IMPROVED GENOME EDITING USING PAIRED NICKASES

Abstract

Genome editing including the introducing of precise gene edits is well established in diploid plants. Methods well established in the art introduce double strand DNA breaks in the genome of a plant applying technologies such as Zn-finger nucleases, homing endonucleases, TALEN or RNA guided nuclease e.g. Cas9 or Cas12a.

Claims

1. A method for introducing at least one donor DNA molecule into at least one target region of the genome of a plant cell comprising the steps of a. introducing into said plant cell i. a donorDNA molecule and ii. at least one RNA guided nickase and iii. at least two sgRNAs or at least two crRNA and tracrRNA and b. incubating the plant cell to allow for introduction of said at least one donor DNA into said at least one target region of the genome, and c. selecting a plant cell comprising the sequence of the donor DNA molecule in said target region, wherein the nickases creates at least two nicks on opposite strands at the target site of the genomic DNA of the plant cell and wherein these nicks are at least 20 apart from each other.

2. A method for producing a plant comprising a donor DNA comprising the steps of a. introducing into a cell of said plant i. a donorDNA molecule and ii. at least one RNA guided nickase and iii. at least two sgRNAs or at least two crRNA and tracrRNA and b. incubating the plant cell to allow for introducing said at least one donor DNA into the target region of the genome of said plant cell, and c. selecting a plant cell comprising the sequence of the donor DNA molecule in said target region, and d. regenerating a plant from said selected plant cell, wherein the nickase creates at least two nicks on opposite strands at the target site of the genomic DNA of the plant cell and wherein these nicks are at least 20 bases apart from each other.

3. The method of claim 1, wherein after step b. the plant cell is incubated on a medium comprising a selection agent.

4. The method of claim 1, wherein the RNA guided nickase is a Cas nickase.

5. The method of claim 1, wherein the Cas nickase is a Cas9 or Cas12a nickase.

6. The method of claim 1, wherein at least one of the nickase or the sgRNA or crRNA and tracrRNA is introduced into said cell encoded by a nucleic acid molecule.

7. The method of claim 6, wherein the nucleic acid molecule is a plasmid comprising an expression cassette encoding said nickase or the sgRNA or crRNA and tracrRNA.

8. The method of claim 6, wherein the nucleic acid is an RNA molecule.

9. The method of claim 6, t 8 wherein the at least one nickase is sequence optimized for expression in the respective plant cell.

10. The method of claim 1, wherein at least one of the RNA guided nickase or the sgRNA or crRNA and tracrRNA are introduced into said cell as ribonucleoprotein (RNP) assembled outside said cell.

11. The method of claim 1, wherein a combination of donorDNA and crRNA/tracrRNA or sgRNA is preselected.

12. The method of claim 1, wherein the donor DNA and the RNA guided nickase and the single guideRNA or tracrRNA and crRNA are introduced into said cell using particle bombardment or Agrobacterium mediated introduction of DNA.

13. The method of claim 1, wherein the RNA guided nickase is comprising a nuclear localization signal.

14. The method of claim 2, wherein after step b. the plant cell is incubated on a medium comprising a selection agent.

15. The method of claim 2, wherein the RNA guided nickase is a Cas nickase.

16. The method of claim 2, wherein the Cas nickase is a Cas9 or Cas12a nickase.

17. The method of claim 2, wherein at least one of the nickase or the sgRNA or crRNA and tracrRNA is introduced into said cell encoded by a nucleic acid molecule.

18. The method of claim 17, wherein the nucleic acid molecule is a plasmid comprising an expression cassette encoding said nickase or the sgRNA or crRNA and tracrRNA.

19. The method of claim 17, wherein the nucleic acid is an RNA molecule.

20. The method of claim 17, wherein the at least one nickase is sequence optimized for expression in the respective plant cell.

21. The method of claim 2, wherein at least one of the RNA guided nickase or the sgRNA or crRNA and tracrRNA are introduced into said cell as ribonucleoprotein (RNP) assembled outside said cell.

22. The method of claim 2, wherein a combination of donorDNA and crRNA/tracrRNA or sgRNA is preselected.

23. The method of claim 2, wherein the donor DNA and the RNA guided nickase and the single guideRNA or tracrRNA and crRNA are introduced into said cell using particle bombardment or Agrobacterium mediated introduction of DNA.

24. The method of claim 2, wherein the RNA guided nickase is comprising a nuclear localization signal.

Description

FIGURES

[0165] FIG. 1: Frequency of rice mono-allelic TIPS edited events with and without an InDel allele: paired Cas9 nickases vs Cas9 nuclease

EXAMPLES

[0166] Chemicals and Common Methods

[0167] Unless indicated otherwise, cloning procedures carried out for the purposes of the present invention including restriction digest, agarose gel electrophoresis, purification of nucleic acids, Ligation of nucleic acids, transformation, selection and cultivation of bacterial cells were performed as described (Sambrook et al., 1989). Sequence analyses of recombinant DNA were performed with a laser fluorescence DNA sequencer (Applied Biosystems, Foster City, Calif., USA) using the Sanger technology (Sanger et al., 1977). Unless described otherwise, chemicals and reagents were obtained from Sigma Aldrich (Sigma Aldrich, St. Louis, USA), from Promega (Madison, Wis., USA), Duchefa (Haarlem, The Netherlands) or Invitrogen (Carlsbad, Calif., USA). Restriction endonucleases were from New England Biolabs (Ipswich, Mass., USA) or Roche Diagnostics GmbH (Penzberg, Germany). Oligonucleotides were synthesized by Eurofins Eurofins Genomics (Ebersberg, Germany) or Integrated DNA Technologies (Coralville, Iowa, USA).

Example 1: Screening of the Best gRNA and Donor DNA Combination for HDR-mediated Precise Gene Editing in Allohexaploid Wheat

[0168] Our approach for precise gene editing in wheat was based on screening first a set of different gRNA/donor DNA combinations at the scutellar callus level to identify the preferred gRNA/donor DNA combination to be used for the generation of edited plantlets.

[0169] In this example we describe that for the introduction of a specific single amino acid substitution (I1781L) into the coding sequence of the ACCase gene, we pre-screened 5 different gRNA/donor DNA combinations. Five different gRNAs were designed that guides the Cas9 to 5 different target sites near the target codon for the I1781L substitution. The sgRNA vectors pBAY02528 (SEQ ID NO: 5), pBAY02529 (SEQ ID NO: 6), pBAY02530 (SEQ ID NO: 7), pBAY02531 (SEQ ID NO: 8) and pBAY02532 ((SEQ ID NO: 9) each comprise a cassette for expression of the gRNA that can guide the Cas9 for the creation of a DSB at the target site TS1 sequence CTAGGTGTGGAGAACATACA-TGG (SEQ ID NO: 50), TS2 sequence GAAGGAGGATGGGCTAGGTG-TGG (SEQ ID NO: 51), TS3 sequence ATAGGCCCTAGAATAGGCAC-TGG (SEQ ID NO: 52), TS4 sequence CTCCTCATAGGCCCTAGAAT-AGG (SEQ ID NO: 53), TS5 CTATTGCCAGTGCCTATTCTAGG (SEQ ID NO: 54), respectively. Three donor DNA vectors were developed, pBAY02539 (SEQ ID NO: 13), pBAY02540 (SEQ ID NO: 14) and pBAY02541 (SEQ ID NO: 15) each including an 803 bp DNA fragment of Triticum aestivum, cv. Fielder subgenome B, ACCase gene containing the desired mutation (I1781L substitution). The 3 donor DNAs differ only in a few silent mutations to prevent cleavage of the donor DNA and the edited allele with the desired mutation (I1781L). The 3-bp (CTC) core sequence in each of the donor DNAs was flanked with an ˜400-bp left and right homologous arm, which are identical to the WT ACCase sequences of the subgenome B. The Cas9 expression pBAY02430 (SEQ ID NO: 1) comprises a Cas9 nuclease codon optimized for wheat and was under the control of the pUbiZm promoter and the 3′35S terminator. Plasmid DNA of a vector with the Cas9 nuclease, a gRNA, a donor DNA were mixed with the plasmid pIB26 (SEQ ID NO: 18) containing an egfp-bar fusion gene to allow selection on phosphinotricin (PPT) and screening for GFP fluorescence.

