Anti-human programmed death-1 monoclonal antibody

Abstract

Provided are a human PD-1 antibody, an antigen-binding fragment thereof and a medical use thereof. A chimeric antibody containing a complementarity determining region (CDR) of the antibody, a pharmaceutical composition containing the human PD-1 antibody and the antigen-binding fragment thereof, and a use of the antibody in preparation of a drug for treating a disease or a disorder are further disclosed.

Claims

1. An anti-PD1 antibody or an antigen-binding fragment thereof, comprising a heavy chain CDR1-3 and a light chain CDR1-3 selected from a group consisting of the following items: (1) HCDR1: represented by a sequence of SEQ ID NO: 8; HCDR2: represented by a sequence of SEQ ID NO: 9; HCDR3: represented by a sequence of SEQ ID NO: 10; LCDR1: represented by a sequence of SEQ ID NO: 20; LCDR2: represented by a sequence of SEQ ID NO: 21; LCDR3: represented by a sequence of SEQ ID NO: 22; (2) HCDR1: represented by a sequence of SEQ ID NO: 12; HCDR2: represented by a sequence of SEQ ID NO: 13; HCDR3: represented by a sequence of SEQ ID NO: 14; LCDR1: represented by a sequence of SEQ ID NO: 24; LCDR2: represented by a sequence of SEQ ID NO: 25; LCDR3: represented by a sequence of SEQ ID NO: 26; and (3) HCDR1: represented by a sequence of SEQ ID NO: 16; HCDR2: represented by a sequence of SEQ ID NO: 17; HCDR3: represented by a sequence of SEQ ID NO: 18; LCDR1: represented by a sequence of SEQ ID NO:28; LCDR2: represented by a sequence of SEQ ID NO:29; LCDR3: represented by a sequence of SEQ ID NO:30.

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody comprises: (1) a heavy chain variable region, which comprises or consists of the following sequences: an amino acid sequence shown in SEQ ID NO: 7, or a sequence having at least 60%, 70%, 80%, and 85%, preferably at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the sequence identity with the sequence shown in SEQ ID NO: 7, and a light chain variable region, which comprises or consists of the following sequences: an amino acid sequence shown in SEQ ID NO: 19, or a sequence having at least 60%, 70%, 80%, and 85%, preferably at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the sequence identity with the sequence shown in SEQ ID NO: 19; (2) a heavy chain variable region, which comprises or consists of the following sequences: an amino acid sequence shown in SEQ ID NO: 11, or a sequence having at least 60%, 70%, 80%, and 85%, preferably at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the sequence identity with the sequence shown in SEQ ID NO: 11, and a light chain variable region, which comprises or consists of the following sequences: an amino acid sequence shown in SEQ ID NO: 23, or a sequence having at least 60%, 70%, 80%, and 85%, preferably at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the sequence identity with the sequence shown in SEQ ID NO: 23; and (3) a heavy chain variable region, which comprises or consists of the following sequences: an amino acid sequence shown in SEQ ID NO: 15, or a sequence having at least 60%, 70%, 80%, and 85%, preferably at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the sequence identity with the sequence shown in SEQ ID NO: 15, and a light chain variable region, which comprises or consists of the following sequences: an amino acid sequence shown in SEQ ID NO: 27, or a sequence having at least 60%, 70%, 80%, and 85%, preferably at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the sequence identity with the sequence shown in SEQ ID NO: 27.

3. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody further comprises a heavy chain constant region and a light chain constant region.

4. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antigen-binding fragment is selected from Fab, scFv, Fab′, dAb, F(ab′).sub.2, Fv or Fab/c.

5. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody is a chimeric antibody or a multispecific antibody.

6. A polynucleotide encoding the antibody or antigen-binding fragment thereof according to claim 1.

7. A pharmaceutical composition, comprising the antibody or antigen-binding fragment thereof according to claim 1.

8. The pharmaceutical composition according to claim 7 for treating a PD-1-mediated disease or disorder.

9. A method for treatment and/or adjuvant treatment and/or diagnosis treatment of a tumor disease, comprising administrating the antibody or antigen-binding fragment thereof according to claim 1 to a subject in need thereof.

