RECOMBINANT VECTOR FOR EXPRESSING TARGET PROTEIN IN PLANT CELL

20200354737 ยท 2020-11-12

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a technique for highly expressing a target protein in a plant cell by using a glycosylation domain, a recombinant vector comprising a gene encoding a fusion protein of a glycosylation domain and a target protein, a recombinant cell, a transformed plant, and a method of producing a target protein using these.

Claims

1. A composition for producing a target protein, the composition comprising one or more selected from the group consisting of: a recombinant vector comprising a gene encoding a fusion protein comprising the target protein and an N-glycosylation domain fused to a C-terminal or N-terminal of the target protein; a recombinant cell comprising the recombinant vector; and a transgenic organism comprising the recombinant cell.

2. The composition of claim 1, wherein the N-glycosylation domain is a polypeptide having a length of 10 to 100 consecutive amino acids in a human CD45 protein of SEQ ID NO: 1, the polypeptide comprising a human CD45-derived M domain of SEQ ID NO: 2 or a portion of the M domain, wherein the portion of the M domain is a polypeptide fragment comprising 10 or more amino acids comprising one or more N-glycosylation sites selected from Asn at position 2, Asn at position 30, Asn at position 40, and Asn at position 46, of SEQ ID NO: 2.

3. The composition of claim 2, wherein the portion of the M domain is a polypeptide fragment having a length of 10 or more consecutive amino acids in SEQ ID NO: 2, the polypeptide fragment comprising LTECKNASVS ISHNSCTAPD (SEQ ID NO: 6) or NVNENVECGN NTCTNNEVHN LTECKNASVS ISHNSCTAPD (SEQ ID NO: 7).

4. The composition of claim 2, wherein the portion of the M domain is a polypeptide fragment having a length of 20 or more consecutive amino acids in SEQ ID NO: 2, the polypeptide fragment comprising NVNENVECGN NTCTNNEVHN LTECKNASVS ISHNSCTAPD (SEQ ID NO: 7).

5. The composition of claim 1, wherein the fusion protein further comprises a peptide linker between the target protein and the N-glycosylation domain.

6. The composition of claim 1, wherein the fusion protein is targeted to an endoplasmic reticulum.

7. The composition of claim 1, wherein the recombinant vector further comprises a BiP (chaperone binding protein)-encoding gene, a HDEL (His-Asp-Glu-Leu) (SEQ ID NO: 54) peptide-encoding gene, or a combination thereof.

8. The composition of claim 1, wherein the cell is a plant cell, and the organism is a plant.

9. A recombinant vector for expressing a target protein, the recombinant vector comprising a gene encoding a fusion protein comprising a target protein and an N-glycosylation domain fused to a C-terminal or N-terminal of the target protein.

10. The recombinant vector of claim 9, wherein the fusion protein further comprises a peptide linker between the target protein and the N-glycosylation domain.

11. The recombinant vector of claim 9, wherein the fusion protein is targeted to an endoplasmic reticulum.

12. The recombinant vector of claim 9, wherein the recombinant vector further comprises a BiP (chaperone binding protein)-encoding gene, a HDEL (His-Asp-Glu-Leu) peptide-encoding gene, or a combination thereof.

13. The recombinant vector of claim 9, wherein the recombinant vector is for use in expression in a plant cell.

14. A recombinant cell comprising the recombinant vector of claim 9.

15. A transgenic organism comprising the recombinant cell of claim 14.

16. A method of producing a target protein, the method comprising culturing the recombinant cell of claim 14.

17. A method of producing a target protein, the method comprising growing the transgenic organism of claim 15.

18. A composition for expressing a protein, the composition comprising a gene encoding an N-glycosylation domain or a recombinant vector comprising the gene, wherein the N-glycosylation domain is a polypeptide having a length of 10 to 100 consecutive amino acids in a human CD45 protein of SEQ ID NO: 1, the polypeptide comprising a human CD45-derived M domain of SEQ ID NO: 2 or a portion of the M domain, wherein the portion of the M domain is a polypeptide fragment comprising 10 or more amino acids comprising one or more N-glycosylation sites selected from Asn at position 2, Asn at position 30, Asn at position 40, and Asn at position 46, of SEQ ID NO: 2.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0066] FIG. 1 is a diagram illustrating a linkage comprising a p35S-M17: Bip: Leptin: M: HA: HDEL moiety in a recombinant vector for transforming a plant which was constructed according to an embodiment.