[0170] Immature embryos, 2-3 mm size, were isolated from sterilized ears of wheat cv. Fielder and bombarded using the PDS-1000/He particle delivery system was as described by Sparks and Jones (Cereal Genomics: Methods in Molecular biology, vol. 1099, Chapter 17). Following DNA mixtures were used for bombardment: [0171] 1) pBAY02430 (Cas9), pBAY02539 (donor DNA-1), pBAY02528 (gRNA1), pIB26 [0172] 2) pBAY02430 (Cas9), pBAY02539 (donor DNA-1), pBAY02529 (gRNA2), pIB26 [0173] 3) pBAY02430 (Cas9), pBAY02540 (donor DNA-2), pBAY02530 (gRNA3), pIB26 [0174] 4) pBAY02430 (Cas9), pBAY02540 (donor DNA-2), pBAY02531 (gRNA4), pIB26 [0175] 5) pBAY02430 (Cas9), pBAY02540 (donor DNA-2), pBAY02532 (gRNA5), pIB26 [0176] 6) pBAY02430 (Cas9), pBAY02541 (donor DNA-3), pBAY02530 (gRNA3), pIB26 [0177] 7) pBAY02430 (Cas9), pBAY02541 (donor DNA-3), pBAY02531 (gRNA4), pIB26 [0178] 8) pBAY02430 (Cas9), pBAY02541 (donor DNA-3), pBAY02532 (gRNA5), pIB26

[0179] Bombarded immature embryos were transferred to non-selective callus induction medium for a few days, then moved to PPT containing selection media as described by Ishida et al. (Agrobacterium Protocols: Volume 1, Methods in Moleclar Biology, vol. 1223, Chapter 15). After 3 to 4 weeks, genomic DNA was extracted from scutellar calli from individual immature embryos for PCR analysis. Following primer pairs were designed for specific amplification of the edited ACCase gene: primer pair HT-18-111 Forward/HT-18-112 Reverse for donor DNA pBAY02539 (SEQ ID NO: 13), primer pair HT-18-113 Forward/HT-18-112 Reverse for donor DNA pBAY02540 (SEQ ID NO: 14) and donor DNA pBAY02541 (SEQ ID NO: 15) (Table 1). The efficiency of precise gene editing was highest when donor DNA-1 (pBAY02539) (SEQ ID NO: 13) was used in combination with gRNA1 pBAY02528 (SEQ ID NO: 5), With this gRNA/donor DNA combination 13% of the scutellar calli derived from individual immature embryos gave in the edit specific PCR, an amplification product of the expected size (Table 2).

[0180] For the generation of wheat plants with the ACCase (I1781L) mutation, we did a cobombardment of immature wheat embryos with DNA mixture 1) pBAY02430 (Cas9) (SEQ ID NO: 1) pBAY02539 (donor DNA-1) (SEQ ID NO: 13), pBAY02528 (gRNA1) (SEQ ID NO: 5), pIB26 (SEQ ID NO: 18) and we showed that wheat plants having the targeted AA susbsitution (I1781L) in one or more homeoalleles via indirect selection on PPT could be obtained with relatively high rates of success (see example 2). This demonstrates that a pre-screening of different gRNA/donor DNA combinations for precise HR-mediated gene editing in scutellar tissue from bombarded immature embryos as described in this example, allows a good prediction on the feasibility of generating wheat plants having the desired AA modification in one or more of the homeoalleles in allohexaploid wheat.

TABLE-US-00005 TABLE 1 Primers for edit-specific PCR (ACCasel1781L) forward primer reverse primer SEQ SEQ ID ID donor DNA name sequence NO name sequence NO pBAY02540 HT-18- GCTAGGTGTGGAGAACCTC 30 HT-18- ACTTGCCCAGCACGAGGAAC 29 113 112 PBAY02541 HT-18- GCTAGGTGTGGAGAACCTC 30 HT-18- ACTTGCCCAGCACGAGGAAC 29 113 112 pBAY02539 HT-18- GTTGGGCGTCGAGAACCTC 28 HT-18- ACTTGCCCAGCACGAGGAAC 29 111 112

TABLE-US-00006 TABLE 2 Screening different gRNA/ donor DNA combinations for editing ACCasel1781L: No of scutellar tissue samples positive in the edit PCR (ACCasel1781L) Samples with expected PCR fragment DNA delivery # Samples analyzed # Samples* % pBAY02430 (Cas9) + 265 35 13.2 PBAY02539 (donor DNA-1) + pBay02528 (gRNA1) + PIB26 PBAY02430 (Cas9) + 275 5 1.8 PBAY02539 (donor DNA-1) + pBay02529 (gRNA2) + PIB26 pBAY02430 (Cas9) + pBAY02540 137 1 0.7 (donor DNA-2) + pBay02530 (gRNA3) + PIB26 pBAY02430 (Cas9) + pBAY02540 109 4 3.6 (donor DNA-2) + pBay02531 (gRNA4) + PIB26 pBAY02430 (Cas9) + pBAY02540 122 0 0 (donor DNA-2) + pBAY02532 (qRNA5) + PIB26 PBAY02430 (Cas9) + pBAY02541 103 0 0 (donor DNA-3) + pBay02530 (gRNA3) + PIB26 PBAY02430 (Cas9) + pBAY02541 182 3 1.6 (donor DNA-3) + pBay02531 (gRNA4) + PIB26 PBAY02430 (Cas9) + pBAY02541 112 0 0 (donor DNA-3) + pBay02532 (gRNA5) + PIB26 *only samples with the amplified edit specific PCR fragment with a concentration >2 ng/μL, have been considered as positive

Example 2: Homology-Dependent Precise Gene Editing for the Introduction of the I1781L Mutation in the ACCase (Acetyl-CoA Carboxylase) Gene of Allohexaploid Wheat by a Cas9 Nuclease

[0181] We demonstrated that by using a Cas9 nuclease and a pre-screened gRNA/donor DNA combination for its capability of potential HR-mediated precise gene editing in allohexaploid wheat as described in example 1, the desired mutation can be introduced in the target codon in one or more homeoalleles. The sgRNA vector pBAY02528 (SEQ ID NO: 5) comprises a cassette for expression of the gRNA1 that guides the Cas9 nuclease for the creation of a DSB at the target site TS1 sequence CTAGGTGTGGAGAACATACA-TGG (SEQ ID NO: 50) which is positioned over the target codon. The donor DNA pBAY2539 was designed for the introduction of 2 base substitutions at the target codon (ATA to CTC) leading to the I1781L change at the protein level. The donor DNA includes an 803 bp DNA fragment of Triticum aestivum, cv. Fielder subgenome B, ACCase gene containing the desired mutation (I1781L substitution). The donor DNA contains also some other silent mutations to prevent cleavage of the donor DNA and the edited allele with the desired mutation (I1781L). The 3-bp (CTC) core sequence in the donor DNA was flanked with an ˜400-bp left and right homologous arm, which are identical to the WT ACCase sequences of the subgenome B.

[0182] Immature embryos, 2-3 mm size, were isolated from sterilized ears of wheat cv. Fielder and bombarded using the PDS-1000/He particle delivery system as described by Sparks and Jones (Cereal Genomics: Methods in Molecular biology, vol. 1099, Chapter 17). Plasmid DNA of vectors pBAY02430 (Cas9 nuclease) (SEQ ID NO: 1), pBAY02528 (gRNA) (SEQ ID NO: 5), pBAY02539 (donor DNA) (SEQ ID NO: 13) were mixed with the plasmid pIB26 (SEQ ID NO: 18). The vector pIB26 (SEQ ID NO: 18) contains an egfp-bar fusion gene under control of the 35S promoter. Bombarded immature embryos were transferred to non-selective callus induction medium for 1-2 weeks, then moved to PPT containing selection media and PPT resistant calli were selected and transferred to regeneration media for shoot formation as described by Ishida et al. (Agrobacterium Protocols: Volume 1, Methods in Molecular Biology, vol. 1223, Chapter 15).

