Cardiomyocyte maturation platform
10837001 ยท 2020-11-17
Assignee
Inventors
Cpc classification
C12N2506/45
CHEMISTRY; METALLURGY
A61K35/44
HUMAN NECESSITIES
C12N2533/90
CHEMISTRY; METALLURGY
C12N2503/04
CHEMISTRY; METALLURGY
C12N2502/45
CHEMISTRY; METALLURGY
A61K35/34
HUMAN NECESSITIES
A61K35/34
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
A61K35/44
HUMAN NECESSITIES
C12N5/00
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are methods of inducing and/or promoting cardiomyocyte maturation comprising: providing an immature cardiomyocyte; providing a three dimensional (3D) cardiac extracellular matrix (ECM) scaffold; and inducing and/or promoting cardiomyocyte cell maturation by seeding the immature cardiomyocyte in the 3D cardiac ECM scaffold and harvesting once the cardiomyocyte has reached maturity. Also disclosed herein are methods of treating a disease in a mammal comprising transplanting a mature cardiomyocyte into an ischemic heart, wherein the mature cardiomyocyte is generated comprising the steps of: providing an immature cardiomyocyte; providing a 3D cardiac ECM scaffold; and generating mature cardiomyocyte by seeding the immature cardiomyocyte in a 3D cardiac ECM scaffold or co-culturing the immature cardiomyocyte in the presence of endothelial cells or stromal cells; and harvesting once the cardiomyocyte has reached maturity.
Claims
1. A cardiomyocyte maturation platform composition, comprising: a 3D complex and adult cardiac extracellular matrix (ECM) scaffold and one or more iPSC-derived cardiomyocytes, wherein the 3D ECM scaffold is created from the following steps: providing a tissue of a subject; decellularizing the tissue by incubating it in a solution comprising SDS and subsequent washing with water; preparing digested ECM by grating the decellularized tissue to a powder form followed by digestion with pepsin; and preparing the 3D ECM scaffold by mixing the digested ECM with fibrinogen.
2. The composition of claim 1, wherein the subject is an adult human.
3. The composition of claim 1, wherein the 3D complex and adult cardiac ECM scaffold is generated from a heart tissue of an adult subject through SDS-mediated decellularization.
4. The composition of claim 1, wherein the 3D complex and adult cardiac ECM scaffold comprises endothelial and/or stromal cells in the 3D complex and adult cardiac ECM scaffold.
5. The composition of claim 1, wherein the one or more iPSC-derived cardiomyocytes may be harvested upon reaching maturity and transplanted into an ischemic heart.
6. The composition of claim 1, wherein the one or more iPSC-derived cardiomyocytes may be harvested upon reaching maturity and used for drug screening.
Description
DESCRIPTION OF THE DRAWINGS
(1) Exemplary embodiments are illustrated in referenced figures. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION
(14) All references, publications, and patents cited herein are incorporated by reference in their entirety as though they are fully set forth. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Hornyak, et al., Introduction to Nanoscience and Nanotechnology, CRC Press (2008); Singleton et al., Dictionary of Microbiology and Molecular Biology 3rd ed., J. Wiley & Sons (New York, N.Y. 2001); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 7th ed., J. Wiley & Sons (New York, N.Y. 2013); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 4th ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, N.Y. 2012), provide one skilled in the art with a general guide to many of the terms used in the present application. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described.
(15) The term immature cell or fetal cell, as used herein, refers to cells that are in various stages of differentiation from undifferentiated stem cells to progenitor cells and other cells such as various precursor cells and neutrophils, which are partially differentiated, and excludes cells that are fully differentiated.
(16) The term cardiac microenvironment, as used herein, refers to the cellular environment in which the heart (cardiac) cells exists, comprising, but not limited to, surrounding blood vessels, cardiomyocytes, pacemaker cells, stromal cells, and the extracellular matrix (ECM). In some embodiments, the natural cardiac micro-environment is mimicked in vitro by exposing immature cardiomyocytes to a three dimensional scaffold of cardiac extracellular matrix.
(17) The terms seed, seeding, and seeded, as used herein, refers to the process of loading or inoculating a scaffold or a cell culture medium with one or more cells or interest, such as tissue regenerating cells. In one embodiment, seeding may be performed by injection of immature cardiomyocytes onto and/or into the scaffold. In another embodiment, seeding may be performed by co-culturing immature cardiomyocytes and endothelial cells and/or stromal cells in a cell culture media. As readily apparent to one of skill in the art, there are many techniques available for seeding, and the present disclosure is not limited to the specific seeding techniques disclosed herein.
(18) In various embodiments, disclosed herein are methods of making and using mature cardiomyocytes for the diagnosis, prognosis and/or treatment of cardiovascular diseases. The inventors have combined multiple parameters of the cardiac microenvironment in order to induce and promote CM maturation. These parameters include, but are not limited to, utilizing a three dimensional cardiac ECM scaffold and vasculature as the microenvironment that induces CM maturation. The mature CM generated from this method platform can be used for studying pathological and developmental stages within the heart, drug screening, and cardiac regeneration through cellular and tissue engineering therapies to treat diseases.
(19) In one embodiment, provided herein is a method of inducing and/or promoting cardiomyocyte cell maturation comprising: providing an immature cardiomyocyte; providing a three dimensional (3D) cardiac extracellular matrix (ECM) scaffold; and inducing and/or promoting cardiomyocyte maturation by seeding the immature cardiomyocytes in the 3D cardiac ECM scaffold and harvesting once the cardiomyocyte has reached maturity. In one embodiment, the 3D cardiac ECM is generated from a heart tissue of an adult subject through SDS-mediated decellularization. In one embodiment, the induction and/or promotion of cardiomyocyte maturation occurs in vitro. In one embodiment, the induction and/or promotion of cardiomyocyte cell maturation occurs in-vivo. In one embodiment, the method further comprises providing endothelial cells in the 3D cardiac ECM scaffold. In one embodiment, the method further comprises providing stromal cells in the 3D cardiac ECM scaffold. In one embodiment, the cardiomyocyte maturation is demonstrated by increase in expression of a maturation marker relative to a fetal cardiomyocytes. In one embodiment, the maturation marker comprises one or more of the proteins: Junctin, SERCA2a, CaV1.2, NCX1, and/or Cx43. In one embodiment, the 3D cardiac ECM is prepared comprising the steps: providing a heart tissue of a subject; decellularizing the tissue by incubating it in a solution comprising SDS for 2-5 days and subsequent washing with water; preparing digested ECM by grating the decellularized tissue to a powder form followed by digestion with pepsin; and preparing the 3D cardiac ECM scaffold by mixing the digested ECM with fibrinogen. In one embodiment, the mature cardiomyocytes in combination with a carrier, diluent, and/or adjuvant are suitable for use in drug screening. In one embodiment, the mature cardiomyocytes in combination with a carrier, diluent, and/or adjuvant are suitable for use in tissue engineering therapy.
