CTGF GENE-SPECIFIC DOUBLE-STRANDED OLIGONUCLEOTIDE, AND A COMPOSITION FOR PREVENTING AND TREATING FIBROTIC DISEASES AND RESPIRATORY-RELATED DISEASES COMPRISING SAME
20230042493 · 2023-02-09
Inventors
- Han-Oh PARK (Sejong-si, KR)
- Tae-Rim KIM (Daejeon, KR)
- Young-Ho KO (Daejeon, KR)
- Sung ll YUN (Daejeon, KR)
- Jun Hong PARK (Daejeon, KR)
Cpc classification
A61P43/00
HUMAN NECESSITIES
C12N2320/32
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
C12N2320/11
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a double-stranded oligonucleotide capable of inhibiting CTGF expression with a very specific and high efficiency, a double-stranded oligonucleotide structure and nanoparticles comprising the double-stranded oligonucleotide, and a use thereof in preventing or treating of fibrotic or respiratory diseases.
Claims
1. A CTGF-specific double-stranded oligonucleotide comprising a sense strand comprising any one sequence selected from the group consisting of SEQ ID NOs: 1, 2, 10, and 15 and an antisense strand comprising a sequence complementary thereto.
2. (canceled)
3. The CTGF-specific double-stranded oligonucleotide according to claim 1, wherein the oligonucleotide is siRNA, shRNA, or miRNA.
4. The CTGF-specific double-stranded oligonucleotide according to claim 1, wherein each of the sense strand and the antisense strand is independently DNA or RNA.
5. The CTGF-specific double-stranded oligonucleotide according to claim 1, wherein the sense strand or the antisense strand of the double-stranded oligonucleotide comprises a chemical modification.
6. (canceled)
7. The CTGF-specific double-stranded oligonucleotide according to claim 1, wherein at least one phosphate group is bound to a 5′ end of the antisense strand of the double-stranded oligonucleotide.
8. A CTGF-specific double-stranded oligonucleotide construct having a structure of Structural Formula (1) below:
A-X—R—Y—B Structural Formula (1) in Structural Formula 1, A is a hydrophilic material, B is a hydrophobic material, X and Y are each independently a simple covalent bond or a linker-mediated covalent bond, and R is the double-stranded oligonucleotide according to claim 1.
9. The CTGF-specific double-stranded oligonucleotide construct according to claim 8, having a structure of Structural Formula (2) below: ##STR00008## in Structural Formula (2), S and AS are a sense strand and an antisense strand of the double-stranded oligonucleotide according to claim 8, respectively, and A, B, X, and Y are as defined in claim 8.
10. The CTGF-specific double-stranded oligonucleotide construct according to claim 9, having a structure of Structural Formula (3) or Structural Formula (4) below: ##STR00009## in Structural Formulas (3) and (4), A, B, X, Y, S, and AS are as defined in claim 9, and 5′ and 3′ are 5′ and 3′ ends of the sense strand of the double-stranded oligonucleotide.
11. (canceled)
12. The CTGF-specific double-stranded oligonucleotide construct according to claim 8, wherein the hydrophilic material has a structure of Structural Formula (5) or Structural Formula (6) below:
(A′.sub.m-J).sub.n Structural Formula (5)
(J-A′.sub.m).sub.n Structural Formula (6) in Structural Formula (5) or Structural Formula (6), A′ is a hydrophilic material monomer, J is a linker connecting m hydrophilic material monomers to each other or connecting m hydrophilic material monomers and a double-stranded oligonucleotide to each other, m is an integer of 1 to 15, n is an integer of 1 to 10, the hydrophilic material monomer A′ is any one compound selected from among compounds (1) to (3) below, and the linker (J) is selected from the group consisting of —PO.sub.3.sup.−—, —SO.sub.3—, and —CO.sub.2−: ##STR00010## compound (1), G is selected from the group consisting of O, S, and NH; ##STR00011##
13. The CTGF-specific double-stranded oligonucleotide construct according to claim 12, having a structure of Structural Formula (7) or Structural Formula (8) below:
(A′.sub.m-J).sub.n-X—R—Y—B Structural Formula (7)
(-A′.sub.m).sub.n-X—R—Y—B. Structural Formula (8)
14.-21. (canceled)
22. Nanoparticles comprising the double-stranded oligonucleotide construct according to claim 8.
23. The nanoparticles according to claim 22, wherein the nanoparticles are configured such that double-stranded oligonucleotide constructs comprising double-stranded oligonucleotides comprising different sequences are mixed.
24. A method of preventing or treating fibrosis or a respiratory disease comprising administering a pharmaceutical composition comprising the double-stranded oligonucleotide according to claim 1.
25. A method of preventing or treating fibrosis or a respiratory disease comprising administering the nanoparticles according to claim 22 as an active ingredient.
