SELF-ASSEMBLED NANOSTRUCTURES OF ELASTIN-AND RESILIN-BASED BLOCK COPOLYPEPTIDES WITH STIMULI RESPONSIVENESS AND RESILIENCE FOR DRUG DELIVERY SYSTEM, TISSUE ENGINEERING AND REGENERATIVE MEDICINE AND METHODS OF PREPARING THE SAME

Abstract

The present disclosure relates to a self-assembled nanostructure of an elastin- and resilin-based block copolypeptide with stimuli responsiveness and resilience for drug delivery, tissue engineering and regenerative medicine, a method for preparing the same and application thereof. The diblock polypeptide reversibly forms a self-assembled micelle structure in response to temperature stimuli and a hydrogel prepared using the triblock polypeptide undergoes reversible sol-gel or gel-sol transition in response to temperature stimuli and exhibits enhanced mechanical strength due to chemical crosslinkages between tyrosine residues. With such superior properties, the diblock/triblock polypeptide of the present disclosure can be used for drug delivery systems, scaffolds for tissue engineering and kits for tissue or organ regeneration.

Claims

1. A resilin-based polypeptide (RBP) exhibiting a phase transition behavior, which consists of an amino acid sequence represented by SEQ ID NO:44.

2. The resilin-based polypeptide (RBP) according to claim 1, wherein a gene sequence encoding the resilin-based polypeptide is SEQ ID NO:42.

3. A diblock polypeptide with stimuli responsiveness, represented by Formula 1, which consists of: a resilin-based polypeptide block; and a polypeptide block exhibiting a phase transition behavior, which is connected to one end of the resilin-based polypeptide block:
[hydrophobic EBP].sub.m-[RBP].sub.n[Formula 1] wherein n or m is independently an integer 1 or greater, the [RBP] is a resilin-based polypeptide block consisting of an amino acid sequence represented by SEQ ID NO:44 and the [hydrophobic EBP] is a [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block of SEQ ID NO:1, a [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block of SEQ ID NO:2 or an [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block of SEQ ID NO:3 (wherein X is any natural or artificial amino acid except proline which is selected as the pentapeptide VPGXG, VPAXG or IPAXG is repeated).

4. The diblock polypeptide with stimuli responsiveness according to claim 3, wherein the [hydrophobic EBP] is a [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block of SEQ ID NO:1, wherein each X of the repeating pentapeptide consists of: A (Ala), G (Gly) and I (Ile) at a ratio of 1:4:1 [SEQ ID NO:23]; K (Lys), G (Gly) and I (Ile) at a ratio of 1:4:1 [SEQ ID NO:25]; D (Asp), G (Gly) and I (Ile) at a ratio of 1:4:1 [SEQ ID NO:27]; E (Glu), G (Gly) and I (Ile) at a ratio of 1:4:1 [SEQ ID NO:29]; or G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:31].

5. The diblock polypeptide with stimuli responsiveness according to claim 3, wherein the [hydrophobic EBP] is a [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block of SEQ ID NO:2, wherein each X of the repeating pentapeptide consists of: G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:32]; K (Lys), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:33]; D (Asp), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:34]; K (Lys) and F (Phe) at a ratio of 3:3 [SEQ ID NO:35]; D (Asp) and F (Phe) at a ratio of 3:3 [SEQ ID NO:36]; H (His), A (Ala) and I (Ile) at a ratio of 3:2:1 [SEQ ID NO:37]; H (His) and G (Gly) at a ratio of 5:1 [SEQ ID NO:38]; or G (Gly), C(Cys) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:39].

6. The diblock polypeptide with stimuli responsiveness according to claim 3, wherein the [hydrophobic EBP] is an [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block of SEQ ID NO:3, wherein each X of the repeating pentapeptide consists of: G (Gly), A (Ala) and F (Phe) at a ratio of 1:4:1 [SEQ ID NO:40]; or G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:41].

7. The diblock polypeptide with stimuli responsiveness according to claim 3, wherein the diblock polypeptide undergoes dynamic change wherein a [RBP] block core-[hydrophobic EBP] block shell micelle structure is formed through self-assembly at or below the lower critical solution temperature of the [hydrophobic EBP], an aggregate is formed at or above the lower critical solution temperature of the [hydrophobic EBP] and a [hydrophobic EBP] block core-[RBP] block shell micelle structure is formed at or above the upper critical solution temperature of the [RBP].

8. The diblock polypeptide with stimuli responsiveness according to claim 7, wherein the dynamic change is reversible in response to temperature.

9. A drug delivery composition comprising the diblock polypeptide according to claim 3.

10. A triblock polypeptide with stimuli responsiveness, represented by Formula 2 which consists of: a resilin-based polypeptide block; and polypeptide blocks exhibiting a phase transition behavior, which are connected to both ends of the resilin-based polypeptide block:
[hydrophobic EBP].sub.m-[RBP].sub.n-[hydrophobic EBP].sub.m[Formula 2] wherein n or m is independently an integer 1 or greater, the [RBP] is a resilin-based polypeptide block comprising an amino acid sequence represented by SEQ ID NO:44 and the [hydrophobic EBP] is a [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block of SEQ ID NO:1, a [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block of SEQ ID NO:2 or an [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block of SEQ ID NO:3 (wherein X is any natural or artificial amino acid except proline which is selected as the pentapeptide VPGXG, VPAXG or IPAXG is repeated).

11. The triblock polypeptide with stimuli responsiveness according to claim 10, wherein the [hydrophobic EBP] is a [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block of SEQ ID NO:1, wherein each X of the repeating pentapeptide consists of: A (Ala), G (Gly) and I (Ile) at a ratio of 1:4:1 [SEQ ID NO:23]; K (Lys), G (Gly) and I (Ile) at a ratio of 1:4:1 [SEQ ID NO:25]; D (Asp), G (Gly) and I (Ile) at a ratio of 1:4:1 [SEQ ID NO:27]; E (Glu), G (Gly) and I (Ile) at a ratio of 1:4:1 [SEQ ID NO:29]; or G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:31].

12. The triblock polypeptide with stimuli responsiveness according to claim 10, wherein the [hydrophobic EBP] is a [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block of SEQ ID NO:2, wherein each X of the repeating pentapeptide consists of: G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:32]; K (Lys), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:33]; D (Asp), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:34]; K (Lys) and F (Phe) at a ratio of 3:3 [SEQ ID NO:35]; D (Asp) and F (Phe) at a ratio of 3:3 [SEQ ID NO:36]; H (His), A (Ala) and I (Ile) at a ratio of 3:2:1 [SEQ ID NO:37]; H (His) and G (Gly) at a ratio of 5:1 [SEQ ID NO:38]; or G (Gly), C(Cys) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:39].

13. The triblock polypeptide with stimuli responsiveness according to claim 10, wherein the [hydrophobic EBP] is an [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block of SEQ ID NO:3, wherein each X of the repeating pentapeptide consists of: G (Gly), A (Ala) and F (Phe) at a ratio of 1:4:1 [SEQ ID NO:40]; or G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2 [SEQ ID NO:41].

14. A hydrogel prepared by a process comprising: a step of applying temperature stimuli to the triblock polypeptide according claim 11; and a step of forming crosslinkages between the triblock polypeptide in response to the temperature stimuli.

15. The hydrogel according to claim 14, wherein the crosslinkages are physical crosslinkages formed between the [hydrophobic EBP] block at or above the lower critical solution temperature of the [hydrophobic EBP].

16. The hydrogel according to claim 14, wherein the hydrogel undergoes reversible sol-gel or gel-sol transition in response to temperature stimuli.