(20) In one embodiment, provided herein is a method of treating a disease in a mammal comprising transplanting mature cardiomyocytes into an ischemic heart, wherein the mature cardiomyocytes are generated comprising the steps of: providing an immature cardiomyocyte; providing a three dimensional (3D) cardiac extracellular matrix (ECM) scaffold; and generating mature cardiomyocytes by seeding the immature cardiomyocyte in the 3D cardiac ECM scaffold and harvesting once the cardiomyocyte cell has reached maturity. In one embodiment, the 3D cardiac ECM is generated from a heart tissue of an adult mammal through SDS-mediated decellularization. In one embodiment, the generation of mature cardiomyocyte occurs in vitro. In one embodiment, the generation of mature cardiomyocyte cell occurs in-vivo. In one embodiment, the method further comprises providing endothelial cells in the 3D cardiac ECM scaffold. In one embodiment, the method further comprises providing stromal cells in the 3D cardiac ECM scaffold. In one embodiment, the cardiomyocytes maturation is demonstrated by increase in expression of a maturation marker relative to a fetal cardiomyocyte cell. In one embodiment, the maturation marker comprises one or more of the proteins: Junctin, SERCA2a, CaV1.2, NCX1, and/or Cx43. In one embodiment, the 3D cardiac ECM is prepared comprising the steps: providing a heart tissue of a subject; decellularizing the tissue by incubating it in a solution comprising SDS for 2-5 days and subsequent washing with water; preparing digested ECM by grating the decellularized tissue to a powder form followed by digestion with pepsin; and preparing the 3D cardiac ECM scaffold by mixing the digested ECM with fibrinogen.
(21) In one embodiment, provided herein is a composition comprising a 3D extracellular matrix (ECM) scaffold and one or more cardiomyocytes. In one embodiment, the 3D ECM scaffold is prepared comprising the steps: providing a tissue of a subject; decellularizing the tissue by incubating it in a solution comprising SDS for 2-5 days and subsequent washing with water; preparing digested ECM by grating the decellularized tissue to a powder form followed by digestion with pepsin; and preparing the 3D ECM scaffold by mixing the digested ECM with fibrinogen.
(22) In one embodiment, provided herein are methods of inducing and/or promoting cardiomyocyte cell maturation comprising: (a) providing an immature cardiomyocyte cell; (b) providing endothelial cells or stromal cells; and (c) inducing and/or promoting cardiomyocyte cell maturation by co-culturing the immature cardiomyocyte with the endothelial cells and/or stromal cells.
(23) In one embodiment, provided herein are methods of using mature cardiomyocytes as a drug screening platform, wherein the mature cardiomyocyte cells are generated comprising the steps of: providing an immature cardiomyocyte cell; providing a 3D cardiac ECM scaffold or presence of EC or stromal cells; and generating mature cardiomyocyte cells by seeding the immature cardiomyocyte in the 3D cardiac ECM scaffold and harvesting once the cardiomyocyte has reached maturity.
(24) Various embodiments of the present disclosure include methods of generating cardiomyocytes in vitro, by exposing fetal or immature cardiomyocytes to an environment similar to their natural cardiac micro-environments. In some embodiments, other cell types are present in the three dimensional scaffold of extracellular matrix. In some embodiments, the other cell types comprise endothelial cells or stromal cells. In some embodiments, the three dimensional scaffold is a single extracellular matrix protein, synthetic scaffolds, biodegradable scaffolds, or hydrogels. In some embodiments, the three dimensional scaffold is cardiac extracellular matrix. In one embodiment, the cardiac extracellular matrix is fetal cardiac extracellular matrix or adult cardiac extracellular matrix.
(25) In one embodiment, cardiomyocyte maturation is promoted in an endothelial cell conditioned medium. In another embodiment, cardiomyocyte maturation is promoted when cardiomyocytes are co-cultured with endothelial cells. In some of these embodiments, cardiomyocyte maturation is demonstrated by increases in expression of the maturation markers, Junctin, SERCA2a, CaV1.2, NCX1, and/or Cx43.
(26) In another embodiment of the present disclosure, presented herein are methods of treating cardiovascular disease in a mammal by transplanting mature cardiomyocytes into ischemic hearts, wherein the mature cardiomyocyte is generated in vitro, by exposing fetal cardiomyocytes to an environment similar to their natural cardiac micro-environment. In some embodiments, the natural cardiac micro-environment is mimicked in vitro by exposing fetal cardiomyocytes to a three dimensional scaffold of cardiac extracellular matrix. In one embodiment, other cell types are present in the three dimensional scaffold of extracellular matrix, such as endothelial cells or stromal cells. In some embodiments, the three dimensional scaffold is a single extracellular matrix protein, synthetic scaffolds, biodegradable scaffolds, or hydrogels. In some embodiments, the three dimensional scaffold is cardiac extracellular matrix. In one embodiment, the cardiac extracellular matrix is fetal cardiac extracellular matrix or adult cardiac extracellular matrix. In one embodiment, cardiomyocyte maturation is promoted in an endothelial cell conditioned medium. In another embodiment, cardiomyocyte maturation is promoted when cardiomyocytes are co-cultured with endothelial cells. In some of these embodiments, cardiomyocyte maturation is demonstrated by increases in expression of the maturation markers, Junctin, SERCA2a, CaV1.2, NCX1, and/or Cx43.
(27) In one embodiment, disclosed herein is a method for prognosing a cardiovascular disease in a subject comprising: (a) Obtaining a cell sample from the subject's heart, (b) Assaying the sample to determine the amount of cardiomyocytes, (c) Comparing the amount of cardiomyocytes to that of a healthy subject, and (d) Prognosing the severity of cardiovascular disease based on the decrease in the amount of cardiomyocytes in the subject.
(28) In one embodiment, disclosed herein is a method for diagnosing cardiovascular disease in a subject at risk of developing cardiovascular disease, or for diagnosing a risk of developing cardiovascular disease in a subject, comprising: (a) Obtaining a cell sample from the subject's heart, (b) Assaying the sample to determine the amount of cardiomyocytes, (c) Comparing the amount of cardiomyocytes to that of a healthy subject, and (d) Prognosing the severity of cardiovascular disease based on the decrease in the amount of cardiomyocytes in the subject. In one embodiment, provided herein is a method of screening for treatment of a disease in a subject, comprising: providing mature cardiomyocytes in the subject; and screening for the treating of the disease based on the amount of mature cardiomyocytes. In one embodiment, provided herein is a method of inducing and/or promoting cell maturation comprising providing a cell; and utilizing a 3D extracellular matrix. In one embodiment, the cells are cardiomyocyte cells. In one embodiment, provided herein is a composition comprising a 3D extracellular matrix scaffold and one or more cardiomyocyte cells.
(29) The present disclosure provides compositions, which in one embodiment, may be a pharmaceutical composition. In one embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipient means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients may be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
(30) In various embodiments, the pharmaceutical compositions according to the invention may be formulated for delivery via any route of administration. Route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, transmucosal, transdermal or parenteral. Parenteral refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrastemal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal. Via the parenteral route, the compositions may be in the form of solutions or suspensions for infusion or for injection, or as lyophilized powders. In one embodiment, the route of administration may be a surgery for insertion of tissue engineering constructions, injected through a catheter.
(31) The pharmaceutical compositions according to the invention can also contain any pharmaceutically acceptable carrier. Pharmaceutically acceptable carrier as used herein refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body. For example, the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof. Each component of the carrier must be pharmaceutically acceptable in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
(32) The pharmaceutical compositions according to the invention can also be encapsulated, tableted or prepared in an emulsion or syrup for oral administration. Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition. Liquid carriers include syrup, peanut oil, olive oil, glycerin, saline, alcohols and water. Solid carriers include starch, lactose, calcium sulfate, dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin. The carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
(33) The pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulation, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms. When a liquid carrier is used, the preparation will be in the form of a syrup, elixir, emulsion or an aqueous or non-aqueous suspension. Such a liquid formulation may be administered directly p.o. or filled into a soft gelatin capsule.
