Modifying messenger RNA stability in plant transformations

10837024 ยท 2020-11-17

Assignee

Inventors

Cpc classification

International classification

Abstract

Materials and methods for genome engineering through transient expression of a targeted nuclease are described herein. For example, the methods described herein can include introducing into a cell a messenger RNA (mRNA) that encodes a nuclease targeted to a selected sequence within the cell, where the stability of the mRNA is modified by the addition of untranslated regions (UTRs).

Claims

1. A method for modifying the genomic material of a plant, plant part, or plant cell, comprising directly introducing into the plant, plant part, or plant cell a messenger RNA (mRNA) comprising (a) a structural coding sequence encoding a rare-cutting endonuclease or a rare-cutting endonuclease subunit targeted to a genomic sequence within the plant cell, wherein the rare-cutting endonuclease is a transcription activator-like effector-endonuclease, a meganuclease, or a programmable RNA-guided endonuclease, and (b) an RNA-stabilizing 5 untranslated region (UTR), is operably linked to the structural coding sequence, and wherein the 5 UTR comprises the nucleic acid sequence set forth in SEQ ID NO:10, with the proviso that the T's in SEQ ID NO:10 are U's.

2. The method of claim 1, wherein the plant, plant part, or plant cell is a dicotyledonous or monocotyledonous plant, plant part, or plant cell.

3. The method of claim 1, further comprising regenerating the plant cell or plant part into a plant.

4. A method for modifying the genomic material of a plant, plant part, or plant cell, comprising directly introducing into the plant, plant part, or plant cell an mRNA comprising (a) a structural coding sequence encoding a rare-cutting endonuclease or a rare-cutting endonuclease subunit targeted to a genomic sequence within the plant cell, wherein the rare-cutting endonuclease is a transcription activator-like effector-endonuclease, a meganuclease, or a programmable RNA-guided endonuclease, and (b) an RNA-stabilizing 3 UTR, wherein the 3 UTR is operably linked to the structural coding sequence, and wherein the 3 UTR comprises the nucleic acid sequence set forth in SEQ ID NO:11, with the proviso that the T's in SEQ ID NO:11 are U's.

5. The method of claim 4, wherein the plant, plant part, or plant cell is a dicotyledonous or monocotyledonous plant, plant part, or plant cell.

6. The method of claim 4, further comprising regenerating the plant cell or plant part into a plant.

7. A method for modifying the genomic material of a plant, plant part, or plant cell, comprising directly introducing into the plant, plant part, or plant cell a messenger RNA (mRNA) comprising (a) a structural coding sequence encoding a rare-cutting endonuclease or a rare-cutting endonuclease subunit targeted to a genomic sequence within the plant cell, wherein the rare-cutting endonuclease is a transcription activator-like effector-endonuclease, a meganuclease, or a programmable RNA-guided endonuclease, and (b) RNA-stabilizing 5 and 3 UTRs, wherein the 5 UTR and the 3 UTR are operably linked to the structural coding sequence, wherein the 5 UTR comprises the nucleic acid sequence set forth in SEQ ID NO:10, and wherein the 3 UTR comprises the nucleic acid sequence set forth in SEQ ID NO:11, with the proviso that the T's in SEQ ID NO:10 and SEQ ID NO:11 are U's.

8. The method of claim 7, wherein the plant, plant part, or plant cell is a dicotyledonous or monocotyledonous plant, plant part, or plant cell.

9. The method of claim 7, further comprising regenerating the plant cell or plant part into a plant.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows a representative DNA sequence (SEQ ID NO:1) from the ALS2 gene. The underlined sequences (SEQ ID NOS:2 and 3) represent target sites for transcription activator-like effector-nucleases (TALE-nucleases) that recognize the ALS2 gene.

(2) FIG. 2 is a diagram of a modified pSP72 vector containing the At1G09740 5 and 3 UTRs.

(3) FIG. 3 is an illustration depicting the transcribed sequences containing the four UTR pairs tested.

(4) FIG. 4 is a diagram of a modified pSP72 vector comprising the At1G09740 5 UTR, a sequence encoding a TALE-nuclease subunit, and the At1G09740 3 UTR.

(5) FIG. 5 shows examples of TALE-nuclease-induced mutations in the ALS2 gene. The top line shows unmodified DNA sequence, with the sequences of recognition sites for the ALS2 TALE-nucleases underlined. The other sequences show representative mutations that were induced by imprecise non-homologous end joining (NHEJ). Deletion sizes are given at the right.

(6) FIG. 6 shows additional examples of TALE-nuclease-induced mutations in the ALS2 gene after delivery of mRNA harboring the At1G09740 UTR pair.

(7) FIG. 7 is a graph plotting NHEJ mutation frequencies for the TALE-nuclease when the coding sequence was fused to different UTR pairs. TALE-nuclease and UTR sequences were delivered to cells as either mRNA or DNA, as indicated.

(8) FIG. 8 is a graph plotting the number of insertions within the TALE-nuclease target site vs. the size of the insertion.

