USE OF 5-METHYLTETRAHYDROFOLATE
20230043678 · 2023-02-09
Assignee
Inventors
Cpc classification
A61K9/0019
HUMAN NECESSITIES
A61K31/519
HUMAN NECESSITIES
A61K9/0056
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
International classification
A61K31/519
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
Use of 5-methyltetrahydrofolate in preparing a medicine or health-care food for preventing neonatal congenital heart disease in peri-pregnancy and/or pregnant women has an effect of preventing congenital heart disease. The prophylactic dosage of the 5-methyltetrahydrofolate can be greater than 1 mg. Compared with synthetic folic acid, high-dose use has no teratogenic effect. Thus the 5-methyltetrahydrofolate can prevent birth defects in a high dose and can be used for preventing neonatal congenital heart disease.
Claims
1. A method for preventing neonatal congenital heart disease in a peri-pregnancy and/or pregnant woman comprising administering a medicine or health-care food comprising 5-methyltetrahydrofolate or a pharmaceutically acceptable salt thereof to the woman.
2. The method according to claim 1, wherein the congenital heart disease is selected from any one of the following subgroup diseases: 1. Congenital malformation of great arteries, comprising any one of patent ductus arteriosus, aortic stenosis, pulmonary artery stenosis, pulmonary atresia or other congenital malformation of great arteries; 2. Congenital septal defects, comprising any one of atrioventricular septal defects (AVSDs), ventricular septal defects (VSDs), atrial septal defects (ASDs), tetralogy of Fallot, aortopulmonary septal defects or other congenital septal defects; and 3. Other congenital heart disease, comprising any one of congenital malformations of cardiac chambers and connections, congenital aortic or mitral valve malformations.
3. The method according to claim 1, wherein the congenital heart disease is caused by heavy metals, alcohol or medicines.
4. The method according to claim 1, wherein the pharmaceutically acceptable salt is a hydrochloride, a sulfate, a nitrate, a phosphate, a sodium salt, a potassium salt, a magnesium salt, a calcium salt, an ammonium salt, a substituted ammonium salt, or a salt formed with arginine or lysine.
5. The method according to claim 4, wherein the 5-methyltetrahydrofolate is selected from a group consisting of 5-methyl-(6S)tetrahydrofolate, 5-methyl-(6R)tetrahydrofolate, or 5-methyl(6R, S)tetrahydrofolate.
6. The method according to claim 4, wherein the pharmaceutically acceptable salt comprises a corresponding acidic salt formed by converting a basic group of the 5-methyltetrahydrofolate and a corresponding basic salt formed by converting an acidic group of the 5-methyltetrahydrofolate.
7. The method according to claim 1, wherein the medicine or the health-care food is in form of an injection, a tablet, a capsule, a pill, an oral liquid, a granule or a powder.
8. A method for preventing miscarriage or stillbirth in a peri-pregnancy and/or pregnant woman comprising administering a medicine or health-care food comprising 5-methyltetrahydrofolate or a pharmaceutically acceptable salt thereof to the woman.
9. The method according to claim 8, wherein the miscarriage or stillbirth is caused by fetal heart development malformations.
10. The method according to claim 8, wherein the miscarriage or stillbirth is caused by the peri-pregnancy and/or pregnant woman in an environment containing formaldehyde.
11. The method according to claim 8, wherein the pharmaceutically acceptable salt is a hydrochloride, a sulfate, a nitrate, a phosphate, a sodium salt, a potassium salt, a magnesium salt, a calcium salt, an ammonium salt, a substituted ammonium salt, or a salt formed with arginine or lysine.
12. The method according to claim 11, wherein the 5-methyltetrahydrofolate comprises 5-methyl-(6S)tetrahydrofolate.
13. The method according to claim 11, wherein the pharmaceutically acceptable salt comprises a corresponding acidic salt formed by converting a basic group of the 5-methyltetrahydrofolate and a corresponding basic salt formed by converting an acidic group of the 5-methyltetrahydrofolate.
14. The method according to claim 1, wherein the medicine or the health-care food is in form of an injection, a tablet, a capsule, a pill, an oral liquid, a granule or a powder.
15. A method for preventing a fetal heart malformation comprising administering a medicine or health-care food comprising 5-methyltetrahydrofolate or a pharmaceutically acceptable salt thereof.
16. The method according to claim 15, wherein the heart malformation is caused by heavy metals, alcohol or medicines.
17. The method according to claim 16, wherein the heart malformation is caused by ethanol, lead nitrate and aristolochic acid.
18. The method according to claim 15, wherein the pharmaceutically acceptable salt is a hydrochloride, a sulfate, a nitrate, a phosphate, a sodium salt, a potassium salt, a magnesium salt, a calcium salt, an ammonium salt, a substituted ammonium salt, or a salt formed with arginine or lysine.
19. The method according to claim 18, wherein the 5-methyltetrahydrofolate is selected from a group consisting of 5-methyl-(6S)tetrahydrofolate, 5-methyl-(6R)tetrahydrofolate, or 5-methyl(6R, S)tetrahydrofolate.
20. The method according to claim 15, wherein the pharmaceutically acceptable salt comprises a corresponding acidic salt formed by converting a basic group of the 5-methyltetrahydrofolate and a corresponding basic salt formed by converting an acidic group of the 5-methyltetrahydrofolate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
DETAILED DESCRIPTION
Embodiment 1
[0092] 0.4 g of calcium 5-methyltetrahydrofolate was mixed with 700 g of microcrystalline cellulose, a mixture was subjected to dry granulation and 1,000 capsules were filled to prepare a capsule preparation containing 0.4 mg of 5-methyltetrahydrofolate calcium each.
Example 2
[0093] 1 g of calcium 5-methyltetrahydrofolate was added to 200 g of superfine silica powder to be mixed well, a mixture was pressed into a tablet containing 2 mg of 5-methyltetrahydrofolate each by a tablet machine.