[0183] All plants developed from one immature embryo were treated as a pool. Genomic DNA was extracted from pooled leaf samples and a primer set (HT-18-111 Forward (SEQ ID NO: 28)/HT-18-112 Reverse (SEQ ID NO: 29)) was designed for specific amplification of the edited ACCase gene. The plantlets in a pool that gave the expected PCR fragment in this 1.sup.st edit specific PCR, were then transferred to individual tubes and further analyzed by PCR using primer set HT-18-111 (SEQ ID NO: 28)/HT-18-112 (SEQ ID NO: 29) and by deep sequencing. For 9 experiments a total of 337, 326, 415, 322, 350, 329, 261, 361 and 362 embryos were bombarded with a mixture of plasmid DNA of pBAY02430 (Cas9 nuclease) (SEQ ID NO: 1), pBAY02528 (gRNA) (SEQ ID NO: 5), pBAY02539 (donor DNA) (SEQ ID NO: 13) and pIB26 (SEQ ID NO: 18). In these 9 experiments, phosphinotricin (PPT) tolerant shoot regenerating calli were obtained from in total 132, 172, 111, 177, 107, 166, 122, 244 and 279 immature embryos. Specific amplification of the edited ACCase gene was observed in 8, 17, 15, 9, 16, 7, 6, 9 and 8 pooled leaf samples. A 2.sup.nd edit specific PCR was performed on in total 51, 62, 66, 33, 49, 25, 35, 42 and 31 individual plants derived from 8, 15, 15, 8, 16, 7, 6, 9 and 8 plantlet pools scored as positive in the 1.sup.st edit PCR and specific amplification of the edited ACCase gene was observed in 16, 28, 12, 25, 19, 19, 13, 21 and 12 individual plantlets derived from 6, 11, 8, 7, 10, 7, 4, 8 and 8 plantlet pools, respectively (Table 3). As each plantlet pool is derived from a single immature embryo, all plantlets derived from a single immature embryo (plantlet pool) are considered as an independent edited event, although we can't exclude that there might be multiple independent edited events between individual shoots derived from a single immature embryo scored as positive in the 2.sup.nd edit PCR. On one plant from each event scored as positive in the 2.sup.nd edit PCR, deep sequencing was performed. The region surrounding the intended target site was PCR amplified with Q5 High-Fidelity polymerase (M0492L) by means of nested PCR. For the 1.sup.st PCR primer pair HT-18-162 (SEQ ID NO: 34)/HT-18-112 (SEQ ID NO: 29) was used; these primers were positioned outside the homology arms of the donor DNA for the amplification of a 1736 bp fragment. For the nested PCR to amplify a region of a 386 bp for NGS, primer pair HT-18-048 (SEQ ID NO: 19)/HT-18-053 (SEQ ID NO: 21) was used.

[0184] We assessed editing frequency by calculating the percentage of sequence reads showing evidence for presence of the desired mutations (AA substitution) at the target codon as directed by the donor DNA, as a proportion of the total number of reads. These data are summarized in Table 4 showing the % of precisely edited reads with the desired mutation (the I1781L substitution) and the % of WT reads based on the total number of reads for 64 plantlets from 59 independent events. The control sample from plantlet TMTA0136-Ctr10001-01$002 derived from a non-bombarded immature embryo showed ˜100% WT reads and no precisely edited reads, as expected.

[0185] These deep sequencing analysis data showed precise gene editing by homologous recombination (HR) of one up to 4 alleles of the native ACCase gene in allohexaploid wheat. HR-mediated precise donor resulting in the desired AA substitution and the introduction of additional silent mutations as directed by the donor DNA, was further confirmed by Sanger sequencing of cloned PCR fragments. On 11 of these events analyzed by deep sequencing, PCR amplification over the target region with primer pair HT-18-162 Forward (SEQ ID NO: 34)/HT-18-112 (SEQ ID NO: 29) Reverse, cloning and Sanger sequencing was performed for subgenomic characterization. Between 52 to 96 clones were sequenced per event. These data are summarized in Table 5 and show that plants with precisely edited allele(s) contain most often also allele(s) with NHEJ-derived InDels and sometimes also WT allele(s). These TO plants have been transferred to the greenhouse for seed production. Plants from independent events with the precise edited allele on different subgenomes can be crossed to create plants with the desired AA modification in e.g. all 3 homeologous copies of the ACCase gene, and the undesired alleles with NHEJ-derived Indels being removed by progeny segregation.

TABLE-US-00007 TABLE 3 Number of ACCase I1781L edited plantlets based on edit PCR analysis # # individual plantlets plantlets tested positive in in 2nd 2nd edit # positive edit PCR, PCR, leaf (derived (derived # bom- PPT.sup.R shoot pools in from # from # Exp barded regenerating 1st edit leaf of leaf n.sup.o embryos calli PCR pools*) pools*) 1 337 132  8 51 (8) 16 (6) 2 326 172 17 62 (15) 28 (11) 3 415 111 15 66 (15) 12 (8) 4 322 177  9 33 (8) 25 (7) 5 350 107 16 49 (16) 19 (10) 6 329 166  7 25 (7) 19 (7) 7 261 122  6 35 (6) 13 (4) 8 361 244  9 42 (9) 21 (8) 9 362 279  8 31 (8) 12 (8) *each leaf pool is derived from one immature embryo

TABLE-US-00008 TABLE 4 Percent (%) precisely edited reads at the Acetyl- CoA carboxylase target locus (ACCase I1781L) in individual plantlets from independent events scored as positive in the 2nd edit PCR NGS on individual shoots from independant events, positive in the 2nd edit PCR Target % edit % WT Sanger se- Event name reads reads reads quencing TMTA0136-Ctrl0001-01$002 40709 0 99.78 TMTA0131-0003-B01-04$001 41239 27.75 0.05 X TMTA0131-0030-B01-02$001 42137 20.53 0.07 TMTA0131-0089-B01-01$001 40069 16.78 53.99 X TMTA0131-0091-B01-01$001 36830 23.25 17.63 X TMTA0132-0005-B01-02$001 40995 9.19 51.37 TMTA0132-0038-B01-01$001 42379 8 59.05 TMTA0132-0058-B01-02$001 43429 21.39 0.05 TMTA0132-0075-B01-03$001 50651 16.35 0.04 TMTA0132-0079-B01-01$001 40691 19.22 32.75 X TMTA0132-0082-B01-01$001 102234 21.17 0.01 TMTA0132-0083-B01-01$001 44100 20.42 0 TMTA0132-0084-B01-01$001 34262 19.75 17.78 TMTA0132-0130-B01-02$001 28768 21.25 0.02 TMTA0132-0138-B01-02$001 34718 20.91 0 TMTA0136-0013-B01-01$001 42346 60.42 0 X TMTA0136-0039-B01-02$001 41189 20.05 78.93 X TMTA0136-0055-B01-03$001 33875 21.23 0.03 TMTA0136-0081-B01-01$001 49956 19.38 13.46 TMTA0136-0108-B01-01$001 51522 27.33 0.01 X TMTA0136-0110-B01-01$001 52048 16.69 0 TMTA0137-0016-B01-02$001 19342 17.06 14.67 TMTA0137-0016-B01-04$001 19125 16.88 14.27 TMTA0137-0017-B01-03$001 10598 17.42 14.87 TMTA0137-0018-B01-04$001 20526 16.23 15.17 TMTA0137-0105-B01-01$001 23270 4.62 72.13 TMTA0137-0107-B01-01$001 27218 18.93 21.18 TMTA0137-0155-B01-01$001 10940 25.43 0 TMTA0138-0025-B01-03$001 33577 19.53 16.75 TMTA0138-0028-B01-01$001 40346 16.09 0 TMTA0138-0034-B01-01$001 35875 30.22 0.07 TMTA0138-0035-B01-01$001 129047 31.98 0.01 X TMTA0138-0041-B01-01$001 44938 18.35 0.02 TMTA0138-0049-B01-01$001 45611 21.59 0.04 TMTA0138-0058-B01-03$001 43272 16.53 12.43 TMTA0138-0059-B01-02$001 39400 24.16 17.8 TMTA0138-0072-B01-04$001 34732 20.41 11.3 TMTA0138-0083-B01-01$001 31915 14.98 12.2 TMTA0140-0004-B01-04$001 40316 22.64 0.02 TMTA0140-0007-B01-01$001 33213 17.7 23.4 TMTA0140-0013-B01-03$001 45408 20.8 0 TMTA0140-0048-B01-01$001 36021 65.03 3.94 X TMTA0140-0050-B01-01$001 53818 32.57 0.04 X TMTA0143-0001-B01-01$001 35829 24.15 0.03 TMTA0143-0086-B01-01$001 107131 34.64 0.05 x TMTA0147-0001-B01-02$001 34822 11.36 18.7 TMTA0171-0047-B01-02$001 26724 11.18 31.67 TMTA0171-0053-B01-01$001 27004 12.49 23.24 TMTA0171-0053-B01-03$001 37877 11.17 26.94 TMTA0171-0080-B01-02$001 26062 7.11 45.67 TMTA0171-0086-B01-03$001 21361 15.46 0.01 TMTA0171-0086-B01-05$001 44053 16.87 20.33 TMTA0171-0134-B01-02$001 29626 9.21 0 TMTA0171-0220-B01-01$001 29826 27.56 16.94 TMTA0171-0220-B01-03$001 35492 29.21 16.84 TMTA0172-0001-B01-04$001 37739 12.56 15.61 TMTA0172-0180-B01-02$001 36540 26.34 16.21 TMTA0172-0180-B01-05$001 43100 25.22 14.44 TMTA0172-0183-B01-01$001 39955 11.93 0.01