DETAILED DESCRIPTION

(9) The global demand for food quantity and quality is ever increasing. To accommodate these growing needs, several genome engineering strategies have been employed to obtain crops at a rate faster than traditional breeding can provide. Genetic engineering offers a route to develop novel plant varieties that are able to thrive under environmental and agricultural constraints, optimizing the energy returned on investment. The vast majority of genetically engineered (GE) crops have traits, such as herbicide and pesticide resistance, that were introduced using transgenic methods. While effective, such methods typically involve insertion of foreign genetic material, and transgenic strains therefore typically require long and arduous regulatory steps before public use is approved (Stoddard et al., ISB Newsletter, 2014). In contrast, the methods described herein involve the transient expression of desired polypeptides by delivery of mRNA transcripts. The transformation of plants, plant parts, or plant cells with mRNA can be particularly useful, since mRNA is not capable of being inserted into plant genomes. Thus, the methods set forth herein can provide tools that are capable of producing novel crops without integration of foreign nucleic acids, which reduces the large scale screenings that would otherwise be necessary to identify a GE plant without the inadvertent incorporation of plasmid DNA.

(10) In eukaryotes, mature mRNAs have a tripartite structure made up of a 5 UTR, a coding region, and a 3 UTR. The UTRs can play a major role in post-transcriptional translation efficiency (van der Velden, Int. J. Biochem. Cell Biol. 31:87-106, 1999), subcellular localization (Jansen, Nat. Rev. Mol. Cell Biol. 2:247-256, 2001) and stability (Bashirullah et al., Proc. Natl. Acad. Sci. USA 98(13):7025-7028, 2001) of the mRNA. mRNA stability can be essential for regulation of gene expression, as the half-life of the mRNA can affect the amount of the corresponding protein that is produced. In some cases, cis-acting elements in the 3 UTR, such as AU-rich elements (AREs), are capable of modulating the stability and translation efficiency of mRNA transcripts (Muhlrad, et al., Genes Dev. 6:2100-2111, 1992; Brown et al., Mol. Cell. Biol. 18(11):6548-6559, 1998). It is to be noted that in some cases, for example, these elements can induce rapid decay of the corresponding transcripts. A reduction in mRNA stability and translation efficiency may be useful in applications where it would be detrimental to have highly targeted mutagenesis by a rare-cutting endonuclease (e.g., disruption of a single copy of a gene).

(11) As described herein, the ability of UTRs to increase or decrease transcript half-life can provide novel methods for introducing mRNA into plants, plant parts, or plant cells. When the mRNA encodes a rare-cutting endonuclease targeted to a particular sequence within a plant, an increased half-life can lead to an increased level of genome engineering at the desired target sequence.

(12) As used herein, the terms plant and plant part refer to cells, tissues, organs, seeds, and severed parts (e.g., roots, leaves, and flowers) that retain the distinguishing characteristics of the parent plant. Seed refers to any plant structure that is formed by continued differentiation of the ovule of the plant, following its normal maturation point at flower opening, irrespective of whether it is formed in the presence or absence of fertilization and irrespective of whether or not the seed structure is fertile or infertile.

(13) Mutagenesis as used herein refers to processes in which mutations are introduced into a selected DNA sequence. Mutations induced by endonucleases generally are obtained by a double-strand break, which results in insertion/deletion mutations (indels) that can be detected by deep-sequencing analysis. Such mutations typically are deletions of several base pairs, and have the effect of inactivating the mutated allele. In the methods described herein, for example, mutagenesis occurs via double-stranded DNA breaks made by nucleases targeted to selected DNA sequences in a plant cell. Such mutagenesis results in nuclease-induced mutations (e.g., nuclease-induced knockouts, such as TALE-nuclease-induced knockouts) and reduced expression of the targeted gene. Following mutagenesis, plants can be regenerated from the treated cells using known techniques (e.g., planting seeds in accordance with conventional growing procedures, followed by self-pollination).

(14) The term expression as used herein refers to the transcription of a particular nucleic acid sequence to produce sense or antisense RNA or mRNA, and/or the translation of an mRNA molecule to produce a polypeptide, with or without subsequent post-translational events.

(15) The term modulating as used herein refers to increasing or decreasing translational efficiency of an mRNA. This can be accomplished by inserting, removing, or altering a 5 UTR sequence, a 3 UTR sequence, or 5 and 3 UTR sequences.

(16) As used herein, the term nucleic acid refers to a polymer made up of nucleotide monomers. A nucleic acid can be single stranded or double stranded, and can be linear or circular. Where single-stranded, a nucleic acid can be a sense strand or an antisense strand. A nucleic acid can be composed of DNA (e.g., cDNA, genomic DNA, synthetic DNA, or a combination thereof), RNA, or DNA and RNA. Further, nucleic acids can contain information for gene expression, including, but not limited to, promoters, 5 UTRs, 3 UTRs, coding sequences, and terminators.

(17) A vector is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. Suitable vector backbones include, for example, those routinely used in the art such as plasmids, viruses, artificial chromosomes, BACs, YACs, or PACs. The term vector includes cloning and expression vectors, as well as viral vectors and integrating vectors. An expression vector is a vector that includes one or more expression control sequences, and an expression control sequence is a DNA sequence that controls and regulates the transcription and/or translation of another DNA sequence. Suitable expression vectors include, without limitation, plasmids and viral vectors derived from, for example, bacteriophage, baculoviruses, tobacco mosaic virus, herpes viruses, cytomegalovirus, retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, Wis.), Clontech (Palo Alto, Calif.), Stratagene (La Jolla, Calif.), and Invitrogen/Life Technologies (Carlsbad, Calif.).

(18) The terms regulatory region, control element, and expression control sequence refer to nucleotide sequences that influence transcription or translation initiation and rate, and stability and/or mobility of the transcript or polypeptide product. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, promoter control elements, protein binding sequences, 5 and 3 UTRs, transcriptional start sites, termination sequences, polyadenylation sequences, introns, and other regulatory regions that can reside within coding sequences, such as secretory signals, Nuclear Localization Sequences (NLS) and protease cleavage sites.