Example 1 Effect of Calcium 5-Methyltetrahydrofolate (L-5-MTHF-Ca) on Survival Rate and Cardiovascular Development of Zebrafish Embryos
[0094] Transgenic zebrafish (fli-1:EGFP) were from the Model Animal Research Center of Nanjing University. Adult zebrafish aged less than 1 were used for experiment and fed at a water pH value of 7±0.2, a temperature around 28° C. and a ratio of illumination to darkness of 14 h:10 h, and with Artemia salina eggs twice a day. Three zebrafish, one female, two males, were placed in a spawning box the night before and eggs were collected the next morning. Fish eggs were placed in an embryo culture medium (prepared with 0.2 g/L of sea salt) and cultured at 28° C. Zebrafish embryos were cultured in 24-well plates with 10 embryos per well (n=10) and 1 mL of the embryo culture medium was added in advance. Each experiment was conducted in triplicate. Zebrafish embryos were administrated at 2 h post fertilization (2 hpf) and termination was conducted at 72 hpf. The number of deaths in each group was recorded at 8, 24, 48 and 72 hpf. No food was fed during a dosing period, and the dead embryos were cleaned up in time. A phenotype of resulted malformation was observed and the number of all abnormal zebrafish where the malformation was present was recorded. A survival rate, morphological defects, a heart rate, cardiac morphology and other indicators were observed and evaluated by an SMZ745T inverted stereomicroscope.
[0095] Test results were as follows: it was found that 10 mML of L-5-MTHF-Ca did not affect an embryo survival rate. Compared with a normal group at 8 hpf, normal embryos had a similar phenotype with embryos treated with 10 mML of L-5-MTHF-Ca, and embryos were almost completely covered. At 24 hpf, the normal embryos were similar to the embryos treated with 10 mML of L-5-MTHF-Ca, and developed head and tail, and the tails swung. After 48 hpf, the head and the tail of each group were fully developed, the whole body pigment was formed, the heart beat was obvious, the intersegmental blood vessels developed normally, and blood flowed throughout the body. At 72 hpf, the heart in each group had a normal shape and the lower intestinal network blood vessels developed normally (
Example 2 Effect of L-5-MTHF-Ca on Cardiovascular Development System of Folic Acid-Deficient Zebrafish Embryo Model Induced by Methotrexate (MTX)
[0096] Transgenic zebrafish (fli-1:EGFP) were from the Model Animal Research Center of Nanjing University. Adult zebrafish aged less than 1 were used for experiment and fed at a water pH value of 7±0.2, a temperature around 28° C. and a ratio of illumination to darkness of 14 h:10 h, and with Artemia salina eggs twice a day. Three zebrafish, one female, two males, were placed in a spawning box the night before and eggs were collected the next morning. Fish eggs were placed in an embryo culture medium (prepared with 0.2 g/L of sea salt) and cultured at 28° C. Zebrafish embryos were cultured in 24-well plates with 10 embryos per well at 6 hpf in a dosing manner, 1 mL of a 1.5 mM MTX solution was added, termination was conducted at 10 hpf, and the zebrafish embryos were transferred to an egg solution for continuous culture to 72 hpf. Dead embryos were cleaned up in time. A phenotype of malformation was observed, the number of all abnormal zebrafish where the malformation was present was recorded and a malformation rate and a rescue rate of each group were calculated. Morphological defects, a heart rate, cardiac morphology and other indicators were observed and evaluated by an SMZ745T inverted stereomicroscope.
[0097] The results were as follows (
[0098] To further quantitatively assess a rescue effect of 10 mM L-5-MTHF-Ca on MTX, pericardium edema and a 10 s heart rate of zebrafish embryos were assessed at 48 hpf, and a body length of zebrafish among groups was assessed at 72 hpf. It can be seen from
Example 3 Teratogenic Effect of Folic Acid (FA) on Zebrafish Embryos
[0099] Transgenic zebrafish (fli-1:EGFP) were from the Model Animal Research Center of Nanjing University. Adult zebrafish aged less than 1 were used for experiment and fed at a water pH value of 7±0.2, a temperature around 28° C. and a ratio of illumination to darkness of 14 h:10 h, and with Artemia salina eggs twice a day. Three zebrafish, one female, two males, were placed in a spawning box the night before and eggs were collected the next morning. Fish eggs were placed in an embryo culture medium (prepared with 0.2 g/L of sea salt) and cultured at 28° C. Zebrafish embryos were cultured in 24-well plates with 5 embryos (n=5) per well at 2 hpf in a dosing manner, 1 mL of a 20 mM NaHCO.sub.3 solution, 1 mL of a 10 mM FA solution (20 mM NaHCO.sub.3 as a solvent), 1 mL of a 8 mM FA solution (20 mM NaHCO.sub.3 as a solvent), 1 mL of a 6 mM FA solution (20 mM NaHCO.sub.3 as a solvent), 1 mL of a 4 mM FA solution (20 mM NaHCO.sub.3 as a solvent), 1 mL of a 2 mM FA ((20 mM NaHCO.sub.3 as a solvent) and 1 mL of 10 mM L-5-MTHF-Ca (20 mM NaHCO.sub.3 as a solvent) were separately added to each well, and termination was conducted at 72 hpf. Dead embryos were cleaned up in time. Each experiment was conducted in triplicate. Dead embryos were cleaned up in time. A phenotype of malformation was observed, the number of all abnormal zebrafish where the malformation was present was recorded and a malformation rate and a rescue rate of each group were calculated. Morphological defects, a heart rate, cardiac morphology and other indicators were observed and evaluated by an SMZ745T inverted stereomicroscope.
