BIOLOGICALLY ACTIVE COMPOUND CONJUGATED TO A STAPLED OR STITCHED PEPTIDE
20200353092 ยท 2020-11-12
Assignee
Inventors
- Keith Foster (Camberley, Surrey, GB)
- Wouter Eilers (Reading, GB)
- Adam James Reginald Gadd (Reading, Berkshire, GB)
Cpc classification
A61K47/65
HUMAN NECESSITIES
C07K7/02
CHEMISTRY; METALLURGY
A61P21/00
HUMAN NECESSITIES
C07K19/00
CHEMISTRY; METALLURGY
A61K48/0075
HUMAN NECESSITIES
A61K47/64
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
C07C13/00
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K47/65
HUMAN NECESSITIES
A61K47/64
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
Abstract
The invention relates to improvements in drug delivery and more particularly to the use of Cell Penetrating Agents (CPA's) or Cell Penetrating Peptides (CPP's) which have been stabilized by, for example: i) stapling two amino acids to form Stapled CPP's (StaP's) or ii) stitching three or more amino acids to form stitched CPP's (StiP's). These stabilized CPP's are conjugated to a drug or Biologically Active Compound (BAC) directly or via a Bi-Functional Linker (BFL) so that the BAC can be carried though a cell membrane by the CPP. The resulting molecules are referred to as Drug Carrying Cell Penetrating Molecules (DCCPM's). The preferred BAC is an electrically low charge carrying oligonucleotide such as a phosphorodiamidate morpholino oligonucleotide (PMO). The invention also relates to a method of facilitating the uptake of a BAC into a cell, the use of a DCCPM in the treatment of a disease requiring alteration of an endogenous or exogenous gene, a method of improving the bioavailability of a drug or BAC, a method of introducing a drug or BAC to a site which is refractory to the drug or BAC in its native state, a method of treating a subject comprising administering the DCCPM's of the invention and to a pharmaceutical composition comprising the DCCPM and one or more pharmaceutically acceptable excipients.
Claims
1-40. (canceled)
41. A drug carrying cell penetrating molecule (DCCPM) comprising: i. a biologically active compound (BAC), and ii. a cell penetrating agent (CPA), which BAC and CPA are linked directly or via a bi-functional linker (BFL), wherein the CPA is a stabilized peptide (CPP) which has a conformation imposed upon it by stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP), the StaP comprises a cross link or bridge between two conformationally adjacent amino acids of the peptide and the StiP comprises a cross link or bridge between at least three conformationally adjacent amino acids of the peptides, and wherein the BAC is an electrically neutral oligonucleotide (ON) having charge 1 to +1 at pH 7.5.
42. The DCCPM as claimed in claim 41, wherein the cross link or bridge comprises two components, a hydrocarbon bridge and a terminal methyl group.
43. The DCCPM as claimed in claim 41, wherein the peptide comprises at least two un-natural amino acids bearing all-hydrocarbon tethers, optionally -methyl,-pentenyl glycine.
44. The DCCPM as claimed in claim 42, wherein CPA is stabilized with a staple or stitch incorporating one or more of: a (S)-pentenylalanine (S5) or its enantiomer (R5), a S-octenylalanine (S8) or its enantiomer (R8) or combinations thereof (e.g R-octenylalanine/S-pentenylalanine (R8/S5) or S-octenylalanine/R-pentenylalanine (S8/R5).
45. The DCCPM as claimed in claim 41, comprising a cross link or bridge between one or more of the unnatural amino acids of Table 1.
46. The DCCPM as claimed in claim 45, wherein the stabilized peptide comprises two or more olefin bearing side chains that are covalently formed.
47. The DCCPM as claimed in claim 41, wherein the stabilized conformation comprises at least one alpha helix, at least one beta sheet, or at least one alpha helix and one beta sheet.
48. The DCCPM as claimed in claim 41, wherein the ON is an anti-sense oligonucleotide (AON), optionally wherein the AON is a polynucleic acid (PNA).
49. The DCCPM as claimed in claim 41, wherein the ON is a phosphorodiamate morpholino oligonucleotide (PMO).
50. The DCCPM as claimed in claim 41, wherein the BFL comprises a chemistry selected from the chemistries of Table 4.
51. The DCCPM as claimed in claim 50, wherein the CPA is linked to a first end of the BFL covalently, and/or the BAC is linked to a second end of the BFL covalently or non-covalently.
52. A composition comprising the DCCPM as claimed in claim 41 and one or more pharmaceutically acceptable excipients.
53. A composition as claimed in claim 52, which is for administration orally, parenterally, intravenously or topically.
54. A method for facilitating the uptake of a biologically active compound (BAC), which is an electrically neutral oligonucleotide (ON) having charge 1 to +1 at pH 7.5 into a cell comprising: conjugating the ON to a cell penetrating agent (CPA) which has a conformation imposed upon it by stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP), wherein the StaP comprises a cross link or bridge between two conformationally adjacent amino acids of the peptide and the StiP comprises a cross link or bridge between at least three conformationally adjacent amino acids of the peptides directly or via a bi-functional linker (B FL) to form a drug carrying cell penetrating molecule (DCCPM) and presenting said DCCPM to said cell in a vehicle.
55. A method for treatment of a disease requiring alteration of the expression of an endogenous or exogenous gene comprising administering the DCCPM of claim 41 to a subject, wherein the BAC alters the expression of an endogenous or exogenous gene.
56. The method of claim 55, wherein the disease is neuromuscular disease, a metabolic disease, cancer, an age-related degenerative disease or an acquired viral infection.