[0067] FIG. 2A is a diagram illustrating a linkage comprising a p35S-M17: Bip: Leptin: HA: HDEL moiety, a p35S-M17: Bip: Leptin: M: HA: HDEL moiety, and a p35S-M17: Bip: Leptin: M1234: HA: HDEL moiety in a recombinant vector for transforming a plant which was constructed according to an embodiment (M1234: M domain variant in which N-glycosylation sites N1, N2, N3, and N4 of an M domain were modified (Asn.fwdarw.Gln)).

[0068] FIG. 2B illustrates electrophoresis results (upper side) of confirming protein expression levels by western blotting according to the presence or absence of N-glycosylation of an M domain and quantification results thereof (lower side).

[0069] FIG. 3 is a diagram of a recombinant vector for testing a difference between protein expression levels according to a targeted plant cell organelle (upper side), and illustrates electrophoresis results (middle side) of confirming protein expression levels by western blotting and quantification results thereof (lower side).

[0070] FIG. 4 illustrates electrophoresis results (upper side) of confirming expression patterns of fusion proteins fused with an M domain over time by western blotting and quantification results thereof (lower side).

[0071] FIG. 5 illustrates western blotting results of confirming an expression level of a fusion protein produced by fusing an M domain with Exendin4 or GLP-1.

[0072] FIG. 6A is a diagram of a recombinant vector for expressing fusion proteins produced by fusing an M domain and various target proteins in various orders, according to an embodiment.

[0073] FIG. 6B illustrates western blotting results of confirming an expression level of a fusion protein produced by fusing an M domain and leptin (Lep), aprotinin (Apr), or GFP (Gfp) in various orders.

[0074] FIGS. 7A-7C is a set of graphs showing expression levels of fusion proteins in which Leptin was fused with each of mutant M domains where the N-glycosylation site of an M domain was mutated in various combinations.

[0075] FIG. 8 illustrates western blotting results of confirming an expression level of a fusion protein fused with a wild type M domain or a mutant M domain according to the presence or absence of ER-associated degradation inhibition.

[0076] FIG. 9 illustrates western blotting results of confirming protein expression levels according to the presence or absence of fusion of a target protein intrinsically having an N-glycosylation site with an M domain.

[0077] FIG. 10 illustrates western blotting results of confirming expression levels of fusion proteins produced by fusing a target protein with various M domain portions or extension portions.

[0078] FIG. 11 is a graph showing quantitative RT-PCR results of confirming transcription levels according to fusion of an M domain or various M domain variants.

MODE OF THE INVENTION

[0079] Hereinafter, the present invention will be described in further detail with reference to the following examples.

[0080] It will be obvious to those of ordinary skill in the art that these examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention.

Reference Example 1: Preparation of Plant Materials

[0081] Arabidopsis (Arabidopsis thaliana ecotype, Col-0) plants were grown on B5 plates in a growth chamber at 20 C. to 22 C. under a 16 h/8 h light/dark cycle. Leaf tissues from 2-week-old plants were used for protoplast isolation.

Reference Example 2: Plasmid Construction

[0082] The mature peptide region of mouse leptin cDNA (NM_008493.3) was used. A DNA fragment (SEQ ID NO: 1) encoding an M domain was synthesized by repetitive PCR, and mutants of the N-glycosylation (Asn-Gln substitution) were generated by PCR-based site-directed mutagenesis. A DNA fragment (SEQ ID NO: 11) encoding aprotinin was produced by chemical synthesis (Bioneer, Daejeon, Korea). Enterokinase and furin cleavage sites were included in the primer used for leptin amplification (5-GGATCCAAGATGATGATGATAAGGTGCCTATCCAGAAAGTCCAGGAT-3 (SEQ ID NO: 18)). AHA epitope and an ER retention signal HDEL were introduced using the primers used for amplification of the M domain. PCR conditions were as follows: 94 C. for 5 minutes, (94 C. for 30 seconds, 52 C. for 1 minute, and 72 C. for 30 seconds) repeated 30 times, 72 C. for 7 minutes. The primer sequences used are summarized in Table 1 below:

TABLE-US-00001 TABLE1 SEQ ID PrimerName Sequence(5to3) NO. BamHI-Ek- GGATCCAAGATGATGATGATAAGGTGCCTA 18 leptin-F TCCAGAAAGTCCAGGAT leptin-furin- ACTAGTTCGCCTGACACGGCATTCAGGGCT 19 SpeI-R AACATCCAACTG hspt-R GAATTCCTTATCTTTAATCATATT 20 M-3-HA-HDEL-F TCATAATTCATGTACTGCTCCTGATTACCCA 21 TACGATGTTCCAGATTACGCTTCCCACGATG AGCTCTAGCTCGAGATATGAAGATGAAGAT GAAATATT M-2-F AATGTGGAAACAATACTTGCACAAACAATG 22 AGGTGCATAACCTTACAGAATGTAAAAATG CGTCTGTTTCCATATCTCATAATTCATGTAC TGCTCCTGA SpeI-M-1-F ACTAGTGCAAACATCACTGTGGATTACTTA 23 TATAACAAGGAAACTAAATTATTTACAGCA AAGCTAAATGTTAATGAGAATGTGGAATGT GGAAACAATACTTGCACAA SpeI-HA-F ACTAGTTACCCATACGATGTTCCAGATTAC 24 XbaI-Cab-F TCTAGAATGGCGTCGAACTCGCTTATGAGC 25 Cab-BamHI-R GGATCCTCTCTGACTCTTTGTA 26 XbaI-F1-F TCTAGAATGGCAATGGCTGTTTTCCGTCGC 27 F1-BamHI-R GGATCCTCTGAACTGCTCTAAGCTTGGAAG 28 SpeI-M-F ACTAGTGCAAACATCACTGTGGAT 29 SpeI-M-N2Q-F ACTAGTGCACAAATCACTGTGGAT 30 M-N30Q-F GTGGAATGTGGACAAAATACTTGCACA 31 M-N30Q-R TGTGCAAGTATTTTGTCCACATTCCAC 32 M-N40Q-F AATGAGGTGCATCAACTTACAGAATGT 33 M-N40Q-R ACATTCTGTAAGTTGATGCACCTCATT 34 M-N46Q-F ACAGAATGTAAACAAGCGTCTGTTTCC 35 M-N46Q-R GGAAACAGACGCTTGTTTACATTCTGT 36 M-N40,46Q-F AACAATGAGGTGCATCAACTTACAGAATGT 37 AAACAAGCGTCTGTTTCCATA M-N40,46Q-R TATGGAAACAGACGCTTGTTTACATTCTGTA 38 AGTTGATGCACCTCATTGTT BamHI-M-F GGATCCCGATGGCAAACATCACTGTGGATT 39 ACTTA M-GS2-SpeI-R ACTAGTTGATCCACCACCAGACCCACCTCC 40 ACCATCAGGAGCAGTACATGAATTAT BamHI-Ek-Apr GGATCCCGGATGACGACGATAAGCGACCGG 41 AC BamHI-ek-Apr-F GGATCCAAGATGATGATGATAAGCGACCGG 42 AC Apr-fu-SpeI-R ACTAGTTCGCCTGACACGGGCACCGCCGCA 43 GGTTCTCATACA GFP-HDEL-stop- CTCGAGCTAGAGCTCATCGTGCTTGTACAG 44 XhoI-R CTCGTCCATGCCGAG GFP-fu-SpeI-R ACTAGTTCGCCTGACACGCTTGTACAGCTC 45 GTCCATGCCGAG SpeI-ek-GFP-F ACTAGTGATGACGACGATAGGTGAGCAAG 46 AtACT2-5 TATGAATTACCCGATGGGCAAG 47 AtACT2-3 TGGAACAAGACTTCTGGGCAT 48 leptin-F- TCGGTATCCGCCAAGCAGTGCCTATCCAGA 49 qRT1-F AAGTCCA leptin-R- GGTGAAGCCCAGGAATGAAGGCATTCAGG 50 qRT1-R GCTAACATCCA

[0083] The mature region of leptin and the M domain or Asn-to-Gln-substituted mutant M domain were sequentially ligated into the vector BiP: HA: CBD: HDEL.