[0100] The results were as follows and it was found that 20 mM NaHCO.sub.3 did not affect a survival rate of zebrafish, 10 mM L-5-MTHF-Ca did not affect the survival rate of zebrafish, while all FA groups showed a low survival rate of embryos, with an increased dose of folic acid, a mortality of the zebrafish embryos also increased (
[0101] Compared with a normal control group, phenotypes of the zebrafish embryos at different time points were evaluated. At 8 hpf, the zebrafish embryos in a normal control group, a L-5-MTHF-Ca group, a NaHCO.sub.3 group and a 2 mM FA group were all covered completely, while the zebrafish embryos of FA groups of other concentrations were all not covered completely and the folic acid was found to lead to developmental malformation of heads and tails of the embryos at 24 hpf (
Example 4 Effect of Folic Acid (FA) on Expressions of Different Transcription Factors During Development of Zebrafish Embryos
[0102] In order to explore an effect of folic acid on epigenetics during development of the zebrafish embryos, the zebrafish embryos at different developmental stages were collected for testing. Transgenic zebrafish (fli-1:EGFP) were from the Model Animal Research Center of Nanjing University. Adult zebrafish aged less than 1 were used for experiment and fed at a water pH value of 7±0.2, a temperature around 28° C. and a ratio of illumination to darkness of 14 h:10 h, and with Artemia salina eggs twice a day. Three zebrafish, one female, two males, were placed in a spawning box the night before and eggs were collected the next morning. Fish eggs were placed in an embryo culture medium (prepared with 0.2 g/L of sea salt) and cultured at 28° C. Zebrafish embryos were cultured in 24-well plates with 10 per well (n=10) at 2 hpf in a dosing manner, 1 mL of a 8 mM FA solution (20 mM NaHCO.sub.3 as a solvent) and 1 ml of 8 mM L-5-MTHF-Ca (20 mM NaHCO.sub.3 as a solvent) were separately added into each well at 24 hpf and 48 hpf, and the zebrafish embryos were fixed overnight with 4% paraformaldehyde solution, stored in a methanol solution and placed at −20° C. for standby use. The zebrafish embryos were administrated at 2 hpf, 10 zebrafish with obvious phenotypes in each group were collected every 24 h, RNA of each group of zebrafish was extracted by Trizol according to the instructions, and the embryos from 2 time points in each group were extracted at 24 hpf and 48 hpf for a follow-up experiment.
[0103] A fluorescent dye SYBR Green was used in the qRT-PCR experiment. The qRT-PCR was conducted according to the instructions of an SYBR Green qPCR Master Mix kit and a detection was conducted on an ABI (HT 7900) PCR instrument. Gene primers were synthesized by GENEWIZ Biotechnology Co., Ltd. and specific information was shown in Table 1. An expression of β-actin was used as an internal reference and relative expression levels of other genes were calculated by a ΔΔCt method.
TABLE-US-00001 TABLE 1 Sequences of primers for target genes and a reference gene Target gene Sequence of primers (5′-3′) β-actin F: CGAGCAGGAGATGGGAACC (SEQ ID NO: 1) R: CAACGGAAACGCTCATTGC (SEQ ID NO: 2) amhc F: AAGGTAAAATCCTACAAACGTTCGG (SEQ ID NO: 3) R: CAAACAAATCAAAGTGCGATTGCAC (SEQ ID NO: 4) vmhc F: ACATAGCCCGTCTTCAGGATTTGG (SEQ ID NO: 5) R: GAGAGAAAGGCAAGCAAGTACTGG (SEQ ID NO: 6) hand2 F: ACTCCGTCTGTGGTTCGC (SEQ ID NO: 7) R: TTGATGCTCTGGGTCCTG (SEQ ID NO: 8) Nkx2.5 F: TTCAATCCAGCAGTGTTCCTTCA (SEQ ID NO: 9) R: ACATCCCAGCCAAACCATATCTC (SEQ ID NO: 10) has2 F: TGGATGCAGGTTTGTGATTC (SEQ ID NO: 11) R: CTCCTCCAACATTGGGATCT (SEQ ID NO: 12) mef2a F: GAACCGGCAGGTTACCTTTA (SEQ ID NO: 13) R: GGGCAATCTCACAGTCACAC (SEQ ID NO: 14) mef2c F: AATCCGAGGACAAATATCGC (SEQ ID NO: 15) R: TTAGACTGAGGGATGGCACA (SEQ ID NO: 17) bmp2b F: CTTCCTCCTCCGAGGCTT (SEQ ID NO: 17) R: ACTGGCATCTCCGAGAACTT (SEQ ID NO: 18) flk-1 F: GATGACCTGAAGACGCTGAA (SEQ ID NO: 19) R: CCAGCAGAACTGACTCCTTAC (SEQ ID NO: 20) ephB4 F: TTCACCTGGAGGGCATAATAAC (SEQ ID NO: 21) R: CAGCATCCCGACTAACTGTATC (SEQ ID NO: 22) eprinB2 F: CCGAGCGACATCATCATCC (SEQ ID NO: 23) R: TGTAAACAGGGTGTCCGTAATC (SEQ ID NO: 24)
[0104] The results were as follows: zebrafish eggs formed a complete heart 48 h after fertilization and the heart consisted of atria and ventricles with valves between them. Under action of signal molecules, cardiomyogenic genes of cardiomyogenic cells were expressed and included Nkx-2 family genes, Mef2 family genes and the like. It was found that folic acid interfered with expressions of various genes and affected the expressions of the various genes to varying degrees compared with the normal control group (
Example 5 L-5-MTHF-Ca Rescues Effects of FA on Teratogenesis, Survival Rate, Heart Rate and Body Length of Zebrafish Embryos
[0105] To investigate whether 5-methyltetrahydrofolate can reduce teratogenicity of FA, the following experiment was conducted. Transgenic zebrafish (fli-1:EGFP) were from the Model Animal Research Center of Nanjing University. Adult zebrafish aged less than 1 were used for experiment and fed at a water pH value of 7±0.2, a temperature around 28° C. and a ratio of illumination to darkness of 14 h:10 h, and with Artemia salina eggs twice a day. Three zebrafish, one female, two males, were placed in a spawning box the night before and eggs were collected the next morning. Fish eggs were placed in an embryo culture medium (prepared with 0.2 g/L of sea salt) and cultured at 28° C. Zebrafish embryos were cultured in 24-well plates with 10 embryos per well at 2 hpf in a dosing manner, 1 mL of a 6 mM FA solution was added (20 mM NaHCO.sub.3 as a solvent), and termination was conducted at 72 hpf. Dead embryos were cleaned up in time. Each experiment was conducted in triplicate. 6 mM FA was selected for modeling, 10 mM L-5-MTHF-Ca was used for the rescue experiment, and 20 mM NaHCO.sub.3 as a solvent was set as a control group. A phenotype of malformation was observed, the number of all abnormal zebrafish where the malformation was present was recorded and a malformation rate and a rescue rate of each group were calculated. Morphological defects, a heart rate, cardiac morphology and other indicators were observed and evaluated by an SMZ745T inverted stereomicroscope.