57. The method of claim 55, wherein the disease is Duchenne's muscular dystrophy.
58. The method of claim 57, wherein the DCCPM comprises an ON targeting exon 51 of the dystrophin gene.
59. A method of improving the bioavailability of a drug or biologically active compound (BAC), which is is an electrically neutral oligonucleotide (ON) having charge 1 to +1 at pH 7.5, comprising linking the ON to a stabilized peptide (CPP) which has a conformation imposed upon it by stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP), the StaP comprises a cross link or bridge between two conformationally adjacent amino acids of the peptide and the StiP comprises a cross link or bridge between at least three conformationally adjacent amino acids of the peptides.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0089] Embodiments of the invention are further described hereinafter with reference to the accompanying Drawings, in which:
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101] The Spectra were collected at room temperature in H.sub.2O spiked with 10% D.sub.2O and 10 mM sodium acetate;
[0102]
[0103]
[0104]
[0105]
[0106] The FITC group here and elsewhere may be any other fluorescent label and is present merely to enable visualization;
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
TABLE-US-00007 Sequenceid1: 5GGCCAAACCTCGGCTTACCTGAAAT3
(an antisense reagent targeted to exon 23 of the mouse dystrophin gene, that causes the exclusion of exon 23 during mRNA splicing maturation); the bi-functional linker was a PEGylated SMCC; and the StaP was RKF-S5-RLF-S5. This configuration of DCCPM is depicted as PMO-CP8M in the subsequent figs; unconjugated PMO acts as a control. All compounds were added to U2OS cells maintained in culture, without transfection reagent for 4 hours;
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
DETAILED DESCRIPTION
[0151] The invention is illustrated with reference to a single example which proves the benefit of the claimed invention.
[0152] An exemplary drug carrying cell penetrating molecule (DCCPM) was produced with a FITC label in order to demonstrate cellular uptake (Example 1).
[0153] The exemplary DCCPM comprises: [0154] i) a biologically active compound (BAC)(see Table 4 for non-limiting examples); [0155] ii) a cell penetrating agent (CPA) which is a stabilized peptide (See Table 2 for non-limiting examples); and [0156] iii) a bi-functional linker (BFL) (see Table 5 for non-limiting examples).
[0157] The three components forming the DCCPM are described in more detail below, although as illustrated in
[0158] 1. The Biologically Active Compound.
[0159] The biologically active compound is any compound that can exert a biological effect within a biological cell. Preferably, though not essentially, the BAC is one which will impact on the expression of one or more endogenous or exogenous genes. Examples include nucleic acids, DNAzymes, ribozymes, aptamers and pharmaceuticals. Preferred biologically active compounds for use in the present invention include electrically neutral oligonucleotides (charge 1 to +1 at physiological pHabout 7.5) such as polynucleic acids (PNAs) or PMOs or their modified derivatives that might impart a small electric charge (either positive or negative).
[0160] The biologically active compound may be used as a steric blocking compound to suppress or enhance: i) RNA splicing; ii) protein translation or iii) other nucleic acid:nucleic acid or nucleic acid:protein interactions, altering the gene expression of endogenous or exogenous (pathogen derived) genes.
[0161] The hybridisation of ON's to specific RNA sequence motifs prevents correct assembly of the spliceosome, so that it is unable to recognise the target exon(s) in the pre-mRNA and hence excludes these exon in the mature gene transcript. Exclusion of an in-frame exon can lead to a truncated yet functional gene product; exclusion of an out of frame exon results in a frame-shift of the transcript, potentially leading to a premature stop codon and a reduction in the target gene expression level.
[0162] Additionally, ON's can be designed to target 5 translation initiation start sites of endogenous or viral gene transcript(s) to prevent binding of the translational machinery. Using ASO to suppress viral translation is a well-established technology and has progressed into clinical trials for viral haemorrhagic fevers such as Marburg and Ebola.
[0163] Also, ON can be designed to target 3 untranslated region of an endogenous transcript that alters the stability of the transcript. Such targets include, and are not limited to, poly adenylation and/or cleavage sites of the transcript.
[0164] Also, ON can be designed to form aptamers such that the secondary and tertiary structures can bind proteins or other cellular targets thus impacting on specific gene expression levels.
[0165] Non-limiting exemplary ON chemistries are illustrated in Table 4.
[0166] In the non-limiting example illustrated, the target is exon 51 of the dystrophin gene and comprises the sequence:
TABLE-US-00008 Sequenceid2: 5CUCCAACAUCAAGGAAGAUGGCAUUUCUAG3
[0167] 2. The Cell Penetrating Agent (CPA) which is a Stabilized Peptide
[0168] The cell penetrating agents of the invention are stabilized peptides.
[0169] The peptides may be stabilized by stapling, to form a stapled peptide (StaP), or by stitching to form a stitched peptide (StiP)
[0170] All-hydrocarbon staples and stitches may confer a property, e.g. an -helical structure, protease resistance, cellular penetrance, and biological activity.
[0171] Non-limiting examples of stapled and stitched peptide sequences are illustrated in Table 2 and include peptide sequences including S5, S8 and B5 (as defined in Table 2).
[0172] Stabilisation of e.g. the -helical structure can be achieved by, for example, a ring-closing metathesis and may be catalysed by a variety of ruthenium catalysts including Grubbs generations 1 and 2 and Grubbs-Hoyveda generations 1 and 2.
[0173] All the peptide components (amino acids, unnatural amino acids, unstapled/unstitched, partially stapled/stitched and stapled/stitched peptides) may exist in specific geometric or stereoisomeric forms. All compounds include cis- and trans-isomers, (R)- and (S)-enantiomers, diastereoisomers and racemic mixtures thereof.