(34) The pharmaceutical compositions according to the invention may be delivered in a therapeutically effective amount. The precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, for instance, by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy (Gennaro ed. 21st edition, Williams & Wilkins Pa., USA) (2005).
(35) Typical dosages of an effective composition can be in the ranges recommended by the manufacturer where known therapeutic compounds are used, and also as indicated to the skilled artisan by the in vitro responses or responses in animal models. Such dosages typically can be reduced by up to about one order of magnitude in concentration or amount without losing the relevant biological activity. Thus, the actual dosage will depend upon the judgment of the physician, the condition of the patient, and the effectiveness of the therapeutic method based, for example, on the in vitro responsiveness of the relevant primary cultured cells or histocultured tissue sample, such as biopsied malignant tumors, or the responses observed in the appropriate animal models, as previously described.
(36) Embodiments of the present disclosure are further described in the following examples. The examples are merely illustrative and do not in any way limit the scope of the invention as claimed.
EXAMPLES
Example 1
iPSC Maintenance and Cardiac Differentiation
(37) All experiments were performed with approval from UC Irvine's Human Stem Cell Research Oversight Committee and used the human WTC-11 GCaMP iPSC line. The WTC-11 iPSC line was derived from a healthy male volunteer with a normal electrocardiogram and no known family history of cardiac disease. The GCaMP iPSC line was generated using nuclease-mediated (TALEN) introduction of GCaMP6f, and the resulting cell line reports calcium fluxes through GFP fluorescence. The iPSC were maintained on Growth Factor Reduced Matrigel (Corning, Salt Lake City, Utah) and fed daily with mTeSR1 medium (StemCell Technologies, Vancouver, Canada). To induce cardiomyocyte differentiation, iPSC were seeded as single cells into 12 well plates coated with 1 mg Matrigel Growth Factor Reduced (BD #354230), in the presence of 10 nM Y-27632 (Ascent, Cambridge, Mass.). Cardiac induction was initiated 2-4 days later (designated as Day 0), when cells were 75-90% confluent, by the addition of glycogen synthase kinase 3 inhibitor (CHIR99021, 6 M, Tocris Inc, Bristol, United Kingdom) in RPMI/B27 (without insulin, Life Technologies, Carlsbad, Calif.). Twenty-four hours later (Day 1) the medium was changed to fresh RPMI/B27 (without insulin). On Day 3, Wnt inhibitor (IWP2, 5 M, Tocris) was added in RMPI/B27 (without insulin), and at Day 5 cells were fed fresh RMPI/B27 (without insulin). The cells were subsequently fed RMPI/B27 (with insulin) (Life Technologies) every 3 days starting at Day 7. Cells began to spontaneously beat by Day 12.
Example 2
Cardiac Tissue Decellularization and Extracellular Matrix Generation
(38) Bovine adult and fetal hearts were purchased from Sierra Medical. Prior to decellularization the tissue (100-200 g) was processed by removing all excess fat, and stored at 80 C. for at least 16 hours. Next the tissue was cut into 3 mm.sup.3 sized pieces and subjected to continuous stirring at 330 RPM during incubation in the following solutions at room temperature: ddH.sub.2O for 30 min, 2PBS for 15 min, sodium dodecyl sulfate (SDS) (1% for adult tissue and 0.5% for fetal tissue, Bio-Rad) for 72 hours, and 1% Triton for 90 min. This was followed by 7 washes in ddH.sub.2O for 30 min each, and 18 hours in PBS with Antibiotic-Antimycotic (Life Technologies) at 4 C.
(39) Decellularized tissues were lyophilized and then milled using a cheese grater (Amazon.com, Seattle, Wash.) to create a fine powder. The extracellular matrix powder was digested with 2 mg/ml pepsin (Sigma-Aldrich, St. Louis, Mo.) diluted in 0.01 M cell culture grade hydrochloric acid (HCl). Approximately 200 mg of cardiac extracellular matrix was added to 20 mg of pepsin and continuously stirred at 330 RPM at room temperature for 48-72 hours or until fully digested. The digested extracellular matrix was divided into 1 ml aliquots and stored at 80 C. until needed.
Example 3
Multiphoton Imaging and Fiber Analysis
(40) Fibrillar collagen generates second-harmonic (SHG) signals when incident light interacts with its non-centrosymmetric structure, and SHG microscopy has been widely used to study collagen fibers in vivo and in vitro. In addition, elastin fibers are autofluorescent due to elastin's tricarboxilic, triamino pyridinium derivatives, and are therefore visualized using multiphoton microscopy.
(41) Imaging was performed in the Laboratory for Fluorescence Dynamics (LFD) at UCI. A Ti:Sapphire laser (Mai Tai, Spectra Physics, Irvine, Calif.) was used for two-photon fluorescence excitation with a wavelength of 740 nm (SHG) and 860 nm (autofluorescence) with an incident power of 20 mW. The signal was collected using a water objective with a long working distance (LUMPlanFl 40/0.80 W, Olympus, Tokyo, Japan). The SHG signal was obtained using a 320 nm-390 nm bandpass filter. The autofluorescent signal was collected using a 500 nm long pass filter. Images were captured every 5 m through the 3D scaffolds with a field of view of 8,464 m.sup.2. Data acquisition was performed in SimFCS (software developed by the LFD). The images were analyzed using ctFIRE MATLAB software by extracting information corresponding to the fiber width and number. The data were collected from 3 separate z-stacks for each sample.
Example 4
Statistical Analysis
(42) Split-Unit ANOVA was used to analyze qRT-PCR data using R analysis (.sup.p>0.05 .sup.p>0.01). Figures show the standard error of the mean with n=3 unless otherwise stated. Student's T-test was performed on GCaMP calcium transients and standard error of the mean is shown. (***p<0.001, **p<0.01, *p<0.05)
Example 5
iPSC-Derived Cardiomyocyte Maturation
(43) 2D cultures: Prior to seeding the iPSC-derived cardiomyocytes (Day 28-64 post induction), tissue culture plates were coated with 1 mg/ml of fetal or adult bovine cardiac extracellular matrix at 37 C. overnight. The cells were harvested with 200 Units/ml collagenase II (LifeTechnologies) for 1 hour, followed by 3 washes with PBS (Ca/Mg free), 5 min incubation in 10 TryplE (LifeTechnologies) and then seeded at 45,000 cells/cardiomyocytes.sup.2.
(44) 3D cultures: The cardiac extracellular matrix was adjusted to pH 7.4 with 0.1N NaOH and supplemented with 1/9 volume with 10PBS (with Ca/Mg). The 3D scaffolds were composed of 5.25 mg/ml cardiac extracellular matrix and 1.75 mg/ml fibrinogen (Sigma). The cells were seeded at 1.6-310.sup.6 cells/ml. The 3D gels were polymerized by the addition of 1.3 Units/ml thrombin (Sigma) and incubation at 37 C. for 2 hours before media was added. Each 3D tissue construct also contained 0.15 U/mL aprotinin (Sigma) in a total scaffold volume of 75 l. Completed 3D gels were cultured in polydimethylsiloxane (PDMS, Dow Corning, Midland, Mich.) retention rings, each with a diameter of 8 mm and an approximate height of 1 mm. Cells were harvested after 7 days by digesting the tissue constructs with 500 Units/ml Collagenase II for 35-45 min.