(19) As used herein, operably linked means incorporated into a genetic construct so that expression control sequences effectively control expression of a coding sequence of interest. A coding sequence is operably linked and under the control of expression control sequences in a cell when RNA polymerase is able to transcribe the coding sequence into RNA, which if an mRNA, then can be translated into the protein encoded by the coding sequence. Thus, a regulatory region can modulate, e.g., regulate, facilitate or drive, transcription in the plant cell, plant, or plant tissue in which it is desired to express a modified target nucleic acid.

(20) A promoter is an expression control sequence composed of a region of a DNA molecule, typically within 100 nucleotides upstream of the point at which transcription starts (generally near the initiation site for RNA polymerase II). Promoters are involved in recognition and binding of RNA polymerase and other proteins to initiate and modulate transcription. To bring a coding sequence under the control of a promoter, it typically is necessary to position the translation initiation site of the translational reading frame of the polypeptide between one and about fifty nucleotides downstream of the promoter. A promoter can, however, be positioned as much as about 5,000 nucleotides upstream of the translation start site, or about 2,000 nucleotides upstream of the transcription start site. A promoter typically comprises at least a core (basal) promoter. A promoter also may include at least one control element such as an upstream element. Such elements include upstream activation regions (UARs) and, optionally, other DNA sequences that affect transcription of a polynucleotide such as a synthetic upstream element.

(21) The choice of promoters to be included depends upon several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and cell or tissue specificity. For example, tissue-, organ- and cell-specific promoters that confer transcription only or predominantly in a particular tissue, organ, and cell type, respectively, can be used. In some embodiments, promoters specific to vegetative tissues such as the stem, parenchyma, ground meristem, vascular bundle, cambium, phloem, cortex, shoot apical meristem, lateral shoot meristem, root apical meristem, lateral root meristem, leaf primordium, leaf mesophyll, or leaf epidermis can be suitable regulatory regions. In some embodiments, promoters that are essentially specific to seeds (seed-preferential promoters) can be useful. Seed-specific promoters can promote transcription of an operably linked nucleic acid in endosperm and cotyledon tissue during seed development. Alternatively, constitutive promoters can promote transcription of an operably linked nucleic acid in most or all tissues of a plant, throughout plant development. Other classes of promoters include, but are not limited to, inducible promoters, such as promoters that confer transcription in response to external stimuli such as chemical agents, developmental stimuli, or environmental stimuli.

(22) Non-limiting examples of promoters that can be included in the nucleic acid constructs provided herein include constitutively expressed promoters such as the cauliflower mosaic virus (CaMV) 35S transcription initiation region and maize ubiquitin-1 promoter, fruit-specific promoters such as the ACC-oxidase (Barry, Plant J. 9:525-535, 1996) and E8 promoters (Mehta, Nat. Biotechnol. 20:613-618, 2011), seed-specific promoters such as the HaG3-A (Bogue, Mol. Gen. Genet. 222:49-57, 1990) and Psl (de Pater, Plant J. 6:133-140, 1994) promoters, floral tissue-specific promoters such as the END1 (Gmez, Planta 219:967-981, 2004) and TomA108 (Xu, Plant Cell Rep. 25:231-240, 2006) promoters, root-specific promoters such as the B33 (Farran, Transgenic Res. 11:337-346, 2002) and RB7 (Vaughan, J. Exp. Botany 57:3901-3910, 2006) promoters, the 1 or 2 promoters derived from T-DNA of Agrobacterium tumefaciens, promoters from a maize leaf-specific gene described by Busk (Plant J. 11:1285-1295, 1997), kn1-related genes from maize and other species, and chemical-inducible promoters such as the XVE (Zuo et al., The Plant Journal 24:265-273, 2000) and GVG (Aoyama and Chua, The Plant Journal 11:605-612, 1997) promoter systems.

(23) A 5 UTR is transcribed, but is not translated, and lies between the start site of the transcript and the translation initiation codon and may include the +1 nucleotide. A 3 UTR can be positioned between the translation termination codon and the end of the transcript. UTRs can have particular functions such as increasing mRNA message stability or translation attenuation. Examples of 3 UTRs include, without limitation, polyadenylation signals and transcription termination sequences. A polyadenylation region at the 3-end of a coding region can also be operably linked to a coding sequence. The polyadenylation region can be derived from the natural gene, from various other plant genes, or from an Agrobacterium T-DNA.

(24) The term rare-cutting endonuclease as used herein refers to a natural or engineered protein having endonuclease activity directed to a nucleic acid sequence with a recognition sequence (target sequence) about 12-40 bp in length (e.g., 14-40, 15-36, or 16-32 bp in length; see, e.g., Baker, Nature Methods 9:23-26, 2012). Typical rare-cutting endonucleases cause cleavage inside their recognition site, leaving 4 nt staggered cuts with 3-OH or 5-OH overhangs. In some embodiments, a rare-cutting endonuclease can be a meganuclease, such as a wild type or variant homing endonuclease (e.g., a homing endonuclease belonging to the dodecapeptide family (LAGLIDADG; SEQ ID NO:9) (see, WO 2004/067736). In some embodiments, a rare-cutting endonuclease can be a fusion protein that contains a DNA binding domain and a catalytic domain with cleavage activity. TALE-nucleases and zinc finger nucleases (ZFNs) are examples of fusions of DNA binding domains with the catalytic domain of the endonuclease FokI. Customized TALE-nucleases are commercially available under the trade name TALEN (Cellectis, Paris, France).