[0106] 6 mM FA was selected for modeling, 10 mM L-5-MTHF-Ca was used for the rescue experiment, and 20 mM NaHCO.sub.3 as a solvent was set as the control group. The results were as follows: 20 mM NaHCO.sub.3 did not affect a survival rate of zebrafish, while 6 mM FA severely led to a low survival rate of zebrafish, but the 10 mML-5-MTHF-Ca can rescue an effect of the 6 mM FA on a survival rate of the embryos. Compared with the normal control group, phenotypes of the zebrafish embryos at different time points were evaluated (
[0107] To further quantitatively assess a rescue effect of the 10 mM L-5-MTHF-Ca on 6 mM FA, pericardium edema and a 10 s heart rate of zebrafish embryos were assessed at 48 hpf, and a body length of zebrafish among groups was assessed at 72 hpf. It can be seen from
[0108] In conclusion, 10 mM L-5-MTHF-Ca could rescue 6 mM FA-induced reduced survival rate, bradycardia, and shortened body length of the zebrafish embryos, but the not pericardium edema and the dyspigmentation.
Example 6 L-5-MTHF-Ca Rescues Effect of Formaldehyde on Survival Rate of Zebrafish Embryos
[0109] Transgenic zebrafish (fli-1:EGFP) were from the Model Animal Research Center of Nanjing University. Adult zebrafish aged less than 1 were used for experiment and fed at a water pH value of 7±0.2, a temperature around 28° C. and a ratio of illumination to darkness of 14 h:10 h, and with Artemia salina eggs twice a day. Three zebrafish, one female, two males, were placed in a spawning box the night before and eggs were collected the next morning. Fish eggs were placed in an embryo culture medium (prepared with 0.2 g/L of sea salt) and cultured at 28° C. Zebrafish embryos were cultured in 24-well plates with 10 embryos per well at 2 hpf in a dosing manner (10 mM L-5-MTHF-Ca) and 1 mL of a 30 mM HCHO solution was added. Dead embryos were cleaned up in time. Each experiment was conducted in triplicate. A phenotype of malformation was observed, the number of all abnormal zebrafish where the malformation was present was recorded and a malformation rate and a rescue rate of each group were calculated. Morphological defects, a heart rate, cardiac morphology and other indicators were observed and evaluated by an SMZ745T inverted stereomicroscope.
[0110] The results were as follows: 30 mM FA was selected for modeling, 10 mM L-5-MTHF-Ca was used for the rescue, 30 mM HCHO would severely lead to a low survival rate of embryos, but the 10 mML-5-MTHF-Ca can rescue an effect of the 30 mM HCHO on a survival rate of the embryos.
[0111] Compared with the control group, phenotypes of the zebrafish embryos at different time points were evaluated (
[0112] To further quantitatively assess a rescue effect of the 10 mM L-5-MTHF-Ca on 30 mM HCHO, pericardium edema and a 10 s heart rate of zebrafish embryos were assessed at 48 hpf, and a body length of zebrafish among groups was assessed at 72 hpf. It can be seen from
[0113] In conclusion, the 30 mM HCHO was lethal but not teratogenic to zebrafish and 10 mM L-5-MTHF-Ca could rescue a reduced survival rate of the zebrafish embryos caused by the 30 mM HCHO. The finding suggested that the L-5-MTHF-Ca could rescue a high mortality rate of embryos in pregnant women exposed to formaldehyde for a long time.
Example 7 Effects of Homocysteine on Fetal Rats
[0114] In order to investigate an effect of homocysteine on the fetal heart, SD rats were selected, male and female rats were mated in a cage at a ratio of 1:1 overnight, a vaginal plug was checked the next morning, a day when the vaginal plug was found was regarded as day 0 of pregnancy, and pregnant mice were fed alone. A 1% homocysteine (HCY) solution was used, an injection volume was calculated according to an injection volume of 1 ml/100 g, a dose was (100 mg/kg/d), on the seventh day of pregnancy, the pregnant mice were intraperitoneally injected once a day until the 17th day of pregnancy and injected once on the 19th day of pregnancy, no fluid was withdrawn during each injection, the pregnant mice were subjected to chloral hydrate anesthesia on the 20th day of pregnancy, and a fetus was obtained by cesarean section. High-dose HCY model pregnant mice were investigated by the same method as above, the dose was 200 mg/kg/d and the other conditions were the same. Fetal rats were dissected, the heart was taken and sliced for observation, and the results were as follows.