17. The hydrogel according to claim 14, wherein the hydrogel has enhanced mechanical strength due to chemical crosslinkages between the tyrosine residues of the resilin-based polypeptide block.

18. A composition for drug delivery comprising the hydrogel according to claim 14.

19. A scaffold for tissue engineering comprising the hydrogel according to claim 14.

20. A kit for tissue or organ regeneration comprising the hydrogel according to claim 14.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0087] FIGS. 1A-1D schematically describes cloning of RBP, monoblock, diblock and triblock polypeptide genes. FIG. 1A illustrates an example for RDL, an adapter sequence containing AcuI and BseRI restriction enzyme sites was inserted into pET-21(a). The RBP nucleotide cassette (with AcuI and BseRI sticky ends) was inserted into the BseRI-restricted modified pET-21(a). FIG. 1B illustrates an example of the RBP gene multimerized by RDL. The vector was linearized by XbaI and BseRI and an insert was restricted by XbaI and AcuI. After ligation, the same procedure was repeated until the desired gene length was achieved. FIG. 1C illustrates an example of a diblock polypeptide cloned by inserting the EBPP gene into a RBP-containing plasmid (linearized by XbaI and BseRI). FIG. 1D illustrates an example of a seamless triblock polypeptide. In the first step, a diblock was synthesized by inserting the EBPP gene into a RBP plasmid. In the second step, a triblock polypeptide, EBPP-RBP-EBPP, synthesized by inserting the EBPP gene (restricted by XbaI and AcuI) into the plasmid containing the diblock.

[0088] FIGS. 2A-2B shows the agarose gel electrophoresis images of FIG. 2A RBP[m-Dros].sub.n and FIG. 2B RBP[Dros].sub.n gene libraries according to the present disclosure. The left lane shows size markers and the expected size of each RBP[m-Dros].sub.n gene is shown on the right side. The number of repeating units encoded by each gene is labeled above each lane.

[0089] FIGS. 3A-3D shows the SDS-PAGE result of RBPs according to the present disclosure. FIG. 3A illustrates an example of the result of thermal profiling of RBP[m-Dros].sub.24. FIG. 3B illustrates an example of the result of thermal profiling of RBP[m-Dros].sub.30. FIG. 3C illustrates an example of the result of thermal profiling of RBP[Dros].sub.8. The lane (M) shows size markers in kDa unit and the expected molecular weights are labeled on the right side. FIG. 3D describes an example of the thermal profile of RBP[Dros].sub.16 at 25, 50, and 100 M in PBS. The thermal profile data were collected by heating the protein solution from 10 C. to 90 C. at a heating rate of 1 C./min.

[0090] FIGS. 4A-4D shows a result of analyzing the characteristics of RBP[m-Dros].sub.n. The result of thermal profiling of FIG. 4A RBP[m-Dros].sub.24, FIG. 4B RBP[m-Dros].sub.30. The thermal profile data were collected by cooling the 25 M solution of each block in PBS from 50 C. to 10 C. at a cooling rate of 1 C./min. The DLS measurement result of FIG. 4C RBP[m-Dros].sub.24 and FIG. 4D RBP[m-Dros].sub.30. The hydrodynamic radius (R.sub.h) of each blocks (15 M) at a scattering angle of 90 as a function of temperature was measured from 30 C. to 0 C.

[0091] FIGS. 5A-5C schematically shows RBP[m-Dros].sub.n and EBPP-RBP[m-Dros].sub.n polypeptides with their transition behavior. FIG. 5A illustrates an example of the RBP[m-Dros].sub.n monoblock with tyrosine residues shows reversible thermal transition. The RBP is completely soluble above the UCST and is aggregated when cooled below the UCST. FIG. 5B illustrates an example of the EBPP-RBP[m-Dros].sub.n diblock polypeptide with hydrophilic RBP and hydrophobic EBPP self-assemble into a micelle structure. Below the T.sub.t of EBPP, the RBP is aggregated to form a core of the micelle whereas the EBP in solubilized state forms a shell. Above the T.sub.t of EBPP, the EBPP is aggregated as a whole through thermal transition. At very high temperatures of 80 C., the RBP becomes soluble and a micelle is formed again. This thermal responsiveness of the diblock peptide is reversible. FIG. 5C illustrates an example of the EBPP-RBP-EBPP triblock polypeptide has a middle RBP block containing tyrosine residues which is flanked by hydrophobic EBPP blocks. Below the T.sub.t of EBPP, the EBP-RBP-EBPP triblock polypeptide is in solubilized state. Above the T.sub.t of EBPP, a physically crosslinked protein hydrogel is formed through thermally triggered reversible gelation. Chemical crosslinkages formed between the tyrosine residues on the middle block may enhance the mechanical properties of the hydrogel.

[0092] FIG. 6A and FIG. 6C are agarose gel and SDS-PAGE images of diblock polypeptides having EBPP[G.sub.1A.sub.3F.sub.2].sub.6. Lane 1: RBP[m-Dros].sub.3-EBPP[G.sub.1A.sub.3F.sub.2].sub.6, lane 2: RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.6, lane 3: RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.6, lane 4: RBP[m-Dros].sub.24-EBPP[G.sub.1A.sub.3F.sub.2].sub.6. FIG. 6B and FIG. 6D are agarose gel and SDS-PAGE images of triblock polypeptides. Lane 1: EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.12, lane 2: EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.12, lane 3: EBPP[G.sub.1A.sub.3F.sub.2].sub.24-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.24, lane 4: EBPP[G.sub.1A.sub.3F.sub.2].sub.24-RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.24. Lane (M) shows size markers and the expected molecular weight is labeled on the right side.

[0093] FIGS. 7A-7B shows a result of analyzing the characteristics of EBPP[G.sub.1A.sub.3F.sub.2].sub.6 diblock polypeptides having RBP[m-Dros] in PBS (10 mM, pH 7.4). In the example of FIG. 7A, the thermal profile data were obtained by heating from 10 C. to 90 C. at a heating rate of 1 C./min. A micelle structure having RBP[m-Dros] as a core was formed below the LOST of EBPP[G.sub.1A.sub.3F.sub.2].sub.6 and an aggregate was formed as a whole above the LOST of EBPP[G.sub.1A.sub.3F.sub.2].sub.6. At 80 C., all the diblock polypeptides except the EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.3 reversibly formed micelles due to solubilization of RBP[m-Dros] above the UCST. FIG. 7B shows a result of measuring the size of EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.24 at 25 C. and 85 C. by DLS.

[0094] FIGS. 8A-8B shows the thermal profiles of RBP[m-Dros].sub.n, FIG. 8A illustrates an example of diblock polypeptide and FIG. 8B illustrates an example of triblock polypeptide having EBPP[G.sub.1A.sub.3F.sub.2].sub.12. The thermal transition pattern was the same in the two plots. The polypeptides were in solubilized state at low temperature and were aggregated as the temperature was increased.

[0095] FIG. 9A illustrates an example of copper-stained SDS-PAGE gel (15%) and FIG. 9B illustrates an example of the thermal profile images of the EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPPI[G.sub.1A.sub.3F.sub.2].sub.12 triblock polypeptide. Lane M: size marker, lane 1: triblock polypeptide. The thermal profile data were measured in PBS (10 mM, pH 7.4) with a sample concentration of 25 M as a function of temperature while heating from 5 C. to 80 C. at a heating rate of 1 C./min.

[0096] FIGS. 10A-10D shows the photographic images of EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 in 10 mM PBS at pH 7.4 as a function of temperature when sequentially incubated at 4 C. FIG. 10A, 37 C. FIG. 10B and FIGS. 10C and 4 C. FIG. 10D. Its gel-sol transition behavior was reversible as the temperature was decreased from 37 C. to 4 C. which indicated the reversibility of physically crosslinked gel.