(25) TALEs are found in plant pathogenic bacteria in the genus Xanthomonas. These proteins play important roles in disease, or trigger defense, by binding host DNA and activating effector-specific host genes (see, e.g., Gu et al., Nature 435:1122-1125, 2005; Yang et al., Proc. Natl. Acad. Sci. USA 103:10503-10508, 2006; Kay et al. Science 318:648-651, 2007; Sugio et al., Proc. Natl. Acad. Sci. USA 104:10720-10725, 2007; and Rmer et al. Science 318:645-648, 2007). Specificity depends on an effector-variable number of imperfect, typically 34 amino acid repeats (Schornack et al., J. Plant Physiol. 163:256-272, 2006; and WO 2011/072246). Polymorphisms are present primarily at repeat positions 12 and 13, which are referred to herein as the repeat variable-diresidue (RVD).

(26) The RVDs of TALEs correspond to the nucleotides in their target sites in a direct, linear fashion, one RVD to one nucleotide, with some degeneracy and no apparent context dependence. This mechanism for protein-DNA recognition enables target site prediction for new target specific TALEs, as well as target site selection and engineering of new TALEs with binding specificity for the selected sites.

(27) TALE DNA binding domains can be fused to other sequences, such as endonuclease sequences, resulting in chimeric endonucleases targeted to specific, selected DNA sequences, and leading to subsequent cutting of the DNA at or near the targeted sequences. Such cuts (double-stranded breaks) in DNA can induce mutations into the wild-type DNA sequence via NHEJ or homologous recombination, for example. In some cases, TALE-nucleases can be used to facilitate site directed mutagenesis in complex genomes, knocking out or otherwise altering gene function with great precision and high efficiency. As described in the Examples below, TALE-nucleases targeted to the Nicotiana benthamiana ALS gene can be used to mutagenize the endogenous gene, confirmed by indels at the target site. The fact that some endonucleases (e.g., FokI) function as dimers can be used to enhance the target specificity of the TALE-nuclease. For example, in some cases a pair of TALE-nuclease monomers targeted to different DNA sequences (e.g., the underlined target sequences shown in FIG. 1; SEQ ID NOS:2 and 3) can be used. When the two TALE-nuclease recognition sites are in close proximity, as depicted in FIG. 1, the inactive monomers can come together to create a functional enzyme that cleaves the DNA. By requiring DNA binding to activate the nuclease, a highly site-specific restriction enzyme can be created.

(28) In some embodiments, the methods provided herein can include the use of programmable RNA-guided endonucleases, or portions (e.g., subunits) thereof. RNA-guided endonucleases are a new genome engineering tool that has been developed based on the RNA-guided CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-associated nuclease (Cas9) from the type II prokaryotic CRISPR adaptive immune system (see, e.g., Belahj et al., Plant Methods 9:39, 2013). This system can cleave DNA sequences that are flanked by a short sequence motif known as a proto-spacer adjacent motif (PAM). Cleavage is achieved by engineering a specific CRISPR RNA (crRNA) that is complementary to the target sequence that associates with the Cas9 endonuclease. In this complex, the trans-activating crRNA (tracrRNA):crRNA complex acts as a guide RNA that directs the Cas9 endonuclease to the cognate target sequence. A synthetic single guide RNA (sgRNA) also has been developed that, on its own, is capable of targeting the Cas9 endonuclease. This tool can be expressed utilizing the UTR sequences described herein, to genetically engineer plant cells. Thus, in some embodiments, the coding sequence of the Cas9 endonuclease and sgRNA or tracrRNA:crRNA can be transiently expressed from the expression plasmids as provided herein.

(29) Another programmable RNA-guided endonuclease of a class 2 CRISPR-Cas system also has been described and used for gene editing purposes (Zetsche et al., Cell 163:759-771, 2015). This system uses a non-specific endonuclease unit from the Cpf1 protein family, with a specificity of cleavage conferred by a single crRNA (lacking tracr RNA). Similar to Cas9, the Cpf1 coding sequence can be fused to UTR sequences described herein to improve its stability, and thus the efficiency of the resulting gene editing method.

(30) Accordingly, this document also provides a method for gene editing using a programmable RNA-guide endonuclease system, where the Cas9 or Cpf1 coding sequence is fused to a suitable stabilizing UTR sequence, such as those disclosed herein.

(31) The percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number is determined as follows. First, a nucleic acid or amino acid sequence is compared to the sequence set forth in a particular sequence identification number using the BLAST 2 Sequences (Bl2seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand-alone version of BLASTZ can be obtained online at fr.com/blast or at ncbi.nlm.nih.gov. Instructions explaining how to use the Bl2seq program can be found in the readme file accompanying BLASTZ. Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\Bl2seq -i c:\seq1.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of Bl2seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq c:\seq1.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.

(32) Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence (e.g., SEQ ID NO:1), or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 240 matches when aligned with the sequence set forth in SEQ ID NO:1 is 94.9 percent identical to the sequence set forth in SEQ ID NO:3 (i.e., 240253100=94.9). It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. It also is noted that the length value will always be an integer.