TABLE-US-00009 TABLE 5 The ACCase locus genotypes in 11 T0 plants from independent events by Sanger sequencing of cloned PCR fragments. Precise edit refers to the presence of a precisely edited ACCase allele with the desired AA substitution and the additional silent mutations as directed by the donor DNA, InDel refers to the presence of a NHEJ mutation and WT refers to the presence of a WT native ACCase sequence. The numbers before Precise Edit, WT, InDei indicate the frequency at which the 3 different versions of the ACCase allele were identified. NCS Sanger sequencing Event edit % WT % A B D TMTA0131-0003- 27.75  0.05 45 indel 14 precise no reads B01-04$001 edit; 25 indel TMTA0131-0089- 16.78 53.99 28 WT 7 WT; 16 11 precise edit; 11 B01-01$001 indel indel; 6WT TMTA0131-0091- 23.25 17.63 29 indel 17 precise 12 indel; 12WT B01-01$001 edit; 12 indel TMTA0132-0079- 19.22 32.75 12 precise 9 indel; 10 18 indel; 12 indel B01-01$001 edit; 21 WT WT TMTA0136-0039- 20.05 78.93 34 WT 11 precise 1 precise edit; 30 WT B01-02$001 edit; 24 WT TMTA0136-0108- 27.33  0.01 18 precise 13 indel 18 indel B01-01$001 edit; 17 indel TMTA0138-0035- 31.98  0.01 21 precise 12 indel; 20 14 precise edit B01-01$001 edit; 17 indel indel TMTA0140-0048- 65.03  3.94 28 indel 33 precise 15 precise edit B01-01$001 edit; 6 indel TMTA0140-0050- 32.57  0.04 10 precise 7 precise edit; 14 precise edit; 11 B01-01$001 edit; 13 indel 22 indel indel TMTA0143-0086- 34.64  0.05 14 precise 19 precise 23 indel B01-01$001 edit; 9 indel edit; 15 indel TMTA0136-0013- 59  6.79 8 precise edit 31 precise edit 13 indel B01-01$001

Example 3: Homology-Dependent Precise Gene Editing for the Introduction of the I1781L Mutation in the ACCase (Acetyl-CoA Carboxylase) Gene of Allohexaploid Wheat by a Paired Cas9 Nickase

[0186] The following example describes homology-dependent precise gene editing for the introduction of the I1781L mutation in the ACCase (Acetyl-CoA carboxylase) gene of allohexaploid wheat by a paired Cas9 nickase. By using a Cas9 nickase and 2 sgRNAs leading the SpCas9 nickase to 2 target sites (TS1, T2) within proximity of each other on opposite strands and in close proximity of the target codon ACCase 11781, and a donor DNA, the desired mutation can be efficiently introduced in the target codon. A Cas9 nickase expression vector pBay02734 (SEQ ID NO: 3) was constructed. The Cas9 nickase by mutation of Aspartic acid to Alanine at position 10 within the RuvC domain (the D10A mutation), was codon optimized for wheat and was under the control the pUbiZm promoter and the 3′35S terminator. Two sgRNAs were designed for targeting all gene copies on the 3 wheat subgenomes A, B and D and for the generation of 32 bp 3′ overhangs spanning the target codon. The sgRNA vector pBAY02528 (SEQ ID NO: 5) comprises a cassette for expression of the gRNA1 that can guide the Cas9 nickase for the creation of a nick at the target site TS1 sequence CTAGGTGTGGAGAACATACA-TGG (SEQ ID NO:50). The sgRNA vector pBAY02531 comprises a cassette for expression of the gRNA2 targeting target site TS2 sequence CTCCTCATAGGCCCTAGAAT-AGG (SEQ ID NO:53). A donor DNA pBAY02540 (SEQ ID NO: 14) was designed for the introduction of 2 base substitutions at the target codon (ATA to CTC) leading to the I1781L change at the protein level. The donor DNA includes an 803 bp DNA fragment of Triticum aestivum, cv. Fielder subgenome B, ACCase gene containing the desired mutation (I1781L substitution). The donor DNA contains also some other silent mutations to prevent cleavage of the donor DNA and the edited allele with the desired mutation (I1781L). The 3-bp (CTC) core sequence in the donor DNA was flanked with an ˜400-bp left and right homologous arm, which are identical to the WT ACCase sequences of the subgenome B.

[0187] Immature embryos, 2-3 mm size, were isolated from sterilized ears of wheat cv. Fielder and bombarded using the PDS-1000/He particle delivery system as described by Sparks and Jones (Cereal Genomics: Methods in Molecular biology, vol. 1099, Chapter 17). Plasmid DNA of vectors pBAY02734 (Cas9 nickase) (SEQ ID NO: 3), pBAY02528 (gRNA1) (SEQ ID NO: 5), pBAY02531 (gRNA2) (SEQ ID NO:8), pBAY02540 (donor DNA) (SEQ ID NO: 14) were mixed with the plasmid pIB26 (SEQ ID NO: 18). The vector pIB26 (SEQ ID NO: 18) contains an egfp-bar fusion gene under control of the 35S promoter. Bombarded immature embryos were transferred to non-selective callus induction medium for 1-2 weeks, then moved to PPT containing selection media and PPT resistant calli were selected and transferred to regeneration media for shoot formation as described by Ishida et al. (Agrobacterium Protocols: Volume 1, Methods in Molecular Biology, vol. 1223, Chapter 15). All plants developed from one immature embryo were treated as a pool. Genomic DNA was extracted from pooled leaf samples and a primer set (HT-18-113 Forward/HT-18-112 Reverse (SEQ ID NOs: 30; 29)) was designed for specific amplification of the edited ACCase gene. The plantlets in a pool that gave the expected PCR fragment in this 1.sup.st edit specific PCR, were then transferred to individual tubes and further analyzed by PCR using primer set HT-18-113/HT-18-112 (SEQ ID NOs: 30; 29) and by deep sequencing. For 6 experiments a total of 358, 423, 365, 355, 409, and 395 embryos were bombarded with a mixture of plasmid DNA of pBAY02734 (Cas9 nickase) (SEQ ID NO: 3), pBAY02528 (gRNA1) (SEQ ID NO: 5), pBAY02531 (gRNA2) (SEQ ID NO: 8), pBAY02540 (donor DNA) (SEQ ID NO: 14) and pIB26 (SEQ ID NO: 18). In these 6 experiments, phosphinotricin (PPT) tolerant shoot regenerating calli were obtained from in total 195, 163, 192, 181, 268 and 190 immature embryos. Specific amplification of the edited ACCase gene was observed in 13, 6, 44, 22, 21 and 22 pooled leaf samples. A 2.sup.nd edit specific PCR was performed on in total 45, 20, 258, 64, 94, 93 individual plants derived from 11, 5, 39, 17, 16 and 20 plantlet pools scored as positive in the 1.sup.st edit PCR. Specific amplification of the edited ACCase gene was observed in 22, 18, 93, 41, 18 and 35 individual shoots derived from 11, 5, 33, 14, 12 and 17 plantlet pools, respectively (Table 6). As each plantlet pool is derived from a single immature embryo, all plantlets derived from a single immature embryo (plantlet pool) are considered as an independent edited event, although we can't exclude that there might be multiple independent edited events between individual shoots derived from a single immature embryo scored as positive in the 2.sup.nd edit PCR. On one plant from each event scored as positive in the 2.sup.nd edit PCR, deep sequencing was performed. The region surrounding the intended target site was PCR amplified with Q5 High-Fidelity polymerase (M0492L) by means of nested PCR. For the 1.sup.st PCR primer pair HT-18-162/HT18-112 (SEQ ID NO 34; 29) was used; these primers were positioned outside the homology arms of the donor DNA for the amplification of a 1736 bp fragment. For the nested PCR to amplify a region of a 386 bp for NGS, primer pair HT-18-048/HT-18-053 (SEQ ID NOs: 19, 21) was used.

[0188] We assessed editing frequency by calculating the percentage of sequence reads showing evidence for presence of the desired I1781L mutation at the target codon, as a proportion of the total number of reads. These data are summarized in Table 7 showing for 57 plantlets, all derived from independent events, the total number of reads, the % of reads with the desired mutation (the I1781L substitution), the % of reads with the desired mutation and all silent mutations as present in the donor DNA, and the % of WT reads. These deep sequencing analysis data showed that one up to 4 alleles of the native ACCase gene in allohexaploid wheat contain the desired I1781L substitution. These data further show that in plants with the desired AA substitution not all silent mutations from the repair DNA have been always introduced. The silent mutations were positioned around target site TS2 (gRNA2). These data further show that ˜50% (28/57) of the plants with allele(s) with the desired edit (I1781L) don't contain reads with NHEJ-derived InDels. In the other 50% the number of reads with NHEJ-derived InDels was sometimes very low. In contrast by using a CRISPR/Cas9 nuclease instead of a CRISPR/Cas nickase, 98-100% of the events with one or more precisely edited alleles also contain allele(s) with NHEJ-derived InDels (Table 4). The absence of alleles with Indels in events with precisely edited alleles by making use of a nickase will make it easier to study the dosage effects of the performance impact of the precisely edited allele(s) as for one or more of the wheat subgenomes (A,B,D) plants homozygous (HH), hemizygous (Hh) and WT (hh) for the precise edit will become available already in the T1 generation for further performance evaluation. Plants from independent events with the precise edited allele on different subgenomes can be crossed to create plants with the desired AA modification in e.g. all 3 homeologous copies of the target gene.