[0097] FIGS. 11A-11B shows a result of oscillatory rheological measurement for 35 wt % of EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 in 10 mM PBS at pH 7.4. The rheological behavior is shown FIG. 11A as a function of temperature at a heating rate of 1 C./min (strain 2%, 1 rad/s) and in FIG. 11B as a function of frequency (strain 2%, 10 C.).

[0098] FIGS. 12A-12D shows a result of oscillatory rheological measurement for 25 wt % of EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPPI[G.sub.1A.sub.3F.sub.2].sub.12 in PBS (10 mM, pH 7.4). FIG. 12A illustrates an example of the amplitude sweep (0.2-20% at a frequency of 1 rad/s). FIG. 12B illustrates an example of the frequency sweep (0.1-10 rad/s at 2% strain). FIG. 12C and FIG. 12D show the rheological behavior as a function of temperature at a heating and cooling rate of 1 C./min (strain 2%, 1 rad/s).

DETAILED DESCRIPTION OF THE INVENTION

[0099] Hereinafter, specific examples are presented to help understanding the present disclosure. However, the following examples are given only to help better understanding of the present disclosure and the present disclosure is not limited by the examples.

EXAMPLES

Example 1. Materials

[0100] The pET-21a vector and BL21 (DE3) E. coli cells were obtained from Novagen Inc. (Madison, Wis., US). Top10 competent cells were obtained from Invitrogen (Carlsbad, Calif., US). Oligonucleotides were synthesized chemically at Cosmo Gene Tech (Seoul, South Korea). The FastAP thermosensitive alkaline phosphatase and restriction endonuclease including BamHI and XbaI were purchased from Fermentas (Ontario, Canada). Other restriction endonuclease including BseRI and AcuI and all other restriction enzymes were obtained from New England Biolabs (Ipswich, Mass., US). DNA miniprep, gel extraction and PCR purification kits were obtained from Geneall Biotechnology (Seoul, South Korea). Dyne Agarose High was obtained from Dyne Bio, Inc. (Seongnam, South Korea). All the Top10 cells were grown in TB DRY media obtained from MO Bio Laboratories, Inc. (Carlsbad. Calif., US). All the BL21 (DE3) cells were grown in CircleGrow media obtained from MP Biomedicals (Solon, Ohio, US). Ready Gel (Tris-HCl 2-20%) as a precast gel was purchased from Bio-Rad (Hercules, Calif., US). Phosphate-buffered saline (PBS, pH 7.4), ampicillin and polyethyleneimine (PEI) were obtained from Sigma-Aldrich (St Louis, Mo.).

Example 2. Notation for Different EBP Blocks and their Block Polypeptides

[0101] Different EBPs with a pentapeptide repeating unit, Val-Pro-(Gly or Ala)-X.sub.aa-Gly [VP(G or A)XG], where X.sub.aa can be any amino acid except Pro are named as follows. First, the pentapeptide repeat of Val-Pro-Ala-X.sub.aa-Gly (VPAXG) with plasticity is defined as an elastin-based polypeptide with plasticity (EBPP) while the pentapeptide repeat of Val-Pro-Gly-X.sub.aa-Gly (VPGXG) being called an elastin-based polypeptide with elasticity (EBPE). And, the pentapeptide repeat of Ile-Pro-Ala-X.sub.aa-Gly (IPAXG) wherein the first amino acid is substituted with Ile is defined as an elastin-based polypeptide with plasticity and substituted with Ile (EBPPI). Secondly, [X.sub.iY.sub.jZ.sub.k].sub.n represents that the bracketed capital letters are single letter amino acid codes of the guest residues, i.e. the amino acid at the fourth position (X.sub.aa or X) in the EBP pentapeptide, and their corresponding subscripts denote the ratio of that guest residue in the EBP monomer gene as the repeating unit. The subscript number n of [X.sub.iY.sub.jZ.sub.k].sub.n indicates the total repeating number of SEQ ID NO:1 [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG], SEQ ID NO:2 [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] or SEQ ID NO:3 [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] in the EBP. For example, EBPP[G.sub.1A.sub.3F.sub.2].sub.12 is an EBPP block that contains 12 repeats of SEQ ID NO:2 [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG], in which the ratio of Gly, Ala and Phe at the fourth guest residue position (X.sub.aa) is 1:3:2.

[0102] Two RBPs having different sequences are named as RBP[Dros].sub.n and RBP[m-Dros].sub.n, where n represents the number of repeating unit. Both sequences are derived from Drosophila exon 1 and the RBP repeating unit contains two repeating sequences of resilin. For RBP[Dros].sub.n, the repeating sequences are the same as reported in previous studies while, for RBP[m-Dros].sub.n, the two repeating sequences of resilin are combined with slight modifications to get the desired properties such as temperature responsiveness and high resilience. The EBPP-RBP diblock and triblock polypeptides are named by the composition of each block in square brackets with a hyphen between blocks such as EBPP[G.sub.1A.sub.3F.sub.2].sub.n-RBP[Dros/m-Dros].sub.n for a diblock and EBPP[G.sub.1A.sub.3F.sub.2].sub.n-RBP[Dros/m-Dros].sub.n-EBPP[G.sub.1A.sub.3F.sub.2].sub.n for a triblock.

Example 3. Preparation of Modified pET-21a Vector for Seamless Gene Cloning

[0103] As shown in FIG. 1A, pET-21a(+) was modified to introduce two unique restriction sites BseRI and AcuI for RDL of EBP and RBP. 4 g of the pET-21a(+) vector was digested with 50 U of XbaI and 50 U of BamHI in FastDigest buffer for 20 minutes at 37 C. The 5 end was dephosphorylated with 10 U of CIP in NEB 3 buffer for 1 hour at 37 C. The restricted plasmid DNA was purified using the PCR purification kit and was eluted in 40 L of distilled deionized water. Two oligonucleotide sequences with XbaI and BamHI sticky ends having BseRI and AcuI restriction sites having XbaI- and BamHI-compatible sticky ends were designed: 5-ctagaaataattttgtttaactttaagaa ggaggagtacatatgggcta ctgataatgatcttcag-3 and 5-gatcctgaagatcattatcagtagcccatatgtactcctcc ttcttaaagttaaacaaaattattt-3. This oligonucleotide DNA also contains Tyr for spectrophotometric detection of proteins and start (Met) and stop codons. 50 L of the two oligonucleotides were annealed at 2 M concentration of each nucleotide in T4 DNA ligase buffer at 95 C. for 2 minutes and then slowly cooled down to the room temperature over 3 hours. The modified cloning insert with XbaI and BamHI stick ends was inserted into the linearized pET-21a(+) vector by incubating with 20 pmol of annealed dsDNA and 0.1 pmol of the linearized vector in T4 DNA ligase buffer containing T4 DNA ligase at 16 C. for 30 minutes. The ligated vector was introduced into chemically transformed Top 10 competent cells, followed by plating on SOC (Super Optimal Broth with catabolite repression) plates supplemented with 50 g/mL of ampicillin. The insert sequence was confirmed by DNA sequencing.

Example 4. Monomer Gene Synthesis and Oligomerization for RBP and EBP

[0104] The EBP sequences with a pentapeptide repeating unit, Val-Pro-(Gly or Ala)-X.sub.aa-Gly, where the fourth residues are varied at different molar ratios were designed at DNA level to optimize T.sub.t below the physiological temperature. The DNA and amino acid sequences of the EBPs with various pentapeptide repeating units are shown in Table 1 and Table 2, respectively.

