KITS AND METHODS FOR PEDIGREE DIVISION AND PATERNITY TESTING OF DOMESTIC PIGS
20230042006 · 2023-02-09
Assignee
Inventors
- Yueyun DING (Hefei, CN)
- Xiaoling DING (Hefei, CN)
- Zongjun YIN (Hefei, CN)
- Xudong WU (Hefei, CN)
- Xiaodong ZHANG (Hefei, CN)
- Xianrui ZHENG (Hefei, CN)
- Zijing LING (Hefei, CN)
- Qiong CHEN (Hefei, CN)
- Yinhui HOU (Hefei, CN)
- Chengcheng KONG (Hefei, CN)
Cpc classification
C12Q1/6888
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure belongs to the field of livestock molecular biotechnology, and provides kits and methods for pedigree division and paternity testing of domestic pigs. The kits and methods specifically select 14 SSR loci of domestic pigs, especially Anqing six-end-white pigs, and synthesize primers for corresponding loci. Through capillary electrophoresis detection of the ear tissue DNA of 98 Anqing six-end-white pigs, the count of effective alleles, heterozygosity, polymorphism information content, and genetic distance, and exclusion probability at each locus are calculated, the pedigree division of domestic pigs, especially Anqing six-end-white pigs, and paternity testing are conducted. The cumulative exclusion probability of 14 microsatellite loci is 99%. The 14 microsatellite loci selected are polymorphic in Anqing six-end-white pig population, which can be used as effective genetic markers in the production practice of domestic pigs, especially in the pedigree division and paternity testing of Anqing six-end-white pig population.
Claims
1. A kit for pedigree division and paternity testing of domestic pigs, comprising: 14 simple sequence repeats (SSR) loci which comprises: a S0155 microsatellite locus on chromosome 1, a SW240 microsatellite locus on chromosome 2, a SW72 microsatellite locus on chromosome 3, a S0227 microsatellite locus on chromosome 4, a SW963 microsatellite locus on chromosome 5, a SW122 microsatellite locus on chromosome 6, a S0101 microsatellite locus on chromosome 7, a S0225 microsatellite locus on chromosome 8, a S0386 microsatellite locus on chromosome 11, a S0090 microsatellite locus on chromosome 12, a S0355 microsatellite locus on chromosome 15, a S0026 microsatellite locus on chromosome 16, a SW24 microsatellite locus on chromosome 17, and a SW2156 microsatellite locus on sex chromosome.
2. The kit of claim 1, wherein primers required for PCR amplification of the SSR loci includes: a forward primer sequence of the S0155 microsatellite locus shown in SEQ ID No. 1 and a reverse primer sequence of the S0155 microsatellite locus shown in SEQ ID No. 2; a forward primer sequence of the SW240 microsatellite locus shown in SEQ ID No. 3 and a reverse primer sequence of the SW240 microsatellite locus shown in SEQ ID No. 4; a forward primer sequence of the SW72 microsatellite locus shown in SEQ ID No. 5 and a reverse primer sequence of the SW72 microsatellite locus shown in SEQ ID No. 6; a forward primer sequence of the SW227 microsatellite locus shown in SEQ ID No. 7 and a reverse primer sequence of the SW227 microsatellite locus shown in SEQ ID No. 8; a forward primer sequence of the SW963 microsatellite locus shown in SEQ ID No. 9 and a reverse primer sequence of the SW963 microsatellite locus shown in SEQ ID No. 10; a forward primer sequence of the SW122 microsatellite locus shown in SEQ ID No. 11 and a reverse primer sequence of the SW122 microsatellite locus shown in SEQ ID No. 12; a forward primer sequence of the S0101 microsatellite locus shown in SEQ ID No. 13 and a reverse primer sequence of the S0101 microsatellite locus shown in SEQ ID No. 14; a forward primer sequence of the S0225 microsatellite locus shown in SEQ ID No. 15 and a reverse primer sequence of the S0225 microsatellite locus shown in SEQ ID No. 16; a forward primer sequence of the S0386 microsatellite locus shown in SEQ ID No. 17 and a reverse primer sequence of the S0386 microsatellite locus shown in SEQ ID No. 18; a forward primer sequence of the S0090 microsatellite locus shown in SEQ ID No. 19 and a reverse primer sequence of the S0090 microsatellite locus shown in SEQ ID No. 20; a forward primer sequence of the S0355 microsatellite locus shown in SEQ ID No. 21 and a reverse primer sequence of the S0355 microsatellite locus shown in SEQ ID No. 22; a forward primer sequence of the S0026 microsatellite locus shown in SEQ ID No. 23 and a reverse primer sequence of the 50026 microsatellite locus shown in SEQ ID No. 24; a forward primer sequence of the SW24 microsatellite locus shown in SEQ ID No. 25 and a reverse primer sequence of the SW24 microsatellite locus shown in SEQ ID No. 26; and a forward primer sequence of the SW2156 microsatellite locus shown in SEQ ID No. 27 and a reverse primer sequence of the SW2156 microsatellite locus shown in SEQ ID No. 28.