[0084] To accumulate fusion proteins in chloroplasts and mitochondria, a Cab transit peptide or F1-ATPase gamma subunit presequence was amplified by PCR and substituted with BiP in EeLepf and EeLepfM vectors (see Lee, D., et al. W. et al., Arabidopsis nuclear-encoded plastid transit peptides contain multiple sequence subgroups with distinctive chloroplast-targeting sequence motifs. Plant Cell 20, 1603-1622 (2008); Lee, S. et al., Mitochondrial targeting of the Arabidopsis F1-ATPase gamma-subunit via multiple compensatory and synergistic presequence motifs. Plant Cell 24, 5037-5057 (2012)).

[0085] The constructs were all constructed from the same vector and therefore have the same 5-UTRs. Nucleotide sequences of all PCR products were confirmed by nucleotide sequencing.

Reference Example 3: Expression, Compound Treatment, and Western Blotting Analysis

[0086] The plasmid prepared in Reference Example 2 was introduced into a protoplast of plant cells prepared in Reference Example 1 by polyethylene glycol (PEG)-mediated transformation. After transformation, proteins were extracted at 24 hours or at a predetermined time to prepare protein extracts. Immediately after transformation, protoplasts were treated with tunicamycin (10 g/mL; Sigma-Aldrich, St. Louis, Mo.) and then treated with cycloheximide (50 g/mL; Sigma-Aldrich, St. Louis, Mo.) 12 hours after transformation. Western blotting analysis was performed on protein extracts using an anti-HA antibody (Roche Diagnostics, Indianapolis, Ind.), an anti-actin antibody (MP Biomedicals, Solon, Ohio), an anti-GFP antibody (Bio-Application, Pohang, Korea), or an anti-BiP antibody. Protein blots were developed with an ECL kit (Amersham Pharmacia Biotech, Piscataway, N.J.) and images were acquired using a LAS4000 image analyzer (Fujifilm, Tokyo, Japan).

Reference Example 4: Total RNA Isolation and Quantitative RT-PCR Analysis at Transcript Level

[0087] Total RNA was extracted from PEG-mediated transformed plant protoplasts using an Ambion phenol-free total RNA isolation kit and treated with TURBO DNase (Ambion). cDNA was synthesized from the extracted total RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems). Transcript levels were detected using the Power SYBR Green PCR Master Mix (Applied Biosystems). ACTIN2 was used as an endogenous control. A PCR mixture (20 l) contained 50 ng of a template, 0.5 mM forward and reverse primers, and 1SYBR Mix.

[0088] PCR conditions were as follows: initial denaturation at 95 C. for 10 min, followed by 40 cycles of 95 C. for 15 s and 60 C. for 1 min.

[0089] To confirm specific amplification, a melting curve was generated by heating at 95 C. for 15 s and then at 60 C. for 1 min, and then increasing the temperature 0.3 C. every 15 sup to 95 C.

Example 1. Construction of Recombinant Vector for M Domain Fusion

[0090] To highly express a target protein in a plant, a recombinant vector for plant transformation which comprised a gene encoding a fusion protein in which the M domain of human CD45 was fused to the target protein was constructed. As the target protein, Leptin in which an enterokinase cleavage site and a furin cleavage site were fused to the N-terminal and the C-terminal, respectively (hereinafter referred to as eLepf) was used. A CaMV 35S promoter was used in the vector pCAMBIA1300 as the recombinant vector, which is a commonly used vector, an M17 sequence (SEQ ID NO: 3) was added to increase the amount of protein synthesized, the target protein was transferred to an endoplasmic reticulum using a genomic DNA sequence (SEQ ID NO: 4) corresponding to a signal peptide of BiP (chaperone binding protein), and HDEL (His-Asp-Glu-Leu) was added to the C-terminal to be retained in the endoplasmic reticulum so that the final target protein could be accumulated in the endoplasmic reticulum. In addition, the HA epitope was used to confirm the presence or absence of fusion protein expression by western blotting. A diagram of the recombinant vector constructed in the present example is shown in FIG. 1 (M: M domain).

[0091] A nucleic acid sequence (SEQ ID NO: 10) of the recombinant vector shown in FIG. 1 is summarized in Table 2 below.