TABLE-US-00001 TABLE1 GenesequencesofEBPlibraries EBP EBPE[A.sub.1G.sub.4I.sub.1] GTCCCAGGTGGAGGTGTACCCGGCGCGGGTGTCCCAGGTGGAGGT (SEQIDNO:4) GTACCTGGGGGTGGGGTCCCTGGTATTGGCGTACCTGGAGGCGGC EBPP[A.sub.1G.sub.4I.sub.1] GTTCCAGCTGGCGGTGTACCTGCTGCTGCTGTTCCGGCCGGTGGT (SEQIDNO:5) GTTCCGGCGGGCGGCGTGCCTGCAATAGGAGTTCCCGCTGGTGGC EBPE[K.sub.1G.sub.4I.sub.1] GTTCCGGGTGGTGGTGTTCCGGGTAAAGGTGTTCCGGGTGGTGGT (SEQIDNO:6) GTTCCGGGTGGTGGTGGTGTTCCGGGTATCGGTGTTCCGGGTGGC EBPP[K.sub.1G.sub.4I.sub.1] GTTCCGGCGGGTGGTGTTCCGGCGAAAGGTGTTCCGGCGGGTGGT (SEQIDNO:7) GTTCCGGCGGGTGGTGTTCCGGCGATCGGTGTTCCGGCGGGTGGC EBPE[D.sub.1G.sub.4I.sub.1] GTTCCGGGTGGTGGTGTTCCGGGTGATGGTGTTCCGGGTGGTGGT (SEQIDNO:8) GTTCCGGGTGGTGGTGGTGTTCCGGGTATCGGTGTTCCGGGTGGC EBPP[D.sub.1G.sub.4I.sub.1] GTTCCGGCGGGTGGTGTTCCGGCGGATGGTGTTCCGGCGGGTGGT (SEQIDNO:9) GTTCCGGCGGGTGGTGTTCCGGCGATCGGTGTTCCGGCGGGTGGC EBPE[E.sub.1G.sub.4I.sub.1] GTTCCGGGTGGTGGTGTTCCGGGTGAAGGTGTTCCGGGTGGTGGT (SEQIDNO:10) GTTCCGGGTGGTGGTGGTGTTCCGGGTATCGGTGTTCCGGGTGGC EEPP[E.sub.1G.sub.4I.sub.1] GTTCCGGCGGGTGGTGTTCCGGCGGAAGGTGTTCCGGCGGGTGGT (SEQIDNO:11) GTTCCGGCGGGTGGTGTTCCGGCGATCGGTGTTCCGGCGGGTGGC EBPE[G.sub.1A.sub.3F.sub.2] GTCCCGGGTGCGGGCGTGCCGGGATTTGGAGTTCCGGGTGCGGGT (SEQIDNO:12) GTTCCAGGCGGTGGTGTTCCGGGCGCGGGCGTGCCGGGCTTTGGC EBPP[G.sub.1A.sub.3F.sub.2] GTGCCGGCGGCGGGCGTTCCAGCCTTTGGTGTGCCAGCGGCGGGA (SEQIDNO:13) GTTCCGGCCGGTGGCGTGCCGGCAGCGGGCGTGCCGGCTTTTGGC EBPP[K.sub.1A.sub.3F.sub.2] GTGCCGGCGGCGGGCGTTCCAGCCTTTGGTGTGCCAGCGGCGGGA (SEQIDNO:14) GTTCCGGCCAAAGGCGTGCCGGCAGCGGGCGTGCCGGCTTTTGGC EBPP[D.sub.1A.sub.3F.sub.2] GTGCCGGCGGCGGGCGTTCCAGCCTTTGGTGTGCCAGCGGCGGGA (SEQIDNO:15) GTTCCGGCCGATGGCGTGCCGGCAGCGGGCGTGCCGGCTTTTGGC EBPP[K.sub.3F.sub.3] GTTCCAGCGTTTGGCGTGCCAGCGAAAGGTGTTCCGGCGTTTGGG (SEQIDNO:16) GTTCCCGCGAAAGGTGTGCCGGCCTTTGGTGTGCCGGCCAAAGGC EBPP[D.sub.3F.sub.3] GTTCCAGCGTTTGGCGTGCCAGCGGATGGTGTTCCGGCGTTTGGG (SEQIDNO:17) GTTCCCGCGGATGGTGTGCCGGCCTTTGGTGTGCCGGCCGATGGC EBPP[H.sub.3A.sub.3I.sub.1] GTGCCGGCGCATGGAGTTCCTGCCGCCGGTGTTCCTGCGCATGGT (SEQIDNO:18) GTACCGGCAATTGGCGTTCCGGCACATGGTGTGCCGGCCGCCGGC EBPP[H.sub.5G.sub.1] GTTCCGGCCGGAGGTGTACCGGCGCATGGTGTTCCGGCACATGGT (SEQIDNO:19) GTGCCGGCTCACGGTGTGCCTGCGCATGGCGTTCCTGCGCATGGC EBPP[G.sub.1C.sub.3F.sub.2] GTGCCGGCGTGCGGCGTTCCAGCCTTTGGTGTGCCAGCGTGCGGA (SEQIDNO:20) GTTCCGGCCGGTGGCGTGCCGGCATGCGGCGTGCCGGCTTTTGGC EBPPI[G.sub.1A.sub.4F.sub.1] ATTCCTGCAGCCGGTATCCCGGCCGGTGGCATTCCGGCAGCCGGC (SEQIDNO:21) ATTCCGGCCGCCGGCATCCCGGCATTTGGCATTCCTGCAGCAGGC EBPPI[G.sub.1A.sub.3F.sub.2] ATTCCGGCCGCAGGCATTCCTGCATTTGGTATTCCGGCGGCAGGC (SEQIDNO:22) ATTCCTGCCGGTGGCATCCCGGCAGCGGGCATTCCGGCCTTTGGC

TABLE-US-00002 TABLE2 AminoacidsequencesofEBPlibraries EBP EBPE[A.sub.1G.sub.4I.sub.1] VPGGG VPGAG VPGGG VPGGG VPGIG VPGGG (SEQIDNO:23) EBPP[A.sub.1G.sub.4I.sub.1] VPAGG VPAAG VPAGG VPAGG VPAIG VPAGG (SEQIDNO:24) EBPE[K.sub.1G.sub.4I.sub.1] VPGGG VPGKG VPGGG VPGGG VPGIG VPGGG (SEQIDNO:25) EBPP[K.sub.1G.sub.4I.sub.1] VPAGG VPAKG VPAGG VPAGG VPAIG VPAGG (SEQIDNO:26) EBPE[D.sub.1G.sub.4I.sub.1] VPGGG VPGDG VPGGG VPGGG VPGIG VPGGG (SEQIDNO:27) EBPP[D.sub.1G.sub.4I.sub.1] VPAGG VPADG VPAGG VPAGG VPAIG VPAGG (SEQIDNO:28) EBPE[E.sub.1G.sub.4I.sub.1] VPGGG VPGEG VPGGG VPGGG VPGIG VPGGG (SEQIDNO:29) EBPP[E.sub.1G.sub.4I.sub.1] VPAGG VPAEG VPAGG VPAGG VPAIG VPAGG (SEQIDNO:30) EBPE[G.sub.1A.sub.3F.sub.2] VPGAG VPGFG VPGAG VPGGG VPGAG VPGFG (SEQIDNO:31) EBPP[G.sub.1A.sub.3F.sub.2] VPAAG VPAFG VPAAG VPAGG VPAAG VPAFG (SEQIDNO:32) EBPP[K.sub.1A.sub.3F.sub.2] VPAAG VPAFG VPAAG VPAGG VPAAG VPAFG (SEQIDNO:33) EBPP[D.sub.1A.sub.3F.sub.2] VPAAG VPAFG VPAAG VPAGG VPAAG VPAFG (SEQIDNO:34) EBPP[K.sub.3F.sub.3] VPAFG VPAKG VPAFG VPAKG VPAFG VPAKG (SEQIDNO:35) EBPP[D.sub.3F.sub.3] VPAFG VPADG VPAFG VPADG VPAFG VPADG (SEQIDNO:36) EBPP[H.sub.3A.sub.3I.sub.1] VPAHG VPAAG VPAHG VPAIG VPAHG VPAAG (SEQIDNO:37) EBPP[H.sub.5G.sub.1] VPAGG VPAHG VPAHG VPAHG VPAHG VPAHG (SEQIDNO:38) EBPP[G.sub.1C.sub.3F.sub.2] VPACG VPAFG VPACG VPAGG VPACG VPAFG (SEQIDNO:39) EBPPI[G.sub.1A.sub.4F.sub.1] IPAAG IPAGG IPAAG IPAAG IPAFG IPAAG (SEQIDNO:40) EBPPI[G.sub.1A.sub.3F.sub.2] IPAAG IPAFG IPAAG IPAGG IPAAG IPAFG (SEQIDNO:41)