[0174] Preferred isomer/enantiomers will be enriched to give a greater proportion of one particular isomer or enantiomer. Embodiments thereof may be made of greater than 90%, 95%, 98% or 99%, by weight, of a preferred isomer/enantiomer.
[0175] Non-limiting examples of unnatural amino acids used in stabilising a peptide structure are illustrated in Table 1.
[0176] In one embodiment the applicant employs ,-disubstituted unnatural amino acids bearing all-hydrocarbon tethers (e.g. -methyl,-pentenyl glycine).
[0177] For single turn stapling, one embodiment could employ a (S)-pentenylalanine (S5) at, e.g. i, i+4 positions, and in another embodiment, for double turn stapling, a combination of either R-octenylalanine/S-pentenylalanine (R8/S5) or S-octenylalanine/R-pentenylalanine (S8/R5) at e.g. i, i+7 positions can be used. The same pairings can be used to install more than one staple within a given peptide template. S5 can be substituted at i, B5 at postion i+4 positions, and S8 can be been substituted at i, i+4, i+11 positions to generate stitched peptides. The S5 configured amino acid and its enantiomer R5, or S8 configured amino acid and its enantiomer R8, differ only in the opposite stereochemical configuration of the staple they bear.
[0178] Based upon the inclusion of a single or a double turn staple, peptides may comprise of one or more of the sequences in Table 2. Based upon the specific peptides shown in Table 2, a person skilled in the art can easily envisage peptides with 3, 4, 5 or more turn stabilising staples.
[0179] The hydrocarbon bridge may be composed of a double hydrocarbon bond or a single hydrocarbon bond.
[0180] In one embodiment the cell penetrating agent has a stitch or staple peptide comprising the sequence RFK-S5-RLF-S5.
[0181] In another embodiment the peptide is a branched stapled peptide. The branched stapled peptide comprises of 2 or more chains of peptides. Branched peptides may be formed using any method know to the art; in one embodiment a lysine residue is used to branch two peptide chains.
[0182] Functional derivatives of disclosed peptide sequences could be used. Functional derivatives may have representative fragments or homologues or peptides that include insertions to the original peptide. Typical derivative would have 70%, 80%, 90% or more of the original peptide sequence and may have up to 200% of the number of amino acids of the original peptide. The derivatives would be used to enhance the delivery of a biologically active compound.
[0183] Peptide sequence can include modified amino acids to include functional groups that permit the addition of other moieties. Non-limiting examples of such moieties include an acetyl, a cholesterol, a fatty acid, a polyethylene glycol, a polysaccharide, an aminoglycan, a glycolipid, a polyphenol, a nuclear localising signal, a nuclear export signal, an antibody and a targeting molecule.
[0184] 3. Bi-Functional Linker
[0185] A bi-functional linker may be used to link the BAC to the CPA.
[0186] Preferred linkers will link between, for example, an amine group on the BAC and a sulfhydryl (thiol) group (usually a cysteine residue) on the CPA terminus. Examples of substrates to achieve this include, but are not limited to, SMCC (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate), AMAS (N--maleimidoacet-oxysuccinimide ester, BMPS (N--maleimidopropyl-oxysuccinimide ester), GMBS (N--aleimidobutyryl-oxysuccinimide ester), DMVS (N--maleimidovaleryl-oxysuccinimide ester, EMCS (N--malemidocaproyl-oxysuccinimide ester), and LC-SMCC (Succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate) as exemplified in Table 5.
[0187] Another preferred linker system is hydrazynal nicotinic acid (HNA), however if the BAC is a PMO, the PMO is modified to incorporate 4 formyl benzioic acid.
[0188] Other linkers such as DSG (disuccinimidyl gluterate) and DSCDS (disuccinimidyl-cyclohexl-1,4-diester) will include the ability to link the 5-amino group of the BAC to the N-terminus of the CPA (Table 5, entries 8 and 9).
[0189] Linkers may include other elements that confer a desirable property on the DCCPM e.g. spacer between ON and CPA or an element that will enhance solubility, for example a PEGylated element as illustrated in
[0190] The biologically active compound is covalently attached to the chimeric cell delivery peptide. Again, this can be done using any method known in the art. Preferably, the cell delivery peptide is attached to the biologically active compound by means of a disulphide bridge or a thiol maleimide linker e.g. SMCC; the attachment may be by means of an amide linker or an oxime linker or a thioether linker.
Example 1: (Proof of Principle)
DCCPM to Enhance RNA Steric Blocking in Treating Duchenne Muscular Dystrophy (DMD).
Introduction
[0191] Duchenne muscular dystrophy (DMD) is the most common inherited lethal childhood disease in the world, with a worldwide incidence of approximately 1 in 4000 live births.sup.33. This severe muscle-wasting disorder is caused in the majority of families by gene mutations leading to disruption of the reading frame and premature truncation of the protein dystrophin.sup.34,35.
[0192] RNA splicing suppression of the DMD transcript has particular promise. The hybridisation of ASOs to specific RNA sequence motifs prevents correct assembly of the spliceosome, so that it is unable to recognise the target exon(s) in the pre-mRNA and hence excludes them in the mature gene transcript. ASO-mediated RNA splicing suppression resulting in the re-expression of a truncated, yet functional dystrophin protein has been demonstrated in vitro and in the pre-clinical mdx mouse model.sup.29,36-41, which led to clinical development programs.sup.8,13.