(45) Three independent biological experiments of the maturation studies were performed with each experiment using cardiac extracellular matrix from independent batch preparations and cardiac differentiations.
Example 6
Ouantitative RT-PCR
(46) Total RNA was harvested from differentiated iPSC using Trizol (Life Technologies) according to the manufacturer's recommended protocol and was treated with RQ1 DNAse (Promega, Madison, Wis.) for 1 hour. Three micrograms of RNA was used to generate cDNA using iScript cDNA Synthesis Kit (BioRad, Hercules, Calif.). qPCR was performed using SYBR green chemistry and an iQ5 BioRad icycler. mRNA levels were normalized to 18S expression and measured in triplicate. Primers were synthesized by Integrated DNA Technologies (Coralville, Iowa) and their sequences can be found in Table 1.
(47) TABLE-US-00001 TABLE1 QuantitativeRT-PCRprimersequences. Gene Name Sequence5->3 SEQID Junctin ATTGCATTGCTGGGCGTCTG SEQID FWD NO:1 Junctin GGCATCATCCACATCAAAATCTCC SEQID REV NO:2 MYL2FWD AGCGGACCCTGAGGAAACCATT SEQID NO:3 MYL2REV GGGAAGGCGGCGAACATCT SEQID NO:4 NCX1FWD GTCCATCGCTGCCATCTACCAC SEQID NO:5 NCX1REV TACAGCAGCACCCCCACATTGA SEQID NO:6 Cx43FWD TCCCCTCTCGCCTATGTCTCCTC SEQID NO:7 Cx43REV CTGCCCCATTCGATTTTGTTCTG SEQID NO:8 CaV1.2 ACAAGGGCCCCATCTACAACTACC SEQID FWD NO:9 CaV1.2 CGATGACGAAGCCCACGAAGAT SEQID REV NO:10 18SFWD CCCCGGCCGTCCCTCTTA SEQID NO:11 18SREV CGCCCCCTCGATGCTCTTAG SEQID NO:12 Triadin AGAGCCCCCAGGTTTTGACACA SEQID FWD NO:13 Triadin CGGGGGATTTGGGCACAG SEQID REV NO:14 CASQ2 GTGGCCCAGGTCCTTGAACATAAA SEQID FWD NO:15 CASQ2 GCTGCAAACTCGCCATCAAACTCT SEQID REV NO:16
(48) Tables 2A-E. SDS concentration used to decellularized cardiac tissue affects polymerization of fetal and adult bovine cardiac extracellular matrix.
(49) TABLE-US-00002 TABLE 2A Fetal cardiac ECM hydrogel. 1% SDS 1% SDS 1 hour 2 hour Day 3 50 L 75 L 50 L 75 L 100% 16 mg/mL Gel Watery decellularized 12 mg/mL 10 mg/mL 7 mg/mL
(50) TABLE-US-00003 TABLE 2B Fetal cardiac ECM hydrogel. 0.5% SDS 1% SDS 1 hour 2 hour Day 3 50 L 75 L 50 L 75 L 90% 16 mg/mL Gel Gel Gel Gel decellularized 12 mg/mL Gel Gel 10 mg/mL Watery Watery 7 mg/mL Watery Watery
(51) TABLE-US-00004 TABLE 2C Fetal cardiac ECM hydrogel. 0.25% SDS 1% SDS 1 hour 2 hour Day 3 50 L 75 L 50 L 75 L 80% 16 mg/mL Gel Gel Gel Gel decellularized 12 mg/mL Gel Gel 10 mg/mL Gel Watery 7 mg/mL Watery Watery
(52) TABLE-US-00005 TABLE 2D Fetal cardiac ECM hydrogel. 0.1% and 0.05% SDS 1% SDS 1 hour 2 hour Day 3 50 L 75 L 50 L 75 L <70% 16 mg/mL Gel Gel Gel Gel decellularized 12 mg/mL Gel Gel Gel Gel 10 mg/mL Gel Gel 7 mg/mL Watery Watery
(53) TABLE-US-00006 TABLE 2E Adult cardiac ECM hydrogel. 1% SDS 1% SDS 1 hour 2 hour 2-3 days 50 L 75 L 50 L 75 L 100% 16 mg/mL Gel Gel Gel Gel decellularized 12 mg/mL Gel Gel Gel Gel 10 mg/mL Gel Gel Gel Gel 7 mg/mL Gel Gel Gel Gel
Example 7
Calcium Imaging and Analysis
(54) The iPSC-derived cardiomyocytes have been engineered to express a calcium indicator (GCaMP6f reporter) that emits fluorescence in the presence of cytosolic calcium. Calcium transients were measured using an epifluorescent microscope with an inverted 10 objective (IX70 Olympus, Tokyo, Japan). Images were captured using a SPOT Idea 3.0 megapixel color fluorescent camera and SPOT acquisition software (SPOT Imaging Solutions, Sterling Heights, Mich.). The cells were placed in a 37 C. heated stage during imaging. The video was captured at 33 frames/second with 88 binning. ImageJ was used to process and extract the temporal fluorescence intensity of the acquired video data.
(55) Subsequent data were analyzed using MATLAB software (MathWorks, Torrance, Calif.). A customized algorithm determined the troughs and peaks of each calcium wave and measured the amplitude, max upslope, max downslope, time to 50% decay, and beat rate. Additional measurements included the effect of caffeine on the slope of amplitude change.
Example 8
Pharmacological Treatment of Cardiomyocytes
(56) Baseline and drug recordings were taken before and after 10 min incubation with the drug(s) on the 37 C. stage. All recordings were taken over 1 min. The order of the -adrenergic drug treatments was baseline, 1 M isoproterenol (Sigma #16504), and 1 M Isoproterenol+10 M Propranolol (Sigma # P0884). The effect of caffeine (Tocris #2793) on calcium signaling was assessed at a final concentration of 20 mM. The video recordings were acquired before and during the addition of caffeine.
Example 9 nanoLC-MS MS
(57) Decellularized fetal and adult tissue pellets were fully solubilized in a buffer comprising 4% SDS, 10 mM TCEP, 100 mM TEAB through repeated cycles of heating (95 C.)/ultrasonication (40 C.) followed by 120 min of ultrasonication. Protein levels were subsequently quantitated using the BCA assay. Equivalent mass amounts of the resulting samples were treated with iodoacetamide and trypsinized as described with modifications, and the resulting peptides desalted using stacked C18/SCX tips. The resulting peptides from each sample individually were subjected to nanoLC-MS/MS using an LTQ Orbitrap Velos Pro mass analyzer (Thermo Fisher Scientific, Waltham, Mass.) connected to a nanoLC-Easy1000, with peptide separation in an in-house-packed 25 cardiomyocytes75 m ID C18 nanospray tip. Peptides were resolved in segmented solvent gradients running from 6 to 35% CH.sub.3CN in 0.1% formic acid over 135 min. FTMS precursor spectra were acquired at 60,000 resolution, and up to 20 of the most intense ions with charge states of +2 and higher in each precursor spectrum were subjected to rapid CID fragmentation and ion trap analysis.