3. The kit of claim 2, wherein the S0155 microsatellite locus, SW963 microsatellite locus, and S0386 microsatellite locus are fluorescent-labeled as 5′-FAM, the SW240 microsatellite locus, the SW72 microsatellite locus, the SW122 microsatellite locus, the SW24 microsatellite locus, and the 50026 microsatellite locus are fluorescent-labeled as 5′-HEX, and the S0227 microsatellite locus, the S0101 microsatellite locus, the S0090 microsatellite locus, and the S0355 microsatellite locus are fluorescent-labeled as 5′ TAMRA, a PCR annealing temperature of the S0155 microsatellite locus, the SW240 microsatellite locus, the SW72 microsatellite locus, the S0227 microsatellite locus, the SW963 microsatellite locus, the S0101 microsatellite locus, the S0225 microsatellite locus, the S0386 microsatellite locus, the S0090 microsatellite locus, the S0355 microsatellite locus and the SW24 microsatellite locus are 55° C., the PCR annealing temperature of the SW122 microsatellite locus is 58.5° C. and the annealing temperature of the SW2156 microsatellite locus is 60° C.
4. The kit of claim 3, wherein the kit is a 25 μL reaction system, comprising a 1 μL upstream primer, a 1 μL downstream primer, a 1 μL mix dNTR, a 2.5 μL MgCl.sub.2 Taq Buffer, a 0.5 μL Taq enzyme, and 19 μL ddH.sub.2O.
5. The kit of claim 1, wherein the domestic pigs are Anqing six-end-white pigs.
6. A method for pedigree division and paternity testing of domestic pigs, comprising: synthesizing primers required for PCR amplification of SSR loci of the domestic pigs, the primers including the primers of claim 3.
7. The method of claim 6, further comprising: collecting samples from the domestic pigs; extracting DNA from the samples by using a rapid genomic DNA extraction kit; performing PCR amplification with the primers to obtain PCR products; detecting PCR products by capillary electrophoresis to obtain a detection result; and performing data processing and results analysis for the detection result.
8. The method of claim 7, wherein the performing data processing and results analysis for the detection result comprises: using Popgene3.2 software to perform an analysis of a count of alleles, a count of effective alleles, an observed homozygosity, an expected homozygosity, an observed heterozygosity, an expected heterozygosity, a Shannon index and a hard Weinberg equilibrium index of each microsatellite locus; using PIC_Cale0.6 software to calculate a polymorphic information content; using the DiploidDate program to calculate a Nei's genetic distance between individuals; and obtaining a phylogenetic cluster diagram constructed by the unweighted pair-group method with arithmetic mean (UPGMA).
9. The method of claim 8, wherein the domestic pigs are Anqing six-end-white pigs and the samples are collected from ears of the domestic pigs.