[0193] Although intravenously administered PMOs have demonstrated a dose-dependent increase in dystrophin re-expression with some functional benefit.sup.13,42, skeletal muscle dystrophin restoration is still very variable between patients after many multiple administrations. Importantly, many other target tissues (e.g. brain and heart) remain refractory to PMO transfection even when repeat administration or high dose strategies are employed.sup.27-29.
[0194] To date unmodified CPA conjugation improves PMO bio-distribution and serum stability.sup.30-32, however toxicity is still a major roadblock for pipeline development.sup.19.
[0195] Applicant hypothesised that a CPA based upon a stabilized e.g. StaP (or StiP) conjugated to a PMO known to cause RNA splicing suppression of the DMD transcript, would lead to a greater level of dystrophin restoration and re-expression of dystrophin in tissues refractory to naked PMO without the potential for CPA related toxicity.
Materials and Methods
Nuclear Magentic Resonance (NMR) Analysis of StaP
[0196] .sup.1H NMR spectra was recorded using a Bruker Avance III 500 (500 MHz) spectrometer. Samples were dissolved in H.sub.2O with 10% D.sub.2O and 10 mM sodium acetate.
[0197] NOESY spectra were recorded with a 12626.263 Hz sweep width, 4096 complex points (DQD acquisition mode) in the direct dimension and 1024 indirect points (States-TPPI acquisition mode). A NOESY mixing time of 250 ms was used to provide cross peaks with high signal to noise while largely avoiding spin diffusion. A pre-saturation pulse on water and a 3-9-19 pulse sequence with 20% Z-gradients (4,5) aided solvent suppression. TOCSY spectra were recorded with the same spectral width and resolution as the NOESY with a homonuclear Hartman-Hahn transfer using the MLEV17 sequence for an 80 ms mixing time (6). Two power levels were used for excitation (3 dB) and spinlock (12.2 dB). Water suppression was achieved as with the NOESY.
High Resolution Mass Spectroscopy
[0198] High-resolution mass spectra were recorded on a Thermo scientific LQT Orbitrap XL under electron spray ionization conditions (ESI) or where indicated under Atomospheric Pressure Ionisation (API) condition.
Circular Dichroism (CD) Spectroscopy
[0199] CD analysis was performed on an Applied Photophysics Chirascan Circular Dichroism spectrometer. Samples were dissolved in D.sub.2O at 0.125 W/W % and data acquired in triplicate at room temperature and subsequently averaged and smoothed using built in qCD software. Graphs were plotted by subtracting a blank D.sub.2O spectrum from the acquired data to provided blank correction.
Synthesis of PMO-CP8M and NF-PMO-CP8M
[0200] PMO (22.2 mg, 2.1 M) was dissolved in PBS (400 L, 1 x) and incubated at room temp after the addition of SMCC linker (6 mg, 18 M, 9 excess) dissolved in MeCN 100 L. After 45 mins the mixture was desalted using sephadex g25 hydrated in a PBS 1 and was also used as the eluent. RCM-C-PEG-8 Mer (3 mg, 2.5 M) was mixed immobilised TCEP (750 L) for 1 h. The SMCC modified PMO was then desalted into PBS/MeCN (500 L 4:1) and immediately the peptide was eluted from the immobilised TCEP and stirred at room temp for 3 hours before purification on a Waters HLB column.
[0201] The solution was loaded onto 4 HLB columns, and washed with milliQ water to remove any salts then 20% MeCN in water and finally PMO-CP8M was removed with 50% MeCN in water. The MeCN content was reduced by rotary evaporation and the conjugate subsequently freeze dried to yield the final lipholysed compound.
Synthesis of PMO-HP8M
Modification of PMO to PMO-4FB.
[0202] 4-FB (250 mg, 1.5 mM) was dissolved in DMF with COMU (1.2 g, 2.6 mM) and NHS (230 mg, 2.0 mM) and stirred for a few mins. Nb, 4-FB did not fully dissolve until DIEA was added. DIEA (0.54 mL 3.0 mM) was then added upon which the reaction mixture changed from colourless to pale yellow/orange. The reaction mixture was stirred for 1 h and monitored by TLC using 5% MeOH in DCM. The mixture was separated over DCM to remove DMF then purified by flash chromatography using DMC to elute the top spot staining positive with 2,4 DNP. Product was collected as an off white solid 112 mg (30%).
[0203] PMO (30.4 mg, 3 M) was added to a solution of 4-FB and dissolved in Carbonate buffer:MeCN (50% MeCN) and NHS activated 4-FB (10 mg, 32 M) was added and stirred overnight. The mixture was then desalted using sephadex G25 superfine with water:MeCN as an eluent. MeCN was removed by rotary evaporation and the remaining eluent was then freeze dried. Freeze dried product yielded 24 mg 83% yield.
Conjugation of PMO-4FB to HP8M
[0204] HP8M was dissolved in milliq ultra pure water (100 L) to give a solution of 12 mg/mL. Aldehyde modified PMO (7 mg, 0.76 M) was dissolved in water/MeCN (300 L, 1:1) and desalted using sephadex G25 superfine and water/MeCN (1:1) as the eluent. The collected fraction was then diluted to 1 mL total volume in water:MeCN mix (1:1) and PMO content was analysed by UV/vis and found to be 6.5 mg/mL or 705 M. HNA peptide and Analine (10 mM final conc) was then added and UV/vis monitored for evidence of A.sub.354 and used to calculate the conjugation of PMO to peptide.