(58) Spectral data were re-calculated using Mascot Distiller 2.5.0 (Matrix Science, Boston, Mass.) and the resulting peaklists were searched against SwissProt (July 2014) with Bos Taurus taxonomy along with a database of common contaminants using Mascot Server 2.5.0 (Matrix Science), with Carbamidomethyl (C) and Oxidation (M) as fixed and variable modifications, respectively, and precursor and fragment mass tolerances of 10 ppm and 0.5 Da, respectively. Homology false discovery rates were either below, or thresholded at 5%. Mascot protein score and emPAI values in Mascot exports were compared between samples using in-house software.
Example 10
Mechanical Analysis of 3D Cardiac Extracellular Matrix Hydrogels
(59) Parallel plate rheology was conducted using an MCR 302 (Anton Paar, Ashland, Va.) to determine the storage and loss moduli (reported as pascals, Pa) of fetal and adult 3D cardiac extracellular matrix hydrogels composed of 5.25 mg/ml cardiac extracellular matrix and 1.75 mg/ml fibrinogen. Hydrogels were polymerized similar to the above experiments with measurements occurring after the two-hour incubation period at 37 C. Heating was conducted within a P-PTD200 Peltier-temperature-controlled hood (Anton Paar). The storage modulus (G) and loss modulus (G) was measured at oscillation frequencies ranging from 0.1 to 10 Hz, with a constant strain amplitude of 1%. Experiments were conducted with a gap height of 200 m using a 25-mm parallel plate. Each of the respective samples was measured in triplicate (n=3).
Example 11
Flow Cytometry
(60) Cells were fixed with 4% PFA for 10 min and then incubated in 0.75% saponin in PBS. Samples were stained with 1:100 anti-cTNT antibody (ThermoScientific) or isotype control mouse IgG and subsequently incubated with goat anti-mouse FITC secondary antibody. Samples were run on a BD FACSCalibur flow cytometer and data were analyzed using FlowJo software.
Example 12
Immunocytochemistry
(61) Cells were fixed with 4% paraformaldehyde for 30 min, permeabilized with 0.5% TritonX100, and then blocked with 0.1% Triton X-100 and 4% bovine serum albumin (blocking buffer). Cells were incubated in primary antibodies: 1:100 MYL2 (ProteinTech, Illinois), 1:100 CaV1.2 (ThermoFisher) and 1:800 -actinin (Sigma-Aldrich) at 4 C. overnight, followed by secondary Alexa Fluor 488/568 for 2 hours in blocking buffer. Cell nuclei were subsequently stained with DAPI for 30 min. The cells were imaged with either an epifluorescent microscope (Nikon Eclipse TE300) or a confocal laser microscope (Leica TCS SP8).
Example 13
Hydrogel Encapsulation of Human iPS-Cardiomyocyte Spheroids
(62) iPSC-derived cardiomyocytes were seeded into AggreWell 400 (STEMCELL Technologies) at 720,000 cells per well. Cardiomyocyte spheroids were allowed to aggregate and self-assembled for two days before encapsulation within extracellular matrix.
(63) Extracellular matrix hydrogels consisted of 10 mg/mL bovine fibrinogen (Sigma-Aldrich) dissolved in Dulbecco's phosphate buffered saline (Life Technologies) and combined with 9 mg/mL rat tail collagen (BD Biosciences) and 10 mg/mL cardiac extracellular matrix. All matrices denoted as a partial percentage had the remaining volume completed with fibrin. Thrombin was mixed with the cell and extracellular matrix solution to yield a final concentration of 3 Units/mL (0.3 Units/mg fibrin). Spheroids resuspended in extracellular matrix mixture were cultured in three PDMS retention rings attached to a glass bottom dish (World Precision Instruments, Sarasota, Fla.). The tissues were incubated for 30 min at 37 C. to allow full polymerization, and then fed RPMI 1640 supplemented with B27. The medium was replaced every 2 days.
Example 14
Characterization of Extracellular Matrix from Decellularized Adult and Fetal Bovine Cardiac Tissue
(64) To investigate the potential differences between fetal and adult cardiac extracellular matrix and their respective contributions to human iPSC-derived cardiomyocyte maturation, cardiac extracellular matrix was isolated through sodium dodecyl sulfate (SDS)- and Triton-X100 detergent-mediated decellularization of fetal and adult bovine heart muscle. In one embodiment similar polymerization characteristics were obtained using 1% SDS for the adult tissue and 0.5% SDS for the fetal tissue (Table 2). In another embodiment, as illustrated in
(65) The protein compositions of fetal and adult cardiac extracellular matrix were characterized by nano-LC MS/MS. At the score thresholds employed, the prominent proteins were fibrinogen, collagen, periostin, fibrillin, fibulin, fibronectin and other matrix proteins (Table 3). The fetal cardiac extracellular matrix samples contained two unique proteins not found in the adult samples, mimecan and versican (Table 3). In one embodiment, to examine the structure and distribution of collagen and elastin within the extracellular matrix, second harmonic generation (SHG) was used to detect collagen fibers and auto-fluorescence to detect elastin fibers. The elastin fibers of the fetal extracellular matrix, prior to pepsin digestion, were more evenly distributed, while there were more defined, organized bundles in the adult extracellular matrix (
(66) TABLE-US-00007 TABLE 3 Key proteins identified in decellularized adult and fetal bovine heart tissue preparations by nanoLC-MS/MS. Data were thresholded at 4.4% and 4.8% FDR for adult and fetal samples, respectively. Bovine Heart Fetal Adult Fibrinogen x x Collagen IV x x Periostin x x Fibrillin-1 x x Collagen III x x Lumican x x Fibronectin x x Fibulin-5 x x Mimecan x Collagen I x x Decorin x x Fibulin-1C x x Elastin x x Dermatopontin x x Versican x
(67) TABLE-US-00008 TABLE 4 Mechanical properties of fetal and adult cardiac extracellular matrix hydrogels. Parallel plate rheology was used to determine storage and loss modulus at an oscillation rate of 1 Hz with 1% strain amplitude. Results are expressed as mean standard error. Source Storage Modulus Loss Modulus (3D Hydrogel) (G, Pa) (G, Pa) Fetal (n = 3) 7.2 3.2 1.3 0.58 Adult (n = 3) 67.5 12.6 26.2 14.1
Example 15
3D Adult Cardiac Extracellular Matrix Promotes Expression of Cardiomyocytes Maturation Genes
(68) In order to determine if cardiac extracellular matrix affects iPSC-derived cardiomyocytes maturation gene expression (by qPCR) in cells cultured in 2D and 3D fetal and adult cardiac extracellular matrix was examined. After 7 days in culture, iPSC-derived cardiomyocytes seeded into 3D cardiac extracellular matrix (from fetal or adult tissue) expressed higher levels of numerous maturation-related genes compared to cells in 2D gels. These included genes related to calcium handling, such as Junctin (JCN), L-type voltage-dependent calcium channel (CACNA1C/CaV1.2), calsequestrin 2 (CASQ2), and sodium-calcium exchanger 1 (NCX1), which were augmented between 2 and 120-fold, as illustrated in
(69) In one embodiment, the expression of key structural and calcium-handling genes at the protein level was examined. After 21 days of cardiac induction, 50-90% of differentiated cells expressed cardiac troponin T (cTNT), which is a marker of cardiomyocytes differentiation (
Example 16
Cardiac Extracellular Matrix Geometry Affects iPSC-Derived Cardiomyocytes Calcium Signaling
(70) The genetically-encoded fluorescent calcium flux reporter GCaMP6 was utilized to assess the functional effects of extracellular matrix geometry on iPSC-derived cardiomyocytes calcium handling. Comparison of single cells in 2D culture with single cells embedded in 3D gels was performed. When cultured for 7 days in 3D cardiac extracellular matrix, the iPSC-derived cardiomyocytes showed a significant decrease in beat rate compared to 2D culture (
(71) In one embodiment, iPSC-derived cardiomyocytes behavior was examined in a third modelcardiac spheroids embedded in 3D hydrogels composed of either adult porcine cardiac extracellular matrix, fibrin, or collagen I. Compared to either fibrin or collagen I, cells in native cardiac matrix showed a decreased beat rate (
Example 17
3D Adult Cardiac Extracellular Matrix Increases iPSC-Derived Cardiomyocyte Response to Drugs
(72) To further assess the functionality of iPSC-derived cardiomyocytes in 3D cardiac extracellular matrix, cells were exposed to isoproterenol and propranolol, drugs known to modulate -adrenergic signaling, and consequently, calcium handling. Consistent with the known behavior of adult cardiomyocytes, the iPSC-derived cardiomyocytes increased their beat rate upon the addition of 1 M isoproterenol (
Example 18
Cardiac Differentiation
(73) The WTC-11 GCaMP iPSC line was used in accordance with UC Irvine's Human Stem Cell Research Oversight Committee. iPSCs were maintained with mTeSR medium (StemCell Technologies) on Matrigel Growth Factor Reduced (BD) coated dishes. Cardiac differentiation was induced by glycogen synthase kinase-3 inhibition (CHIR99021, 6 M, Tocris Inc) and Wnt inhibition (IWP2, 5 M, Tocris).