10. The pharmaceutical composition according to claim 7, wherein the pharmaceutical composition is in a form suitable for injection.

11. The pharmaceutical composition according to claim 10, wherein the form suitable for administration by subcutaneous injection, intradermal injection, intravenous injection, intramuscular injection or intralesional injection.

12. The method according to claim 9, wherein the antibody or antigen-binding fragment thereof is in a form suitable for injection.

13. The method according to claim 12, wherein the form suitable for administration by subcutaneous injection, intradermal injection, intravenous injection, intramuscular injection or intralesional injection.

14. The antibody or antigen-binding fragment thereof according to claim 3, wherein the heavy chain constant region and the light chain constant region are derived from human IgG or IgM.

15. The antibody or antigen-binding fragment thereof according to claim 14, wherein the heavy chain constant region and the light chain constant region are derived from IgG4.

16. The pharmaceutical composition according to claim 7, the pharmaceutical composition which further comprises a pharmaceutically acceptable carrier and/or excipient.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0061] FIG. 1: effects of different concentrations of PD-1-112-C2 on IL-2/IFN-γ secretion.

[0062] FIG. 2: effects of different concentrations of PD-1-97-C2 on IL-2/IFN-γ secretion.

[0063] FIG. 3: effects of different concentrations of PD-1-76-C2 on IL-2/IFN-γ secretion.

[0064] FIG. 4: effects of different concentrations of PD-1-97-C2 on T cell proliferation and a cytokine

[0065] IL-2 secreted by T cells.

[0066] FIG. 5: effects of different concentrations of PD-1-112-C2 on T cell proliferation and the cytokine IL-2 secreted by T cells.

[0067] FIG. 6: effects of different concentrations of PD-1-76-C2 on T cell proliferation and the cytokine IL-2 secreted by T cells.

[0068] FIG. 7: effects of different concentrations of PD-1-97-C2 on T cell proliferation and a cytokine IFN-γ secreted by T cells.

[0069] FIG. 8: effects of different concentrations of PD-1-112-C2 on T cell proliferation and the cytokine IFN-γ secreted by T cells.

[0070] FIG. 9: effects of different concentrations of PD-1-76-C2 on T cell proliferation and the cytokine IFN-γ secreted by T cells.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0071] Implementation schemes of the present invention are described in detail below in combination with embodiments, but those skilled in the art may understand that the following embodiments are only used to describe the present invention, and should not be regarded as limiting a scope of the present invention. If a specific condition is not indicated in the embodiment, it is performed according to a conventional condition or a condition suggested by a manufacturer. Reagents or instruments used without the indications of manufactures are all conventional products that may be obtained by market purchase.

Embodiment 1: Preparation of anti-PD-1 antibody

[0072] 1. Immunogen

[0073] A human PD-1 sequence (NCBI NP 005009), an upstream primer CCGCAAGCTTGCCGCCACCATG (SEQ ID NO: 1) and a downstream primer CCGGAATTCTCATTAATGGTGATGGTGATGATGCTGGAACTGGCCGGCAGGTC (SEQ ID NO: 2) were artificially synthesized, an extracellular domain was amplified through polymerase chain reaction (PCR) and cloned into a pCDNA3.4A eukaryotic expression system after double digestion with Hind III and EcoRl, then 293 cells were transfected with this plasmid, and the supernatant was harvested and purified to obtain recombinant human PD-1 protein (hPD-1).