PMO and Peptide Synthesis
[0205] PMO were synthesised with a 5 amine group and 3 fluorescein isothiocyanate (FITC) label and purified >90% by Genetool LLC (Philomath, Oreg. USA). All peptides were synthesized following an established protocol using standard Fmoc-peptide chemistry on Rink amide MBHA resin. The coupling reactions were performed by the addition of a mixture of 10 equivalents of the amino acids, 9.9 equivalents of HCTU and 20 equivalents of DIPEA in NMP (equivalents relative to initial loading of Rink amide MBHA resin). The reactions were allowed to proceed for at least one hour. Coupling of non-natural amino acids (R/S5, R/S8 or B5) was performed with 4 equivalents of the amino acid, 3.9 equivalents of HCTU and 10 equivalents of DIPEA in NMP for two hours. The ring closing metathesis reaction of the olefin-containing non-natural amino acids was facilitated with Grubbs I catalyst (benzylidene-bis(tricyclohexylphosphine)-dichlororuthenium) dissolved to approximately 10 mg/mL in 1,2-dichloroethane (DCE) for two hours under nitrogen bubbling. Subsequently, excess catalyst was washed from the resin with DCE and then coupled with an N-terminal FITC. Upon completion, peptides were simultaneously cleaved from the resin and de-protected using a cleavage cocktail containing 95% TFA, 2.5% TIS and 2.5% water. Crude peptides were dissolved in 50% acetonitrile/water, passed through a 0.2 m syringe filter, and purified by reverse phase HPLC using a C-18 column (Agilent, Palo Alto, Calif.). Compound identification and purity was assessed using coupled LC/MS (Agilent, Palo Alto, Calif.). Purified fractions were pooled and evaporated to remove acetonitrile and trace TFA by Speedvac and then lyophilized to dryness. A non-ring closed peptide was also produced as a control.
Cell Culture and Transfection
[0206] U2OS cells (Human osteosarcoma) were cultured in high glucose DMEM supplemented with 10% foetal calf serum (Sigma, UK) at 37 C. under an 8% CO2/92% air atmosphere.
[0207] H.sub.2K mdx mouse myoblasts were cultured at 33 C. under a 8% CO.sub.2/92% air atmosphere in high-glucose DMEM supplemented with 20% foetal calf serum, 0.5% chicken embryo extract (PAA laboratories Ltd, Yeovil, UK), and 20 units/ml -interferon (Roche applied science, Penzberg, Germany). Cells were then treated with trypsin and plated at 810.sup.4/cm.sup.2 in 24-well plates coated with 0.1 mg/ml ECM gel (Sigma). H2K mdx cells were transfected 24 h after seeding with treatment in a final volume of 0.2 ml of normal growth media. Following 4 hours of transfection, the PMO or PMO-SAP was removed and replaced with DMEM supplemented with 5% horse serum. Fluorescence and RNA extraction was performed 48 hours post transfection.
[0208] HEK293T cells (Human embryonic kidney) were cultured in high glucose DMEM supplemented with 10% foetal calf serum (Sigma, UK) at 37 C. under an 8% CO.sub.2/92% air atmosphere.
[0209] U2OS cells were incubated with PMO or PMO-CP8M at increasing concentration (0.5 M, 1.0 M, 5.0 M and 10 M) with any facilitation transfection reagent; H.sub.2K mdx mouse myoblasts were incubated with PMO or PMO-CP8M at 5.0 M: HEK293T cells were incubated with CP8M (1.0 M, 10 M and 100 M) and PMO, PMO-CP8M-NC, PMO-C8M at 1.0 M. Levels of fluorescence was quantified at 494 nm to determine relative entry of respective compounds by microscopic or flow cytometry methodologies.
RNA Extraction and Nested RT-PCR Analysis
[0210] Total RNA was isolated from H.sub.2K mdx mouse myoblasts cells (RNeasy, Qiagen, UK). The RNA was reversed transcribed (nanoscript2, Primer Design UK) and an amplification between exons 20 and 26, followed by a nested amplification between exon 20 and 26 was performed to yield a full length product of 901 bp or 688 bp if the mouse dystrophin exon 23 was excluded. Products loaded in a 1% agarose gel (buffered with tris acetate 40 mM and 1 mM ethylenediaminetetraacetic acid).
Animals
[0211] mdx mice, with access to chow and water ad libitum, were used in all experiments. All experiments were carried out in the Animal unit, School of Biological Science, University of Reading, Reading, UK according to procedures authorized by the UK Home Office. Mice were killed by CO.sub.2 inhalation or cervical dislocation at desired time points, and muscles and other tissues were snap-frozen in liquid nitrogen-cooled isopentane and stored at 80 C.
Administration of PMO or PMO-CP8M
[0212] Intramuscular administrations: Tibialis anterior muscles of mdx mice were injected with either 2.2 nmol PMO or 2.2 nmol PMO-CP8M under isoflurane anaesthesia. Systemic administration: mdx mice were subject to a single or repeated intraperitoneal injections of PMO or PMO-CP8M (or non-fluorescently labelled variants) at doses ranging from 1 mol/kg to 10.9 mol/kg total delivery; alternatively, mdx mice were subject to single or repeated intravascular injections of PMO or PMO-CP8M ranging from 1 mol/kg to 4.4 mol/kg total. A series of tissues were recovered at the end of the experiment that included skeletal muscle, heart, brain and liver.
Histology and Immuno-Cytochemistry
[0213] For skeletal muscle, heart and brain, 10 M cryosections were cut and dystrophin protein was detected using rabbit polyclonal antibody to dystrophin (ab15277; Abcam, Cambridge, UK). Routine haematoxylin and eosin staining was used to assess general pathology and morphology. For liver, 10 M cryosections were dried and embedded in fluorescence-compatible mounting medium (Dako), and general fluorescence was assessed microscopically at 494 nm.