(33) This document provides expression plasmids that contain (a) a coding sequence and (b) a 5 UTR, a 3 UTR, or both a 5 UTR and a 3 UTR. In some embodiments, the 5 UTR can have the sequence set forth in SEQ ID NO:10 or SEQ ID NO:12, or a sequence with at least 95 percent identity to SEQ ID NO:10 or SEQ ID NO:12. In some embodiments, the 3 UTR can have the sequence set forth in SEQ ID NO:11 or SEQ ID NO:13, or a sequence with at least 95 percent identity to SEQ ID NO:11 or SEQ ID NO:13. In some embodiments, the 5 UTR can have the sequence set forth in SEQ ID NO:10, or a sequence with at least 95 percent identity to SEQ ID NO:10, and the 3 UTR can have the sequence set forth in SEQ ID NO:11, or a sequence with at least 95 percent identity to SEQ ID NO:11. In some embodiments, the 5 UTR can have the sequence set forth in SEQ ID NO:12, or a sequence with at least 95 percent identity to SEQ ID NO:12, and the 3 UTR can have the sequence set forth in SEQ ID NO:13, or a sequence with at least 95 percent identity to SEQ ID NO:13. The expression plasmids provided herein can be constructed for in vitro expression of mRNA transcripts or for expression in planta.

(34) An expression plasmid as provided herein can contain, for example, (a) a 5 promoter region, (b) a 5 UTR, (c) a structural coding sequence encoding a polypeptide, and (d) a polyadenylated tail [poly(A)-tail], where the 5 promoter region and the 5 UTR are operably linked to the structural coding sequence, such that the polypeptide encoding sequence can be transiently expressed in a plant cell after introduction of the plasmid into the plant cell. In some embodiments, an expression plasmid as provided herein can contain (a) a 5 promoter region, (b) a structural coding sequence encoding a polypeptide, (c) a 3 UTR, and (d) a poly(A)-tail, where the 5 promoter region and the 3 UTR are operably linked to the structural coding sequence, such that the polypeptide encoding sequence can be transiently expressed in a plant cell after introduction of the plasmid into the plant cell. In some embodiments, an expression plasmid can contain (a) a 5 promoter region, (b) a 5 UTR, (c) a structural coding sequence encoding a polypeptide, (d) a 3 UTR, and (e) a poly(A)-tail, where the 5 promoter region, 5 UTR, and 3 UTR are operably linked to the structural coding sequence, such that the polypeptide encoding sequence can be transiently expressed in a plant cell after introduction of the plasmid into the plant cell.

(35) The 5 promoter region can exist naturally in a plant cell, or can be capable of naturally entering a plant cell (e.g., a promoter sequence that may have originated in either a bacterial system such as Agrobacterium, or a viral system such as Geminivirus). The 5 promoter region can include a constitutive promoter or an inducible promoter. When the promoter is inducible, the methods provided herein can include inducing the promoter.

(36) The polypeptide-encoding sequence can encode a rare-cutting endonuclease or rare-cutting endonuclease subunit (e.g., a monomer of an endonuclease that functions as a dimer). The rare-cutting endonuclease can be, for example, a transcription activator-like (TAL) effector endonuclease, a ZFN, a meganuclease, or a programmable RNA-guided endonuclease. Transient expression of the rare-cutting endonuclease can result in site-directed mutagenesis.

(37) Any suitable UTR or combination of UTRs can be used. As described in the Examples herein, for example, certain UTRs derived from Arabidopsis thaliana mRNA transcripts are capable of increasing the stability of mRNA-encoding sequence-specific nucleases when operably linked to the polypeptide-encoding sequence. Such UTRs can be from the gene At1G09740 (SEQ ID NOS:10 and 11), which is annotated as being involved in cellular response to iron ion starvation, iron ion transport, nitrate transport, response to molecules of fungal origin, and response to nitrate. This protein codes for a universal stress protein A (UspA) domain, which is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents (The Arabidopsis Information Resource [TAIR], available online at arabidopsis.org/servlets/TairObject?type=locus&name=At1g09740). The At1G09740 mRNA transcript was determined to have a half-life of 73.8 hours in a genome-wide analysis of mRNA decay rates in A. thaliana (Narsai et al., Plant Cell 19:3418-3436, 2007). Thus, in some embodiments, increased stability granted by the At1G09740 UTRs can allow site-specific nucleases to be expressed at a higher and more sustained level, resulting in increased frequency of targeted mutagenesis.

(38) In some cases, UTRs derived from A. thaliana mRNA transcripts can decrease the stability of mRNA encoding sequence-specific nucleases. Such UTRS can be from the gene At5G28050 (SEQ ID NOS:12 and 13), which is annotated as being involved purine nucleoside catabolic process, and functions in zinc ion binding (The Arabidopsis Information Resource [TAIR], supra). The At5G28050 mRNA transcript was determined to have a half-life of 34.1 hours in a genome-wide analysis of mRNA decay rates in A. thaliana (Narsai et al., supra). Thus, in some cases, decreased stability granted by the At5G28050 UTRs can allow site-specific nucleases to be expressed at a lower level, which can be useful in applications that benefit from reduced transcription (e.g., reduced toxicity, reduced off-target cleavage, reduction of gene copies targeted).

(39) Other examples of UTR sequences that may be useful in the materials and methods provided herein are described by Narsai et al. (supra), which contains a list of several thousand genes with UTRs that could have effects similar to those of the At1G09740 gene.

(40) This document also provides host cells containing expression plasmids as described herein. Suitable host cells include, without limitation, plant cells or plant cell lines (e.g., protoplasts, mesophyll cells, hypocotyl cells, or undifferentiated calli cells), bacterial cells, yeast cells, and animal cells (e.g., non-human cells, or cells derived from an animal such as a mammal).