[0074] 2. Immunize animal

[0075] The recombinant hPD-1 protein at a concentration of 1.23 mg/ml was used as an antigen. Totally 125 pg recombinant PD1 was mixed with the same amount of immune adjuvant of Freund's adjuvant (Sigma-Aldrich F5881). 5 6-week-old female BAL b/C mice were subcutaneously immunized, and the amount of the immunized antigen for each mouse was 25 pg. After primary immunization, booster immunization of the same dose was performed once a week. After a total of 5 immunizations, the immune response was monitored by collecting mouse tail blood and testing serum titer. After fluorescence activating cell sorter (FACS) screening (as described below), the mice with sufficient anti-hPD-1 immunoglobulin titers were used for fusion. Three days after the intraperitoneal booster immunization with the antigen, the mice were killed and spleens were removed for hybridoma fusion.

[0076] 3. Selection of BAL b/C mice producing anti-hPD-1 antibody

[0077] In order to select the BAL b/C mice producing the anti-hPD-1 antibody, immunized mouse serum was tested by FACS. Serum dilutions from the mice immunized with the hPD-1 recombinant protein were incubated with hPD1-transfected CHO cells at 4° C. for 30 minutes, and after 3 times washing with phosphate buffered saline (PBS), 0.4 pg/ml of PE goat anti-mouse IgG (Biolegend 405307) was added and incubated at 4° C. for another 30 minutes. After 3 times washing with PBS, samples were load into a Beckman Coulter flow cytometer (CytoFLEX A00-1-1102) to verify whether the antibodies in samples may bind to the hPD1-transfected CHO cells, the BAL b/C mice producing the anti-hPD-1 antibody were selected, and the cell fusion was performed.

[0078] 4. Generation of hybridoma producing mouse monoclonal antibody against hPD-1

[0079] Spleen cells of the immunized BAL b/C mice were fused with mouse myeloma cells, and the obtained hybridomas were screened for the antigen-specific antibody. Single cell suspension of the spleen cells from the immunized mice was fused at a ratio 5:1 with the mouse myeloma cells (SP2/0, ATCC CRL1581) in the presence of polyethylene glycol (PEG) 1500 (Roche 10783641001). The mouse myeloma cells did not secrete immunoglobulins before cell fusion. The fused cells were plated into 96-well cell culture plate at about 1×10.sup.5 cells/well, All cells were grown in a 37° C. incubator (Panasonic MCO-18A1C) supplied with 5% CO.sub.2. Subsequently, the cells were cultured for about one week in an HAT selective culture medium, which contains 1X penicillin-streptomycin dual antibody (Gibco 15140122), 1X HAT (Sigma CRLP-7185) and 20% fetal bovine serum (Royacel RY-F11-01) in a 1640 culture medium. After 1 week, the HAT culture medium was replaced with an HT culture medium (the 1640 culture medium containing 1X penicillin-streptomycin dual antibody (gibco 15140122), 1X HT (gibco 11067030) and 20% fetal bovine serum (Royacel RY-F11-01)) for culture, and then cell culture supernatants of the fusion plate was detected by FACS. The hybridomas secreting the antibody that may bind to the hPD-1 protein were selected. replated, for another round screening. The positive hybridomas that secreting hPD1 binding antibodies were subcloned at least twice by limiting dilution. Stable subclones were then cultured in vitro and a small amount of the antibodies were generated for further analysis. In this case, hybridoma clones PD1-112-C2, PD1-97-C2, and PD-76-C2 were selected for next evaluation.

Embodiment 2: Affinity characterization of anti-PD-1 mouse monoclonal antibody

[0080] According to a conventional method, a Chinese hamster ovary cell (CHO) cell line (CHO-hPD1) expressing recombinant human PD-1 on the cell surface, a CHO cell line (CHO-cynoPD1) expressing monkey PD1 (Uniprot: BOLAJ2), and a CHO cell line (CHO-mousePD1) expressing mouse PD1 (Uniprot: Q02242) were prepared by a recombinant technology, and these three cell lines were used in flow cytometry(FCM) for measuring binding characterization of anti-PD-1 mouse monoclonal antibodies PD-1-76-C2, PD-1-97-C2, and PD-1-112-C2 measured by a flow cytometry (FCM).