Example 19
Endothelial Cell Isolation
(74) Endothelial progenitor cells (ECs) were isolated from human umbilical cord blood through CD31(+) cell purification from the mononuclear cell fraction.
Example 20
EC Co-Culture and Condition Medium
(75) EC and iPSC-derived CMs were plated onto Matrigel Growth Factor Reduced (BD) coated dishes. Cells were fed with RPMI media supplemented with B27 (Life Technologies) and Endothelial Cell Growth Supplement (ECGS; BD Biosciences) every 2-3 days. EC-conditioned medium was collected after 1-3 days of EC growth. Endothelin inhibition was achieved by adding 10 nM PD145065 inhibitor (EMD Millipore) and notch inhibition with 20 M DAPT (Sigma) at every media change. Cells were fed on days 1 and 4 and then harvested after 7 days.
Example 21 gPCR
(76) RNA was extracted using TRIzol (Life Technologies) according to manufacturer's instructions. Three micrograms of RNA was used to generate cDNA using the iSCRIPT cDNA Synthesis Kit (Bio-Rad). The reaction mix included SYBR green chemistry and primers generated by IDT Technologies. The samples were analyzed using an iQ5 Real Time PCR Detection System (Bio-Rad). The control sample, compared to EC/iPSC-derived CM co-culture, consisted of a mix of equal parts EC and iPSC-derived CM RNA that were isolated separately. (n=3; *p<0.05 **p<0.01 ***p<0.001, Student's t-test)
Example 22
EC-Conditioned Media and EC Co-Culture Increases iPSC-Derived CM Gene Expression of Maturation Markers
(77) In one embodiment, in order to determine the effect of EC on CM maturation, the inventors differentiated iPSC into CMs using small molecule inhibitors for glycogen synthase kinase 3 and Wnt signaling. After 21 days, the iPSC-derived CMs were between 50-80% positive for cardiac troponin T (cTNT) (
Example 23
Inhibition of ET and Notch Signaling Decreases iPSC-Derived CM Gene Expression of Maturation Markers Induced by EC
(78) In one embodiment, to determine the mechanism by which EC induce iPSC-derived CM maturation, the inventors focused on the secreted protein ET and measured gene expression of CM maturation markers when cultured in EC conditioned medium. By using a 10 nM PD 142893, a non-selective endothelin receptor inhibitor, a decrease was found in maturation markers Junctin, SERCA2a, and CaV1.2 in the CM only control (
Example 24
Cardiomyocytes and Cardiac Extracellular Matrix
(79) In one embodiment, the properties and composition of native cardiac extracellular matrix from adult and fetal bovine hearts were studied and tested their ability to promote iPSC-derived cardiomyocyte maturation in both 2D and 3D conformations. Using a 3D conformation was found to have several advantages compared to 2D cultures for the generation of iPSC-derived cardiomyocytes, notably that that the composition and stiffness of the 3D matrix conveys critical maturation signals to the developing cardiomyocytes.
(80) While 2D studies to induce the maturation of pluripotent stem cell-derived cardiomyocytes have advanced the knowledge of cardiomyocyte maturation, the 3D environment greatly impacts cell behavior and maturation, and so a full understanding of this process requires the use of a more physiologic (3D) environment. Previous studies have shown that growing pluripotent stem cell-derived cardiomyocytes in 3D benefits maturation induction, however, these studies used only single-protein extracellular matrix scaffolds, which do not recapitulate the complexity of the in vivo extracellular matrix. In one embodiment, porcine cardiac extracellular matrix affects cardiomyocyte maturation, however, only modest changes were observed, likely due to the use of a 2D geometry.
(81) In one embodiment, it was found that iPSC-derived cardiomyocytes grown in a complex 3D scaffold behave differently to those in single protein gels (collagen I or fibrin) and that cells in 3D differ considerably from those cultured in 2D. This was especially notable when calcium handling and expression of maturation markers was studied. In one embodiment, biomechanical cues, likely mediated through integrins, were found to be critical.
(82) Fetal and adult cardiac extracellular matrix derived from decellularized heart tissue have a similar composition but differ in their mechanical properties and fiber architecture. The adult extracellular matrix has a higher density of collagen compared to the fetal extracellular matrix, which is similar to what has been shown in rat adult cardiac extracellular matrix. In addition, the stiffness of the adult extracellular matrix hydrogel is 10-fold greater than the fetal hydrogel. These data are in agreement with findings that adult hearts are much stiffer than fetal hearts (10-50 KPa versus 6 KPa), and previous studies have shown that substrate mechanics, particularly stiffness, influence cardiomyocyte growth and maturation. In one embodiment, the induction of maturation genes, such as JCN, by 3D culture and by the presence of adult versus fetal matrix, is largely the result of gel stiffness, which is a consequence of gel composition. In another embodiment, specific matrix proteins engage with specific integrins to mediate maturation signals.
(83) In one embodiment, iPSC-derived cardiomyocytes cultured in 3D cardiac extracellular matrix showed increased expression of calcium handling genes compared to 2D cultures. This result is consistent with previous studies that primarily focused on the expression of ion channels and contractile machinery. In one embodiment, the increase in calcium handling genes supports the result that a 3D geometry significantly influences cardiomyocyte maturation. In vivo, adult cardiomyocytes express higher levels of calcium handling proteins than do fetal cells. This is consistent with the idea that expression of calcium-handling genes can be used as a measure of cardiomyocyte maturity. Interestingly, cardiomyocytes of the adult heart express NCX1 at a lower level than cardiomyocytes of the fetal heart. However, increased NCX1 expression was seen in the 3D cultured cardiomyocytes. In one embodiment, the 3D cardiac extracellular matrix is only one component involved in promoting cardiomyocyte maturation. In one embodiment, additional maturation stimuli (hormones, growth factors, mechanical stretching, signals from non-cardiomyocytes) also affect NCX1 expression. In addition, only a subset of maturation genes disclosed here reached elevated levels indicative of maturation when cells were cultured in 3D gels.