TABLE-US-00010 TABLE 6 Number of ACCase I1781L edited plantlets by the use of a Cas9 paired nickase based on edit PCR analysis # plant- lets tested # individual in 2nd plantlets # positive edit PCR, positive leaf (derived in 2nd # bom- PPT.sup.R shoot pools in from # edit PCR, (de- Exp barded regenerating 1st edit leaf rived from # n.sup.o embryos calli PCR pools*) of leaf pools*) 1 358 195 13  45 (11) 22 (11) 2 423 163  6  20 (5) 18 (5) 3 365 192 44 258 (39) 93 (33) 4 355 181 22  64 (17) 41 (14) 5 409 268 21 125 (19) 18 (12) 6 395| 190 22 118 (22) 35 (17)

TABLE-US-00011 TABLE 7 Percent (%) precisely edited reads at the Acetyl-CoA carboxylase target locus (ACCase I1781L) in individual plantlets from independent events scored as positive in the 2.sup.nd edit PCR NGS on individual shoots from inde- pendent events, positive in the 2nd edit PCR % edit I > L + all % edit silent no Target I > L mutations InDel Event name reads reads reads % WT reads TMTA0252-0018-B01-01$001 22708 31.72 0 29.17 TMTA0252-0020-B01-03$001 58416 14.89 14.29 40.9 TMTA0252-0022-B01-04$001 52965 23.84 0 71.26 X TMTA0252-0038-B01-01$001 54433 21.98 21.04 56.1 TMTA0252-0072-B01-03$001 53496 18.55 0 76.46 X TMTA0253-0060-B01-01$001 37901 17.46 16.66 73.37 TMTA0254-0001-B01-03$001 53446 29.83 27.68 65.81 X TMTA0254-0002-B01-01$001 51254 18.46 0 76.5 X TMTA0254-0009-B01-02$001 56029 41.18 21.06 53.65 X TMTA0254-0010-B01-03$001 51141 41.01 20.72 53.37 X TMTA0254-0045-B01-01$001 39511 21.12 19.94 73.14 X TMTA0254-0054-B02-01$001 41727 20.19 0 72.78 X TMTA0254-0068-B01-01$001 43282 15.66 0 56.99 TMTA0254-0070-B01-01$001 17115 24.29 23.32 69.83 X TMTA0254-0071-B01-05$001 41360 17.06 16.02 76.96 X TMTA0254-0080-B02-03$001 29495 12.81 0 47.2 TMTA0254-0082-B01-01$001 40045 15.96 0 51.4 TMTA0254-0087-B01-01$001 40672 18.24 0 76.34 X TMTA0254-0105-B01-02$001 42879 22.12 21.27 47.7 TMTA0254-0110-B01-01$001 42238 20.13 0 75.73 X TMTA0254-0111-B01-01$001 42935 45.59 24.6 51.26 X TMTA0254-0120-B01-01$001 36683 18.94 18.13 51.47 TMTA0254-0120-B01-07$001 39382 17.6 16.9 51.12 TMTA0254-0132-B01-03$001 39999 38.98 37.3 54.96 X TMTA0254-0139-B01-03$001 43059 41.63 31.03 35.57 TMTA0255-0073-B01-01$001 42027 13.74 0 81.48 X TMTA0255-0080-B01-01$001 43476 63.73 36.67 26.9 X TMTA0255-0098-B01-01$001 48254 18.38 0 52.77 TMTA0255-0110-B01-01$001 38849 30.94 0.17 64.5 TMTA0255-0112-B01-03$001 48472 26.23 25.19 51.21 TMTA0255-0133-B01-01$001 1890532 23.83 23.2 24.45 TMTA0257-0104-B01-02$001 640098 13.8 0 62.47 TMTA0252-0078-B02-01$001 76441 14.87 14.17 36.79 TMTA0252-0109-B01-01$001 69453 21.27 20.2 72.85 TMTA0252-0142-B01-01$001 71863 20.43 19.62 47.18 TMTA0252-0156-B01-02$001 65565 15.87 0 78.3 X TMTA0254-0177-B01-01$001 67618 15.35 14.35 60.98 TMTA0254-0186-B01-07$001 67449 28.66 28.11 14.79 TMTA0254-0187-B01-04$001 70634 21.63 20.46 71.54 X TMTA0255-0012-B02-03$001 74277 19.47 18.54 52.18 TMTA0255-0040-B01-01$001 64076 21.02 0 74.27 X TMTA0255-0061-B01-01$001 69062 21.75 20.54 72.68 X TMTA0257-0040-B01-08$001 69229 13.99 13.37 58.78 TMTA0257-0074-B02-01$001 72358 11.77 11.07 70.52 TMTA0257-0133-B01-06$001 71008 13.93 13.35 57.74 TMTA0257-0169-B01-02$001 73796 4.42 4.2 90.43 X TMTA0257-0208-B01-02$001 65922 20.94 19.58 75.39 X TMTA0258-0019-B01-02$001 67969 13.19 0 38.41 TMTA0258-0044-B01-05$001 66375 21.75 21.26 32.46 TMTA0258-0051-B02-02$001 66099 13.93 13.21 80.61 X TMTA0258-0079-B01-01$001 68208 15.94 0 56.84 TMTA0258-0084-B01-04$001 32557 21.81 20.68 70.33 X TMTA0258-0105-B01-01$001 70097 18.99 18.09 73.83 X TMTA0258-0111-B02-03$001 66455 29.7 28.29 65.05 X TMTA0258-0161-B01-01$001 69256 22.16 20.87 71 X TMTA0258-0166-B01-07$001 69820 21.65 20.31 72.56 X TMTA0258-0170-B02-05$001 74311 13.72 0 69.3

Example 4: Homology-Dependent Precise Gene Editing for the Introduction of the A2004V Mutation in the ACCase (Acetyl-CoA Carboxylase) Gene of Allohexaploid Wheat by a Cas9 Nuclease

[0189] By using a Cas9 nuclease and a pre-screened gRNA/donor DNA combination for its capability of potential HR-mediated precise gene editing capability in allohexaploid wheat as described in example 1, we recovered edited wheat plants having the desired amino acid substitution A2004V in one or more alleles of the ACCase gene by HR-mediated donor of a targeted DSB and via indirect selection for resistance to PPT. The sgRNA vector pBAY02524 (SEQ ID NO: 10) comprises a cassette for expression of the gRNA that guides the Cas9 nuclease for the creation of a DSB at the target site TS sequence TTCCTCGTGCTGGGCAAGTC-TGG (SEQ ID NO: 55) which is positioned close upstream of the target GCT codon. The donor DNA pBAY02536 (SEQ ID NO: 16) was designed for the introduction of 2 base substitutions at the target codon (GCT to GTC) leading to the A2004 change at the protein level. The donor DNA includes an 787 bp DNA fragment of Triticum aestivum, cv. Fielder subgenome B, ACCase gene containing the desired mutation (A2004V substitution). The donor DNA contains also some other silent mutations to prevent cleavage of the donor DNA and the edited allele with the desired mutation (A2004V). The 3-bp (GTC) core sequence in the donor DNA was flanked with an ˜390-bp left and right homologous arm, which are identical to the WT ACCase sequences of the subgenome B. Immature embryos, 2-3 mm size, were isolated from sterilized ears of wheat cv. Fielder and bombarded using the PDS-1000/He particle delivery system as described by Sparks and Jones (Cereal Genomics: Methods in Molecular biology, vol. 1099, Chapter 17). Plasmid DNA of vectors pBAY02430 (Cas9 nuclease) (SEQ ID NO: 1), pBAY02524 (gRNA) (SEQ ID NO: 10), pBAY02536 (donor DNA) (SEQ ID NO: 16) were mixed with the plasmid pIB26 (SEQ ID NO: 18). The vector pIB26 (SEQ ID NO: 18) contains an egfp-bar fusion gene under control of the 35S promoter. Bombarded immature embryos were transferred to non-selective callus induction medium for 1-2 weeks, then moved to PPT containing selection media and PPT resistant calli were selected and transferred to regeneration media for shoot formation as described by Ishida et al. (Agrobacterium Protocols: Volume 1, Methods in Molecular Biology, vol. 1223, Chapter 15).