TABLE-US-00002 TABLE2 Nucleicacidsequence(SEQIDNO:10)of recombinantvectorforexpressinga Leptin-Mdomainfusiondomain Nucleicacidsequence(5.fwdarw.3) XbaI tctaga (Restriction enzymesite) M17 ggcgtgtgtgtgtgttaaaga(SEQIDNO:3) BiP atggctcgctcgtttggagctaacagtaccgttgtg ttggcgatcatcttcttcggtgagtgattttccgat cttcttctccgatttagatctcctctacattgttgc ttaatctcagaaccttttttcgttgttcctggatct gaatgtgtttgtttgcaatttcacgatcttaaaagg ttagatctcgattggtattgacgattggaatcttta cgatttcaggatgtttatttgcgttgtcctctgcaa tagaagaggctacgaagttaa(SEQIDNO:4) Enk ggatccaagatgatgatgataag (Enterokinase cleavagesite) Leptin Gtgcctatccagaaagtccaggatggcaccaaagcc ctcatcaagaccattgtcaccaggatcaatgacatt tcacacacgcagtcggtatccgccaagcagagggtc actggcttggacttcattcctgggcttcaccccatt ctgagtagtccaagatggaccagactctggcagtct atcaacaggtcctcaccagcctgccttcccaaaatg tgctgcagatagccaatgacctggagaatctccgag acctcctccatctgctggccttctccaagagctgct ccctgcctcagaccagtggcctgcagaagccagaga gcctggatggcgtcctggaagcctcactctactcca cagaggtggtggctttgagcaggctgcagggctctc tgcaggacattcttcaacagttggatgttagccctg aatgc(SEQIDNO:53) furin cgtgtcaggcgaactagt cleavagesite M gcaaacatcactgtggattacttatatatagcaaac tctaaatgttaatgagaatgtggaatgtggaaacaa tacttgcacaaacaatgaggtgcataaccttacaga atgtaaaaatgcgtctgtaccatatctcataattca tgtactgctcctgat(SEQIDNO:1) HA tacccatacgatgttccagattacgct linker tcc HDEL cacgatgagctc(SEQIDNO:9) stopcodon- tagctcgag XhoI

[0092] The N-glycosylation residues of an M domain of SEQ ID NO: 2 are as follows:

TABLE-US-00003 130 ANITVDYLYNKETKLFTAKLNVNENVECGN N1N2 3160 NTCTNNEVHNLTECKNASVSISHNSCTAPD N3N4

Example 2. Confirmation of Increased Protein Expression by N-Glycosylation of M Domain

[0093] For comparison with an expression level of the fusion protein eLepfM produced by the recombinant vector comprising the M domain, constructed in Example 1, a recombinant vector was constructed as follows.

[0094] A vector EeLepf in which the M domain was removed from the recombinant vector (EeLepfM; see FIG. 1) of Example 1 and a vector EeLepfM1234 in which four N-glycosylation sites (Asn) of the M domain (see Example 1) were mutated (mutation; Asn was substituted with Gln) were constructed (see Reference Example 1). The three vectors (see FIG. 2A) were transformed into plant cells (see Reference Example 1) isolated from leaves of Arabidopsis thaliana via polyethylene glycol (PEG), and then treated with tunicamycin, which inhibits N-glycosylation, to confirm the effect of N-glycosylation. After 24 hours, protein expression levels were confirmed by western blotting. The results of the protein expression levels are shown in FIG. 2B (upper side: western blotting results; lower side: a graph showing results of quantifying the protein expression levels obtained as a result of western blotting, by using an LAS4000 image analyzer (Error bars, standard deviation (n=3); *, p<0.05 (Student's t-test)).

[0095] As illustrated in FIG. 2B, even when N-glycosylation did not occur, a protein expression level was increased when the M domain was fused (EeLepfM+tunicamycin), but when tunicamycin was not added to the recombinant vector comprising the M domain (EeLepfMtunicamycin), N-glycosylation occurred and the expression level of the target protein was increased to a maximum degree.

[0096] To more clearly verify whether the increase in protein expression level due to the fusion of the M domain was induced by N-glycosylation, a recombinant vector was constructed such that the M domain-free target protein (eLepf) and the M domain-fused protein (eLepfM) were targeted to each of the endoplasmic reticulum, chloroplast, and mitochondria. To target the fusion proteins to each of the endoplasmic reticulum, chloroplast, and mitochondria, BiP (SEQ ID NO: 4), a Cab transit peptide (SEQ ID NO: 12), or F1-ATPase gamma subunit presequence (SEQ ID NO: 13) was fused to the N-terminal of the target protein, and an M domain-encoding nucleic acid sequence (SEQ ID NO: 1) was fused to the C-terminal of the target protein, thereby completing the construction of the recombinant vectors. Each recombinant vector was introduced into a plant cell using the above-described method, followed by culturing to express the corresponding fusion protein. Protein expression levels were confirmed by western blotting.