[0081] In order to evaluate binding of the anti-PD-1 mouse monoclonal antibody to CHO-hPD1, 2×10.sup.5 CHO-hPD1 cells and the anti-PD-1 mouse monoclonal antibody that diluted in a concentration gradient (the initial concentration was 10 pg/ml, 3-fold serial dilution) were added to a 96-well plate. then it was incubated at 4° C. for 30 minutes. After the cells were washed once with a buffer (PBS containing 3% bovine serum albumin (BSA)), PE-labeled anti-mouse IgG(Fc) Ab (Biolegend) fluorescent secondary antibody was added, it was incubated at 4° C. for another 30 minutes. the cells were washed once with the buffer and resuspended in PBS, and then cell suspension was analyzed through flow cytometry by CytoFlex (Beckman flow cytometer), the amount of the antibody bound to the cells was measured according to the mean fluorescence intensity (MFI); the same method was used to evaluate binding of anti-PD-1 mouse monoclonal antibody to a CHO-cyno cell, and a CHO-mousePD1 (sometimes abbreviated as “CHO-mPD1” in the present invention) cell. Results were shown in Table 1, data showed that the anti-PD-1 mouse monoclonal bodies PD-1-76-C2, PD-1-97-C2, and PD-1-112-C2 may all bind to the CHO-hPD1 cell and CHO-cyno cell with high affinity; while all of three mouse monoclonal bodies may not bind to the CHO-mousePD1 cell (data omitted).

Embodiment 3: Binding of PD-1 antibody to activated PBMC

[0082] Fresh human peripheral blood mononuclear cells (PBMC) could activate and proliferate lymphocytes under the stimulation of PHA (Sigma), and express PD1 with the highest abundance on the third day, so it may be used for a binding experiment of PD-1 antibody and PD1 naturally expressed by the activated lymphocytes.

[0083] After PBMC was obtained from fresh human peripheral blood by a lymphatic separation fluid gradient centrifugation method, the density was adjusted to 1×10.sup.6 cells/ml and then inoculated into T75. At the same time, PHA-L (Sigma) at a final concentration of 1 μg/ml was added to stimulate lymphocyte proliferation. After standing in an incubator supplied with 37° C. and 5% CO.sub.2 for 3 days, cell suspension was taken out and centrifuged to remove the supernatant. Cells were resuspended in a buffer (PBS containing 3% BSA), and added into a 96-well U-shaped plate at a density of 2*10.sup.5 cells/well. And then the anti-PD1 antibody that prepared for a total of 10 concentration gradients (started from 30 μg/ml, diluted in a 3-fold gradient) was added. After incubation at 4° C. for 30 minutes, the plate was centrifuged at 300 g for 5 minutes, cells were washed once with the buffer, A PE-labeled goat anti-human IgG fluorescent antibody (Biolegend) was added, and incubated at 4° C. for 30 minutes; after incubation, the cells were washed once by centrifugation resuspended in PBS, and analyzed by a CytoFlex flow cytometer, to detect the amount of the antibody bound to PBMC. Results were shown in Table 1. The anti-PD1 antibody may bind to the activated lymphocytes with high affinity.

Embodiment 4: Binding specificity of anti-PD-1 mouse monoclonal antibody

[0084] To verify the specificity of the antibody binding to PD-1, the binding assay of anti-PD-1 mouse monoclonal antibody with four different CD28 family member proteins was conducted. According to standard enzyme-linked immunosorbent assay (ELISA) method, PD-1, CD28, CTLA-4, and ICOS (ACRO) were coated at a concentration of 1 μg/ml on an ELISA plate, and the anti-human PD-1 mouse monoclonal antibody at a concentration of 10 μg/ml was added. Anti-mouse IgG coupled with peroxidase (HRP) was used as a secondary antibody (Sigma). The color was developed by TMB, and after reaction termination, the absorbance was read by a microplate reader. Results were shown in Table 2. The anti-PD-1 mouse monoclonal antibodies PD-1-76-C2, PD-1-97-C2 and PD-1-112-C2 may all specifically bind to PD-1, but not other family members of CD28.