[0115] Low-dose HCY led to widening of myocardial trabeculae in fetal rats and atria was filled with red blood cells (
Example 8 Effect of High-Dose Folic Acid on Fetal Rat Heart (Pre-Experiment)
[0116] 28 each of female and male adult healthy SD rats, weighing about 200-250 g, were purchased from SPF (Beijing) biotechnology co., LTD. After all animals were purchased, general physiological indicators, body weight and feeding of the animals were observed. The animals were adaptively fed for one week. The animals were fed with a standard pelleted feed and had a free access to water. The animals were fed day and night in natural lighting, and at a room temperature of 18-26° C. and a relative humidity of 40%-70%.
[0117] The obtained 16 pregnant mice were randomly divided into 4 groups with 4 rats in each group according to body weight: a normal group, a high-dose folic acid group, a middle-dose folic acid group and a low-dose folic acid group. The high-dose folic acid (36.44 mg/kg) group, the middle-dose folic acid (18.22 mg/kg) group, the low-dose folic acid (9.11 mg/kg) group and a blank control group were separately set. The pregnant mice were intragastrically administrated with a 1 ml/100 g solution. The pregnant mice were given pure water in the normal group. The pregnant mice in the other groups started to be administrated on the 2nd day after grouping once a day for 21 consecutive days. The pregnant mice in each group freely ate and drunk. After the female rats were administrated for 7 days, male and female rats were mated in a cage at a ratio of 1:1 overnight, a vaginal plug was checked the next morning, a day when the vaginal plug was found was regarded as day 0 of pregnancy, the pregnant mice were separately fed and administrated for 21 consecutive days, and a fetus was obtained by cesarean section.
[0118] Routine histopathologic paraffin sample preparation, serial section (a thickness of 5 μm) and HE staining were conducted. Sample preparation: routine histopathologic paraffin sample sections were prepared and each sample was 1 paraffin block; and section: each numbered sample had 20 sections. A starting point of mounting was when the paraffin block was sliced, there were ventricular mounting slices and 4 consecutive tissue points were mounted on each glass slide on average. HE staining: there were 20 glass slides for each sample and every other 1 slide was taken for HE staining, a total of 10 slides. Observation and analysis: Leica panoramic image acquisition and comparative analysis were conducted. Fetal rat hearts were dissected and sliced for observation, and the results were as follows.
[0119] The atrium and the ventricle of the rats in the normal group were well differentiated, and the pericardium, endocardium and epicardium were intact. Longitudinal, oblique, or transverse sections of myocardial fibers could be observed simultaneously. Myocardial fibers were neat and regular with clear texture, and the muscle fibers were branched and anastomosed into a network. The myocardial fibers were divided into fiber bundles of different sizes by loose connective tissues and there were abundant blood vessels in the bundles. Myocardial trabeculae were densely developed in the atrium and the ventricle. Cardiomyocytes were normal and nuclei were neatly arranged, oval or spherical, and subjected to light blue staining. There were a small amount of round or oval red-stained blood cells between the myocardial fibers. No obvious pathological changes showed. Due to development or cutting angles, an aortic structure connected to the ventricles was not shown in some animals (
[0120] In the high-dose folic acid group, most animals had delayed cardiac development (n=3), a smaller heart size and thinner heart walls (C9-1, C9-4 and C9-5). In some animals, ventricular septum disappeared (n=1), right ventricule was defective (n=4), and the heart was a solid muscle tissue or only had a small cavity and almost did not have myocardial trabeculae; an inner wall of a left ventricular cavity did not have myocardial trabeculae or only had a small amount of short and thick myocardial trabeculae; and the left and right atria were basically normal (C9-2, C9-3, C9-4 and C9-5). The hearts of individual animals showed different microscopic features, left and right atrial cavities were obviously dilated, left and right ventricular cavities had a similar size, the left ventricle had sparse myocardial trabeculae, and the right ventricle had a smooth inner wall with almost no myocardial trabeculae (C9-1). Due to development or cutting angles, an aortic structure connected to the ventricles was not shown in some animals (C9-3 and C9-4) (
[0121] In the middle-dose folic acid group, the ventricle and the atrium were differentiated, and the intact pericardium, endocardium and epicardium were seen. Longitudinal, oblique, or transverse sections of myocardial fibers could all be seen. The myocardial fibers were well developed and regularly arranged and had a clear texture. No degeneration and necrosis of histiocytes or infiltration of inflammatory cells were seen. However, the ventricle and the atrium of individual animals showed a certain degree of developmental delay (n=1) and the atrium and the ventricle had a relatively small volume (D1-3). In some animals, the ventricular cavity was narrow, the differentiation was delayed, the ventricular wall was smooth, and even ventricular defect existed (n=2), the ventricular cavity was almost invisible and a solid muscle tissue, the myocardial trabeculae were short and sparse in the ventricule (D1-3 and D1-5), and the myocardial trabeculae were sparse in the atrium (D1-3) (
[0122] In the low-dose folic acid group, the differentiation of the atrium and the ventricle was completed, the myocardial fibers were neatly arranged in bundles, different sections of the myocardial fibers were visible, the texture was clear, and there were abundant capillaries between the myocardial fibers. However, the ventricular differentiation of some animals was delayed and the right ventricule was defective (n=3) with only a small cavity; and the left and right atrial cavities were slightly dilated and basically normal (E3-3 and E3-4). Individual animals showed obviously delayed cardiac development (n=1), the heart was smaller, the ventricular septum disappeared, and the right ventricule was defective and a solid muscle tissue, and no myocardial trabeculae were not found; and the left ventricular cavity became smaller, only had a small amount of myocardial trabeculae in the inner wall; and left and right atrial atrophy became smaller (E3-5) (
[0123] The statistical data were shown in Table 2 below. It can be seen from the figure that folic acid may also affect a litter rate of rats and reduce the litter rate under a high dose.