10. The method of claim 9, wherein the performing PCR amplification with the primers to obtain PCR products comprises: performing pre denaturation at 95° C. for 3 minutes; performing denaturation at 94° C. for 30 seconds, annealing at 60° C. for 30 seconds, performing extension at 72° C. for 30 seconds for 10 cycles; performing denaturation at 94° C. for 30 seconds, annealing at 55° C. for 30 seconds, performing extension at 72° C. for 30 seconds for 35 cycles; and performing repairing and extension at 72° C. for 8 minutes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022]
[0023]
[0024]
DETAILED DESCRIPTION
[0025] The terminology used herein is for the purposes of describing particular examples and embodiments only and is not intended to be limiting. As used herein, the singular forms “a,” “an,” and “the” may be intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “include” and/or “comprise,” when used in this disclosure, specify the presence of integers, behaviors, stated features, steps, elements, and/or operations, but do not exclude the presence or addition of one or more other integers, behaviors, features, steps, elements, operations, and/or groups thereof.
[0026] According to one aspect of the present disclosure, a kit for pedigree division and paternity testing of domestic pigs is provided. The kit includes a plurality of SSR loci. The SSR loci include a SW72 microsatellite locus on chromosome 3, a SW963 microsatellite locus on chromosome 5, a S0101 microsatellite locus on chromosome 7, a S0386 microsatellite locus on chromosome 11, a S0090 microsatellite locus on chromosome 12, a SW24 microsatellite locus on chromosome 17, and a SW2156 microsatellite locus on sex chromosome. The SSR loci further include a S0155 microsatellite locus on chromosome 1, a SW240 microsatellite locus on chromosome 2, a S0227 microsatellite locus on chromosome 4, a SW122 microsatellite locus on chromosome 6, a S0225 microsatellite locus on chromosome 8, a S0355 microsatellite locus on chromosome 15, and a S0026 microsatellite locus on chromosome 16.
[0027] In some embodiments, primers required for PCR amplification of the SSR loci includes: a forward primer sequence of the SW72 microsatellite locus shown in SEQ ID No. 5 and a reverse primer sequence of the SW72 microsatellite locus shown in SEQ ID No. 6; a forward primer sequence of the SW963 microsatellite locus shown in SEQ ID No. 9 and a reverse primer sequence of the SW963 microsatellite locus shown in SEQ ID No. 10; a forward primer sequence of the S0101 microsatellite locus shown in SEQ ID No. 13 and a reverse primer sequence of the S0101 microsatellite locus shown in SEQ ID No. 14; a forward primer sequence of the S0386 microsatellite locus shown in SEQ ID No. 17 and a reverse primer sequence of the S0386 microsatellite locus shown in SEQ ID No. 18; a forward primer sequence of the S0090 microsatellite locus shown in SEQ ID No. 19 and a reverse primer sequence of the S0090 microsatellite locus shown in SEQ ID No. 20; a forward primer sequence of the SW24 microsatellite locus shown in SEQ ID No. 25 and a reverse primer sequence of the SW24 microsatellite locus shown in SEQ ID No. 26; and a forward primer sequence of the SW2156 microsatellite locus shown in SEQ ID No. 27 and a reverse primer sequence of the SW2156 microsatellite locus shown in SEQ ID No. 28.
[0028] In some embodiments, the primers further include a forward primer sequence of the S0155 microsatellite locus shown in SEQ ID No. 1 and a reverse primer sequence of the S0155 microsatellite locus shown in SEQ ID No. 2; a forward primer sequence of the SW240 microsatellite locus shown in SEQ ID No. 3 and a reverse primer sequence of the SW240 microsatellite locus shown in SEQ ID No. 4; a forward primer sequence of the SW227 microsatellite locus shown in SEQ ID No. 7 and a reverse primer sequence of the SW227 microsatellite locus shown in SEQ ID No. 8; a forward primer sequence of the SW122 microsatellite locus shown in SEQ ID No. 11 and a reverse primer sequence of the SW122 microsatellite locus shown in SEQ ID No. 12; a forward primer sequence of the S0225 microsatellite locus shown in SEQ ID No. 15 and a reverse primer sequence of the S0225 microsatellite locus shown in SEQ ID No. 16; a forward primer sequence of the S0355 microsatellite locus shown in SEQ ID No. 21 and a reverse primer sequence of the S0355 microsatellite locus shown in SEQ ID No. 22; and a forward primer sequence of the S0026 microsatellite locus shown in SEQ ID No. 23 and a reverse primer sequence of the S0026 microsatellite locus shown in SEQ ID No. 24.