26. The method according to claim 24, wherein the respiratory disease is any one selected from the group consisting of chronic obstructive pulmonary disease (COPD), asthma, acute or chronic bronchitis, allergic rhinitis, productive cough, bronchitis, bronchiolitis, laryngopharyngitis, tonsillitis, and laryngitis.
27. The method according to claim 24, wherein the fibrosis is any one selected from the group consisting of idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, keloid, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.
28. The method according to claim 25, wherein the respiratory disease is any one selected from the group consisting of chronic obstructive pulmonary disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, productive cough, bronchitis, bronchiolitis, laryngopharyngitis, tonsillitis, and laryngitis.
29. The method pharmaceutical composition according to claim 25, wherein the fibrosis is any one selected from the group consisting of idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, keloid, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.
30.-31. (canceled)
32. A method of preventing or treating fibrosis or a respiratory disease comprising administering the double-stranded oligonucleotide construct according to claim 8 as an active ingredient.
33. The method according to claim 32, wherein the respiratory disease is any one selected from the group consisting of chronic obstructive pulmonary disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, productive cough, bronchitis, bronchiolitis, laryngopharyngitis, tonsillitis, and laryngitis.
34. The method according to claim 32, wherein the fibrosis is any one selected from the group consisting of idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, keloid, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.
35. (canceled)
Description
DESCRIPTION OF DRAWINGS
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
MODE FOR INVENTION
[0142] A better understanding of the present invention may be obtained through the following examples. These examples are merely set forth to illustrate the present invention and are not construed as limiting the scope of the present invention, as will be apparent to those skilled in the art. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.
[0143] In the present invention, it was confirmed that a specific sequence capable of inhibiting the expression of CTGF was ultimately identified and CTGF expression was effectively inhibited by complementary binding thereof to mRNA encoding CTGF, thereby effectively treating fibrosis and respiratory diseases.
Example 1. Algorithm for Screening of SAMiRNA Targeting CTGF and Selection of Candidate Sequences
[0144] SAMiRNA-based drug high-throughput screening is a method for generating all possible candidate sequences by applying a 1-base or 2-base sliding-window algorithm to an entire mRNA sample, removing unnecessary candidate sequences by performing homology filtering, and determining the extent of inhibition of expression of the corresponding gene by all of the finally selected SAMiRNAs.
[0145] A design process for SAMiRNA candidate sequences for CTGF was performed in a manner in which a 2-base sliding-window algorithm was applied to NM_001901.2 (2,358 bp), which is human CTGF mRNA, to thus finally select 1,162 SAMiRNA candidate sequences each composed of 19 nucleotides, and the extent of inhibition of CTGF thereby was evaluated.
Example 2. Synthesis of Double-Stranded Oligo RNA Construct
[0146] The double-stranded oligo RNA construct (SAMiRNA) produced in the present invention has a structure according to the following structural formula.
C.sub.24-5′ S 3′-(hexaethyleneglycol-PO.sub.4.sup.−).sub.3-hexaethyleneglycol
AS 5′-PO4
[0147] The sense strand of a monoSAMiRNA (n=4) double-stranded oligo construct was synthesized in a manner in which three dimethoxytrityl (DMT) hexaethylene glycol phosphoramidates, which are hydrophilic material monomers, were successively bound through the above reaction using 3,4,6-triacetyl-1-hexa(ethyleneglycol)-N-acetyl galactosamine-CPG as a support, RNA or DNA synthesis was performed, and then C.sub.24(C.sub.6—S—S—C.sub.18) containing a disulfide bond, which is a hydrophobic material, was bound to the 5′ end, thereby obtaining the sense strand of monoSAMiRNA (n=4) in which NAG-hexaethylene glycol-(—PO.sub.3-hexaethylene glycol) 3 was bound to the 3′ end and C.sub.24 (C.sub.6—S—S—C.sub.18) was bound to the 5′ end.
[0148] After completion of synthesis, the synthesized single-stranded RNA and oligo (DNA or RNA)/polymer construct were separated from CPG using 28% (v/v) ammonia in a water bath at 60° C., followed by a deprotection reaction to remove protective residues. After removal of the protective residues, the single-stranded RNA and the oligo (DNA or RNA)/polymer construct were treated with N-methylpyrrolidone, triethylamine, and triethylamine trihydrofluoride at a volume ratio of 10:3:4 in an oven at 70° C. to remove 2′-dimethylsilyl. The single-stranded RNA, the oligo (DNA or RNA)/polymer construct, and the ligand-bound oligo (DNA or RNA)/polymer construct were separated from the reaction products through high-performance liquid chromatography (HPLC), and the molecular weights thereof were measured using a TOF mass spectrometer (MALDI TOF-MS, SHIMADZU, Japan) to determine whether they matched the nucleotide sequence and the oligo/polymer construct to be synthesized. Thereafter, in order to produce each double-stranded oligo construct, the sense strand and the antisense strand were mixed in equal amounts, added to a 1× annealing buffer (30 mM HEPES, 100 mM potassium acetate, 2 mM magnesium acetate, pH 7.0), allowed to react in a constant-temperature water bath at 90° C. for 3 minutes, and allowed to react at 37° C. again, thereby producing desired SAMiRNA. Annealing of the double-stranded oligo RNA constructs thus produced was confirmed through electrophoresis.