[0097] The results of the obtained protein expression levels are illustrated in FIG. 3 (upper side: a diagram of expression vectors; middle side: western blotting results; lower side: a graph showing results of quantifying the protein expression levels obtained as a result of western blotting by using an LAS4000 image analyzer (Error bars, standard deviation (n=3); *, p<0.05 (Student's t-test)).

[0098] As illustrated in FIG. 3, it was confirmed that, while the M domain-free eLepf showed no difference in protein amount according to an intracellular organelle, in the case of the M domain-fused eLepfM, the expression level of only EeLepfM targeted to the ER where N-glycosylation occurs was increased.

[0099] When the results of FIGS. 2B and 3 are taken together, it was confirmed that the increase in expression of the target protein due to the fusion of the M domain was caused by N-glycosylation.

Example 3. Expression Rate of M Domain-Fused Protein

[0100] As confirmed in Example 2, to understand the mechanism for the N-glycosylation-induced increase in protein expression, an expression rate of the M domain-fused protein was examined. Each of the M domain-fused recombinant vector EeLepfM and the vector EeLepfM1234 in which the N-glycosylation sites of the M domain were mutated was transformed into a plant cell, and after 12 hours, each vector was treated with cycloheximide or dimethyl sulfoxide (DMSO), which blocks protein synthesis, and then proteins were extracted at an interval of 12 hours to perform western blotting thereon.

[0101] The results thereof are illustrated in FIG. 4 (upper side: western blotting results; lower side: a graph showing results of quantifying the protein expression levels obtained as a result of western blotting by using an LAS4000 image analyzer (x-axis, time: Error bars, SD (n=3); *, p<0.05; ***, p<0.001).

[0102] As a result, as illustrated in FIG. 4, it was confirmed that there were almost no significant difference in expression levels of EeLepfM and EeLepfM1234 at the initial time (12 h), but the difference continued to increase over time, from which it was confirmed that the expression rate of EeLepfM was much faster than that of EeLepfM1234. However, it was confirmed that, while EeLepfM slightly disappeared in the plant cell when protein synthesis was blocked by treatment with cycloheximide, EeLepfM1234 was maintained as is up to 48 hours, from which it was confirmed that the fused protein EeLepfM1234 exhibited higher stability in the endoplasmic reticulum. These results indicate that a translation rate of a protein where N-glycosylation occurs is faster than that of a protein where no N-glycosylation occurs.

Example 4. Fusion of Various Proteins and M Domain

[0103] To confirm whether the expression increase effect due to the M domain is applicable to proteins other than the target protein (eLepf) used in the examples, the M domain-encoding gene (SEQ ID NO: 1) was fused to another target protein, e.g., a gene encoding Exendin4 (SEQ ID NO: 51) or a gene encoding GLP-1 (SEQ ID NO: 52), and a G domain, which is a translation enhancer domain, was fused thereto, thereby completing the construction of a recombinant vector (see FIG. 1). Each recombinant vector was transformed into a plant cell (see Reference Example 1), and then protein expression levels were confirmed by western blotting. The results thereof are illustrated in FIG. 5. As illustrated in FIG. 5, it was confirmed that the protein expression level was significantly increased when N-glycosylation occurred, due to no treatment with tunicamycin, as compared to when treated with tunicamycin that blocks N-glycosylation.

Example 5. Fusion of Various Proteins and M Domain in Various Orders

[0104] In addition, a recombinant vector comprising leptin (Lep), aprotinin (Apr; SEQ ID NO: 11), or GFP (Gfp; SEQ ID NO: 15) at the position Xxx of each of the recombinant vectors illustrated in FIG. 6A was prepared ((G45)2: linker (GGGGSGGGGS) (SEQ ID NO: 55)), and each recombinant vector was transformed into a plant cell, and then protein expression levels were confirmed by western blotting.

[0105] The results thereof are illustrated in FIG. 6B. As illustrated in FIG. 6B, it was confirmed that, when a gene encoding a fusion protein of a target protein and an M domain was expressed, an expression level of the target protein was significantly increased compared to when the M domain was not fused, regardless of the type of target protein, an order linked to the M domain, and the presence or absence of a linker.