[0029] In some embodiments, the S0155 microsatellite locus, SW963 microsatellite locus, and S0386 microsatellite locus are fluorescent-labeled as 5′-FAM, the SW240 microsatellite locus, the SW72 microsatellite locus, the SW122 microsatellite locus, the SW24 microsatellite locus, and the S0026 microsatellite locus are fluorescent-labeled as 5′-HEX, and the S0227 microsatellite locus, the S0101 microsatellite locus, the S0090 microsatellite locus, and the S0355 microsatellite locus are fluorescent-labeled as 5′TAMRA. A PCR annealing temperature of the S0155 microsatellite locus, the SW240 microsatellite locus, the SW72 microsatellite locus, the S0227 microsatellite locus, the SW963 microsatellite locus, the S0101 microsatellite locus, the S0225 microsatellite locus, the S0386 microsatellite locus, the S0090 microsatellite locus, the S0355 microsatellite locus and the SW24 microsatellite locus are 55° C., the PCR annealing temperature of the SW122 microsatellite locus is 58.5° C. and the annealing temperature of the SW2156 microsatellite locus is 60° C.
[0030] The kit is a 25 μL reaction system, comprising a 1 μL upstream primer, a 1 μL downstream primer, a 1 μL mix dNTR, a 2.5 μL MgCl.sub.2 Taq Buffer, a 0.5 μL Taq enzyme, and 19 μL ddH.sub.2O.
[0031] The domestic pigs are Anqing six-end-white pigs.
[0032] According to other aspect of the present disclosure, a method for pedigree division and paternity testing of domestic pigs is provided. The method includes:
[0033] (1) collecting samples from the domestic pigs;
[0034] (2) extracting DNA from the samples by using the rapid genomic DNA extraction kit of Beijing Adlai biotechnology company;
[0035] (3) synthesizing primers required for PCR amplification of the SSR loci, the primers including the primers of claim 3;
[0036] (4) performing PCR amplification with the primers to obtain PCR products;
[0037] (5) detecting PCR products by capillary electrophoresis to obtain a detection result; and
[0038] (6) data processing and results analysis for the detection result.
[0039] In some embodiments, the step of (6) includes using Popgene3.2 software to perform an analysis of a count of alleles, a count of effective alleles, an observed homozygosity, an expected homozygosity, an observed heterozygosity, an expected heterozygosity, a Shannon index and a hard Weinberg equilibrium index of each microsatellite locus; using PIC_Cale0.6 software to calculate a polymorphic information content; using the DiploidDate program to calculate a Nei's genetic distance between individuals; and obtaining a phylogenetic cluster diagram constructed by the unweighted pair-group method with arithmetic mean (UPGMA).
[0040] The domestic pigs are Anqing six-end-white pigs and the samples are collected from pig ears.
[0041] The step of (4) performing PCR amplification with the primers to obtain PCR products comprises: performing pre denaturation at 95° C. for 3 minutes; performing denaturation at 94° C. for 30 seconds, annealing at 60° C. for 30 seconds, performing extension at 72° C. for 30 seconds for 10 cycles; performing denaturation at 94° C. for 30 seconds, annealing at 55° C. for 30 seconds, performing extension at 72° C. for 30 seconds for 35 cycles; and performing repairing and extension at 72° C. for 8 minutes.
[0042] The present disclosure is described in detail below in combination with specific examples.
Example 1
1 Material Method:
1.1 Sample Collection
[0043] The present disclosure collects ear tissue samples of 98 pure Anqing six-end-white pigs, which are provided by Anhui Huating Lake Green Food Development Co., Ltd. (Chengling village, Jinxi Town, Taihu County, Anqing City, Anhui Province). The ear tissue samples are stored in a 1.5 ml centrifuge tube filled with 500 μL of 75% alcohol, which are brought back to the laboratory and stored at −20° C.
1.2 DNA Extraction
[0044] The tissue DNA of Anqing six-end-white pigs is extracted with the rapid extraction kit of tissue genomic DNA of Adlai biotechnology company (Beijing). The extracted DNA samples are checked for concentration and purity by ultraviolet spectrophotometer. The qualified DNA samples are stored at −80° C. for standby.