[0190] All plants developed from one immature embryo were treated as a pool. Genomic DNA was extracted from pooled leaf samples and a primer pair (HT-18-101 Forward (SEQ ID NO: 25)/HT-18-102 Reverse (SEQ ID NO: 26)) was designed for specific amplification of the edited ACCase gene. The plantlets in a pool that gave the expected PCR fragment in this 1.sup.st edit specific PCR, were then transferred to individual tubes and further analyzed by PCR using primer set HT-18-101 Forward (SEQ ID NO: 25)/HT-18-102 Reverse (SEQ ID NO: 26) and by deep sequencing. For 4 experiments a total of 382, 424, 401 and 375 embryos were bombarded with a mixture of plasmid DNA of pBAY02430 (Cas9 nuclease) (SEQ ID NO: 1), pBAY02524 (gRNA1) (SEQ ID NO: 10), pBAY02536 (donor DNA-1) (SEQ ID NO: 16) and pIB26 (SEQ ID NO: 18). In these 4 experiments, phosphinotricin (PPT) tolerant shoot regenerating calli were obtained from in total 107, 326, 341 and 300 immature embryos. Specific amplification of the edited ACCase gene was observed in 2, 28, 7 and 5 pooled leaf samples. A 2.sup.nd edit specific PCR was performed on in total 14, 259, 29 and 40 individual plants derived from 2, 27, 6 and 5 plantlet pools scored as positive in the 1.sup.st edit PCR and specific amplification of the edited ACCase gene was observed in 7, 58, 7 and 7 individual plantlets, derived from 2, 23, 3 and 6 plantlet pools, respectively (Table 8). As each plantlet pool is derived from a single immature embryo, all plantlets derived from a single immature embryo (plantlet pool) are considered as an independent edited event, although we can't exclude that there might be multiple independent edited events between individual shoots derived from a single immature embryo scored as positive in the 2.sup.nd edit PCR. On plants from independent events scored as positive in the 2.sup.nd edit PCR, deep sequencing was performed. For the 1.sup.st PCR primer pair HT-18-101 (SEQ ID NO: 25)/HT-18-110 (SEQ ID NO: 27) was used; these primers were positioned outside the homology arms of the donor DNA for the amplification of a 1313 bp fragment. For the nested PCR to amplify a region of 348 bp for NGS, primer pair HT-18-051 (SEQ ID NO: 20)/HT-18-054 (SEQ ID NO: 22) was used. These data showed that we have recovered plants with one or two alleles precisely edited with the desired AA substitution A2004V (Table 9).

TABLE-US-00012 TABLE 8 # plantlets tested in # individual 2nd edit plantlets PCR, positive # positive (derived in 2nd edit # PPT.sup.R shoot leaf pools from # PCR, (derived Exp bombarded regenerating in 1st edit leaf from # of leaf n° embryos calli PCR pools*) pools*) 1 382 107  2  14 (2)  7 (2) 2 424 326 28 259 (27) 58 (23) 3 401 341  7  29 (6)  7 (3) 4 375 300  5  40 (5)  7 (3)

TABLE-US-00013 TABLE 9 Percent (%) precisely edited reads at the Acetyl-CoA carboxylase target locus (ACCase A2004V) in individual plantlets from independent events scored as positive in the 2.sup.nd edit PCR NGS on individual shoots from independent events, positive in the 2nd edit PCR Target % edit % WT Event name reads reads reads TMTA0166-0005-B01-06$001 55817 10.79 0.09 TMTA0170-0097-B01-07$001 51820 16.32 51.08 TMTA0170-0118-B01-09$001 54705 14.06 0.08 TMTA0170-0119-B01-02$001 48846 18.39 0.15 TMTA0166-0134-B01-02$001 52468 16.34 32.31 TMTA0167-0135-B01-05$001 56139 14.72 13.36 TMTA0167-0150-B01-01$001 53638 14.27 13.11 TMTA0167-0152-B01-08$001 47913 40.21 0.04 TMTA0167-0164-B01-05$001 44855 13.76 10.3 TMTA0167-0163-B01-04$001 56177 15.62 39.62 TMTA0167-0247-B01-03$001 53868 19.72 33.08 TMTA0167-0235-B01-01$001 48851 9.16 63.89 TMTA0167-0100-B01-04$001 59993 12.71 48.52 TMTA0167-0188-B01-02$001 53936 13.45 17.07 TMTA0167-0124-B01-09$001 55733 2.97 67.63 TMTA0167-0140-B01-02$001 51273 1.93 77.74 TMTA0167-0102-B01-03$001 57154 24.86 31.89 TMTA0167-0211-B01-02$001 51305 64.06 0.01 TMTA0167-0191-B01-09$001 56996 22.33 26.19 TMTA0167-0214-B01-08$001 42659 14.99 37.49 TMTA0167-0213-B01-01$001 59588 10.25 23.7

Example 5: Homology-Dependent Precise Gene Editing for the Introduction of the ALSW548L Mutation in the ALS (Acetolactate Synthase) Gene of Allohexaploid Wheat by a Cas9 Nuclease

[0191] By using a Cas9 nuclease and a pre-screened gRNA/donor DNA combination for its capability of potential HR-mediated precise gene editing capability in allohexaploid wheat as described in example 3, we recovered edited wheat plants having the desired amino acid substitution W548L in one or more alleles of the ALS gene by HR-mediated donor of a targeted DSB and via indirect selection for resistance to PPT. We identified 2 appropriate sgRNA vectors. The sgRNA vectors pBAY02533 (SEQ ID NO: 11) and pBAY02535 (SEQ ID NO: 12) comprise a cassette for expression of the gRNA that guides the Cas9 nuclease for the creation of a DSB at the target site TS sequence GAACAACCAGCATCTGGGAA-TGG (SEQ ID NO: 56) and ATCTGGGAATGGTGGTGCAG-TGG (SEQ ID NO: 57), respectively. The donor DNA pBAY02542 (SEQ ID NO: 17) was designed for the introduction of 2 base substitutions at the target codon (TGG to CTC) leading to the W548L change at the protein level. The donor DNA includes an 805 bp DNA fragment of Triticum aestivum, cv. Fielder subgenome D, ALSgene containing the desired mutation (W548L substitution). The donor DNA contains also some other silent mutations to prevent cleavage of the donor DNA and the edited allele with the desired mutation (W548L). The 3-bp (CTC) core sequence in the donor DNA was flanked with an ˜400-bp left and right homologous arm, which are identical to the WT ALS sequence of the subgenome D.

[0192] Immature embryos, 2-3 mm size, were isolated from sterilized ears of wheat cv. Fielder and bombarded using the PDS-1000/He particle delivery system as described by Sparks and Jones (Cereal Genomics: Methods in Molecular biology, vol. 1099, Chapter 17). Plasmid DNA of vectors pBAY02430 (Cas9 nuclease) (SEQ ID NO: 1), pBAY02533 (gRNA) (SEQ ID NO: 11) or pBAY02535 (gRNA) (SEQ ID NO: 12), pBAY02542 (donor DNA) (SEQ ID NO: 17) were mixed with the plasmid pIB26 (SEQ ID NO: 18). The vector pIB26 (SEQ ID NO: 18) contains an egfp-bar fusion gene under control of the 35S promoter. Bombarded immature embryos were transferred to non-selective callus induction medium for 1-2 weeks, then moved to PPT containing selection media and PPT resistant calli were selected and transferred to regeneration media for shoot formation as described by Ishida et al. (Agrobacterium Protocols: Volume 1, Methods in Molecular Biology, vol. 1223, Chapter 15). All plants developed from one immature embryo were treated as a pool. Genomic DNA was extracted from pooled leaf samples and a primer pair (HT-18-135 Forward (SEQ ID NO: 32)/HT-18-136 Reverse (SEQ ID NO: 33)) was designed for specific amplification of the edited ALS gene. The plantlets in a pool that gave the expected PCR fragment in this 1.sup.st edit specific PCR, were then transferred to individual tubes and further analyzed by PCR using primer pair HT-18-135 Forward (SEQ ID NO: 32)/HT-18-136 Reverse (SEQ ID NO: 33) and by deep sequencing. For 4 experiments a total of 325, 467, 385 and 339 embryos were bombarded with a mixture of plasmid DNA of pBAY02430 (Cas9 nuclease) (SEQ ID NO: 1), pBAY02533 (gRNA) (SEQ ID NO: 11) or pBAY02535 (SEQ ID NO: 12) and pBAY02542 (donor DNA) (SEQ ID NO: 17) and pIB26 (SEQ ID NO: 18). In these 4 experiments, phosphinotricin (PPT) tolerant shoot regenerating calli were obtained from in total 235, ˜258, 112 and 164 immature embryos, respectively. Specific amplification of the edited ALS gene was observed in 10, 11, 3 and 4 pooled leaf samples. A 2.sup.nd edit specific PCR was performed on in total 53, 71, 27 and 13 individual plants derived from 10, 11, 3 and 3 plantlet pools scored as positive in the 1.sup.st edit PCR and specific amplification of the edited ALS gene was observed in 14, 25, 12 and 4 individual plantlets, derived from 4, 7, 3 and 2 plantlet pools, respectively (Table 10). On a number of plants from independent events scored as positive in the 2.sup.nd edit PCR, deep sequencing was performed. For the 1.sup.st PCR primer pair HT-18-130 (SEQ ID NO: 31)/HT-18-136 (SEQ ID NO: 33) was used; these primers were positioned outside the homology arms of the donor DNA for the amplification of a 1278 bp fragment. For the nested PCR to amplify a region of 320 bp for NGS, primer pair HT-18-065 (SEQ ID NO: 23)/HT-18-066 (SEQ ID NO: 24) was used. These data showed that we have recovered plants with one or two alleles precisely edited with the desired AA substitution W548L. Plantlets with a precise edit % below 10% are considered as chimeric ones (e.g. TMTA0158-0107-B01-01$001, TMTA0183-0055-B01-01$001) (Table 11).