Example 3. High-Throughput Screening (HTS) of SAMiRNA Nanoparticles Inducing RNAi Targeting Human CTGF
[0149] 3.1 Production of SAMiRNA Nanoparticles
[0150] 1,162 SAMiRNAs targeting the CTGF sequence synthesized in Example 2 were dissolved in 1× Dulbecco's phosphate-buffered saline (DPBS) (WELGENE, KR) and lyophilized for 5 days in a freeze dryer (LGJ-100F, CN). The lyophilized nanoparticle powder was dissolved and homogenized in 1.429 ml of deionized distilled water (Bioneer, KR) and used in the experiments for the present invention.
[0151] 3.2 Intracellular Processing of SAMiRNA Nanoparticles
[0152] MDA-MB231, which is a human-derived breast cancer cell line, was used to discover SAMiRNA that inhibits CTGF expression, and the MDA-MB231 cell line was cultured at 37° C. and 5% CO.sub.2 in a Gibco™ RPMI 1640 medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US). Using the same medium as above, the MDA-MB231 cell line was dispensed at a density of 2×10.sup.4 cells/well in a 96-well plate (Costar, US), and the next day, SAMiRNA homogenized with deionized distilled water in Example 3.1 was diluted to 200 nM or 600 nM with 1×DPBS and added to the cells. Cell treatment with SAMiRNA was performed a total of 4 times, once every 12 hours, and culture was carried out at 37° C. and 5% CO.sub.2.
[0153] 3.3 SAMiRNA Screening Through Analysis of CTGF mRNA Expression Inhibitory Efficacy
[0154] Total RNA was extracted from the cell line treated with SAMiRNA in Example 3-2 and was synthesized into cDNA, after which the relative mRNA expression level of the CTGF gene was quantified using real-time PCR.
[0155] In order to analyze the mRNA expression level of the CTGF gene, a 300 nM CTGF forward primer, a 300 nM CTGF reverse primer, a 300 nM CTGF probe, a 200 nM RPL13A forward primer, a 200 nM RPL13A reverse primer, a 300 nM RPL13A probe, a 400 nM TBP forward primer, a 400 nM TBP reverse primer, and a 300 nM TBP probe were added to each well of an AccuPower® Dual-HotStart RT-qPCR kit (Bioneer, Korea) and dried (Table 2). The performance of the prepared kit was determined based on PCR amplification efficiency (Table 3) by creating a calibration curve using A549 cell total RNA. RT-qPCR was performed under reaction conditions of 95° C. for 10 minutes and then (95° C. for 5 seconds and 58° C. for 15 seconds)×45 cycles, and a protocol in which the fluorescence value was detected at each cycle was followed.
[0156] The SAMiRNA-treated 96-well plate (Costar, US) was subjected to total RNA extraction and one-step RT-qPCR according to an automated program using ExiStation HT™ Korea, which is an automated apparatus that performs all procedures from total RNA extraction to RT-qPCR, an HT DNA/RNA extraction kit (Bioneer, Korea), and an AccuPower® Dual-HotStart RT-qPCR kit (Bioneer, Korea) that is separately prepared by including primers and probes for quantitative analysis of CTGF gene mRNA.
[0157] Based on the Ct values of two genes obtained after qPCR array, the relative mRNA expression level (%) of the CTGF gene in the experimental group compared to the control group was calculated through relative quantitative analysis using a 2(−Delta Delta C(T)) method [Livak K. J., Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. December; 25(4):402-8].