1.3 Microsatellite Loci Selection and Primer Design
[0045] The information of the 14 loci selected by the present disclosure is shown in Table 1. The primer sequences of the corresponding loci are synthesized according to the locus information. See Table 1 for the locus information and primer sequences.
TABLE-US-00001 TABLE 1 Microsatellite loci and primer information Microsatellite Annealing loci Chromosomal Primer sequence temperature Fluorescent (SSR) location (5′-3′) (° C.) label S0155 1 TGTTCTCTGTTTCTCCTCTGTTT 55 5′-FAM G (SEQ ID No. 1) GTTAAAGTGGAAAGAGTCAATG GCTAT (SEQ ID No. 2) SW240 2 AGAAATTAGTGCCTCAAATTGG 55 5′-HEX (SEQ ID No. 3) AAACCATTAAGTCCCTAGCAAA (SEQ ID No. 4) SW72 3 TCAGAACAGTGCGCCGT 55 5′-HEX (SEQ ID No. 5) GTTTGAAAATGGGGTGTTTCC (SEQ ID No. 6) S0227 4 GATCCATTTATAATTTTAGCACA 55 5′-TAMRA AAGT (SEQ ID No. 7) GCATGGTGTGATGCTATGTCAAG C (SEQ ID No. 8) SW963 5 TCTGTTGTTTCCCACCAGC (SEQ 55 5′-FAM ID No. 9) TGTGCACCTGACACATAGACTC (SEQ ID No. 10) SW122 6 TTGTCTTTTTATTTTGCTTTTGG 58.5 5′-HEX (SEQ ID No. 11) CAAAAAAGGCAAAAGATTGACA (SEQ ID No. 12) S0101 7 GAATGCAAAGAGTTCAGTGTAG 55 5′-TAMRA G(SEQ ID No. 13) GTCTCCCTCACACTTACCGCAG (SEQ ID No. 14) S0225 8 GCTAATGCCAGAGAAATGCAGA 55 5′-FAM (SEQ ID No. 15) CAGGTGGAAAGAATGGAATGAA (SEQ ID No. 16) S0386 11 GAACTCCTGGGTCTTATTTTCTA 55 5′-FAM (SEQ ID No. 17) GTCAAAAATCTTTTTATCTCCAA CAGTAT (SEQ ID No. 18) S0090 12 CCAAGACTGCCTTGTAGGTGAA 55 5′-TAMRA TA (SEQ ID No. 19) GCTATCAAGTATTGTACCATTAG G (SEQ ID No. 20) S0355 15 TCTGGCTCCTACACTCCTTCTTG 55 5′-TAMRA ATC (SEQ ID No. 21) GTTTGGGTGGGTGCTGAAAAAT AGGA (SEQ ID No. 22) SW24 17 CTTTGGGTGGAGTGTGTGC(SEQ 55 5′HEX ID No. 23) ATCCAAATGCTGCAAGCG (SEQ ID No. 24) S0026 16 AACCTTCCCTTCCCAATCAC 58.5 5′HEX (SEQ ID No. 25) CACAGACTGCTTTTTACTCC (SEQ ID No. 26) SW2156 X.Y CAAGTGCCCATCAACACTTG 60 5′-FAM (SEQ ID No. 27) TCATCTCTGGGTCCATCTTACG (SEQ ID No. 28)
1.4 PCR Amplification System and Reaction Conditions
[0046] PCR reaction is performed with 25 μL reaction system, including 1 μL upstream primer, 1 μL downstream primer, 1 μL dNTR (mix), 2.5 μL Taq Buffer (with MgCl2), 0.5 μL Taq enzyme, 19 μL ddH2O. The PCR procedure is set as follows: 95° C. pre denaturation (3 min), 10 cycles (94° C. denaturation (30 sec), 60° C. annealing (30 sec), 72° C. extension (30 sec)), 35 cycles (94° C. denaturation (30 sec), 55° C. annealing (30 sec), 72° C. extension (30 sec)), 72° C. repair extension (8 min))
1.5 Capillary Electrophoresis Detection of PCR Products
[0047] ABI3730xl gene sequencer is used to perform capillary electrophoresis on PCR products, and Genemapper software is used to read and analyze the capillary electrophoresis results to judge the allele size and genotype of each sample at each microsatellite locus.
