATGTCAAACAACATTCGTAT HindIII CGAAG Note: The underlined sequences are the cleavage sites
(15) 2) PCR was carried out using pET-24a (+)-maiA and pET-28a (+)-aspA as templates, respectively, to obtain maiA and aspA gene fragments with different cleavage sites as shown in
(16) 3) The PCR fragments were purified and cleaved with two corresponding enzymes for 2 h. The corresponding plasmid vectors pRSF.sub.Duet-1, pET.sub.Duet-1, and pET-28a(+) were cleaved with two corresponding enzymes for 2 h, and then the cleaved products were recovered by gel extraction, and purified.
(17) 4) The concentrations of the recovered gene and vector fragments were determined by a nucleic acid quantification instrument. The gene and vector fragments were mixed at a ratio of gene fragment: vector fragment=3:1, and then T.sub.4 DNA ligase was added for ligation at 16 C. overnight.
(18) 5) The ligation product was transformed into competent JM109 cells, and then plated onto a corresponding antibiotic-resistant LB plate of the vector.
(19) 6) Verification by colony PCR was performed first, then a single colony was picked up to 5 mL of LB liquid test medium (10 g peptone, 5 g yeast extract, and 10 g NaCl, to make 1 L) with antibiotic concentration of 50 g/mL, and cultured at 37 C. and 200 rpm for 8 h. The plasmid was extracted, cleaved by two enzymes, and verified (
(20) 7) The recombinant plasmid sequenced to be correct was transformed into the competent host cells E. coli BL21 (DE3) fumAC (where the E. coli BL21 (DE3) fumAC is produced as described in Fang Yueqin, Zhou Li, Zhou Zhemin. Efficient Production of Fumarate from Maleate Using Recombinant E. coli as Whole Cell Biocatalyst [J]. Journal of Food Science and Biotechnology, 2016, 35(12):1323-1329.), and then coated onto a corresponding antibiotic-resistant LB plate of the vector. Single colonies were picked up to obtain six co-expression systems: pMA 1: pET-28a (+)-maiA-aspA; pAM 1: pET-28a (+)-aspA-maiA; pMA 2: pRSFDuet-1-maiA-aspA; pAM 2: pRSFDuet-1-aspA-maiA; pMA 3: pRSFDuet-1-maiA-pETDuet-1-aspA; and pAM 3: pRSFDuet-1-aspA-pETDuet-1-maiA 6.
(21) 8) A single colony was picked up, inoculated into 5 mL of LB medium with antibiotic concentration of 50 g/mL, incubated at 37 C. and 200 rpm for 8 h, and then transferred to a 250 mL shake flask containing 50 mL of 2 YT medium (16 g peptone, 10 g yeast extract, and 5 g NaCl, to make 1 L) with an antibiotic concentration of 50 g/mL by inoculating in an amount of 2%, and incubated at 37 C. and 200 rpm until the OD was 0.8. Then IPTG was added at a final concentration of 0.2 mmol/L to induce the expression at 20 C. for 20 h.
(22) 9) The same amount of cells induced to express were taken, collected by centrifugation, resuspended in 50 mM Na.sub.2HPO.sub.4KH.sub.2PO.sub.4 buffer of pH 8.0, and ultrasonically homogenized to obtain a crude enzyme solution. The expression of the target proteins was analyzed by SDS-PAGE analysis (as shown in
(23) TABLE-US-00002 TABLE 2 Comparison of the catalytic effects for 200 mM maleate of crude enzymes from recombinant strains Intermediate End product Recombinant Substrate product (L-aspartic strain (maleate) mM (fumarate) mM acid) mM pMA 1 156.3 0.8 49.1 pAM 1 170.7 0.5 30.8 pMA 2 41.4 0.2 161.2 pAM 2 200 0 0 pMA 3 134.8 0.1 65.1 pAM 3 138.4 0.1 63.6
Embodiment 2
(24) Production of L-Aspartic Acid from Maleic Acid by Whole-Cell Biocatalysis by the Recombinant Strain pMA 2 Co-Expressing Maleate Cis-Trans Isomerase and L-Aspartate Lyase
(25) A maleic acid solution (pH 8.0) was formulated, and wherein the pH of the maleic acid solution was adjusted to 8.0 with aqueous ammonia. The pMA 2 cells induced to express in embodiment 1 were collected, re-suspended in 50 mM Na.sub.2HPO.sub.4KH.sub.2PO.sub.4 buffer (pH 8.0), and diluted to an OD.sub.600 of 40. Then, 20% (by volume) of the resting cells was mixed with 80% (by volume) of the substrate maleic acid to give a reaction system of 30 mL. The reaction was catalyzed in a shaker at 200 r/min and 37 C., and samples were taken every 20 minutes to determine the contents of maleic acid, fumaric acid and L-aspartic acid in the reaction solution. As shown in
Embodiment 3
(26) Engineering of RBS in the MaiA Gene Sequence
(27) (1) RBS sequences with different rates of translation initiation were predicted by the RBS Calculator software. Four RBS sequences with different rates of translation initiation were selected, and primers were designed (Table 3).