Embodiment 5: Determination of anti-human PD-1 mouse monoclonal antibody affinity by biolayer interference (BLI) method

[0085] ForteBio (Octet Qke) affinity determination: by loading a PD-1-his (ACRO) recombinant protein at a concentration of 5 μg/ml on an HISIK biosensor for 120 seconds, and then equilibrating the loaded sensor in a standard buffer (PBST, PBS+0.02% Tuween20) for 120 seconds, after that, the sensor was transferred to an anti-PD-1 mouse monoclonal antibody dilution for 180 seconds to measure the binding rate, and then transferred to the standard buffer for 20 minutes to measure the dissociation rate. Finally, a kinetic model was used for analysis, and processed data was shown in Table 3.

Embodiment 6: Anti-PD-1 mouse monoclonal antibody blocks the binding of ligand PD-L1/PD-L2 to CHO-hPD1

[0086] The ability of the anti-PD-1 mouse monoclonal antibody to block the binding of the ligand to CHO-hPD1 cells was analyzed by a flow cytometer. The ligand proteins used in the experiment were fusion proteins that consists of recombinant PD-L1/PD-L2 extracellular domain and human IgG1 Fc fragment fusion proteins: PD-L1-hFc (ACRO), and PD-L2-hFc (ACRO).

[0087] CHO-hPD1 cells were resuspended in a buffer (PBS containing 3% BSA), the density was adjusted to 2×10.sup.6 cells/ml, then cell suspension was added to a 96-well U-shaped plate in 100 μl/well, The plate was centrifuged at 300 g for 5 minutes, and the supernatant was removed.

[0088] The subsequent process may be divided into two blocking modes: mode 1, PD-L1-hFc/PD-L2-hFc at a concentration of 3 μg/ml was added to cell wells, and incubated at 4° C. for 30 minutes, and then the anti-PD1 antibody that prepared for a total of 10 concentration gradients (started from 30 μg/ml, diluted in a 3-fold gradient) was added, the anti-PD1 antibody that prepared for a total of 10 concentration gradients (started from 30 μg/ml, diluted in a 3-fold gradient) was added to cell wells, after incubation at 4° C. for 30 minutes, the PD-L1-hFc/PD-L2-hFc protein at a concentration of 3 μg/ml was added, and incubated at 4° C. for another 30 minutes.

[0089] The plate was centrifuged at 300 g for 5 minutes, cells were washed once with a buffer, a PE-labeled goat anti-human IgG fluorescent antibody (Biolegend) was added, and incubated at 4° C. for 30 minutes. After the cells were washed once by centrifugation, the cells were resuspended in PBS, and then analyzed by a Cyto Flex flow cytometer, to detect the amount of the ligand protein bound to the cells, and the IC.sub.50 value of the PD-1 antibody blocking was calculated. Results were shown in Table 4, and three anti-PD-1 mouse monoclonal antibodies: PD-1-76-C2, PD-1-97-C2, and PD-1-112-C2 may all effectively block the binding of PD-L1/PD-L2 to cell CHO-PD1.

Embodiment 7: Effect of anti-PD-1 antibody on cytokine release from SEB-stimulated PBMC cell

[0090] In this embodiment, PBMCs cultured overnight were stimulated by addition of superantigen Staphylococcus Aureus enterotoxin B (SEB), in the presence or absence of the anti-PD-1 antibody, the secretion of cytokines was detected.