1.6 Data Processing and Analysis
[0048] The genotypes of microsatellite loci in Anqing six-end-white pigs are sorted out. Use POPgene3.2 software to analyze microsatellite loci genetic information based on the following information including: count of alleles, effective count of alleles, observed homozygote, expected homozygote, observed heterozygosity, expected heterozygosity, Shannon's information index, Hard Weinberg equilibrium test, and use PIC_Cale0.6 software to calculate the polymorphism information content. The present disclosure regards each sample as a group. Using the DiploidDate program to calculate the NEI genetic distance between the individual, and obtain the affinity cluster map constructed by the Unweight Pair-GROUP Method with Arithmetic Mean (UPGMA). Cervus 3.07 software is used to calculate the null allele frequency and combined exclusion probability of 14 microsatellite loci. The exclusion probability is calculated by an equation of 1−combined exclusion probability.
2 Results and Analysis
2.1 Genetic Diversity Analysis of 14 Microsatellite Loci in Anqing Six-End-White Pigs
[0049] The present disclosure selects 14 microsatellite loci to analyze the genetic diversity of 98 Anqing six-end-white pigs. The capillary electrophoresis results of PCR products at some microsatellite loci are shown in
[0050] The alleles and gene frequencies of microsatellite loci in Anqing six-end-white pig population are shown in Table 2 (they are named allele A to allele L respectively according to the order of fragment size from low to high).
TABLE-US-00002 TABLE 2 Statistics of alleles and gene frequencies of 14 microsatellite loci in Anqing six-end-white pig population Allele\ Loci S0155 SW240 SW72 S0227 SW963 SW122 S0101 S0255 S0386 S0090 S0355 SW24 S0026 SW2156 Allele A 0.0969 0.0053 0.2448 0.2755 0.0263 0.3041 0.0465 0.1684 0.2296 0.1378 0.1833 0.0412 0.1701 0.0227 Allele B 0.0663 0.0947 0.4323 0.0051 0.0105 0.1340 0.0581 0.2143 0.1071 0.1582 0.0889 0.0258 0.0928 0.1193 Allele C 0.0408 0.0158 0.0625 0.0612 0.1105 0.0361 0.1047 0.0459 0.0612 0.3878 0.0222 0.0155 0.2113 0.2500 Allele D 0.1174 0.0842 0.2292 0.1582 0.1211 0.1340 0.0116 0.1786 0.1276 0.1735 0.0222 0.1753 0.0309 0.1648 Allele E 0.3724 0.0474 0.0312 0.3673 0.1895 0.2062 0.2209 0.0102 0.0255 0.0153 0.0889 0.0619 0.4794 0.0909 Allele F 0.1684 0.0684 0.1173 0.0526 0.0309 0.0233 0.0918 0.4235 0.1122 0.1889 0.4742 0.0155 0.1080 Allele G 0.1378 0.3000 0.0154 0.3684 0.0155 0.0174 0.0204 0.0255 0.0152 0.2611 0.0412 0.0170 Allele H 0.1105 0.0947 0.0155 0.0291 0.0153 0.1445 0.0103 0.0170 Allele I 0.0421 0.0264 0.1237 0.3837 0.1122 0.0567 0.0739 Allele J 0.1421 0.1047 0.1020 0.0979 0.0455 Allele K 0.0895 0.0357 0.0909 Allele L 0.0052
[0051] A total of 119 alleles are detected at 14 loci, and the average number of alleles at each locus is 8.5. Among them, the number of alleles at S0255 locus is the most (n=12), the corresponding fragment range is 167 bp-191 bp, and the number of alleles at SW72 locus is the least (n=5), and the corresponding fragment range is 99 bp-113 bp. Among the 14 loci, the allele B (100 bp) of SW72 locus has the highest allele frequency of 0.4323 in Anqing six-end-white pig population. The allele L (191 bp) of S0255 locus has the lowest allele frequency of 0.0052 in Anqing six-end-white pig population. The count of alleles with allele frequency greater than 0.1 is 2-5.