(41) In addition, this document provides methods for modulating (e.g., increasing or decreasing) the transient expression of a polypeptide in a plant cell. The methods can include, for example, introducing into a plant cell a nucleic acid that includes (a) a 5 promoter region, (b) an optional 5 UTR, (c) a structural coding sequence encoding a polypeptide, (d) an optional 3 UTR, and (e) a poly(A)-tail, where one or both of the 5 UTR and the 3 UTR are present, where the 5 promoter region, 5 UTR (when present), and 3 UTR (when present) are operably linked to the structural coding sequence such that the polypeptide is transiently expressed in the plant cell. As described above, the 5 promoter region can exist naturally in a plant cell or can be capable of naturally entering a plant cell, the 5 promoter region can include a constitutive promoter or an inducible promoter (in which case the methods can include inducing the promoter), and the polypeptide-encoding sequence can encode a rare-cutting endonuclease or rare-cutting endonuclease subunit targeted to a DNA sequence (e.g., an endogenous genomic sequence) within the plant cell. Transient expression of the rare-cutting endonuclease in the plant cell can result in site-directed mutagenesis when the endonuclease cleaves the DNA at its target site.

(42) Any suitable method can be used to introduce the nucleic acid into the plant cell. In some embodiments, for example, a method as provided herein can include contacting a plant cell with an organism that is capable of horizontal gene transfer (e.g., a bacterium, such as an Agrobacterium), where the organism contains a Ti or Ri plasmid having a T-DNA region that includes the promoter, UTRs, coding sequence, and poly-A tail. In other embodiments, a method for modulating the transient expression of a polypeptide in a plant cell can include using PEG-mediated, biolistics-mediated, or electroporation-mediated transformation of a plant cell (e.g., a protoplast) to introduce a plasmid containing the nucleic acid.

(43) This document also provides methods for generating plants. The methods can include, for example, (a) introducing into a plant cell a nucleic acid that includes (i) a 5 promoter region, (ii) an optional 5 UTR, (iii) a polypeptide-encoding sequence, (iv) an optional 3 UTR, and (v) a poly(A)-tail, where one or both of the 5 UTR and the 3 UTR are present, and where the 5 promoter region, 5 UTR (when present), and 3 UTR (when present) are operably linked to the structural coding sequence such that the polypeptide is transiently expressed in the plant cell, and (b) regenerating the plant cell into a plant. The polypeptide-encoding sequence can encode a rare-cutting endonuclease or a rare-cutting endonuclease subunit, and the regenerated plant can contain one or more mutations generated by transient expression of the rare-cutting endonuclease.

(44) Again, any suitable method can be used to introduce the plasmid into the plant cell. For example, the plant cell can be contacted with an organism capable of horizontal gene transfer (e.g., an Agrobacterium) that contains a modified Ti or Ri plasmid having a T-DNA region that includes the above-referenced nucleic acid, such that the polypeptide-encoding sequence is expressed in the plant cell. In other embodiments, PEG-mediated, biolistics-mediated, or electroporation-mediated transformation can be used to introduce an expression plasmid containing the above-referenced nucleic acid into the plant cell.

(45) In some embodiments, methods for using rare-cutting endonucleases (e.g., TALE-nucleases or CRISPR/Cas-based nucleases) operably linked to a 5 UTR, a 3 UTR, or a 5 UTR and a 3 UTR to generate plants, plant cells, or plant parts having mutations in endogenous genes can include, for example, using vectors as described in the Examples herein. For example, one or more nucleic acids encoding TALE-nucleases targeted to selected sequences (e.g., the ALS2 sequence shown in FIG. 1) can be transformed into plant cells (e.g., protoplasts, mesophyll cells, hypocotyl cells, or undifferentiated calli cells), where they can be expressed. In some cases, one or more TALE-nuclease proteins can be introduced into plant cells (e.g., protoplasts). The plant cells, or a plant cell line or plant part(s) generated from the plant cells, can subsequently be analyzed to determine whether mutations have been introduced at the target site(s), using nucleic acid-based assays (e.g., PCR and DNA sequencing, or PCR followed by a T7E1 assay; Mussolino et al., Nucleic Acids Res. 39:9283-9293, 2011) to detect mutations at the genomic loci.

(46) This document also provides articles of manufacture that include one or more expression plasmids as described herein, in combination with packaging material and one or more additional components (e.g., buffers or other reagents) for use in the methods described herein. In some embodiments, an article of manufacture can include host cells transformed with an expression plasmid as provided herein. The one or more plasmids and/or the host cells can be packaged using packaging material well known in the art to prepare an article of manufacture. An article of manufacture also can have a label (e.g., a tag or label secured to the packaging material, a label printed on the packaging material, or a label inserted within the package). The label can indicate that the plasmid(s) and/or host cells contained within the package can be used to generate genetically modified plants, for example.

(47) The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

EXAMPLES

Example 1Engineering Sequence-Specific Nucleases to Mutagenize the ALS2 Gene

(48) To completely inactivate or knock-out the ALS2 gene in N. benthamiana, software that specifically identifies TALE nuclease recognition sites (e.g., TALE-NT 2.0; Doyle et al., Nucleic Acids Res 40:W117-122, 2012) was used to design sequence-specific nucleases targeted to sequences just downstream of the ALS2 protein coding sequence. The TALE-nuclease target sites for the ALS2 gene are shown in FIG. 1 and also in TABLE 1 below; this TALE-nuclease pair is designated ALS2_T1. TALE-nucleases were obtained from Cellectis Bioresearch (Paris, France).