(84) Consistent with changes in gene expression, significant differences were found in the calcium-handling in cardiomyocytes, as measured by the calcium flux reporter GCaMP6. Recent publications show that mature cardiomyocytes display increased calcium signaling and kinetics. In one embodiment, in aggregates of iPSC-derived cardiomyocytes, calcium transient amplitude, maximum upslope, and maximum downslope were all increased and the time to 50% decay was correspondingly decreased when cells were in 3D versus 2D. These data are entirely consistent with the findings of increased expression of calcium handing genes/proteins such as JCN, CASQ2, CaV1.2, and SERCA2a in 3D, which would act to increase the amount of calcium within the sarcoplasmic reticulum (SR) and create cardiomyocytes with a greater capacity to handle calcium during calcium-induced calcium release.
(85) In one embodiment, when cardiomyocytes were seeded as single cells into 3D gels (to allow a more direct comparison of matrix effects in 2D versus 3D), it was found that calcium handling kinetics were differentcalcium transient amplitude, maximum upslope, and maximum downslope were all decreased and the time to 50% decay was correspondingly increased when cells were in 3D versus 2D. This illustrates that gene expression is not enough to determine calcium-handling characteristics. Rather, it is the association of cells and the coupling of these calcium-handling systems that determines the kinetics of calcium handling.
(86) In one embodiment, cardiomyocytes were cultured for 7 days before measuring calcium signaling. In another embodiment, cardiomyocytes can be cultured for over 100 days before assaying for maturation. In one embodiment, iPSC-derived cardiomyocytes cultured long term (comparing a 5 month to a 2 month culture) exhibit increased calcium signaling and kinetics suggesting that maturation continues over an extended period of time. Since endogenous cardiomyocytes take several years before maturation is complete, it is not entirely surprising that maturation of cardiomyocyte in culture may take considerable time.
(87) An important characteristic of cardiomyocytes, and one that needs to be recapitulated by iPSC-derived cardiomyocytes, is their response to drugs. In one embodiment, iPSC-derived cardiomyocytes cultured in 3D were found to be more responsive to various stimuli compared to cells cultured in 2D. The addition of the -adrenergic agonist, isoproterenol, to the iPSC-derived cardiomyocytes cultured in 3D induced an increased beat rate compared to cells in 2D culture. Furthermore, exposure to caffeine induced a steeper slope and a shorter time to maximum calcium concentration in the cardiomyocytes cultured in the 3D cardiac extracellular matrix compared to 2D. In one embodiment, caffeine increases RyR sensitivity by lowering the luminal calcium threshold for calcium release from the SR. In one embodiment, 3D culturing of iPSC-derived cardiomyocytes increases the slope and decreases the time to maximum calcium signaling due to an increase in absolute calcium and/or faster release of calcium from the SR caused by the increased expression of JCN, CASQ2, and triadin, which are all proteins that handle calcium within the SR and modulate its release through the RyR.
(88) In one embodiment, 3D adult cardiac extracellular matrix was used as a strategy to promote iPSC-derived cardiomyocyte maturation. In one embodiment, the age (fetal vs. adult) of the cardiac extracellular matrix modulates its mechanical properties and fiber architecture, and these aspects affect cardiomyocyte gene and protein expression. After 7 days of culture within the 3D adult cardiac extracellular matrix hydrogels, the iPSC-derived cardiomyocytes showed increased expression of many calcium-handling genes, consistent with the increase in these genes seen in adult versus fetal cardiomyocytes. In another embodiment, calcium signaling in the iPSC-derived cardiomyocytes is enhanced in 3D compared to 2D, consistent with the changes in gene expression. The utilization of 3D adult cardiac extracellular matrix to culture pluripotent stem cell-derived cardiomyocytes better recapitulates the in vivo environment than traditional 2D cultures or the use of non-native matrix, thereby promoting cardiomyocyte maturation. In one embodiment, the present disclosure advances strategies for maturing pluripotent stem cell-derived cardiomyocytes, so that they can be safely and effectively used for therapeutic applications to treat heart disease.
(89) There is a critical need to produce adult cardiomyocytes in order to create novel treatments for heart disease. Of the potential sources for these cells, there is growing interest in using iPSCs to generate cardiomyocytes. Unfortunately, iPSC-derived cardiomyocytes are immature and have characteristics of fetal cardiomyocytes, rather than of adult cardiomyocytes. In one embodiment, the present disclosure provides a strategy that utilizes endothelial cells to induce cardiomyocyte maturation. In one embodiment, endothelial cells co-culturing and conditioned medium promote the maturation of iPSC-derived cardiomyocytes. In one embodiment, by using small molecule inhibitors, endothelin-1 protein and notch signaling are, in part, responsible for the increase in cardiomyocyte maturation.
Example 25
Endothelial Cells(EC)
(90) In one embodiment, endothelial cells (EC) affect iPSC-derived cardiomyocyte maturation, and both EC conditioned medium and co-culture promotes cardiomyocyte maturation. This was evident from significantly increased iPSC-derived cardiomyocyte expression of Junctin, SERCA2a, Cx43, CaV1.2, and NCX1 when co-cultured with endothelial cells or in endothelial cell conditioned medium. In vivo the calcium handling proteins, Junctin, SERCA2a, and CaV1.2, are expressed at higher levels in adult cardiomyocytes, compared to fetal cardiomyocytes, thereby supporting the increase in these genes as markers of maturation. Moreover, co-culturing endothelial cells with cardiomyocytes led to an up regulation of miRNAs that resulted in increased expression of Cx43.
(91) The endothelin (ET) family of proteins and peptides consists of four active endothelin isoforms, with ET-1 most prominently expressed within the cardiovascular system. ET-1 is secreted by cardiomyocytes to regulate contraction, hypertrophy and calcium signaling within the heart. ET-1 is known to promote terminal differentiation of developing cardiomyocytes by decreasing proliferation and increasing cell size and binucleation. In one embodiment, ET-1 is responsible, in part, for the increase in maturation by endothelial cells. Downstream, ET-1 is known to enhance NCX1 activity. In one embodiment, this result explains why increased NCX1 expression was observed in CMs grown in EC-conditioned medium and its subsequent reduction in the presence of the ET receptor antagonist PD 142893. While there are two known endothelin receptors (ETA and ETB), ETB is predominantly expressed by endothelial cells in the cardiovascular system while cardiomyocytes express the ETA receptor. In one embodiment, to selectively inhibit ETA, the inventors selected a PD 142893 dose (10 nM) greater than ETA receptor's IC.sub.50 of 4 nM, but still below ETB receptor's IC.sub.50 of 15 nM.
(92) In one embodiment, a similar decrease was observed in NCX1 expression following PD 142893 treatment of cardiomyocytes alone, thereby suggesting that iPSC-derived cardiomyocytes secrete and respond to endothelin in an autocrine manner. In addition, the increase in the iPSC-derived cardiomyocyte expression of Junctin, SERCA2a, and Cx43 by endothelial cells conditioned medium was diminished upon incubation with PD 142893 thereby indicating that ET is responsible increased expression of these calcium handling genes. In one embodiment, ET-1 is responsible for the increase in maturation because ET-1 is the predominant isoform within the myocardium.