[0105] In Table 1, SEQ ID NOS 4-11 may be classified as gene sequences for hydrophilic EBP blocks and SEQ ID NOS 12-22 may be classified as gene sequences for Phe- and His-containing hydrophobic EBP blocks. In Table 2, SEQ ID NOS 23-30 may be classified as hydrophilic and SEQ ID NOS 31-41 containing Phe and His may be classified as hydrophobic EBP blocks. That is to say, hydrophobicity is exhibited when the LOST of EBP is below the body temperature and hydrophilicity is exhibited when the LOST of EBP is above the body temperature. Therefore, the hydrophilicity and hydrophobicity of the EBP may be defined relatively with regard to bioengineering applications.

[0106] Different EBPs having the pentapeptide repeating unit Val-Pro-(Gly or Ala)-X.sub.aa-Gly [where X.sub.aa may be any amino acid except Pro] were designed at DNA level to have unique responsiveness to stimuli including temperature and pH. Both the EBP with plasticity (EBPP) having the Val-Pro-Ala-X.sub.aa-Gly pentapeptide repeats and the EBP with elasticity (EBPE) having the Val-Pro-Gly-X.sub.aa-Gly pentapeptide repeats were replicated to have the same guest residue composition and ratio. The gene and amino acid sequences of the EBPs with different pentapeptide repeating units are shown in Table 1 and Table 2, respectively. For example, EBPE[G.sub.1A.sub.3F.sub.2].sub.12 and EBPP[G.sub.1A.sub.3F.sub.2].sub.12 show not only almost the same molar mass and but also the same combination of the fourth residue of the EBP pentapeptide repeating unit. They have different mechanical properties due to the difference in the third amino acid residue (Ala or Gly) of the pentapeptide repeating unit. Positively and negatively charged EBPs were constructed by introducing charged amino acids such as Lys, Asp, Glu, His, etc. as guest residues. In addition, in order to investigate the effect of the first amino acid (Val or Ile) on temperature responsiveness and physical crosslinking of the triblock polypeptide, the first amino acid Val of the pentapeptide unit was substituted with Ile, i.e., Ile-Pro-Ala-X-Gly.

[0107] 50 L of each pair of oligonucleotides for encoding various EBPs at 2 M concentration in T4 DNA ligase buffer were annealed by heating at 95 C. for 2 minutes and then slowly cooled down to the room temperature over 3 hours. The resulting dsDNA products have nonpalindromic, 2 bp, 3 overhangs. A total of 4 g of the modified pET-21a(+)vector was digested with 15 U of BseRI in FastDigest buffer for 30 minutes at 37 C. The 5 ends were dephosphorylated with 10 U of CIP in NEB 3 buffer for 1 hour at 37 C. The restricted vector was purified using the PCR purification kit and was eluted in 40 L of distilled deionized water. The dsDNA was inserted into the linearized and modified pET-21a(+) vector by incubating 90 pmol of the annealed dsDNA and 30 pmol of the vector in T4 DNA ligase buffer containing T4 DNA ligase at 16 C. for 30 minutes. The ligated vector was introduced into chemically transformed Top10 competent cells, and then plated on SOC (Super Optimal Broth with catabolite repression) plates supplemented with 50 g/mL of ampicillin. The insert sequence was confirmed by DNA sequencing.

[0108] Two RBPs, RBP[Dros].sub.n and RBP[m-Dros].sub.n, were derived from Drosophila exon 1. The RBP[Dros].sub.n sequence was reported in previous studies with a repeating sequence of GGRPSDTYGAPGGGN. But, in the present disclosure, two sequences were combined in the repeating unit to have same molecular weight as RBP[m-Dros].sub.n. The RBP[m-Dros].sub.n was RBP[Dros].sub.n modified with two repeating sequences of GGRPSDSYGAPGGGN and GGRPSSSYGAPGQGN. The nucleotide and amino acid sequences of RBP[Dros].sub.1 and RBP[m-Dros].sub.1 are given in Table 3 and Table 4, respectively.

TABLE-US-00003 TABLE3 GenesequencesofRBPlibraries RBP RBP[m-Dros].sub.1 GGCGGCCGTCCGTCAGATTCTTATGGCGCACCGGGTGGGGGTAAT (SEQIDNO:42) GGCGGCCGTCCATCTTCGAGCTATGGCGCACCGGGCCAAGGTAAT RBP[Dros].sub.1 GGGGCGCCGGGTGGTGGCAACGGTGGTCGTCCGAGCGATACCTAC (SEQIDNO:43) GGGGCGCCGGGTGGTGGCAACGGTGGTCGTCCGAGCGATACCTAC

TABLE-US-00004 TABLE4 AminoacidsequencesofRBPlibraries RBP RBP[m-Dros].sub.1 GGRPSDSYGAPGGGNGGRPSSSYGAPGQGN (SEQIDNO:44) RBP[Dros].sub.1 GGRPSDTYGAPGGGNGGRPSDTYGAPGGGN (SEQIDNO:45)

[0109] As shown in FIG. 1B, the RBP gene was multimerized up to 30 repeating units by RDL. A vector was prepared through double digestion by 15 U of BseRI and 10 U of XbaI and dephosphorylation by 10 U of CIP. For insertion, a total of 4 g of monomer genes were digested with 10 U of XbaI and 15 U of AcuI in Outsmart buffer at 37 C. for 30 minutes. After the digestion, the reaction product was separated by agarose gel electrophoresis and purified using the PCR purification kit. Ligation was carried out by incubating 30 pmol of the purified insert with 30 pmol of the linearized vector in T4 DNA ligase buffer containing 1 U of T4 DNA ligase at 16 C. for 30 minutes. E. coli Top 10 competent cells were transformed with the ligated product and then spread on SOC plates supplemented with 50 g/mL of ampicillin. The transformants were initially screened by diagnostic restriction endonuclease digests (restricted by XbaI and BamHI) and further confirmed by DNA sequencing.

Example 5. Expression/Purification and Characterization of RBP

[0110] The RBP[Dros].sub.n and RBP[m-Dros].sub.n gene containing plasmids were transformed into E. coli BL21 (DE3) cells. A single bacterial colony was inoculated into 10 mL of TB media (1st primary culture) containing 50 mg/mL ampicillin and incubated at 37 C. for overnight growth at 150 rpm. 400 mL of TB medium supplemented with 50 mg/mL ampicillin was inoculated with the 1st primary culture in a 2-L flask and incubated at 37 C. for 4 hours at 200 rpm. The 2nd primary culture was inoculated into 500 mL of CircleGrow containing trace elements in a 2-L flask and incubated at 37 C. and 200 rpm. Bacterial cells were harvested by centrifugation and cell pellets were resuspended in PBS. Cells lysate was obtained by sonicating the resuspended sample on an ice bath for 5 minutes at 50% power (10 seconds on with 20-second intervals).