TABLE-US-00003 TABLE 2 Primer and hydrolysis probe sequences used in high-throughput screening (HTS) CTGF Forward CACCAGCATGAAGACATACCG (SEQ ID NO: primer 33) CTGF Reverse CGTCAGGGCACTTGAACTC (SEQ ID NO: 34) primer CTGF probe 5′FAM-CCGACGGCCGATGCTGCACCCCC-3′EBQ (SEQ ID NO: 35) RPL13A GTGTTTGACGGCATCCCACC (SEQ ID NO: 36) Forward primer RPL13A TAGGCTTCAGACGCACGACC (SEQ ID NO: 37) Reverse primer RPL13A probe 5′TAMRA-AAGCGGATGGTGGTTCCTGCT-3′EBQ (SEQ ID NO: 38) TBP Forward CACCACAGCTCTTCCACTC (SEQ ID NO: 39) primer TBP Reverse ATCCCAGAACTCTCCGAAGC (SEQ ID NO: 40) primer TBP probe 5′TEXASRED-ACCCTTGCCGGGCACCACTC- 3′EBQ (SEQ ID NO: 41)
TABLE-US-00004 TABLE 3 3-plex RT-qPCR amplification efficiency Name Slope R.sup.2 Efficiency CTGF Y = −0.3020X + 7.6316 0.9966 100% RPL13A Y = −0.2977X + 7.4425 0.9997 98% TBP Y = −0.2958X + 10.5934 0.9952 99%
Example 4. Screening of SAMiRNA Nanoparticles Inducing RNAi Targeting Human CTGF
[0158] In order to select highly efficient SAMiRNA, a lung cancer cell line A549 was treated with sequences having the highest efficiency of reduction of the mRNA expression level of CTGF at a final concentration of 200 nM or 600 nM compared to the control group, namely 16 sequences having reduction efficiency >60% or more (secondary screening results for a total of 49 types of SAMiRNA-hCTGF), at concentrations of 500 nM and 1000 nM, and the sequence information of the corresponding SAMiRNA is shown in Table 4 below.
[0159] Thereafter, in order to proceed with an experiment to confirm the effect of reduction of expression level (knock-down) after treatment at a low concentration to determine IC.sub.50 compared to Rxi-109 (sense: 5′-GCACCUUUCUA*G*A-chol-3′ (SEQ ID NO: 57) 13mer/AS: 5′-phosphate-UCUAGAAAGGUGC*A*A*A*C*A*U-3′ (SEQ ID NO: 58) 19mer/bold=2′OME/underline=2′F/asterisk=phosphorothioate/chol=cholesterol) (WO 2009/102427), tertiary screening of the lung cancer cell line A549 for the eight strongest sequences was performed at 50, 100, 200, 500, and 1000 nM. Consequently, four SAMiRNAs having the sequences of SEQ ID NOs: 1, 2, 10, and 15 as respective sense strands were selected.
[0160] As shown in
TABLE-US-00005 TABLE 4 CTGF-specific SAMiRNA candidate sequences selected through 2-base sliding-window screening and high- throughput screening (HTS) SEQ ID NO: Accession No. Position Sequence (DNA/RNA) 1 NM_001901.2 1890-1908 Sense ATGTACAGTTATCTAAGTT 17 Antisense AACUUAGAUAACUGUACAU 2 NM_001901.2 1891-1909 Sense TGTACAGTTATCTAAGTTA 18 Antisense UAACUUAGAUAACUGUACA 3 NM_001901.2 1982-2000 Sense GTACAGTTATCTAAGTTAA 19 Antisense UUAACUUAGAUAACUGUAC 4 NM_001901.2 2042-2060 Sense ATGGAAATTCTGCTCAGAT 20 Antisense AUCUGAGCAGAAUUUCCAU 5 NM_001901.2 2043-2061 Sense TGGAAATTCTGCTCAGATA 21 Antisense UAUCUGAGCAGAAUUUCCA 6 NM_001901.2 2044-2062 Sense GGAAATTCTGCTCAGATAG 22 Antisense CUAUCUGAGCAGAAUUUCC 7 NM_001901.2 1332-1350 Sense ATTTCAGTAGCACAAGTTA 23 Antisense UAACUUGUGCUACUGAAAU 8 NM_001901.2 1333-1351 Sense TTTCAGTAGCACAAGTTAT 24 Antisense AUAACUUGUGCUACUGAAA 9 NM_001901.2 1334-1352 Sense TTCAGTAGCACAAGTTATT 25 Antisense AAUAACUUGUGCUACUGAA 10 NM_001901.2 1330-1348 Sense TGATTTCAGTAGCACAAGT 26 Antisense ACUUGUGCUACUGAAAUCA 11 NM_001901.2 1331-1349 Sense GATTTCAGTAGCACAAGTT 27 Antisense AACUUGUGCUACUGAAAUC 12 NM_001901.2 1324-1342 Sense TAAAAATGATTTCAGTAGC 28 Antisense GCUACUGAAAUCAUUUUUA 13 NM_001901.2 1325-1343 Sense AAAAATGATTTCAGTAGCA 29 Antisense UGCUACUGAAAUCAUUUUU 14 NM_001901.2 1326-1344 Sense AAAATGATTTCAGTAGCAC 30 Antisense GUGCUACUGAAAUCAUUUU 15 NM_001901.2 1335-1353 Sense TCAGTAGCACAAGTTATTT 31 Antisense AAAUAACUUGUGCUACUGA 16 NM_001901.2 1336-1354 Sense CAGTAGGAGAAGTTATTTA 32 Antisense UAAAUAACUUGUGCUACUG
[0161] The lung cancer cell line A549 was treated with SAMiRNA having, as the sense strand, each of the sequences of SEQ ID NOs: 1, 2, 10, and 15 selected in Example 3, and the mRNA expression pattern of CTGF in the cell line was analyzed.