(93) Notch signaling plays a significant role in the myocardium by regulating cardiomyocyte differentiation and proliferation during development and cardiac remodeling during pathogenesis. Addition of DAPT during endothelial cells/cardiomyocyte co-culture resulted in the decrease in cTNT expression. This is similar to the decrease in cardiac genes in the endothelial cells/cardiomyocyte co-culture with DAPT disclosed in the present application. Notch inhibition, by DAPT, results in the decrease in cardiac maturation genes during endothelial cells/cardiomyocyte co-culture, indicating notch plays a role in iPSC-derived cardiomyocyte maturation.
(94) Endothelial cells play a significant role in promoting the maturation of iPSC-derived cardiomyocyte in vitro. In one embodiment, the present disclosure provides multiple pathways by which may endothelial cells influence cardiomyocyte maturation that include endothelial cells co-culture and secreted factors produced by both endothelial cells and cardiomyocytes. In one embodiment, endothelin, secreted by both endothelial cells and cardiomyocytes, and notch signaling are responsible for the iPSC-derived cardiomyocyte increase in expression of calcium handling genes indicative cardiomyocyte maturation. In one embodiment, the present disclosure illustrates multiple mechanisms of how endothelial cells promote iPSC-derived cardiomyocyte maturation and created a platform that utilizes endothelial cells to generate mature cardiomyocytes that can be used to develop new therapies to treat heart disease.
Example 26
Results
(95) In one embodiment, the present disclosure creates a platform to induce cardiomyocyte (CM) maturation in a similar context that the native CMs would undergo maturation within the developing heart in vivo. The cardiac micro-environment, as disclosed herein comprises cardiac extracellular matrix (ECM) and other non-CM cell types such as endothelial cells and stromal cells.
(96) Cardiac ECM Promotes CM Maturation:
(97) There are many types of scaffolds that can be used for cardiomyocytes, which include single extracellular matrix protein, synthetic scaffolds, biodegradable scaffolds, hydrogels, etc. Specifically, the present disclosure provides cardiac ECM from fetal and adult bovine heart tissue through SDS-mediated decellularization, and find that in contrast to fetal cardiac ECM, the adult ECM promotes induced pluripotent stem cell-derived CM maturation, as assessed by enhanced expression of mature CM markers (
(98) Endothelial Cells Promote CM Maturation:
(99) In one embodiment, endothelial cells were found to play a significant role in inducing CM maturation. There was significant cross talk between the CMs, stromal cells and ECs, which include physical contact and soluble factors. The present disclosure provides multiple modes of action in which EC can induce CM maturation, which include possible roles for Notch and ET-1 signaling. Thus cell types present in the cardiac microenvironment affect CM maturation. Thus, in one embodiment, combining multiple parameters of the cardiac microenvironment, such as the cardiac ECM and vasculature (including endothelial cells and stromal cells) will have beneficial, additive effects on CM maturation.
(100) Cardiac ECM Preparation:
(101) Bovine heart tissue was commercially purchased. The detergents sodium dodecyl sulfate (SDS) and tritonX-100 were used to decellularize the heart tissue. Once all the cells have been removed the scaffold is lyophilized, it was ground into a fine powder and subjected to pepsin digestion in hydrochloric acid. This yields a viscous solution that can polymerize into a three-dimension scaffold when neutralized and brought to 37 degrees C. The cardiac ECM from adult bovine heart was utilized as the three-dimensional scaffold or 2D coating substrate for the cardiomyocytes.
(102) CM Differentiation:
(103) Induced pluripotent stem cells (iPSC) are directly differentiated into CM using small molecules. The iPSC are subjected to GSK3 inhibitor (CHIR99021) and Wnt inhibitor (IWP2) and after 10 days convert into beating clusters of CM. After 21 days of differentiation, the immature CMs are subjected to maturation conditions.
(104) Cardiac Tissues:
(105) The harvested cells ere be embedded into a scaffold that has been neutralized. The cardiac ECM is neutralized with NaOH and diluted to 7 mg/mL. The scaffold was composed of 75% volume of 7 mg/mL of cardiac ECM and 25% volume of 7 mg/mL of fibrinogen. The cells can be seeded at a density ranging from 1-10 million cells/mL within the scaffold. The scaffold polymerization was induced by the addition of thrombin and being place in a 37 degree C. incubator.
(106) Vasculature: Other Cell Types:
(107) Vasculogenesis was utilized to develop in vitro blood vessels in three dimensional scaffolds. The cell types used were endothelial cells and stromal cells. The endothelial cells created the wall of the vessel and sources for these cells types include human umbilical cords, cord blood, pluripotent cells, etc. In addition, the stromal cells that support blood vessel formation and maintenance include cardiac fibroblasts, pericytes, etc.
(108) The various methods and techniques described above provide a number of ways to carry out the invention. Of course, it is to be understood that not necessarily all objectives or advantages described may be achieved in accordance with any particular embodiment described herein. Thus, for example, those skilled in the art will recognize that the methods can be performed in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other objectives or advantages as may be taught or suggested herein. A variety of advantageous and disadvantageous alternatives are mentioned herein. It is to be understood that some preferred embodiments specifically include one, another, or several advantageous features, while others specifically exclude one, another, or several disadvantageous features, while still others specifically mitigate a present disadvantageous feature by inclusion of one, another, or several advantageous features.
(109) Furthermore, the skilled artisan will recognize the applicability of various features from different embodiments. Similarly, the various elements, features and steps discussed above, as well as other known equivalents for each such element, feature or step, can be mixed and matched by one of ordinary skill in this art to perform methods in accordance with principles described herein. Among the various elements, features, and steps some will be specifically included and others specifically excluded in diverse embodiments.
(110) Although the invention has been disclosed in the context of certain embodiments and examples, it will be understood by those skilled in the art that the embodiments of the invention extend beyond the specifically disclosed embodiments to other alternative embodiments and/or uses and modifications and equivalents thereof.
(111) Many variations and alternative elements have been disclosed in embodiments of the present invention. Still further variations and alternate elements will be apparent to one of skill in the art. Among these variations, without limitation, are the selection of constituent modules for the inventive compositions, and the diseases and other clinical conditions that may be diagnosed, prognosed or treated therewith. Various embodiments of the invention can specifically include or exclude any of these variations or elements.
(112) In some embodiments, the numbers expressing quantities of ingredients, properties such as concentration, reaction conditions, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term about. Accordingly, in some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The numerical values presented in some embodiments of the invention may contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements.
(113) In some embodiments, the terms a, an, and the and similar references used in the context of describing a particular embodiment of the invention (especially in the context of certain of the following claims) can be construed to cover both the singular and the plural. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g. such as) provided with respect to certain embodiments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
(114) Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
(115) Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations on those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. It is contemplated that skilled artisans can employ such variations as appropriate, and the invention can be practiced otherwise than specifically described herein. Accordingly, many embodiments of this invention include all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
(116) Furthermore, numerous references have been made to patents and printed publications throughout this specification. Each of the above cited references and printed publications are herein individually incorporated by reference in their entirety.
(117) In closing, it is to be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the present invention. Other modifications that can be employed can be within the scope of the invention. Thus, by way of example, but not of limitation, alternative configurations of the present invention can be utilized in accordance with the teachings herein. Accordingly, embodiments of the present invention are not limited to that precisely as shown and described.