[0091] After fresh PBMCs were resuspended in an X-VIVO 15 culture medium (LONZA) containing 10% FBS. The cells were added to a T25 culture flask, and cultured stationarily overnight at 37° C. and 5% CO.sub.2. Suspended cells were taken on the next day, and after being centrifuged, they were resuspended in a fresh X-VIVO (containing 10% FBS) culture medium, and added to a 96-well flat plate with a density of 1×10.sup.5 cells per well. And then a SEB superantigen (Toxin technology) at a final concentration of 200 ng/ml was added. At the same time, the anti-PD-1 antibodies of different concentrations were added, isotype control (mIgG1 isotype control antibody (Biolegend); and hIgG4 isotype control antibody (Biolegend)) and negative control with no antibody were set additionally. After 3 days, constant supernatants were taken from a sample well, and the level of IL-2/IFN-γ was measured with an IL2/IFN-γ Human Uncoated ELISA Kit (eBioscience), and results were shown in FIGS. 1-3, the secretion of IL-2/IFN-γ was improved by the anti-PD-1 antibody in a concentration-dependent manner. These results indicated that in SEB superantigen-stimulated PBMCs, the anti-PD-1 antibodies: PD-1-76-C2, PD-1-97-C2, and PD-1-112-C2 could further promote T cells to secrete the cytokines.

Embodiment 8: Effect of anti-PD-1 antibody in mixed lymphocyte reaction

[0092] In the mixed lymphocyte reaction (MLR), the presence or absence of the anti-PD-1 antibody may demonstrate the proliferation of T cells and the level of cytokines secreted by T cells when the PD1 signal is blocked.

[0093] CD14.sup.+monocytes were isolated from fresh PBMCs with CD14 MicroBeads, human (Miltenyi). In the presence of GM-CSF/IL-4, after 6 days of induction, TNF-α was added, and 3 days later, immature dendritic cells (DC) were induced to mature DC; On the day of the experiment, T cells in PBMCs were isolated with EasySep™ Human T Cell Enrichment Kit (StemCell), 1×10.sup.4 DC cells were mixed and cultured with 1×10.sup.5 T cells, and different concentration gradients of anti-PD-1 antibodies were added to the mixed cells. Isotype control antibodies (mIgG1 isotype control antibody and hIgG4 isotype control antibody (Biolegend)) and no antibody control well were set additionally. After 3 days of mixed culture, supernatants were taken for detection of IL-2 production, and at day 5, the supernatants were taken for detection of IFN-γ production. Results were shown in FIGS. 4-9, the anti-PD-1 antibodies: PD-1-76-C2, PD-1-97-C2, and PD-1-112-C2 in the MLR experiment, may block the binding of PD1 to the ligand in an antibody concentration-dependent mode, and inhibit the PD1 signaling pathway, thereby the proliferation of T cells was promoted, and the secretion of IL-2 and IFN-γ was promoted.

Embodiment 9: Candidate antibody variable region sequence

[0094] Candidate antibody hybridoma cells were cultured to 110.sup.7 cells, it was centrifuged at 300′g for 10 minutes, and RNA was extracted using an MagExtractor .sup.®-RNA-kit (Toyobo/NPK-201F). The RNA was denatured and then reverse-transcribed to obtain cDNA. PCR was performed separately for heavy and light chains with the cDNA as a template, A Light Chain gene was amplified with Universal Primer A Mix (U PM), Nested Universal Primer A (NUP) and mkR primers, and a Heavy Chain gene was amplified with Universal Primer A Mix (UPM), Nested Universal Primer A (NUP) and mHR primers. Herein, the primer pair of Light Chain amplifies ‘a target band of about 0.8 KB, and the primer pair of Heavy Chain amplifies a target band of about 1.4 KB.

TABLE-US-00001 Universal Primer A Mix (UPM): (SEQ ID NO: 3) 5′>CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAG T<3′; Nested Universal Primer A (NUP): (SEQ ID NO: 4) 5′>AAGCAGTGGTATCAACGCAGAGT<3′ mkR: (SEQ ID NO: 5) 5′>TTTTCCTTTTGAATTCCTAAGACTCATTCCTGTTGAAGC<3′; mHR: (SEQ ID NO: 6) 5′>TTTTCCTTTTGAATTCTCATTTACCAGGAGAGTGGGA<3′.