TABLE-US-00014 TABLE 10 Number of ALS W548L edited plantlets based on edit PCR analysis # # plantlets if individual PPTR positive tested in 2nd plantlets shoot leaf edit PCR, positive in # bom- re- pools in ide rived 2nd edit PCR, barded generating 1st edit from # leaf (derived from # Exp n° embryos calli PCR pools.sup.*) of leaf pools') 1 325 ~285 10 53 (10) 14 (4) 2 467 ~308 11 71 (11) 35 (7) 3 385  112  3 27 (3} 12 (3) 4 333  164  4 13 (3)  4 (2)

TABLE-US-00015 TABLE 11 Percent (%) precisely edited reads at the Acetolactate synthase gene (ALS W548L) in individual plantlets from independent events scored as positive in the 2.sup.nd edit PCR NGS on individual shoots from inde- pendant events, positive in the 2nd edit PCR % edit % WT Event name Target reads reads reads TMTA0158-0107-B01-01$001 50207 3.95 60.56 TMTA0180-0050-B01-06$001 53374 21.69 0 TMTA0176-0033-B01-04$001 57042 21.09 0 TMTA0176-0032-B01-01$001 52353 21.71 0 TMTA0176-0031-B01-01$001 43073 21.7 0 TMTA0176-0225-B01-01$001 49785 22.72 0.01 TMTA0176-0279-B01-01$001 47708 11.02 0 TMTA0183-0055-B01-01$001 23655 5.86 0

Example 6: Homology-Dependent Precise Gene Editing for the Introduction of the I1781L Mutation in the ACCase (Acetyl-CoA Carboxylase) Gene of Allohexaploid Wheat by a Cas9 Nuclease and by Direct Selection

[0193] Bombarded immature embryos were bombarded with a mixture of the plasmid DNAs pBAY02430 (Cas9) (SEQ ID NO: 1), pBAY02528 (gRNA) (SEQ ID NO: 5) and donor DNA pBAY02539 (SEQ ID NO: 13) for the introduction of the I1781L mutation in the ACCase gene. Bombarded immature embryos were transferred to non-selective callus induction medium for 1-2 weeks, then moved to selection media with 200 and 300 nM quizalofop. Quizalofop tolerant lines have been recovered that were positive in the edit specific PCR using primer pair HT-18-111 Forward (SEQ ID NO: 28)/HT-18-112 Reverse (SEQ ID NO: 29). On a number of plants from independent events scored as positive in the 2nd edit PCR, deep sequencing was performed. These NGS data further confirms that these plants contain one or more precisely edited alleles with the desired AA substitution I1781L.

Example 7: Homology-Dependent Precise Gene Editing for the Introduction of the I1781L Mutation in the ACCase (Acetyl-CoA Carboxylase) Gene of Allohexaploid Wheat by RNP-Mediated Delivery of CRISPR/Cas9 Components

[0194] To generate CRISPR/Cas9 RNP complexes the Cas9 protein (Alt-R® S.p. Cas9 Nuclease V3, IDT) and the sgRNA (Alt-R® CRISPR-Cas9 crRNA XT and Alt-R® CRISPR-Cas9 tracrRNA, IDT) were premixed according to the protocol of IDT (www.idtdna.com). The sgRNA was designed to target the sequence CTAGGTGTGGAGAACATACA-TGG (SEQ ID NO: 50) which is positioned over the target codon in ACCase.

[0195] Immature embryos, 2-3 mm size, were bombarded with a mixture of RNP and donor DNA pBay02539 (SEQ ID NO: 13) using the PDS-1000/He particle delivery system as described by Svitashev et al. 2016. Bombarded immature embryos were transferred to non-selective callus induction medium for 2 weeks, then moved to selection medium with 200 nM quizalofop. For 2 experiments a total of 298 and 302 embryos were bombarded with a mixture of RNP and donor DNA pBAY02539 (SEQ ID NO: 13). From these 2 experiments quizalofop tolerant lines were obtained from 16 and 9 immature embryos and specific amplification of the edited ACCase gene using primer pair HT-18-111 Forward (SEQ ID NO: 28)/HT-18-112 Reverse (SEQ ID NO: 29) was observed for these 25 lines.

[0196] For 9 independent events scored as positive in the edit PCR, deep sequencing was performed on 1 plant/event. The region surrounding the intended target site was PCR amplified with Q5 High-Fidelity polymerase (M0492L) by means of nested PCR. For the 1st PCR primer pair HT-18-162 (SEQ ID NO: 34)/HT-18-112 (SEQ ID NO: 29) was used; these primers were positioned outside the homology arms of the donor DNA for the amplification of a 1736 bp fragment. For the nested PCR to amplify a region of a 386 bp for NGS, primer pair HT-18-048 (SEQ ID NO: 19)/HT-18-053 (SEQ ID NO: 21) was used. We assessed editing frequency by calculating the percentage of sequence reads showing evidence for presence of the desired mutations AA substitution (ACCase 11781 L) at the target codon as directed by the donor DNA, as a proportion of the total number of reads. These data showed that we have recovered plants with one to three alleles precisely edited with the desired AA substitution I1781L (Table 12).

TABLE-US-00016 TABLE 12 Percent (%) precisely edited reads at the at the Acetyl-CoA carboxylase target locus (ACCase I1781L) in individual plantlets from independent events scored as positive in the 2nd edit PCR NGS on individual shoots from independant events, positive in the 2nd edit PCR Target % % Event name reads edit reads WT reads TMTA0406-0002-B01-05$001 32333 20.15 71.48 TMTA0406-0005-B01-02$001 24434 41.73 0 TMTA0407-0002-B01-02$001 34153 35.65 18.29 TMTA0407-0004-B01-06$001 29263 20.05 16.86 TMTA0407-0008-B01-06$001 30420 18.72 29.71 TMTA0407-0015-B01-07$001 23696 34.95 37.07 TMTA0407-0018-B01-03$001 24723 23.44 0 TMTA0407-0026-B01-01$001 28637 18.92 29.05 TMTA0407-0027-B01-02$001 29306 20.59 60.67

Example 8: Homology-Dependent Precise Gene Editing for the Introduction of the I1781L Mutation in the ACCase (Acetyl-CoA Carboxylase) Gene of Allohexaploid Wheat by a Paired Cas9 Nickase by RNP-Mediated Delivery of CRISPR/Cas9 Components

[0197] To generate CRISPR/Cas9 nickase RNP complexes the Cas9 nickase protein (Alt-R® S.p. Cas9 D10A Nickase V3, IDT) and each sgRNA (Alt-R® CRISPR-Cas9 crRNA XT and Alt-R® CRISPR-Cas9 tracrRNA, IDT) were premixed according to the protocol of IDT (www.idtdna.com). The crRNA1 was designed to target the sequence CTAGGTGTGGAGAACATACA-TGG (TS1) (SEQ ID NO: 50) and the crRNA2 was designed to target the target sequence CTCCTCATAGGCCCTAGAAT-AGG (TS2) (SEQ ID NO: 53) which are positioned on opposite strands with a distance of 32 nt between the 2 nick sites. Immature embryos, 2-3 mm size, were bombarded with a 1:1 mixture of RNP1 targeting TS1 and RNP2 targeting TS2 together with the donor DNA pBay02540 (SEQ ID NO: 14) using the PDS-1000/He particle delivery system as described by Svitashev et al. 2016. Bombarded immature embryos were transferred to non-selective callus induction medium for 2 weeks, then moved to selection medium with 200 nM quizalofop. Quizalofop resistant plants were further analyzed by PCR using primer set (HT-18-112/HT-18-113) (SEQ ID NOs: 29; 30) for specific amplification of the edited ACCase gene. On plants scored as positive in the edit PCR, deep sequencing was performed. For the deep sequencing the region surrounding the intended target site was PCR amplified with Q5 High-Fidelity polymerase (M0492L) by means of nested PCR. For the 1st PCR primer pair HT-18-162/HT18-112 (SEQ ID NOs: 34; 29) was used; these primers were positioned outside the homology arms of the donor DNA. For the nested PCR, primer pair HT-18-048/HT-18-053 (SEQ ID NOs: 19; 21) was used.