[0111] RBP[Dros].sub.n was purified by the ammonium sulfate precipitation and heating method as described in previous literatures with slight modifications. The sonicated sample was centrifuged at 16000 rpm for 30 minutes at 4 C. to remove insoluble cell debris and a PEI solution (0.5%) was added to the supernatant. Nucleic acid contaminants were separated by centrifuging at 16000 rpm for 15 minutes at 4 C. The clear soluble lysate was used for the purification of RBP[Dros]. The ammonium sulfate salt at final saturation of 30% was slowly added to the PEI-treated sample at 4 C. with stirring, mixed completely and kept for 20 minutes. Aggregated proteins were separated by centrifugation at 16000 rpm for 20 minutes at 4 C. and the pellet was resuspended in PBS. RBP[Dros].sub.n was separated with 20% s ammonium sulfate by centrifuging under the same condition as described above. The supernatant was discarded and the pellet was resuspended in PBS. The sample was dialyzed in excess PBS to remove the ammonium sulfate salt. A high-purity product was obtained using the thermal stability of RBP[Dros].sub.n and the sample was heated at 90 C. for 5 minutes with stirring which denatured the contaminated proteins. The RBP[Dros].sub.n was maintained in solubilized state even under the high temperature condition. The denatured proteins were removed by centrifuging at 13000 rpm for 20 minutes at room temperature. The pellet was discarded and pure RBP[Dros].sub.n existing in the supernatant was stored for further use.

[0112] For purification of the RBP[m-Dros].sub.n, the sonicated sample was centrifuged at 16000 rpm for 30 minutes at 4 C. The supernatant was discarded and the cell pellet was resuspended in 3-5 mL of PBS. The sample was heated at 65 C. for 20 minutes for complete solubilization and the heated sample was centrifuged at 16000 rpm for 15 minutes at room temperature to remove the contaminated proteins. The RBP[m-Dros].sub.n remained in the supernatant because of its solubility at high temperature. The supernatant was cooled at 4 C. for 30 minutes and then cooled to 20 C. for 5 minutes to trigger the phase transition of the RBP[m-Dros].sub.n which was visible due to increased turbidity. The aggregated proteins were separated by centrifugation at 16000 rpm for 10 minutes at 4 C. and the cell pellet was suspended in PBS at room temperature. The solubilization at high temperature and aggregation cycles at low temperature were continued for 3 more times to get purified proteins.

[0113] Purity and molecular weight were analyzed by SDS-PAGE for Coomassie-stained RBP[Dros].sub.n and copper-stained RBP[m-Dros].sub.n. The phase transition behavior of the RBP[m-Dros].sub.n was characterized by UV-visible spectrophotometry and dynamic light scattering (DLS). For the lower critical solution temperature, the 25 M sample solution was heated to 50 C. and then optical density at 350 nm (OD.sub.350) was measured from 50 C. to 10 C. as a function of temperature at a cooling rate of 1 C./min.

[0114] Through the agarose gel electrophoresis analysis, RBP[Dros].sub.n and RBP[m-Dros].sub.n gene libraries having various repeating units from 336 bp to 2766 bp were identified (FIG. 2A and FIG. 2B). FIGS. 3A-3C show the molecular weight of the Coomassie-stained RBP[m-Dros].sub.24, RBP[m-Dros].sub.30 and RBP[Dros].sub.8. The expected molecular weight of the RBP[m-Dros].sub.n and RBP[Dros].sub.n multimerized by RDL is shown in Table 5.

TABLE-US-00005 TABLE 5 Expected molecular weight of RBP[m-Dros].sub.n and RBP[Dros].sub.n multimerized by RDL RBP monoblock polypeptides MW (kDa) RBP[m-Dros].sub.3 8.48 RBP[m-Dros].sub.6 16.59 RBP[m-Dros].sub.12 32.81 RBP[m-Dros].sub.24 65.26 RBP[m-Dros].sub.30 81.48 RBP[Dros].sub.3 8.44 RBP[Dros].sub.6 16.50 RBP[Dros].sub.8 21.30 RBP[Dros].sub.12 32.63 RBP[Dros].sub.16 43.39 RBP[Dros].sub.24 64.90 RBP[Dros].sub.30 81.03

[0115] FIG. 3D shows the thermal profile of the RBP[Dros].sub.16. No transition was observed in the thermal profile of the RBP[Dros].sub.16 at different concentrations (25, 50 and 100 M in PBS) over the range from 10 C. to 85 C. at a heating rate of 1 C./min. FIGS. 4A and 4B show the thermal transition behavior of the RBP[m-Dros].sub.24 and the RBP[m-Dros].sub.30, respectively, by measuring absorbance at 350 nm over the range from 50 C. to 10 C. at a cooling rate of 1 C./min. From FIG. 4C and FIG. 4D, it was confirmed that the RBP[m-Dros].sub.24 and the RBP[m-Dros].sub.30 were aggregated when the solution was cooled from 30 C. to 0 C. at a cooling rate of 1 C./min. That is to say, the RBP[m-Dros].sub.24 and the RBP[m-Dros].sub.30 showed varying UCST and cloud point depending on the block length of RBP[m-Dros].sub.n. Turbidity increased as the completely solubilized RBP[m-Dros].sub.n was cooled below the UCST, which suggests aggregation. As reported previously, longer block lengths resulted in higher UCST.

Example 6. Synthesis and Expression of EBPP-RBPP Diblock Polypeptide Gene

[0116] As seen from FIG. 10, EBPP-RBP diblock genes were synthesized by inserting the EBPP gene into the RBP gene-containing plasmid. Two EBPP genes, EBPP[G.sub.1A.sub.3F.sub.2].sub.6 and EBPP[G.sub.1A.sub.3F.sub.2].sub.12, were fused with different block lengths of both [Dros] and [m-Dros]. For vector preparation, 4 g of the plasmid was digested with 15 U of BseRI and 10 U of XbaI in FastDigest buffer for 30 minutes at 37 C. The 5 ends were dephosphorylated with 10 U of CIP in NEB 3 buffer for 1 hour at 37 C. The restricted vector was purified using the PCR purification kit. For insertion, the plasmid was doubly digested with 10 U of XbaI and 15 U of AcuI for 30 minutes at 37 C. The digested product was separated by agarose gel electrophoresis and purified using the PCR purification kit. Ligation was carried out by incubating 90 pmol of the purified insert and 30 pmol of the linearized vector in T4 DNA ligase buffer containing 1 U of T4 DNA ligase at 16 C. for 30 minutes. E. coli Top 10 competent cells were transformed with the ligated product and then spread on SOC plates supplemented with 50 g/mL of ampicillin. All block lengths were checked by agarose gel electrophoresis after restriction by XbaI and AcuI and further confirmed by DNA sequencing.