[0095] The total reaction volume was 50 μL, containing 25 μL of PCR 2x buffer, 1.sub.IA. of DNA template, 1 μL of KOD DNA Polymerase, 10 μL of dNTP (25 mM), and 1 μL of each specific upper or lower primer (the final concentration is 200 nmol/L), and sterilized double distilled water was added to a total volume of 50 μL.

[0096] The reaction conditions were pre-denaturation at 94° C. for 5 minutes, followed by denaturation at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and extension at 72° C. for 40 seconds, and there was a total of 30 cycles.

[0097] After sequencing amplified products, variable regions of the heavy and light chains of hybridoma clones 76, 97 and 112 were obtained as follows: [0098] PD-1-76-C2 [0099] Heavy chain variable region: SEQ ID NO: 7 [0100] HCDR1: SEQ ID NO: 8 [0101] HCDR2: SEQ ID NO: 9 [0102] HCDR3: SEQ ID NO: 10 [0103] PD-1-97-C2 [0104] Heavy chain variable region: SEQ ID NO: 11 [0105] HCDR1: SEQ ID NO: 12 [0106] HCDR2: SEQ ID NO: 13 [0107] HCDR3: SEQ ID NO: 14 [0108] PD-1-112-C2 [0109] Heavy chain variable region: SEQ ID NO: 15 [0110] HCDR1: SEQ ID NO: 16 [0111] HCDR2: SEQ ID NO: 17 [0112] HCDR3: SEQ ID NO: 18 [0113] PD-1-76-C2 [0114] Light chain variable region: SEQ ID NO: 19 [0115] LCDR1: SEQ ID NO: 20 [0116] LCDR2: SEQ ID NO: 21 [0117] LCDR3: SEQ ID NO: 22 [0118] PD-1-97-C2 [0119] Light chain variable region: SEQ ID NO: 23 [0120] LCDR1: SEQ ID NO: 24 [0121] LCDR2: SEQ ID NO: 25 [0122] LCDR3: SEQ ID NO: 26 [0123] PD-1-112-C2 [0124] Light chain variable region: SEQ ID NO: 27 [0125] LCDR1: SEQ ID NO: 28 [0126] LCDR2: SEQ ID NO: 29 [0127] LCDR3: SEQ ID NO: 30

TABLE-US-00002 TABLE 1 FCM, EC.sub.50, nM Antibody to be tested CHO-hPD1 CHO-cynoPD1 PBMC (activated) PD-1-76-02 0.583 0.576 0.02 PD-1-97-C2 0.745 0.578 1.033 PD-1-112-C2 0.739 0.463 0.109

TABLE-US-00003 TABLE 2 Antibody Elisa, OD value to be Human Human Human Human tested PD-1-hFc CD28-hFc ICOS-hFc CTLA4-hFc PD-1-76-C2 2.457 0.0616 0.076 0.1457 PD-1-97-C2 2.371 0.0606 0.0636 0.1293 PD-1-112-C2 2.1213 0.0625 0.062 0.131

TABLE-US-00004 TABLE 3 Antibody to be tested Kon (1/Ms) Kdis (1/s) KD (M) Opdivo (ABA0333) 1.38E+06 3.63E−06 2.62E−12 PD-1-97-C2 4.68E+05 <1.0E−07 <1.0E−12 PD-1-112-C2 7.32E+05 3.18E−05 4.35E−11 PD-1-76-C2 7.71E+05 <1.0E−07 <1.0E−12

TABLE-US-00005 TABLE 4 FCM, IC.sub.50, nM Antibody Blocking CHO-hPD1 Blocking CHO-hPD1 to be and PD-L1 and PD-L2 tested Mode 1 Mode 2 Mode 1 Mode 2 PD-1-76-C2 2.28 1.4 4.669 3.112 PD-1-97-C2 2.218 1.621 7.539 3.493 PD-1-112-C2 2.567 1.546 4.614 3.727