TABLE-US-00002 TABLE 2 Effects of folic acid on development of fetal rats Ventricular Sparse Number Development defects/septal myocardial Malformation Malformation of fetal delay defects trabeculae cases rate rats Folic acid group 3 4 1 4 .sup. 25% 16 (36.44 mg/kg) Folic acidg roup 1 2 2 4 15.4% 26 (18.22 mg/kg) Folic acid group 1 3 1 3 10.7% 28 (9.11 mg/kg) Blank control 0 0 0 0 0% 26 group
Example 9 Effect of Folic Acid on Fetal Rat Heart Under Pharmacological Dose
[0124] In order to investigate an effect of folic acid on fetal rat heart under pharmacological dose, 6 folic acid groups and a blank control group were divided in the experiment, the folic acid groups were divided into a folic acid group 1 (4.555 mg/kg/d), a folic acid group 2 (2.2775 mg/kg/d), a folic acid group 3 (0.911 mg/kg/d), a folic acid group 4 (0.4555 mg/kg/d), a folic acid group 5 (0.22775 mg/kg/d) and a folic acid group 6 (0.113875 mg/kg/d). The folic acid groups and the blank control group consisted of 4 pregnant mice each. The pregnant mice in the folic acid group 1 (4.555 mg/kg/d), the folic acid group 2 (2.2775 mg/kg/d) and the folic acid group 3 (0.911 mg/kg/d) were intraperitoneally injected, the pregnant mice in the folic acid group 4 (0.4555 mg/kg/d), the folic acid group 5 (0.22775 mg/kg/d) and the folic acid group 6 (0.113875 mg/kg/d) were intragastrically administrated, and the pregnant mice in the blank control group were naturally fed. After the female rats were administrated for 7 days, male and female rats were mated in a cage at a ratio of 1:1 overnight, a vaginal plug was checked the next morning, a day when the vaginal plug was found was regarded as day 0 of pregnancy, the pregnant mice were separately fed and administrated for 21 consecutive days, a fetus was obtained by cesarean section, and the number of fetal rats in each group was shown in
[0125] In the folic acid group 1 (4.555 mg/kg/d), the atrium and the ventricle were basically formed by differentiation, and no obvious pathological changes were found in pericardium, endocardium and myocardium. The left and right atriums were basically normally developed, a section of the right atrium was generally slightly larger than that of the left atrium, and abundant myocardial trabeculae could be seen in an inner wall of the cavity. Several individuals had smaller atrial cavities. The left and right ventricles were basically formed, the ventricular wall had rich blood vessels, the left ventricular wall was often thick and had a narrow cavity, there was no obvious left ventricular cavity (n=3), or only closely arranged myocardial trabeculae was seen. Several individuals also showed narrow cavities in the right ventricles. Several individuals also showed too thin right ventricular walls. Large blood vessel lumen connected to the ventricles could be seen in all sections and valves in the lumen could be seen in some sections.
[0126] In the folic acid group 2 (2.2775 mg/kg), the atrium and the ventricle were basically formed by differentiation, the pericardium, the myocardium, the epicardium and the endocardium were intact, and no necrosis and inflammatory cell infiltration were found. Abundant myocardial trabeculae were seen in the left and right atrium, and only a small section of the left atrium was seen in the several individuals (
[0127] In the folic acid group 3 (0.911 mg/kg), the atrium and the ventricle were basically formed by differentiation, the pericardium, the myocardium, the epicardium and the endocardium were intact, and no necrosis and inflammatory cell infiltration were found. The left and right atria were relatively full, and the myocardial trabeculae in the atrium were abundant. Only a small part of the left atrium was seen in some individual sections (
[0128] In the folic acid group 4 (0.4555 mg/kg), the myocardial trabeculae in the left and right atria were abundant, and the atrial section was smaller. The left and right ventricular walls were thicker, the cavities were narrow, the myocardial trabeculae were closely arranged, and the ventricular walls had abundant blood vessels. Several individuals had smaller ventricular sections and stained darker. In the folic acid group 5 (0.22775 mg/kg), the myocardial trabeculae in the left and right atria were abundant. The left and right ventricular walls were thicker, the cavities were narrow, the myocardial trabeculae were closely arranged, the ventricular walls had abundant blood vessels, and the left ventricular cavities were invisible in some individuals (n=5). Large blood vessels and intraluminal valves connected to the ventricles were visible in most sections and only invisible in several individuals.
[0129] In the folic acid group 6 (0.113875 mg/kg), the atrium and the ventricle were basically formed by differentiation, the pericardium was intact, the pericardium, intact myocardium, epicardium and endocardium were not seen in sections of only several individuals, and no necrosis and inflammatory cell infiltration were found. The left and right atria were relatively full, and the myocardial trabeculae in the atrium were abundant. In some individuals, the atrial walls were defective (n=1) and there was hematocele in the pericardial cavity. Since there were no corresponding pathological changes, it might be related to sampling. Several individuals had smaller heart. Myocardial trabeculae in the left and right ventricles were abundant, and some individuals had thicker left ventricular walls and narrow left ventricular cavities. Several individuals also showed ventricular septal defects (n=3), right ventricular stenosis or too thin right ventricular walls.
[0130] Statistics of all the folic acid groups were as follows.
TABLE-US-00003 TABLE 3 Effects of folic acid on development of heart of fetal rats Atrioventricular Sparse Number Development defects/septal myocardial Malformation Malformation of fetal delay defects trabeculae cases rate rats Group 1 1 3 0 4 12.9% 31 Group 2 2 2 0 4 12.1% 33 Group 3 2 1 0 3 11.5% 26 Group 4 0 5 0 5 17.2% 29 Group 5 0 5 0 5 15.2% 33 Group 6 1 4 0 4 9.5% 42 Blank control 0 0 0 0 0% 43 group
[0131] Due to a small sample size, no statistical induction was made. However, from pathological results, the folic acid was likely to cause ventricular defects or septal defects.