(28) TABLE-US-00003 TABLE3 PrimerdesignforengineeringofRBSinMaiA Initiation rateofRBS translation Primer Primersequence(5---3) 90504.51 maiA-1up CGAAAATCCCTAAGGAGCTTAAGCATGGGCAGCAGCCATCACCAT CATCACC(SEQIDNO:15) maiA-1down GCTTAAGCTCCTTAGGGATTTTCGATTAAAGTTAAACAAAATTAT TTCTACAGGGGAATTGTTATCCGCTC(SEQIDNO:16) 212828.18 maiA-2up CATCACCGTTAGACGAGGAGGTATCCTATGGGCAGCAGCCATCAC CATCATCACC(SEQIDNO:17) maiA-2down AGGATACCTCCTCGTCTAACGGTGATGATTAAAGTTAAACAAAAT TATTTCTACAGGGGAATTGTTATCCGCTC(SEQIDNO:18) 318342.84 maiA-3up AATACCCTACTAAGGAGGTAAGCATGGGCAGCAGCCATCACCATC ATCACC(SEQIDNO:19) maiA-3down GCTTACCTCCTTAGTAGGGTATTATTAAAGTTAAACAAAATTATT TCTACAGGGGAATTGTTATCCGCTC(SEQIDNO:20) 370978.54 maiA-4up GAACTCGAACATAGTCTTAAGGAGGTTCAAATGGGCAGCAGCCAT CACCATCATCACC(SEQIDNO:21) maiA-4down TTGAACCTCCTTAAGACTATGTTCGAGTTCATTAAAGTTAAACAAA ATTATTTCTACAGGGGAATTGTTATCCGCTC(SEQIDNO:22) Note: The RBS sequences predicted by the RBS Calculator are underlined in italics.
(29) (2) Using pMA 2 as a template, the original RBS sequence of MaiA in pRSFDuet-1-maiA-aspA was replaced by whole plasmid PCR, and the PCR product was digested overnight with DpnI.
(30) (3) The digested product was transformed into competent JM109 cells and then plated onto an LB plate with kanamycin.
(31) (4) Single colonies were picked for sequencing, and the correctly mutated recombinant plasmid mutants were transformed into the expression host competent E. coli BL21 (DE3) fumAC cells, and then plated onto an LB plate with kanamycin to obtain four strains expressing MaiA having RBS with different rates of translation initiation, that is, pMA 2-1, pMA 2-2, pMA 2-3, and pMA 2-4.
(32) (5) Single colonies were picked and inoculated respectively into 5 mL of LB medium with antibiotic concentration of 50 g/mL, cultured at 37 C. and 200 rpm for 8 h, and then transferred to a 250 mL shake flask containing 50 mL of 2 YT medium (16 g peptone, 10 g yeast extract, and 5 g NaCl, to make 1 L) with an antibiotic concentration of 50 g/mL by inoculating in an amount of 2%, and incubated at 37 C. and 200 rpm until the OD.sub.600 was 0.8. Then IPTG was added at a final concentration of 0.2 mmol/L to induce the expression at 20 C. for 20 h.
(33) (6) The same amount of cells were collected by centrifugation, resuspended in 50 mM Na.sub.2HPO.sub.4KH.sub.2PO.sub.4 buffer pH 8.0, and ultrasonically homogenized to obtain a crude enzyme solution. The expression level of MaiA was analyzed by SDS-PAGE analysis (as shown in
(34) (7) A maleic acid solution (pH 8.0) was formulated, and wherein the pH of the maleic acid solution was adjusted to 8.0 with aqueous ammonia. The pMA 2-4 cells induced to express in Step (5) were collected, re-suspended in 50 mM Na.sub.2HPO.sub.4KH.sub.2PO.sub.4 buffer (pH 8.0), and diluted until OD.sub.600 was 40. Then, 20% (by volume) of the resting cells was mixed with 80% (by volume) of the substrate maleic acid to give a reaction system of 30 mL. The reaction was catalyzed in a shaker at 200 r/min and 37 C., and samples were taken every 20 minutes to determine the contents of maleic acid, fumaric acid and L-aspartic acid in the reaction solution. As shown in
Embodiment 4
(35) Mutation of Maleate Cis-Trans Isomerase
(36) (1) The mutant maiA gene fragments maiA(G27A-G171A) and maiA(G27A-K104R) were obtained by PCR using pET-24a (+)-maiA(G27A-G171A) and pET-24a (+)-maiA(G27A-K104R) as templates.
(37) (2) As described in Steps 2-9 of embodiment 1, the recombinant strain was constructed, induced and cultured. The whole-cell reaction was carried out as described in embodiment 2.
(38) The half-life of G27A-G171A at 55 C. is 2.9 times that of wild type, and the enzyme activity is 1.96 times that of wild type. The half-life of G27A-K104R at 55 C. is 4.18 times that of wild type, and the enzyme activity is 1.59 times that of wild type. The results are shown in
(39) The above description is only preferred embodiments of the present invention and not intended to limit the present invention, it should be noted that those of ordinary skill in the art can further make various modifications and variations without departing from the technical principles of the present invention, and these modifications and variations also should be considered to be within the scope of protection of the present invention.