[0162] 4.1 Intracellular Processing of SAMiRNA Nanoparticles
[0163] A549 (ATCC® CCL-185™, Manassas, Va.), which is a human-derived lung cancer cell line, was used to discover SAMiRNA that inhibits CTGF expression, and the A549 cell line was cultured at 37° C. and 5% CO.sub.2 in a Gibco™F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US). Using the same medium as above, the A549 cell line was dispensed at a density of 8×10.sup.4 cells/well in a 12-well plate (Costar, US), and the next day, SAMiRNA homogenized with deionized distilled water in Example 3.1 was diluted to 50, 100, 200, 500, or 1000 nM with 1×DPBS and added to the cells. Cell treatment with SAMiRNA was performed a total of 4 times, once every 12 hours, and culture was carried out at 37° C. and 5% CO.sub.2.
[0164] 4.2 SAMiRNA Screening Through Analysis of Human CTGF mRNA Expression Inhibitory Efficacy
[0165] Total RNA was extracted from the cell line treated with SAMiRNA in Example 4-1 and was synthesized into cDNA, and then the relative mRNA expression level of the CTGF gene was quantified using real-time PCR.
[0166] 4-2-1 RNA Isolation from SAMiRNA-Treated Cells and cDNA Synthesis
[0167] Total RNA was extracted from the cell line treated with SAMiRNA in Example 4-1 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, Bioneer, Korea), and the extracted RNA was synthesized into cDNA using RNA reverse transcriptase (AccuPower® RocketScript™ Cycle RT Premix with oligo (dT)20, Bioneer, Korea) in the following manner. Specifically, 1 μg of the extracted RNA was added to AccuPower RocketScript™RT Premix with oligo (dT) 20 (Bioneer, Korea) contained in each of 0.25 ml Eppendorf tubes, and DEPC (diethyl pyrocarbonate)-treated distilled water was added thereto to achieve a total volume of 20 μl. In a gene amplification system (MyGenie™ Gradient Thermal Block, Bioneer, Korea), two processes of hybridizing RNA with primers at 37° C. for 30 seconds and synthesizing cDNA at 48° C. for 4 minutes were repeated 12 times, after which the amplification reaction was terminated by deactivating the enzyme at 95° C. for 5 minutes.
[0168] 4-2-2 Relative Quantitative Analysis of Human CTGF mRNA
[0169] The relative mRNA expression level of CTGF compared to the SAMiRNA control sample was analyzed in the following manner through SYBR green real-time qPCR using the cDNA synthesized in Example 4-2-1 as a template. Specifically, the cDNA synthesized in Example 4-2-1 was diluted 5-fold with distilled water, and for analysis of the mRNA expression level of CTGF, 3 μl of the diluted cDNA, 25 μl of AccuPower® GreenStar™ (Korea), 19 μl of distilled water, and 3 μl of CTGF qPCR primers (SEQ ID NOs: 7 and 8 (Table 5); 10 pmol/μl, respectively, Bioneer, Korea) were added to each well of a 96-well plate to obtain a mixed solution. Meanwhile, in order to normalize the mRNA expression level of CTGF, GAPDH (glyceraldehyde-3-phosphate dehydrogenase), which is a housekeeping (HK) gene, was used as a standard gene. The 96-well plate containing the mixed solution was subjected to the following reaction using an Exicycler™ Real-Time Quantitative Thermal Block (Bioneer, Korea): reaction at 95° C. for 15 minutes to activate the enzyme and remove the secondary structure of cDNA, 42 cycles each including four processes of denaturation at 94° C. for 30 seconds, annealing at 58° C. for 30 seconds, extension at 72° C. for 30 seconds, and SYBR green scan, and final extension at 72° C. for 3 minutes, after which the temperature was maintained at 55° C. for 1 minute and the melting curve from 55° C. to 95° C. was analyzed.
[0170] After termination of PCR, the Ct (threshold cycle) value of each target gene was corrected using the GAPDH gene, and then a difference ΔCt in Ct values was calculated using a control group treated with SAMiRNA (SAMiCONT) (sense: 5′-CUUACGCUGAGUACUUCGA-3′ (19mer) (SEQ ID NO: 59), antisense: 5′-UCGAAGUACUCAGCGUAAG-3′ (19mer) (SEQ ID NO: 60)), which is a control sequence that does not induce gene expression inhibition. The relative expression level of the target gene in the cells treated with CTGF-specific SAMiRNA was quantified using the ΔCt value and equation 2 (−ΔCtx100).