Flow Cytometry
[0214] Uptake of fluorescently-labelled PMO was determined by flow cytometry using an Accuri C6 flow cytometer. PMO-transfected cells were released with trypsin, washed in PBS and kept on ice before analysis. Cell fluorescence in single live cells was determined using FlowJo software after appropriate gating. Untreated cells were used to establish gating settings for the determination of the % fluorescein-positive cells.
Statistical Analysis
[0215] All data are reported as mean values SEM. Statistical differences between treatment groups and control groups were evaluated by SigmaStat (Systat Software, UK) and student's t test was applied. Significance was accepted for p-values<0.05.
Results
[0216] Circular dichroism and the nuclear magnetic resonance data confirmed that the ordered structure of the peptides was as expected and that the stapled peptides adopted an -helical structure (
[0217] The conjugation of PMO-SMCC with a CPP to form PMO-CP8M has consistently yielded an efficiency of 10%. Surprisingly, adopting a conjugation based upon a PMO modified to incorporate 4 formyl benzioic acid and hydrazynal nicotinic acid (HNA) incorporated into the terminal end of the CPP, increased the efficiency of conjugation to yield PMO-HP8M at 59% (
[0218] PMO was conjugated to the bi-functional linker (a PEGylated SMCC) and a CPP (RKF-S5-RLF-S5) as confirmed by mass spectrometry (
[0219] Transfection experiments conducted in the HEK293T human embryonic kidney cells again demonstrated that PMO was refractory to cell entry. Importantly, a non-ring closed variant of CP8M (termed CP8M-NC) also did not result in significant cell entry above that of PMO alone. However a ring closed variant that contains the core sequence RKF-S5-RLF-S5 demonstrated that when conjugated to a fluorescently labelled PMO (to form PMO-C8M), that the PMO was now efficiently taken into cells (
[0220] The formal charge of CP8M is +3 at physiological pH. We also provide data demonstrating that reducing the formal charge within this sequence still leads to a surprising and significant cellular entry of CP8M variants with formal charges of +2 (CP8M-2) and +1 (CP8M-1) (
[0221] When transfection experiments were conducted in the H2K mdx mouse myoblasts cells, it confirmed the finding that PMO are refractory to muscle cell entry, which was overcome with the conjugation of CP8M (
[0222] In order to determine if CP8M hindered the biological activity of the PMO, direct intramuscular administrations (2.2 nmol) were conducted into the Tibialis anterior muscle of mdx female mice, with muscle recovered 7 days post-administration. The percentage of dystrophin re-expression was equivocal between the PMO-CP8M (805.75) and the naked PMO (762.25) with no statistical significant difference (n=4, p=0.863;
[0223] Systemic administrations of PMO-CP8M and PMO were conducted in mdx mice to determine if the CP8M moiety enhanced cell entry into skeletal muscle. Varying sub-optimal amounts (totally 1 mol/kg, 4.4 mol/kg, 10.9 mol/kg) were administered by either intraperitoneal or intravenous injections, and diaphragm and/or Tibialis anterior (TA) muscle recovered 7 days post-administration. After a single intraperitoneal administration of 1 mol/kg the diaphragm muscle gave more dystrophin positive fibres after PMO-CP8M treatment compared to the PMO control group (
[0224] (4.4 mol/kg; n=3) data was equivocal between group (
[0225] Systemic intraperitoneal administrations of PMO-CP8M and PMO were conducted in mdx mice to determine if CP8M enhanced cell entry (
[0226] A single low dose of PMO or PMO-CP8M (1 mol/kg) was administered (n=1 per group) and tissues recovered 7 days post-administration. Dystrophin-positive heart muscle fibres were detected after PMO-CPM8, but not PMO administration (
[0227] In addition, we carried out repeated intraperitoneal administrations into mdx mice. Intraperitoneal injections of PMO-CP8M (without fluorescent label) totaling 7.6 mol/kg over 4 days (n=4 per group) lead to a significant increase in dystrophin-positive heart muscle fibres 2 weeks post-administration compared to injection of an equimolar amount of PMO (34069 vs 5717 fibres, p<0.01;
[0228] Furthermore, Applicant carried out intraperitoneal administration of PMO or PMO-CP8M, totaling 10.9 mol/kg over 2 days (n=4 per group). Again, administration of PMO-CP8M lead to a significantly higher number of dystrophin-positive heart muscle fibres compared to administration of PMO (680163 vs 338 fibres, p<0.05;
[0229] PMO-peptide conjugates of both 8.7 kDa and 9.2 kDa were successfully delivered to heart muscle fibres as evidenced by the induction of dystrophin re-expression in the hearts of mdx mice (
[0230] A single low dose (1 mol/kg) intravenous administration of PMO-CP8M, but not PMO (both without fluorescent label), led to recovery of dystrophin expression in the Purkinje cells of mdx mouse cerebellum (
[0231] A single low dose (1 mol/kg) intravenous administration of PMO-HP8M led to increased hepatocyte fluorescence in the vicinity of blood vessels two weeks post-administration compared to administration of PMO (
CONCLUSION
[0232] From the data generated it can be seen that the conjugation of a CPA, stabilized by stapling, to a BAC (in the form of a PMO), via a BFL, facilitates entry of the PMO into a cell. The StaP CPA facilitated PMO entry in both in vitro and in vivo assay systems.