Example 10 Effects of Folic Acid and 5-methyltetrahydrofolate on Development of Fetal Mice
[0132] 75 7-week-old female C57BL/6J mice and 25 8-week-old male C57BL/6J mice were provided by Shanghai Lingchang Biotechnology Co., Ltd. with a certificate number of SCXK (Shanghai) 2018-0003. After the animals were purchased, the animals were fed adaptively for about 10 days until the female mice had a weight about 20 g and the male mice had a weight about 25 g, and an experiment began after body maturation. The female mice were randomly divided into 5 groups according to body weight: a solvent control group, a folic acid (151.66 μg/kg) group, a folic acid (303.32 μg/kg) group, a calcium 5-methyltetrahydrofolate (converted to folic acid, 151.66 μg/kg) group and a calcium 5-methyl tetrahydrofolate (converted to folic acid, 303.32 μg/kg) group. 1.1275 unit mass of the calcium 5-methyltetrahydrofolate equaled to 1 unit mass of the folic acid.
[0133] 15 mice were in each group and numbered by a toe clipping method. The mice were intragastrically administrated once a day on the second day after grouping. One week after the pre-administration, male and female mice were caged at a ratio of 3:1, a vaginal plug was observed every day from the next day, and a day when the vaginal plug was seen was recorded as day 0.5 of pregnancy. After 14 days of caging, the female mice stopped the administration, the male mice were removed, and the pregnant female mice were fed alone until litter.
[0134] Neonatal mice of the day were taken out and weighed. Some neonatal mice were randomly selected from each group and electrocardiogram (NeoNatal Mouse, iWorx, Dover, N.H., USA) was performed on the day of birth.
[0135] In addition, 4-5 mice were randomly selected from each group and the 6-day-old small animals were subjected to cardiac echocardiography (Vevo 2100 Imaging System, VisualSonics, Toronto, ON, Canada).
[0136] After the detection, thoracic and abdominal cavities of the mice were dissected, cardiac morphology and beating were observed under a stereoscopic microscope (SMZ168, Motic, Xiamen, Fujian, China), and photographs and video recordings were taken (Motic Image Plus 3.0, Motic, Xiamen, Fujian, China). The mice were sacrificed and the hearts, the livers, the kidneys and the lungs were harvested. The hearts and the livers of the neonatal mice were selected from each group and fixed with 4% paraformaldehyde, the fixed hearts and livers were embedded in paraffin, the embedded hearts and livers were sliced and the slices were stained with H&E. A half of the other tissues were immersed in RNA later for fixation and the other half were directly immersed in liquid nitrogen and frozen for a subsequent experiment.
[0137] Results were as follows:
[0138] Effects of folic acid on cardiac echocardiography of neonatal mice were as follows. The neonatal mice were divided into a control group (A), a low-dose folic acid group (B), a high-dose folic acid group (C), a low-dose methyltetrahydrofolate group (D) and a high-dose methylenetetrahydrofolate group (E). From basic knowledge of kinetics, groups B and C had significantly different dynamic flow phases compared with the control group, while groups D and E were similar to the control group. Echocardiograms of the 6-day-old neonatal mice were seen in
[0139] There was no significant difference in interventricular septum thickness end-diastole (IVS(d)) (mm) and interventricular septum thickness end-systole (IVS(s)) (mm) (A-B); the left ventricular internal diameter end-diastole (LVID(d)) (mm) and the left ventricular internal diameter end-systole (LVID(s)) (mm) in the high-dose folic acid group were significantly lower than those of other groups, and the LVID(d) in the high-dose folic acid group was statistically different from that of other groups (C-D); and there were no significant differences in ejection fraction (EF) and fractional shortening (%) (FS) among groups (E-F). Echocardiogram data of the 6-day-old neonatal mice were seen in
[0140] 1-day-old neonatal mice were sacrificed, the hearts were taken and fixed with 4% paraformaldehyde, the fixed hearts were embedded in paraffin, the embedded hearts were sliced, the slices were stained with H&E and pictures were taken under a normal microscope. The neonatal mice in the control group, the low-dose methyltetrahydrofolate group and the high-dose methyltetrahydrofolate group had intact myocardium. A small block of a heart wall was defective in a part between the left atrium and ventricle of the neonatal mice in the high- and low-dose folic acid group (B and C) as seen in
TABLE-US-00004 TABLE 4 Effects of folic acid on development of heart of fetal mice Ventricular Sparse Number Develop- defects/ myo- Malfor- of fetal ment septal cardial mation rats in delay defects trabeculae cases each group Group A 0 0 0 0 90 Group B 0 5 0 5 84 Group C 2 10 2 10 45 Group D 0 0 0 0 68 Group E 0 0 0 0 68
[0141] Electrodes of the neonatal mice were not inserted subcutaneously like in the adult mice, but were only in contact with the skin, such that measured signals were not very stable and not statistically summarized.
[0142] The above results indicated that the calcium 5-methyltetrahydrofolate had no direct ability to cause cardiac development malformations, while the folic acid may cause congenital heart disease.
Example 11 Calcium 5-Methyltetrahydrofolate for Preventing Cardiac Malformations
[0143] Transgenic zebrafish (fli-1:EGFP) were from the Model Animal Research Center of Nanjing University. Adult zebrafish aged less than 1 year were used for experiment and fed at a water pH value of 7±0.2, a temperature around 28° C. and a ratio of illumination to darkness of 14 h:10 h, and with Artemia salina eggs twice a day. Three zebrafish, one female, two males, were placed in a spawning box the night before and eggs were collected the next morning. Fish eggs were placed in an embryo culture medium (prepared with 0.2 g/L of sea salt) and cultured at 28° C.
[0144] According to literatures, three different types of substances that have been reported to cause congenital heart disease were selected, namely ethanol, lead nitrate and aristolochic acid. A table was listed below for details.