Example 6: Test of Target Protein Expression According to Combinations of N-Glycosylation Sites of M Domain

[0106] The expression level of a target protein (Leptin) was measured using recombinant vectors comprising genes encoding mutants (one mutation, two mutations, three mutations, and all four mutations of the four N-glycosylation sites) into which Asn-Gln substitution mutation(s) was/were introduced to various combinations of the four N-glycosylation sites of the M domain (see the drawing of Example 1) (see FIGS. 7A-7C). Each recombinant vector was transformed into a protoplast of a plant cell, and then proteins were extracted, and the obtained protein extracts were analyzed by western blotting using an anti-HA antibody. The signal intensity of bands obtained as a result of western blotting was quantified using software provided with an LAS4000 image analyzer, and the results thereof are illustrated in FIGS. 7A-7C (on the x-axis, numbers following EeLepfM denote Asn-to-Gln mutated N-glycosylation sites). In FIGS. 7A-7C, the expression level of the target protein in a case in which each mutant was used was expressed as a relative value with respect to the expression level (1) of EeLepfM, which is an ER-targeted wild type protein (fusion of wild-type M domain and target protein). FIG. 7A illustrates relative expression levels of the target protein when single Asn-Gln mutants were used, FIG. 7B illustrates relative expression levels of the target protein when double Asn-Gln mutants were used, and FIG. 7C illustrates relative expression levels of the target protein when triple Asn-Gln mutants were used (Error bars, SD (n=4)).

[0107] As illustrated in FIGS. 7A-7C, when mutation occurred at positions 1 to 3 of the N-glycosylation sites of the M domain, the expression level of the target protein was lower than that of wild type, but these cases exhibited a high expression level of the target protein compared to a case in which all four N-glycosylation sites were mutated. When considering that, even though a mutant in which all four N-glycosylation sites of the M domain were mutated was used, the expression level of the target protein was increased compared to a case in which the target protein was expressed alone (see FIG. 2B), even a case in which not only a wild-type M domain but also a mutant M domain in which mutations occurred at positions 1 to 4 of the four N-glycosylation sites may be considered to contribute to increasing the expression level of the fusion-expressed target protein.

Example 7: Test for Correlation Between Low Expression Level of Unglycosylated Protein and ER-Related Degradation

[0108] It was tested whether the low expression level of an unglycosylated protein is related to ER-associated degradation. In conclusion, it was confirmed that the low expression level of the unglycosylated protein was not due to ER-associated degradation.

[0109] More specifically, each of the EeLepfM vector (expression of a fusion protein of Leptin and wild-type M domain) and EeLepfM1234 vector (expression of a fusion protein of Leptin and a mutant M domain in which all four glycosylation sites were mutated (substituted with Gln) was transformed into a plant protoplast, and then 20 M MG132 (IUPAC name: Benzyl N-[(2S)-4-methyl-1-[[(2S)-4-methyl-1-[[(2S)-4-methyl-1-oxopentan-2-yl]amino]-1-oxopentan-2-yl]amino]-1-oxopentan-2-yl]carbamate), which is an inhibitor of 26S proteasome-mediated degradation, was added to a protoplast culture medium at 18 h or 21 h, followed by further culturing of each protoplast for 6 hours or 3 hours.

[0110] [Schematic View of Test Design]

##STR00001##

[0111] (HAT: Hours after Transformation)

[0112] For comparison (positive control), each protoplast was transformed with Rbcs[T4, 7A]: GFP, and then treated with MG132 at 18 h and further cultured for 6 hours. Rbcs[T4, 7A]: GFP, which is a GFP fusion construct, expresses a mutant form of the RbcS delivery peptide defective in the introduction of a protein into the chloroplast, and is ubiquitinated and degraded by the cytoplasmic 26S proteasome.

[0113] At 24 hours after transformation, proteins were extracted from each transformed protoplast, and then the protein extracts were analyzed by western blotting using an anti-HA antibody or an anti-GFP antibody.

[0114] The obtained western blotting results are illustrated in FIG. 8. As illustrated in FIG. 8, the expression level of Rbcs[T4, 7A]: GFP was higher upon treatment with MG132, compared to non-treatment with MG132, and these results show that MG132 inhibits 26S proteasome-dependent protein degradation under test conditions of the present example. However, the expression levels of the EeLepfM and EeLepfM1234 proteins showed no difference regardless of MG132 treatment, which indicates that ER-associated degradation did not play a role in the expression of the N-glycosylated EeLepfM protein and the unglycosylated EeLepfM1234 protein.