[0233] Applicant's data presents evidence that modified linker systems based on HNA and 4 formyl benzioic acid improve the efficiency of conjugation between a BAC and CPA.
[0234] Surprisingly, variants of CPA in which the formal charge is reduced demonstrate enhanced cell entry at lower concentrations. This will have important sequelae with respect to improving the toxicological profile of CPA, more specifically a CPP.
[0235] The in vivo model of RNA splicing suppression demonstrated that the biological action of an -helical peptide conjugated PMO is equivalent to naked PMO following intramuscular administration, thus determining that no steric hindrance is exerted upon the PMO when coupled to an -helical peptide moiety.
[0236] The data demonstrates the fact that in the in vivo model of RNA splicing suppression the stabilized CPA may enhance cell entry into skeletal muscle, particularly at lower doses. However PMO are known to enter skeletal muscle without a CPP conjugation.
[0237] Surprisingly, and very significantly, it has been demonstrated that tissues refractory to naked PMO transfection re-express dystrophin protein in both the heart and brain (purkinje cell) compartments when the PMO is conjugated with a StaP.
[0238] Applicant further provides evidence that the CPP can facilitate the entry of cargoes of different size and mass far beyond that stated in the current state of the art.
[0239] The repertoire of human and animal diseases that can be addressed is now expanded and enhanced due to the increased pharmacodynamics of the PMOs when conjugated with a stabilised peptide. Neuromuscular disease, metabolic disease, cancer, age-related degenerative diseases and acquired viral infection can all be targeted.
REFERENCES
[0240] 1 Iversen, P. L. et al. Discovery and early development of AVI-7537 and AVI-7288 for the treatment of Ebola virus and Marburg virus infections. Viruses 4, 2806-2830, doi:10.3390/v4112806 (2012). [0241] 2 Heald, A. E. et al. Safety and pharmacokinetic profiles of phosphorodiamidate morpholino oligomers with activity against ebola virus and marburg virus: results of two single-ascending-dose studies. Antimicrob Agents Chemother 58, 6639-6647, doi:10.1128/aac.03442-14 (2014). [0242] 3 Warren, T. K. et al. Advanced antisense therapies for postexposure protection against lethal filovirus infections. Nat Med 16, 991-994, doi:10.1038/nm.2202 (2010). [0243] 4 Campbell, J. M., Bacon, T. A. & Wickstrom, E. Oligodeoxynucleoside phosphorothioate stability in subcellular extracts, culture media, sera and cerebrospinal fluid. Journal of biochemical and biophysical methods 20, 259-267 (1990). [0244] 5 Agrawal, S., Mayrand, S. H., Zamecnik, P. C. & Pederson, T. Site-specific excision from RNA by RNase H and mixed-phosphate-backbone oligodeoxynucleotides. Proc Natl Acad Sci USA 87, 1401-1405 (1990). [0245] 6 Tereshko, V. et al. Correlating structure and stability of DNA duplexes with incorporated 2-O-modified RNA analogues. Biochemistry 37, 10626-10634, doi:10.1021/bi980392a (1998). [0246] 7 Shibahara, S. et al. Inhibition of human immunodeficiency virus (HIV-1) replication by synthetic oligo-RNA derivatives. Nucleic Acids Res 17, 239-252 (1989). [0247] 8 Goemans N, C. C., Kraus J E, et al. Drisapersen efficacy and safety in Duchenne muscular dystrophy: results of a phase III, randomized, double-blind, placebo-controlled trial (study DMD114044). World Muscle Society Congress; Asilomar, CA, USA; Oct. 1-5, 2013 (2103). [0248] 9 Goemans, N. M. et al. Long-Term Efficacy, Safety, and Pharmacokinetics of Drisapersen in Duchenne Muscular Dystrophy: Results from an Open-Label Extension Study. PLoS One 11, e0161955, doi:10.1371/journal.pone.0161955 (2016). [0249] 10 Dirin, M. & Winkler, J. Influence of diverse chemical modifications on the ADME characteristics and toxicology of antisense oligonucleotides. Expert Opin Biol Ther 13, 875-888, doi:10.1517/14712598.2013.774366 (2013). [0250] 11 Sazani, P. et al. Repeat-dose toxicology evaluation in cynomolgus monkeys of AVI-4658, a phosphorodiamidate morpholino oligomer (PMO) drug for the treatment of duchenne muscular dystrophy. Int J Toxicol 30, 313-321, doi:10.1177/1091581811403505 (2011). [0251] 12 Sazani, P., Weller, D. L. & Shrewsbury, S. B. Safety pharmacology and genotoxicity evaluation of AVI-4658. Int J Toxicol 29, 143-156, doi:10.1177/1091581809359206 (2010). [0252] 13 Mendell, J. R. et al. Eteplirsen for the treatment of Duchenne muscular dystrophy. Ann Neurol 74, 637-647, doi:10.100.sup.2/ana.23982 (2013). [0253] 14 Heemskerk, H. A. et al. In vivo comparison of 2-O-methyl phosphorothioate and morpholino antisense oligonucleotides for Duchenne muscular dystrophy exon skipping. J Gene Med 11, 257-266, doi:10.1002/jgm.1288 [doi] (2009). [0254] 15 Kreutz, M. et al. Antibody-antigen-adjuvant conjugates enable co-delivery of antigen and adjuvant to dendritic cells in cis but only have partial targeting specificity. PLoS One 