[0171] In order to select highly efficient SAMiRNA, SAMiRNA #10, having, as the sense strand, the sequence having the highest efficiency of reduction of the mRNA expression level of CTGF at a final concentration of 50, 100, 200, 500, or 1000 nM compared to the control group, namely the sequence of SEQ ID NO: 10, was finally selected.
[0172] As shown in
[0173] Consequently, it was confirmed that all of the CTGF-specific SAMiRNAs having the sequence of SEQ ID NO: 10 as the sense strand reduced the mRNA expression level of CTGF by 50% or more even at a low concentration of 50 nM, thereby inhibiting the CTGF expression with very high efficiency. As shown in
TABLE-US-00006 TABLE 5 Primer sequence information for qPCR Primer Sequence SEQ ID NO: hGAPDH-F GGTGAAGGTCGGAGTCAACG 42 hGAPDH-R ACCATGTAGTTGAGGTCAATGAAGG 43 hCTGF-F CACCAGCATGAAGACATACCG 44 hCTGF-R CGTCAGGGCACTTGAACTC 45
[0174] (F stands for forward primer and R stands for reverse primer)
TABLE-US-00007 TABLE 6 SAMiRNA sequence effectively inhibiting CTGF expression SEQ ID NO: Code Name Position Sense strand sequence 10 SAMi- 1330-1348 TGATTTCAGTAGCACAAGT CTGF#1330
Example 5. Comparative Analysis of Inhibition of Human CTGF Expression by DNA/RNA Hybrid and RNA/RNA Hybrid SAMiRNA Including Selected Sequence of SEQ ID NO: 10 as Sense Strand
[0175] A lung cancer cell line A549 was treated using a double-stranded oligo DNA/RNA hybrid and RNA/RNA hybrid including CTGF-specific SAMiRNA having the sequence of SEQ ID NO: 10 selected in Example 4 as a sense strand, and the relative mRNA expression level (%) of CTGF in the cell line was analyzed.
[0176] 5.1 Intracellular Processing of SAMiRNA Nanoparticles
[0177] A549, which is a human-derived lung cancer cell line, was used to discover SAMiRNA that inhibits CTGF expression, and the A549 cell line was cultured at 37° C. and 5% CO.sub.2 in a Gibco™F-12K (Kaighn's) medium (Thermo, US) containing 10% fetal bovine serum (Hyclone, US) and 1% penicillin-streptomycin (Hyclone, US). Using the same medium as above, the A549 cell line was dispensed at a density of 8×10.sup.4 cells/well in a 12-well plate (Costar, US), and the next day, SAMiRNA homogenized with deionized distilled water in Example 3.1 was diluted to 200 nM or 600 nM with 1×DPBS and added to the cells. Cell treatment with SAMiRNA was performed a total of 4 times, once every 12 hours, and culture was carried out at 37° C. and 5% CO.sub.2.
[0178] 5.2 SAMiRNA Screening Through Analysis of Human CTGF mRNA Expression Inhibitory Efficacy
[0179] Total RNA was extracted from the cell line treated with SAMiRNA in Example 5-1 and was synthesized into cDNA, after which the relative mRNA expression level of the CTGF gene was quantified using real-time PCR.
[0180] 5-2-1 RNA Isolation from SAMiRNA-Treated Cells and cDNA Synthesis
[0181] Total RNA was extracted from the cell line treated with SAMiRNA in Example 5-1 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, Bioneer, Korea), and the extracted RNA was synthesized into cDNA in the following manner using RNA reverse transcriptase (AccuPower® RocketScript™ oligo (dT)20, Bioneer, Korea). Specifically, 1 μg of the extracted RNA was added to AccuPower® RocketScript™ (Korea) contained in each of 0.25 ml Eppendorf tubes, and DEPC (diethyl pyrocarbonate)-treated distilled water was added thereto to achieve a total volume of 20 μl. In a gene amplification system (MyGenie™ Gradient Thermal Block, Bioneer, Korea), two processes of hybridizing RNA with primers at 37° C. for 30 seconds and synthesizing cDNA at 48° C. for 4 minutes were repeated 12 times, after which the amplification reaction was terminated by deactivating the enzyme at 95° C. for 5 minutes.