Example 8: Test for Effect of N-Glycosylation of Target Protein Itself and N-Glycosylation of M Domain on Target Protein Expression

[0115] It was examined whether the expression level of the target protein is increased even in the case of N-glycosylation of the target protein itself that was not fused with the M domain, that is, a case in which N-glycosylation of the target protein itself was possible due to its intrinsic inclusion of N-glycosylation sites.

[0116] To this end, with reference to the previous examples, an LIF (EeLiff)-expressing recombinant vector to which the M domain was fused or not fused was constructed using a leukemia inhibitory factor (LIF) (SEQ ID NO: 17; nucleic acid-encoding sequence: SEQ ID NO: 16; EeLiff; intrinsically having 6 N-glycosylation sites) instead of the Leptin protein, each recombinant vector was transformed into a plant protoplast, and after 24 hours, proteins were extracted and protein expression levels were measured by western blotting.

[0117] The obtained protein expression levels are illustrated in FIG. 9. As illustrated in FIG. 9, it can be seen that the expression level of M domain-fused EeLiffM is significantly high compared to that of EeLiff to which the M domain was not fused (RbcL: loading control). These results show that, while N-glycosylation at N-glycosylation sites intrinsically comprised in the target protein does not affect the expression level of the target protein, N-glycosylation of the M domain, which is a fusion partner fused with the target protein, plays an important role in the expression level of the target protein.

Example 9: Expression Level of Fusion Protein Fused with Portion or Extension Portion of M Domain

[0118] The expression level of a fusion protein in which the target protein (Leptin) was fused with a portion or extension portion of the M domain was tested. To this end, with reference to the method of Example 2, a fusion protein in which the target protein and a fragment (SEQ ID NO: 6) having a length of 20 amino acids at positions 41-60 of the M domain (SEQ ID NO: 2; total 60aa) (EeLepfM20; comprising 1 N-glycosylation site (N4: Asn at position 46), a fusion protein in which a fragment (SEQ ID NO: 7) having a length of 40 amino acids at positions 21-60 was fused (EeLepfM40; comprising 3 N-glycosylation sites of the M domain (N2: Asn at position 30; N3: Asn at position 40; and N4: Asn at position 46), and a fusion protein (E3LepfM80) in which a fragment (SEQ ID NO: 8) having a length of a total of 80 amino acids which extends by 10 amino acids towards each of the N-terminal and C-terminal of the M domain of SEQ ID NO: 2 in CD45 (SEQ ID NO: 5) were each introduced into a protoplast of a plant cell and expressed, and then proteins were extracted and expression levels thereof were measured by western blotting. For comparison, the expression level of EeLepf to which the M domain was not fused was also measured.

[0119] The obtained protein expression levels are illustrated in FIG. 10. As illustrated in FIG. 10, all of EeLepfM20, EeLepfM40, EeLepfM60, and EeLepfM80 exhibited higher expression levels than that of EeLepf (EeLepf<<EeLepfM20<EeLepfM40EeLepfMEeLepfM80).

Example 10: Test for Transcript Level According to Fusion of M Domain or Various M Domain Mutants

[0120] A plant cell (Reference Example 1) was transformed with each of recombinant vectors comprising a wild-type (not mutated) M domain or various M domain mutants in which each of the N-glycosylation sites was mutated and leptin, and total RNA was extracted after 1 day to perform quantitative RT-PCR. For a detailed method, refer to Reference Example 4.

[0121] The obtained RNA levels are illustrated in FIG. 11. FIG. 11 illustrates mean values of mRNA levels in the case in which each M domain mutant was fused, relative to an mRNA level (=1) in the case in which a wild-type (not mutated) M domain (i.e., fully glycosylated) and leptin were fused with each other (Error bar, SD (n=3 for M to 14; n=2 for 23 to 1234). As a result of a Student's t-test, p values were equal to or greater than 0.05, which indicates that there was no difference in mRNA level between M domain-fused leptin and leptins to which mutated M domains were fused. These results indicate that the increase in expression due to fusion of the M domain is not due to an increase in mRNA level by increasing transcription, and suggests that such an expression increase is due to the promotion of translation from mRNA into a protein.