[0117] For expression of fusion proteins, the pET-21a(+) vector containing EBPP-RBP polypeptides was transformed into E. coli BL21(DE3) cells. A single colony was inoculated into 50 mL of CircleGrow media in 250-mL flasks containing 50 g/mL of ampicillin, and subsequently used to inoculate CircleGrow media in 2-L flasks. The flasks were incubated on a shaking incubator at 200 rpm and expression was induced by adding IPTG at a final concentration of 1 mM when the optical density (OD.sub.600) reached 1.0. The cultures were harvested after 18 hours of incubation and the fusion proteins were purified by ITC. The cell pellets were resuspended in PBS, and the cells lysate was obtained by sonicating the samples (VC-505, Sonic and Materials Inc., Danbury, Conn.) on an ice bath. The cells debris was separated by centrifugation at 16000 rpm for 15 minutes at 4 C. and the soluble lysate was transferred to a fresh tube. Then a PEI solution was added to a final concentration of 0.5% w/v and mixed well. Nucleic acid contaminants were separated by centrifuging at 16000 rpm for 15 minutes at 4 C. Sodium chloride was added at a final concentration of 3-4 M to the PEI-treated samples to trigger the phase transition of the fusion proteins. The aggregated fusion proteins were separated by centrifuging at 16000 rpm for 30 minutes at 40 C. The aggregated fusion proteins were resuspended in cold PBS, and the samples were centrifuged at 16000 rpm for 15 minutes at 4 C. to remove any remaining insoluble matter. This aggregation and resuspension process was repeated 4-5 times until an appropriate purity of the fusion proteins was obtained.

Example 7. Physicochemical Properties of EBPP-RBP Diblock Polypeptide

[0118] FIG. 5B schematically shows the EBPP-RBP diblock polypeptide with stimuli responsiveness, fused from the hydrophobic EBP and RBP[m-Dros], which reversibly forms a micelle structure. At low temperature, a core-shell micelle structure is formed due to the difference in hydrophobicity of the blocks. Below the LOST, the EBPP is solubilized whereas the RBP[m-Dros] is aggregated. The RBP[m-Dros] remains aggregated above the LOST of the EBPP, forming an aggregate as a whole. The aggregate consisting of the RBP[m-Dros] core and the EBPP shell forms a micelle structure again at high temperature of 80 C. as the RBP[m-Dros] is solubilized above the UCST. The self-assembly from the EBPP-RBP[m-Dros] diblock to the micelle is reversible. The expected molecular weight and transition temperature (T.sub.t) of EBPP[G.sub.1A.sub.3F.sub.2].sub.6 or EBPP[G.sub.1A.sub.3F.sub.2].sub.12 when fused with RBP[Dros].sub.n or RBP[m-Dros].sub.n of various lengths depending on the length of the hydrophobic block and the RBP[m-Dros].sub.n are given in Table 6.

TABLE-US-00006 TABLE 6 Expected molecular weight and transition temperature of EBPP-RBP diblock peptide having different block lengths EBPP-RBP diblock polypeptides MW (kDa) T.sub.tS EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.3 23.55 44.5 EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.6 31.66 48.9 EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.12 47.88 47.9 EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.24 80.32 55.4 EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.3 38.61 36.62 EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6 46.72 33.21 EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.12 62.94 31.49 EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.24 95.39 28.00 EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[Dros].sub.3 23.50 N/A EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[Dros].sub.6 31.57 N/A EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[Dros].sub.12 47.70 N/A EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[Dros].sub.24 79.96 N/A EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[Dros].sub.3 38.57 N/A EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[Dros].sub.6 46.63 N/A EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[Dros].sub.12 62.76 N/A EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[Dros].sub.24 95.03 N/A

[0119] The molecular weight of the diblock polypeptide varied from 23.55 to 95.03 kDa. FIGS. 6A and 6C show the gene lengths and protein purification of the diblocks containing [G.sub.1A.sub.3F.sub.2].sub.6 (lane 1: RBP[m-Dros].sub.3-EBPP[G.sub.1A.sub.3F.sub.2].sub.6, lane 2: RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.6, lane 3: RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.6, lane 4: RBP[m-Dros].sub.24-EBPP[G.sub.1A.sub.3F.sub.2].sub.6). FIG. 7A shows the thermal profile of the diblock polypeptides containing [G.sub.1A.sub.3F.sub.2].sub.6. The diblock polypeptides except EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.3 show three stages of thermal transition: micelle formation, aggregation and micelle structure formation. In the first stage, the hydrophobic RBP[m-Dros].sub.3 is aggregated at low temperature to form a core, whereas the EBPP remains soluble and serves as a shell. As the temperature is increased above the LOST of the EBPP, an aggregate is formed as a whole. In the third stage, absorbance is decreased rapidly as the temperature is increased above 70 C. and a reversible micelle structure is formed as the RBP[m-Dros] is solubilized.

[0120] At this temperature, the EBPP[G.sub.1A.sub.3F.sub.2].sub.6 serves as a core and the RBP[m-Dros].sub.24 serves as a shell. Whereas the UCST of the monoblock is 18 C., the fusion of EBPP[G.sub.1A.sub.3F.sub.2].sub.6 and RBP[m-Dros].sub.24 resulted in increased UCST because the aggregated state is maintained until the thermal transition of the EBPP[G.sub.1A.sub.3F.sub.2].sub.6. For the EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.3, a micelle was not formed because the effect of the EBPP[G.sub.1A.sub.3F.sub.2].sub.6 was dominant throughout the temperature range due to the small molecular weight. FIG. 7B shows a result of measuring the size of the EBPP[G.sub.1A.sub.3F.sub.2].sub.6-RBP[m-Dros].sub.24 at low and high temperatures. The R.sub.h was 68 mm at 25 C., but 34 mm at 85 C. That is to say, the micelle structure and size of the diblock polypeptide could be changed reversibly by controlling the temperature.

[0121] FIG. 8A shows the thermal profile of the EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.n diblocks. All the diblock polypeptides containing EBPP[G.sub.1A.sub.3F.sub.2].sub.12 were in solubilized state below the LOST of the EBPP and remained in aggregated state above the temperature. Unlike when the length of the EBPP was shorter, micelle formation was not observed at low and high temperatures. This result suggests that the RBP[m-Dros] is greatly affected by the hydrophobic block at low and high temperatures. The effect of the EBPP[G.sub.1A.sub.3F.sub.2].sub.12 block was dominant throughout the temperatures and the UCST of the RBP[m-Dros] was not observed.

Example 8. Synthesis and Expression of EBPP-RBP-EBPP Triblock Polypeptide Gene

[0122] EBPP-RBP-EBPP triblock peptides were synthesized in two steps. In the first step, a RBP-EBPP block copolymer was formed by inserting the RBP gene into an EBPP-containing plasmid. In the second step, the EBPP gene was inserted into the RBP-EBPP-containing plasmid. For vector preparation, 4 g of the plasmid was digested with 15 U of BseRI and 10 U of XbaI in FastDigest buffer for 30 minutes at 37 C. The 5 ends were dephosphorylated with 10 U of CIP in NEB 3 buffer for 1 hour at 37 C. The restricted vector was purified using the PCR purification kit. For insertion, the plasmid was doubly digested with 10 U of XbaI and 15 U of AcuI for 30 minutes at 37 C. The digested product was separated by agarose gel electrophoresis and purified using the PCR purification kit. Ligation was carried out by incubating 90 pmol of the purified insert and 30 pmol of the linearized vector in T4 DNA ligase buffer containing 1 U of T4 DNA ligase at 16 C. for 30 minutes. E. coli Top 10 competent cells were transformed with the ligated product and then spread on SOC plates supplemented with 50 g/mL of ampicillin. Triblock polypeptides with different EBP lengths and RBP genes were synthesized and all block lengths were checked by agarose gel electrophoresis after restriction by XbaI and AcuI and further confirmed by DNA sequencing. Then, the expression of fusion proteins was conducted in the same manner as in Example 6.

Example 9. Physicochemical Properties of EBPP-RBP-EBPP Triblock Polypeptide

[0123] FIG. 5C schematically shows the hydrogel consisting of the EBPP-RBP-EBPP triblock polypeptide. It consists of the RBP[m-Dros] middle block and EBPP end blocks. The triblock polypeptide is completely soluble at low temperature and undergoes transition to a physically crosslinked network above the LOST of the EBPP. This self-assembly of the triblock polypeptide can occur reversibly depending on temperature change.