Example 2ALS2-T1 TALE Nuclease Activity in Yeast

(49) To assess the activity of the TALE-nucleases targeting the ALS2 gene, activity assays were performed in yeast using methods similar to those described elsewhere (Christian et al., Genetics 186:757-761, 2010). For these assays, a target plasmid was constructed with the TALE-nuclease recognition sites cloned into a non-functional -galactosidase reporter gene; the plasmid was transformed into yeast using PEG-mediated transformation (Sigma; St. Louis, Mo.). The sequence containing the target sites was flanked by a direct repeat of -galactosidase coding sequence, so that if the reporter gene was cleaved by the TALE-nuclease pair (expressed from the translational elongation factor EF-1 alpha (TEF1) promoter), recombination would occur between the direct repeats and function would be restored to the -galactosidase gene. -galactosidase activity therefore served as a measure of TALE-nuclease cleavage activity. In the yeast assay, the ALS2_T1 TALE-nuclease pair displayed cleavage activity. Activities were normalized to the benchmark nuclease, I-SceI. Results are summarized in TABLE 2.

Example 3Construction of Enhanced Stability Expression Plasmids

(50) To achieve transient expression of desired nucleases without integration of exogenous DNA into the genome of a targeted cell, an mRNA expression vector was synthesized that included the 5 and 3 UTRs from either At1G09740 (SEQ ID NOS:10 and 11), At5G28050 (SEQ ID NOS:12 and 13), actin (SEQ ID NOS:14 and 15), or At4G16190 (SEQ ID NOS:16 and 17) (FIG. 3). The effects of adding these UTRs to the expression constructs was assessed to determine the level of increased stability and/or translational efficiency for the nuclease or nuclease mRNA, as measured by NHEJ frequencies. To construct the enhanced mRNA expression plasmid, the pSP72 plasmid (Promega; Madison, Wis.) (FIG. 2) was modified using restriction enzymes to insert a synthesized cassette (Integrated DNA Technologies; Coralville, Iowa) containing: (i) 5 UTR sequence, (ii) linker sequence, and (iii) 3 UTR sequence. This cassette was synthesized and ligated into the modified pSP72 utilizing sticky end restriction site ligation. After verification in E. coli, this plasmid was subjected to restriction enzyme digests followed by ligation of the TALE-nuclease subunits to yield the desired product (FIG. 4).

Example 4Increased NHEJ Frequency in N. benthamiana Protoplasts Using Expression Vectors Containing 5 and 3 UTRs

(51) TALE-nuclease activity at endogenous target sites in N. benthamiana was measured by expressing the TALE-nucleases operably linked to the 5 and 3 UTRs from either At1G09740 (SEQ ID NOS:10 and 11), At5G28050 (SEQ ID NOS:12 and 13), actin (SEQ ID NOS:14 and 15), or At4G16190 (SEQ ID NOS:16 and 17) in protoplasts and subsequently surveying the target sites for mutations introduced by NHEJ. Methods for protoplast preparation were performed as described elsewhere (Wright et al., Plant J. 44:693-705, 2005). Briefly, seeds were sterilized by washing them successively with 100% ethanol, 50% bleach and then sterile distilled water. The sterilized seeds were planted on MS agarose medium supplemented with iron. Protoplasts were isolated from young expanded leaves using the protocol described by Wright et al. (supra).

(52) Plasmids containing TALE nuclease coding sequences operably linked to the 5 and 3 UTRs, together a plasmid encoding yellow fluorescent protein (YFP), were introduced into N. benthamiana protoplasts by polyethylene glycol- (PEG-) mediated transformation (Yoo et al., Nature Protocols 2:1565-1572, 2007). Twenty-four hours after treatment, transformation efficiency was measured using a fluorescent microscope to monitor YFP fluorescence in an aliquot of the transformed protoplasts. The remainder of the transformed protoplasts were harvested, and genomic DNA was prepared using a hexadecyltrimethylammonium bromide- (CTAB-) based method. Using genomic DNA prepared from the protoplasts as a template, a 235-bp fragment encompassing the TALE-nuclease recognition site was amplified by PCR. Sequencing reads with insertion/deletion (indel) mutations in the spacer region were considered to be derived from imprecise repair of a cleaved TALE-nuclease recognition site by NHEJ. Mutagenesis frequency was calculated as the number of sequencing reads with NHEJ mutations out of the total sequencing reads.

(53) Three biological replicates were performed. The activities of the ALS2 TALE-nuclease pairs, with or without the addition of UTRs, are summarized in TABLE 3. When the TALE-nucleases were delivered as mRNA with the At1G09740 UTRs, a NHEJ frequency of 15.5% was observed at the ALS2 loci, as compared to 5.1% for mRNA encoding TALE-nucleases delivered with the At5G28050 UTRs, and 7.7% for transformations in which the TALE-nuclease-encoding mRNA did not contain the UTRs. When the TALE-nucleases were delivered as DNA with the At1G09740 UTRs, a NHEJ frequency of 77.3% was observed at the ALS2 loci, as compared to 27.1% for transformation in which the TALE-nuclease-encoding DNA was delivered with the At5G28050 UTRs, and 70.7% for transformations in which the TALE-nuclease-encoding DNA did not contain the UTRs. Examples of TALE-nuclease-induced mutations at ALS2 are shown in FIGS. 5 and 6. A summary of mutation frequencies from all four UTR pairs is shown in FIG. 7.