[0182] 5-2-2 Relative Quantitative Analysis of Human CTGF mRNA
[0183] The relative mRNA expression level of CTGF compared to the SAMiRNA control sample was analyzed in the following manner through SYBR green real-time qPCR using the cDNA synthesized in Example 5-2-1 as a template. Specifically, the cDNA synthesized in Example 5-2-1 was diluted 5-fold with distilled water, and for analysis of the mRNA expression level of CTGF, 3 μl of the diluted cDNA, 25 μl of AccuPower® (Korea), 19 μl of distilled water, and 3 μl of CTGF qPCR primers (SEQ ID NOs: 44 and 45 (Table 5); 10 pmol/μl, respectively, Bioneer, Korea) were added to each well of a 96-well plate to obtain a mixed solution. Meanwhile, in order to normalize the mRNA expression level of CTGF, GAPDH (glyceraldehyde-3-phosphate dehydrogenase), which is a housekeeping (HK) gene, was used as a standard gene. The 96-well plate containing the mixed solution was subjected to the following reaction using an Exicycler™ Quantitative Thermal Block (Bioneer, Korea): reaction at 95° C. for 15 minutes to activate the enzyme and remove the secondary structure of cDNA, 42 cycles each including four processes of denaturation at 94° C. for 30 seconds, annealing at 58° C. for 30 seconds, extension at 72° C. for 30 seconds, and SYBR green scan, and final extension at 72° C. for 3 minutes, after which the temperature was maintained at 55° C. for 1 minute and the melting curve from 55° C. to 95° C. was analyzed.
[0184] After termination of PCR, the Ct (threshold cycle) value of each target gene was corrected using the GAPDH gene, and then the difference L in values was calculated using a control group treated with SAMiRNA (SAMiCONT), which is a control sequence that does not induce gene expression inhibition. The relative expression level of the target gene in the cells treated with CTGF-specific SAMiRNA was quantified using the A value and equation 2 (−Δx100).
[0185] In order to select highly efficient SAMiRNA among double-stranded oligo DNA/RNA hybrid and RNA/RNA hybrid, SAMiRNA, which is a DNA/RNA hybrid having, as the sense strand, the sequence having the highest efficiency of reduction of the mRNA expression level of CTGF at a final concentration of 200 nM or 600 nM compared to the control group, namely the DNA sequence of SEQ ID NO: 10, was finally selected.
[0186] As shown in
Example 6. Screening of SAMiRNA Nanoparticles Inducing RNAi Targeting Rat CTGF
[0187] In siRNA therapeutic agents, it is difficult to discover the optimal sequence that may be commonly applied to different strains. Here, US FDA guidelines are provided to verify pharmacological efficacy due to inhibition of expression of the corresponding gene and toxicity due to inhibition of expression of the corresponding gene by designing an siRNA sequence (surrogate sequence; mouse gene-specific siRNA) specific to an animal model (confirmed through an in-vivo efficacy test) that analyzes the therapeutic effect (presentation by Robert T. Dorsam Ph.D. Pharmacology/Toxicology Reviewer, FDA/CDER).
[0188] The SAMiRNA-based sequence was discovered using a conventional algorithm-based siRNA design program (Turbo-si-designer owned by the applicant). A total of 94 candidate siRNA sequences were generated from rat CTGF gene (NM_022266.2) full transcript sequences, and the corresponding SAMiRNA was synthesized, after which the rat liver-cancer-derived H4-II-E cell line was treated therewith at 500 nM under cell culture conditions containing 10% FBS, so the in-vitro expression inhibitory effect was primarily screened using the primers shown in Table 8 below (primer sequence information for qPCR) (
[0189] In order to select highly efficient SAMiRNA, secondary screening for the sequences having the highest efficiency of reduction of the mRNA expression level of rat CTGF at a final concentration of 500 nM compared to the control group, namely 12 sequences having reduction efficiency >60% or more (a total of 94 types of SAMiRNA-rat CTGF), was performed at 200 nM and 500 nM in an H4-II-E cell line, which is a rat liver cancer cell line. Consequently, three SAMiRNAs having the sequences of SEQ ID NOs: 46, 47, and 48 as respective sense strands were selected.
[0190] As shown in
[0191] In order to select highly efficient SAMiRNA, SAMiRNA-rat CTGF #46, having, as the sense strand, the sequence having the highest efficiency of reduction of the mRNA expression level of rat CTGF at a final concentration of 25, 50, 100, 200, 400, or 800 nM compared to the control group, namely the sequence of SEQ ID NO: 46, was finally selected.