[0124] Under physiological conditions and above the T.sub.t, the hydrophobic EBPP block self-assembled with the hydrophilic RBP middle block containing the tyrosine residues to form a physically crosslinked hydrogel. The mechanical properties of the physically crosslinked hydrogel was enhanced by the chemical crosslinkages of the tyrosine residues on the RBP block. The expected molecular weight and transition temperature (T.sub.t) depending on the lengths of the hydrophobic block and the RBP[m-Dros].sub.n when EBPP[G.sub.1A.sub.3F.sub.2].sub.12 or EBPP[G.sub.1A.sub.3F.sub.2].sub.24 is fused with RBP[m-Dros].sub.n of various lengths are given in Table 7. In addition, in order to confirm the effect of physical crosslinking, EBPP or EBPPI libraries differing only in the first amino acid residue of the pentapeptide repeating unit (Val or Ile) were fused with the same RBP[m-Dros] block.

TABLE-US-00007 TABLE 7 Expected molecular weight and transition temperature of EBPP(I)- RBP-EBPP(I) triblock peptides having different block lengths EBPP-RBP-EBPP triblock polypeptides MW (kDa) T.sub.tS EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPPI[G.sub.1A.sub.3F.sub.2].sub.12 78.9 14.5 EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 76.8 29.74 EBPP[G.sub.1A.sub.3F.sub.2].sub.24-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.24 137.1 25.59 EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 93.1 27.86 EBPP[G.sub.1A.sub.3F.sub.2].sub.24-RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.24 153.3 23.10

[0125] The transition temperature was decreased as the EBPP[G.sub.1A.sub.3F.sub.2] block length was increased. In particular, the triblock polypeptides having EBPPI libraries showed much lower transition temperatures (T.sub.t) than the triblock polypeptides of the same block lengths having EBPP libraries. That is to say, the LOST of EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPPI[G.sub.1A.sub.3F.sub.2].sub.12 was much lower than that of the EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 triblock polypeptide of the same block length but having EBPP library. Such a significant decrease in T.sub.t is due to the substitution of Val in the first position of the pentapeptide repeat with the relatively more hydrophobic Ile.

[0126] FIGS. 6B and 6D show the gene length and protein purification results for the [G.sub.1A.sub.3F.sub.2].sub.6-containing triblocks (lane 1: EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.12, lane 2: EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.12, lane 3: EBPP[G.sub.1A.sub.3F.sub.2].sub.24-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.24, lane 4: EBPP[G.sub.1A.sub.3F.sub.2].sub.24-RBP[m-Dros].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.24). And, FIG. 8B shows the thermal profile for the EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.n-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 triblock polypeptide. The thermal profile pattern of the triblock polypeptide was similar to that of the diblock polypeptide where the effect of the EBPP[G.sub.1A.sub.3F.sub.2].sub.12 block was dominant throughout all the temperatures.

[0127] FIG. 9 shows the purity and characteristics of the triblock polypeptides having EBPPI libraries (Ile-Pro-Ala-X.sub.aa-Gly) for investigating the effect of substitution of Val at the first position of the pentapeptide repeat with Ile with regard to the physical crosslinking of the hydrogel. FIG. 9A a single band for EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPPI[G.sub.1A.sub.3F.sub.2].sub.12 in SDS-PAGE gel. FIG. 9B shows the thermal profile at 25 M concentration in PBS, showing complete dissolution below the T.sub.t and rapid aggregation above the LOST.

[0128] FIG. 10 shows the photographic images for the reversible sol-gel transition behavior of EBPP[G.sub.1A.sub.3F.sub.2].sub.12-RBP[m-Dros].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 in 10 mM PBS at pH 7.4. The triblock polypeptide was in solubilized state below the T.sub.t of EBPP and turned into an aggregate and formed a physically crosslinked network as the temperature was increased. The aggregated was dissolved again as the temperature was lowered. This result confirms the reversibility of the physically crosslinked hydrogel.

Example 10. Rheological Measurement of EBPP-RBP-EBPP Triblock Polypeptide

[0129] Various concentrations of EBPP-RBP-EBPP polypeptide solutions were prepared using phosphate-buffered saline (PBS, pH 7.4) and subjected to dynamic-shear rheological test to measure the elastic modulus (G), loss modulus (G), complex shear modulus (G*), complex viscosity (*) and loss angle () as functions of temperature and frequency. The G characterizes the elastic behavior of a material while the G characterizes its viscous behavior. G* and * represent the frequency-dependent stiffness and the frequency-dependent viscous drag of a viscoelastic liquid or solid, respectively. The loss angle () is a relative measure of viscous to elastic properties (Newtonian viscous fluid: =90; elastic solid: =0). A metal solvent trap under fully hydrating conditions was used to prevent solvent evaporation over temperatures ranging from 10 C. to 40 C. Dynamic frequency sweep measurements were performed in the linear viscoelastic regime at different temperatures, as confirmed by independent strain sweep tests (strain sweep range: 0.2-20%, angular frequency: 0.1, 1.0 or 10 rad/s). The angular frequency ranged from 1.0 to 100 rad/s, both at 10 C. (below T.sub.t) and 40 C. (above T.sub.t) for the frequency sweep tests. The temperature sweep tests were executed with 2% strain at 1 rad/s over a temperature range of 10 C. to 45 C. with one-minute duration per degree for forward heating and reverse cooling measurements to examine the reversibility of their rheological and mechanical properties. All measurements were made 3 times to ensure reproducibility.

[0130] FIG. 11 shows the rheological measurement result of EBPP[G.sub.1A.sub.3F.sub.2].sub.12-[RBP].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 in 10 mM PBS buffer at pH 7.4. The rheological properties and thermal reversibility were measured from 10 C. to 40 C. at 1 C./min as shown in FIG. 11A. At 37 C., the loss angle () was 57 and the values of G and G were approximately 76 Pa and 118. No physical crosslinking was observed as reflected by the absence of a crossover point in G and G. FIG. 11B shows the frequency-dependent rheological behavior which showed the frequency dependence on G and G with no crossover point.

[0131] FIG. 12 shows rheological measurement result of 25 wt % EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-[m-RBP].sub.6-EBPP[G.sub.1A.sub.3F.sub.2].sub.12 in 10 mM PBS buffer at pH 7.4. FIG. 12A shows higher G at lower and higher temperatures than 37 C. FIG. 12B shows frequency-dependent G and G having a crossover point at 1 rad/s, suggesting that the polypeptide is a viscoelastic solid above the T.sub.t of EBPPI. FIGS. 12C and 12D show the measurement result as a function of temperature from 1 to 40 C. at a heating and cooling rate of 1 C./min. The triblock polypeptide having EBPPI libraries, wherein the Val at the first position of the pentapeptide repeat was substituted with Ile, showed a modulus crossover point at 23 C., which clearly reveals gelation during thermal transition. This gelation was reversible as the temperature was decreased. The G and G values of the polypeptide below and above the crossover point were much higher for EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-[m-RBP].sub.6-EBPPI[G.sub.1A.sub.3F.sub.2].sub.12 than for EBPP[G.sub.1A.sub.3F.sub.2].sub.12-[m-RBP].sub.12-EBPP[G.sub.1A.sub.3F.sub.2].sub.12, which suggests that the Ile in the pentapeptide repeating unit improves physical crosslinking by enhancing hydrophobicity.

[0132] The present invention has been described in detail with reference to specific embodiments thereof. However, it will be appreciated by those skilled in the art that various changes and modifications may be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.