Example 5Decreased Insertion Frequencies when TALE-Nucleases are Delivered by mRNA

(54) A benefit of using mRNA over DNA for nuclease delivery is that plants without foreign DNA are more likely to be created, and this may lessen the regulatory burden for crop varieties created through genome engineering. Consistent with this hypothesis, the analysis of the insertion/deletion (indel) mutation profile from the 454 pyrosequencing data revealed a large disparity in the types of mutations created by mRNA and DNA reagents. Cells transformed with DNA constructs had an average insertion frequency of 6.25%, compared to a 1.98% insertion frequency for cells transformed with mRNA. Among the insertions created with DNA reagents, 88% were >10 bp, with a median insertion size of 90 bp (FIG. 8). In contrast, only 24% of insertions resulting from mRNA delivery were >10 bp, with a median insertion size of a 3 bp. For the DNA transformation experiments, the majority (>90%) of insertions 10 bp were derived from the plasmid vector; that is, the inserted sequence originated from the TALEN-encoding plasmid. In contrast, only one of the insertions resulting from the mRNA transformation experiments had an insertion (131 bp) that matched the TALEN coding sequence. This insertion may have arisen from DNA contamination if the expression vector was not completely digested by DNase treatment after in vitro transcription.

(55) Taken together, these data indicate that mRNA delivery yields mutation profiles that only rarely involve DNA insertion, which may be an advantage for creating plants that contain mutations but to not contain foreign DNA.

(56) TABLE-US-00001 At1G097405 UTRSequence (SEQIDNO:10) ctcttgaactttccaagagttgaagaaaatcacagaaagccttagcacag agaagagagattgaagaagtc At1G097403 UTRSequence (SEQIDNO:11) agaggatatatatgtacatatgcaaagggatatcaagaccatctgtaatc ttttgaagttttgtgaagctatagaagccaagcaagaattctaccagatt acttcccaaataagtggtgtgaatgtaaattaataagagctacagaaaca ttgattggctcagtgtatgtgttgtattcatattcgttgttttattttat acggttgagaattgaataatgttgttgcatcaaatcactatgaaggacat ttacag At5G280505 UTRSequence (SEQIDNO:12) ctcaattttggactcgtctgcttttgtttatataaacacttctcttcttc ttcaatctccacacacaccacacaaaaccacctaccttcttcgatttctc cagaaatcctccttcaagttcatactcatggaagaagctaaag At5G280503 UTRSequence (SEQIDNO:13) agcacttctccattaccacattcttcttcttcttctccttcatgatggta attagaagtagtagaagaagaactgcacttgctttaacttaaataaatct ctgtttcaaattgttcattttaaaaacagaaggaaacgaaaaaaaaaatc aatttcggttcttgttgacacgatttgtaatttcttttcttcatttgaat tgaactggtaaatactttcttctctgtcaaaatctttattttctattttc tgtacaaggccaagttcttcactaataaatcgaattgtttttcta Actin5 UTRSequence (SEQIDNO:14) agaaaaaaataaaagagtgagaaaaatcgtagagctatatattcgcacat gtactcgtttcgctttccttagtgttagctgctgccgctgttgtttctcc tccatttctctatctttctctctcgctgcttctcgaatcttctgtatcat cttcttcttcttcaagtgaaaa Actin3 UTRSequence (SEQIDNO:15) gtgtgtcttgtcttatctggttcgtggtggtgagtttgttacaaaaaaat ctattttccctagttgagatgggaattgaactatctgttgttatgtggat tttattttcttttttctctttagaaccttatggttgtgtcaagaagtctt gtgtactttagttttatatctctgttttatctcttctattttctttagga tgcttgtgatgatgctgtttttttttgtccctaagcaaaaaaatatcata ttatatttggtccttggttcatttttttggtttttttttgtcttcacata taaatattgtttgaatgtcttcaatcttttatttgtatgagacaattatt taagtatcgggtgacaatgcagctattatgtattgtcgattgtt At4G161905 UTRSequence (SEQIDNO:16) tgtccccaaagtctcctcttccttatctcttggaaaccaagaagc At4G161903 UTRSequence (SEQIDNO:17) aattattaggacactacctgtctatctttgtgtatatgtatgtatggttg cataaagatactacgaacttttatcgttagtattgtgtctctgtttcagc ttttaatgtaaaatagcttgggggtattatctttgtagcattgaatgctt aagatgataatatgatatgattatcaaattattataagttggaacttgga ataatagaaattttatatgttttatatt

(57) TABLE-US-00002 TABLE1 ALS2_T1TALE-nucleasetargetsequences TargetSequenceLeft SEQID: TargetSequenceRight SEQID: TAGCTTGTTCCACATTT 2 TGTCATGCTGGGTCAG 3

(58) TABLE-US-00003 TABLE 2 ALS2 TALE-nuclease activity in yeast Activity in yeast* Target Subunit ALS2_T1 37 C. ALS2_T1 30 C. ALS2 T01 Left 0.97 (0.02) 0.86 (0.02) ALS2 T01 Right *Normalized to I-SceI (max = 1.0)

(59) TABLE-US-00004 TABLE 3 454 Sequencing Data UTR SEQ ID Nucleic Acid Mean NHEJ Standard Construct NOS: Delivered Frequency (%) Error ALS2 TALE nuclease with UTR 10 and 11 mRNA 15.53 2.97 ALS2 TALE nuclease with UTR 12 and 13 mRNA 5.13 2.58 ALS2 TALE nuclease no UTR N/A mRNA 7.69 3.32 ALS2 TALE nuclease with UTR 10 and 11 DNA 77.31 2.15 ALS2 TALE nuclease with UTR 12 and 13 DNA 27.09 6.23 ALS2 TALE nuclease no UTR N/A DNA 70.68 2.73

Other Embodiments

(60) It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.