[0192] As shown in
[0193] In addition, as shown in
TABLE-US-00008 TABLE 8 (F stands for forward primer and R stands for reverse primer) Primer Sequence rat-GAPDH-F AACATCATCCCTGCATCCAC (SEQ ID NO: 49) rat-GAPDH-R CGGATACATTGGGGGTAGGA (SEQ ID NO: 50) rat-CTGF-F CAAGGGTCTCTTCTGCGAC (SEQ ID NO: 51) rat-CTGF-R ATTTGCAACTGCTTTGGAAGG (SEQ ID NO: 52)
TABLE-US-00009 TABLE 9 SEQ ID Sense NO: Code Name Position strand sequence 46 SAMi- 195-213 GACACTGGTTTCGAGACAG rCTGF#46 47 SAMi- 182-200 CCTGTCAATCTCAGACACT rCTGF#47 48 SAMi- 984-1002 CATCCGGACGCCTAAAATT rCTGF#48
Example 7. Verification of Efficacy of SAMiRNA-Rat CTGF Through Intradermal Administration in Wound-Induced Keloid Animal Model
[0194] The efficacy of SAMi-rCTGF on wounds induced with an 8 mm biopsy punch (Biopsy punch, BP-80F, Kai, Japan) was analyzed. For the experiment, 7-week-old rats were purchased (SD Rats, Nara Biotech, Gangnam, Korea) and acclimatized for 1 week. Wounds were made on the back skin of the rats using an 8 mm biopsy punch. 1200 μg/site of each of saline (PBS) for a negative control group, SAMiRNA-rCTGF #46 DNA/RNA(D/R) for an experimental group, and SAMiRNA-rCTGF #46 RNA/RNA(R/R) for another experimental group was intradermally administered thereto a total of two times 2 days before wound induction and on the day of wound induction. The rats were sacrificed on the 3.sup.rd day after wound induction.
[0195] 7-1. Analysis of Gene Expression for SAMiRNA in Wound-Induced Keloid Animal Model
[0196] The rat skin tissue treated with SAMiRNA was obtained and primarily ground using a mortar and pestle and liquid nitrogen. The ground tissue was placed in a lysis buffer of an RNA extraction kit (AccuPrep Cell total RNA extraction kit, Bioneer, Korea) and secondarily ground using a homogenizer. Thereafter, total RNA was extracted according to the manufacturer's protocol. The extracted RNA was synthesized into cDNA using RNA reverse transcriptase (AccuPower® RocketScript™RT Premix with oligo (dT)20, Bioneer, Korea) in the following manner.
TABLE-US-00010 TABLE 10 RT parameter Step Temperature Time 1 37° C. 30 sec 2 48° C. 4 min 3 55° C. 30 sec 4 Go to step 1 12 cycle 5 95° C. 5 min
[0197] The relative expression level of total mRNA in each group was analyzed in the following manner through SYBR green real-time qPCR using the synthesized cDNA as a template. Specifically, the synthesized cDNA was diluted 10-fold with distilled water, and for analysis of the mRNA expression level of CTGF, 10 μl of the diluted cDNA, 25 μl of AccuPower® GreenStar™ (Korea), 20 μl of distilled water, and 5 μl of CTGF qPCR primers (3 pmol/μl each, Table 11) were added to each well of a 96-well plate to obtain a mixed solution. Meanwhile, in order to normalize the mRNA expression levels of CTGF, fibronectin, and Col3α1, RPL13A, which is a housekeeping (HK) gene, was used as a standard gene. After termination of qPCR, the Ct (threshold cycle) value of each target gene was corrected using the RPL13A gene, the ΔCt value of the target gene was determined, and then the ΔΔCt value thereof compared to the control group was calculated. The relative expression levels of CTGF, fibronectin, and Col3α1 genes were quantified using the ΔΔCt value and equation 2 (−ΔΔCt×100).
TABLE-US-00011 TABLE 11 (F stands for forward primer and R stands for reverse primer) Primer Sequence Rat Rpl13a F AGGGGCAGGTTCTAGTATTG (SEQ ID NO: 53) Rat Rpl13a R GCGTACAACCACCACCTTTC (SEQ ID NO: 54) Rat Ctgf F AGGAGTGGGTGTGTGATGAG (SEQ ID NO: 55) Rat Ctgf R TTGGCTCGCATCATAGTTGG (SEQ ID NO: 56)
TABLE-US-00012 TABLE 12 Step Temperature Time qPCR parameter 1 95° C. 10 min 2 95° C. 5 sec 3 58° C. 25 sec 4 72° C. 30 sec Scan 5 Go to step 2 40 cycle
[0198] Consequently, it was confirmed that CTGF expression was significantly reduced in the group treated with 1200 μg of SAMiRNA-rCTGF(D/R) compared to the group treated with saline in wound-induced rats, and a statistically significant reduction was also confirmed in the group treated with 1200 μg of SAMiRNA-rCTGF(D/R) compared to the group treated with 1200 μg of SAMiRNA-rCTGF(R/R).
[0199] As shown in
[0200] Although specific embodiments of the present invention have been disclosed in detail above, it will be obvious to those skilled in the art that the description is merely of preferable exemplary embodiments and is not to be construed as limiting the scope of the present invention. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.
INDUSTRIAL APPLICABILITY
[0201] According to the present invention, a double-stranded oligonucleotide construct including a CTGF-specific double-stranded oligonucleotide and a pharmaceutical composition containing the same as an active ingredient are capable of inhibiting the expression of CTGF with high efficiency without side effects, and are very effective at preventing and treating diseases and respiratory diseases caused by excessive fibrosis.
SEQUENCE LIST FREE TEXT
[0202] An electronic file is attached.