TABLE-US-00005 TABLE 4 Rescue agent and drug concentrations in developmental toxicity experiments Name of drugs Concentration L-5-MTHF-Ca 10 mM (maximum solubility) Pb(NO.sub.3).sub.2 2 and 4 mM CH.sub.3CH.sub.2OH 0.6%, 0.9% and 1.2% Aristolochic acid A 1, 1.5, 2, 3, 4 and 5 μM
[0145] Zebrafish embryos were cultured in 24-well plates with 10 embryos per well at 2 hpf in a dosing manner, drug solutions of the above concentrations in the table were separately added, termination was conducted at 8 hpf, and the embryos were washed and transferred to an egg solution for continuous culture to 72 hpf. Dead embryos were cleaned up in time. Each experiment was conducted in triplicate.
[0146] 5-Selected concentrations of methyltetrahydrofolate in the experiment were recorded in the table. A phenotype of malformation was observed, the number of all abnormal zebrafish where the malformation was present was recorded and a malformation rate and a rescue rate of each group were calculated. Morphological defects, a heart rate, cardiac morphology and other indicators were observed and evaluated by an SMZ745T inverted stereomicroscope.
[0147] 1. Effect of 5-Methyltetrahydrofolate on Preventing Cardiac Malformations Induced by Lead Nitrate
[0148] It was found that 2 and 4 mM Pb(NO.sub.3).sub.2 reduced a survival rate of embryos, but 10 mM L-5-MTHF-Ca did not rescue an effect of the 2 and 4 mM Pb(NO.sub.3).sub.2 on a survival rate of the embryos; compared with the control group, phenotypes of the zebrafish embryos at different time points were evaluated; at 8 hpf, the 2 and 4 mM Pb(NO.sub.3).sub.2 and 2 and 4 mM Pb(NO.sub.3).sub.2+10 mM L-5-MTHF-Ca did not lead to an obvious embryonic developmental delay; at 24 hpf, the 2 and 4 mM Pb(NO.sub.3).sub.2 did not significantly affect development and growth of the zebrafish, the zebrafish embryos developed heads and tails, and the tails swung; and at 48 hpf, the 2 and 4 mM Pb(NO.sub.3).sub.2 did not affect development of intersegmental blood vessels in the zebrafish and did not lead to pericardium edema; and at 72 hpf, the 2 and 4 mM Pb(NO.sub.3).sub.2 led to a shortened body length of the zebrafish and a large amount of embryonic malformations, mainly manifested as curved bodies and short tails, but there was no significant difference in development of lower intestinal network blood vessels. In contrast, 10 mM L-5-MTHF-Ca could rescue embryonic development malformations induced by 2 and 4 mM Pb(NO.sub.3).sub.2(
[0149] To further quantitatively assess a rescue effect of the 10 mM L-5-MTHF-Ca on Pb(NO.sub.3).sub.2, since no pericardium edema of embryos showed, a 10 s heart rate of zebrafish embryos was assessed at 48 hpf and a body length of zebrafish among groups was assessed at 72 hpf. It can be seen from
[0150] In conclusion, 10 mM L-5-MTHF-Ca could rescue all development malformations of zebrafish embryos induced by 2 and 4 mM Pb(NO.sub.3).sub.2.
[0151] 2. Effect of 5-Methyltetrahydrofolate on Preventing Cardiac Malformations Induced by Ethanol
[0152] It was found that a survival rate of a 1.2% EtOH group was significantly different from that of the control group, but a 1.2% EtOH+10 mM L-5-MTHF-Ca group could rescue the survival rate and had no difference in the survival rate with the control group (
[0153] At 48 hpf, 0.9% EtOH and 1.2% EtOH led to a malformed phenotype of bradycardia in zebrafish embryos and had no effect on pigment growth and development of intersegmental blood vessels; and 0.9% and 1.2% EtOH+10 mM L-5-MTHF-Ca could relieve bradycardia. At 48 hpf, EtOH of various concentrations led to a malformed phenotype of pericardium edema in zebrafish embryos and 0.6% EtOH+10 mM L-5-MTHF-Ca could reduce a rate of pericardium edema; and 1.2% EtOH+10 mM L-5-MTHF-Ca had no effect on relieving pericardium edema (
[0154] In conclusion, the ethanol led to early embryonic developmental delay, pericardium edema, bradycardia, a shortened body length, and developmental disorders of lower intestinal network blood vessels in zebrafish embryos, while had no effects on the pigment growth and development of intersegmental blood vessels. The 10 mM L-5-MTHF-Ca could relieve pericardium edema at a low concentration (0.6%) of EtOH, relieve a shortened body length and improve a survival rate of embryos at a high concentration (1.2%) of EtOH, and obviously relieve bradycardia and have a certain preventive effect on malformations at middle and high concentrations (0.9% and 1.2%) EtOH.
[0155] 3. Preventive Effect of 5-Methyltetrahydrofolate on Malformation Caused by Aristolochic Acid A
[0156] 1-5 μM aristolochic acid A were selected for modeling and 10 mM L-5-MTHF-Ca was used for a rescue experiment. It was found that 2-5 μM aristolochic acid A would seriously reduce a survival rate of embryos, while 10 mM L-5-MTHF-Ca could rescue an effect of the aristolochic acid A on the survival rate of the embryos (
[0157] Compared with the control group, phenotypes of zebrafish embryos at different time points were evaluated (
[0158] To further quantitatively assess a rescue effect of the 10 mM L-5-MTHF-Ca on the aristolochic acid A, pericardium edema and a 10 s heart rate of zebrafish embryos were assessed at 48 hpf, and a body length of zebrafish among groups was assessed at 72 hpf. It can be seen from
[0159] In conclusion, the 10 mM L-5-MTHF-Ca could rescue development malformations of zebrafish embryos and death induced by the 1-5 μM aristolochic acid A to a certain extent.