[0198] These data show that in nearly all plants containing allele(s) with the desired edit (I1781L), no alleles with NHEJ-derived InDels were present (Table 13).

TABLE-US-00017 TABLE 13 Percent (%) precisely edited reads at the at the Acetyl-CoA carboxylase target locus (ACCase I1781L) in quizalofop resistant plants edited by a paired Cas9 nickase delivered as RNP no NGS alleles # Target % I1781L % with InDel Plant name reads edits WT InDels alleles TMTA0496-0002-B01- 18598 17.47 77.87 X 0 05$001 TMTA0496-0002-B01- 20550 17.24 78.09 X 0 06$001 TMTA0497-0049-B01- 21083 21.04 74.15 X 0 01$001 TMTA0497-0164-B01- 24065 16.76 78.35 X 0 02$001 TMTA0497-0164-B01- 20158 17.04 77.98 X 0 05$001 TMTA0497-0164-B01- 21306 10.96 83.58 X 0 14$001 TMTA0497-0164-B01- 25632 16.97 78.4 X 0 16$001 TMTA0498-0001-B01- 23001 14.84 80.44 X 0 01$001 TMTA0498-0001-B01- 21526 16.97 78.2 X 0 02$001 TMTA0543-0010-B01-02 121507 14.24 45.75 1

Example 9: Homology-Dependent Precise Gene Editing for the Introduction of the I1781L Mutation in the ACCase (Acetyl-CoA Carboxylase) Gene of Allohexaploid Wheat by a Paired Cas9 Nickase with Greater Distances Between the Nicks

[0199] For this experiment gRNAs are designed leading the SpCas9 nickase to target sites on opposite strands with the distance between the 2 nick sites of either 45 nt or 136 nt. Immature embryos were co-bombarded with the Cas9 nickase vector pBas02734 (SEQ ID NO: 3), the donor DNA pBas04096 (SEQ ID NO: 35) and the gRNA vector pair pBay02528 (SEQ ID NO: 5) and pBas04093 (SEQ ID NO: 37) for the creation of a nick on opposite strands at a distance of 136 nt from each other, or the embryos were co-bombarded with the Cas9 nickase vector pBas02734 (SEQ ID NO: 3), the donor DNA pBay02544 (SEQ ID NO: 36) and the gRNA vector pair pBay02529 (SEQ ID NO: 6) and pBay02531 (SEQ ID NO: 8) each creating a nick on opposite strands at a distance of 45 nt from each other. After bombardment immature embryos were transferred to non-selective callus induction medium for 2 weeks, then moved to selection medium with 200 nM quizalofop. Quizalofop resistant plants were further analyzed by PCR using primer set (HT-18-113 Forward/HT-18-112 Reverse) (SEQ ID NOs: 30; 29) for specific amplification of the edited ACCase gene. On plants scored as positive in the edit PCR, deep sequencing was performed. For the deep sequencing the region surrounding the intended target site was PCR amplified with Q5 High-Fidelity polymerase (M0492L) by means of nested PCR. For the 1st PCR primer pair HT18-162/HT-18-112 (SEQ ID NO: 34; 29) was used; these primers were positioned outside the homology arms of the donor DNA for the amplification of a 1736 bp fragment. For the nested PCR, primer pair 18-048/HT-18-053 (SEQ ID NOs: 19; 21) was used. These data in Table 14 showed that it is possible, even with larger distances between the nicks, to identify plants with one precisely edited allele carrying no alleles with NHEJ-derived InDels.

TABLE-US-00018 TABLE 14 Percent (%) precisely edited reads at the at the Acetyl-CoA carboxylase target locus (ACCase I1781L) in quizalofop resistant plants edited by a paired Cas9 nickase distance % # between Target I1781L % INDEL Plant name nicks reads edits WT alleles TMTA0279-0117-  45 nt  75258 24.19 73.29 0 B01-01 TMTA0279-0128-  45 nt  79808 13.22 37.31 3 B01-01 TMTA0280-0153-  45 nt  76765 19.71 78.05 0 B01-01 TMTA0654-0022- 136 nt 122904 16.59 77.96 0 B01-02 TMTA0654-0022- 136 nt 112145 18.06 75.84 0 B01-03

Example 10: Homology-Dependent Precise Gene Editing for the Introduction of the TIPS Mutation in the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in Rice

[0200] The following example describes homology-dependent precise gene editing by a paired nickase for the introduction of the T1731 and P177S mutation in the 5-enolpyruvylshikimate-3-phosphate synthase gene of Oryza sativa, providing the TIPS amino acid substitutions, conferring resistance to glyphosate. By using a rice codon optimized version of the Cas9 nickase (D10A) (pKVA824 (SEQ ID NO: 43)) and 2 gRNAs (pKVA766 (SEQ ID NO: 45)) and pKVA769 (SEQ ID NO: 46)) and a donor DNA (pKVA791 (SEQ ID NO: 47)), the desired mutations could be introduced in the target codons. The two sgRNAs were designed for the generation of 33 bp 3′ overhangs spanning the target codon. The sgRNA vectors pKVA766 and pKVA769 lead the SpCas9 nickase to the target sites TS1 (5′-CCATTGACAGCAGCCGTGACTGC-3′) (SEQ ID NO: 58) and TS2 (5′-GAGGAAGTGCAACTCTTCTTG-GGG 3′) (SEQ ID NO: 59), respectively. The sequence of exon 2 in the donor plasmid pKVA791 contained the TIPS amino acid nucleotide substitutions C518T, and C529T, and a silent mutation A531G to create a unique Pvul restriction site. Rice embryogenic callus derived from mature seeds was used as starting material for particle bombardment. Embryogenic callus was bombarded using the particle inflow gun (PIG) system (Grayel). The bombardment parameters were as follows: diameter gold particles, 0.6 μm; target distance 17 cm, bombardment pressure 500 kPa, and for each plasmid DNA (Cas9, gRNA, donor DNA) 1.25 μg DNA was used per shot. After bombardment the callus pieces were transferred to non-selective RSK500 callus induction medium (SK-1m salts Duchefa (Khanna & Raina, 1998, Plant Cell, Tissue and Organ Culture, 52: 145-153), Khanna vitamins (Khanna & Raina, supra), L-proline 1.16 g/L, CuSO4.5H2O 2.5 mg/L, 2.4-D 2 mg/L, maltose 20 g/L, sorbitol 30 g/L, MES 0.5 g/L, agarose 6 g/L, pH 5.8) for a few days, followed by transfer to RSK500 medium supplemented with 150 mg/L glyphosate. Shoots were regenerated from the active growing glyphosate tolerant embryogenic callus lines. Restriction digestion (Pvul) of the amplified PCR product over the target region of glyphosate tolerant events was done as a first molecular screen to confirm the introduction of the TIPS mutation in the native epsps gene. A silent mutation to create a Pvul site was introduced close to the TIPS mutation in the donor DNA to facilitate molecular screening for identification of TIPS edited events. Pvul digest of the amplified PCR product of 24 glyT events reveal 13 mono-allelic TIPS edited events, 10 bi-allelic TIPS edited events and 1 event with no TIPS mutation. Sequencing analysis of the bi-allelic events confirmed the presence of the TIPS mutation in both alleles. Sequencing of cloned PCR products obtained from 13 mono-allelic edited events obtained by the paired nickase showed that 10 of these events were mono-allelic TIPS edited events with one allele precisely edited with the TIPS mutation and one WT allele (TIPS/WT). The other 3 events had also a precisely edited TIPS allele but a non-specific mutation (InDel) in the other allele (TIPS/InDel) (FIG. 1).

[0201] Sequencing of cloned PCR products obtained from 23 mono-allelic TIPS edited events obtained by co-delivery of the Cas9 nuclease (pKVA790 (SEQ ID NO: 48)), the single sgRNA (pKVA766 (SEQ ID NO:45)) and the repair DNA (pKVA761 (SEQ ID NO: 60) instead of the paired Cas9 nickase as described above, showed that all these 23 events with one allele precisely edited with the TIPS mutation, also contained an InDel allele (TIPS/InDel) (FIG. 1). These data showed that by using a paired nickase instead of a nuclease, the number of (TIPS/WT) events is increased and the number of (TIPS/InDel) events reduced.