7, e40208, doi:10.1371/journal.pone.0040208 (2012). [0255] 16 Derossi, D., Joliot, A. H., Chassaing, G. & Prochiantz, A. The third helix of the Antennapedia homeodomain translocates through biological membranes. J Biol Chem 269, 10444-10450 (1994). [0256] 17 Gautam, A. et al. CPPsite: a curated database of cell penetrating peptides. Database the journal of biological databases and curation 2012, bas015, doi:10.1093/database/bas015 (2012). [0257] 18 Hirose, H. et al. Transient focal membrane deformation induced by arginine-rich peptides leads to their direct penetration into cells. Mol Ther 20, 984-993, doi:10.1038/mt.2011.313 (2012). [0258] 19 Moulton, H. M. & Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim Biophys Acta 1798, 2296-2303, doi:10.1016/j.bbamem.2010.02.012 (2010). [0259] 20 Tunnemann, G. et al. Live-cell analysis of cell penetration ability and toxicity of oligo-arginines. J Pept Sci 14, 469-476, doi:10.1002/psc.968 (2008). [0260] 21 Chu, Q. et al. Towards understanding cell penetration by stapled peptides. MedChemComm 6, 111-119, doi:10.1039/C4MD00131A (2015). [0261] 22 Hilinski, G. J. et al. Stitched -Helical Peptides via Bis Ring-Closing Metathesis. Journal of the American Chemical Society 136, 12314-12322, doi:10.1021/ja505141j (2014). [0262] 23 Lehto, T. et al. Cellular trafficking determines the exon skipping activity of Pip6a-PMO in mdx skeletal and cardiac muscle cells. Nucleic Acids Res 42, 3207-3217, doi:10.1093/nar/gkt1220 (2014). [0263] 24 Nakase, I. et al. Interaction of arginine-rich peptides with membrane-associated proteoglycans is crucial for induction of actin organization and macropinocytosis. Biochemistry 46, 492-501, doi:10.1021/bi0612824 (2007). [0264] 25 Chang, Y. S. et al. Stapled alpha-helical peptide drug development: a potent dual inhibitor of MDM2 and MDMX for p53-dependent cancer therapy. Proc Natl Acad Sci USA 110, E3445-3454, doi:10.1073/pnas.1303002110 (2013). [0265] 26 Vitiello, L. et al. In vivo delivery of naked antisense oligos in aged mdx mice: analysis of dystrophin restoration in skeletal and cardiac muscle. Neuromuscul Disord 18, 597-605, doi:50960-8966(08)00141-7 [pii]10.1016/j.nmd.2008.05.011 [doi] (2008). [0266] 27 Jearawiriyapaisarn, N., Moulton, H. M., Sazani, P., Kole, R. & Willis, M. S. Long-term improvement in mdx cardiomyopathy after therapy with peptide-conjugated morpholino oligomers. Cardiovasc Res 85, 444-453, doi:cvp335 [pii]10.1093/cvr/cvp335 [doi] (2010). [0267] 28 Wu, B. et al. One-year treatment of morpholino antisense oligomer improves skeletal and cardiac muscle functions in dystrophic mdx mice. Mol Ther 19, 576-583, doi:10.1038/mt.2010.288 (2011). [0268] 29 Wu, B. et al. Effective rescue of dystrophin improves cardiac function in dystrophin-deficient mice by a modified morpholino oligomer. Proc Natl Acad Sci USA 105, 14814-14819, doi:0805676105 [pii]10.1073/pnas.0805676105 [doi] (2008). [0269] 30 Jearawiriyapaisarn, N. et al. Sustained dystrophin expression induced by peptide-conjugated morpholino oligomers in the muscles of mdx mice. Mol Ther 16, 1624-1629, doi:mt2008120 [pii]10.1038/mt.2008.120 [doi] (2008). [0270] 31 Betts, C. et al. Pip6-PMO, A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Molecular therapy. Nucleic acids 1, e38, doi:10.1038/mtna.2012.30 (2012). [0271] 32 Ivanova, G. D. et al. Improved cell-penetrating peptide-PNA conjugates for splicing redirection in HeLa cells and exon skipping in mdx mouse muscle. Nucleic Acids Res 36, 6418-6428 (2008). [0272] 33 Mendell, J. R. et al. Evidence-based path to newborn screening for Duchenne muscular dystrophy. Ann Neurol 71, 304-313, doi:10.1002/ana.23528 (2012). [0273] 34 Hoffman, E. P., Brown, R. H., Jr. & Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51, 919-928. (1987). [0274] 35 Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H. & Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 2, 90-95 (1988). [0275] 36 Aartsma-Rus, A. et al. Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet 12, 907-914 (2003). [0276] 37 Alter, J. et al. Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med 12, 175-177 (2006). [0277] 38 Kinali, M. et al. Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study. Lancet Neurol 8, 918-928, doi:S1474-4422(09)70211-X [pii]1 0.1016/S1474-4422(09)70211-X [doi] (2009). [0278] 39 Lu, Q. L. et al. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci USA 102, 198-203 (2005). [0279] 40 van Deutekom, J. C. et al. Local dystrophin restoration with antisense oligonucleotide PRO051. N Engl J Med 357, 2677-2686, doi:357/26/2677 [pii]10.1056/NEJMoa073108 [doi] (2007). [0280] 41 Wu, B. et al. Dose-dependent restoration of dystrophin expression in cardiac muscle of dystrophic mice by systemically delivered morpholino. Gene Ther 17, 132-140, doi:gt2009120 [pii]10.1038/gt.2009.120 [doi] (2010). [0281] 42 Cirak, S. et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. Lancet 378, 595-605, doi:10.1016/s0140-6736(11)60756-3 (2011).