[0052] The genetic diversity analysis of 14 microsatellite loci in Anqing six-end-white pigs is shown in Table 3. The count of effective alleles at each locus is 3.1927-7.1078, and the average count of effective alleles is 4.8161, of which the count of effective alleles at S0026 is the least and the count of effective alleles at SW2156 is the most. The observed homozygosity of each locus is between 0.1684-0.6421, among which the observed homozygosity value of SW240 is the smallest and that of SW963 is the largest. The expected homozygosity of each locus is 0.3579-0.8316, among which the expected homozygosity value of SW963 is the smallest and that of SW240 is the largest. The observed heterozygosity of each locus ranges from 0.1358 to 0.3097. The observed heterozygosity of SW2156 is the smallest and that of S0026 is the largest. The expected heterozygosity of each locus ranges from 0.6903 to 0.8626, the expected heterozygosity of S0026 is the lowest, and the expected heterozygosity of S0255 is the highest.
TABLE-US-00003 TABLE 3 Genetic information analysis of 14 microsatellite loci in Anqing six-end-white pig population Loci S0155 SW240 SW72 S0227 SW963 SW122 S0101 S0255 S0386 S0090 S0355 SW24 S0026 SW2156 Na 7 11 5 7 9 9 10 12 7 7 8 10 6 11 Ne 4.6452 6.4326 3.2873 3.9425 4.7227 5.2919 4.4380 7.0540 3.7759 4.2104 5.7103 3.614 3.1927 7.1078 Hom 0.2347 0.1684 0.3021 0.3571 0.6421 0.1856 0.2326 0.4592 0.6020 0.2857 0.4333 0.3299 0.3299 0.3864 (Obs) Hom 0.7653 0.8316 0.6979 0.6429 0.3579 0.8144 0.7674 0.5408 0.3980 0.7143 0.5667 0.6701 0.6701 0.6136 (Exp) Het 0.2113 0.1510 0.3006 0.2498 0.2076 0.1848 0.2208 0.1374 0.2611 0.2336 0.1705 0.2729 0.3097 0.1358 (Obs) Het 0.7887 0.8490 0.6994 0.7502 0.7924 0.8152 0.7792 0.8626 0.7389 0.7664 0.8295 0.7271 0.6903 0.8642 (Exp) PIC 0.7591 0.8293 0.6445 0.7069 0.7636 0.7866 0.7482 0.8424 0.7003 0.7307 0.8018 0.6985 0.6444 0.8446 I 1.7291 2.0840 1.3263 1.5281 1.7997 1.8411 1.7944 2.1130 1.5619 1.6094 1.8554 1.6903 1.3748 2.1314 H-W ** ** ** ** ** ** ** ** Note: Na (count of observed alleles); Ne (count of effective alleles); Hom (Obs) observed homozygosity; Hom (Exp) expected homozygosity; Het (Obs) observed heterozygosity; Het (Exp) expected heterozygosity; I: Shannon index; PIC: polymorphic information content; H-W: Hard-Weinberg equilibrium testing, ** indicates that the locus has not reached H-W dynamic equilibrium, and no ** mark indicates that the locus has reached H-W dynamic equilibrium.
[0053] The Shannon index of each locus is between 1.3263-2.1314, the Shannon index of SW72 is the lowest, and the Shannon index of SW2156 is the highest. The polymorphic information content of each locus ranges from 0.6444 to 0.8424. The polymorphic information content of S0026 is the lowest and that of S0255 is the highest. Each locus is subject to chi-square test to study whether it is in hard Weinberg dynamic equilibrium. Through calculation, S0155, S0227, SW963, SW122, S0255, S0386, S0355 and SW2156 are not in Hard-Weinberg dynamic equilibrium. SW240, SW72, S0101, S0090, SW24, S0026 are in Hard-Weinberg dynamic equilibrium.
2.2 Pedigree Division and Paternity Testing Based on SSR Markers
[0054] According to Nei's genetic distance calculation results, the phylogenetic tree of 98 Anqing six-end-white pigs is constructed. It can be found that the samples in the examples may be divided into 7 groups, which is consistent with the pedigree composition records of the protected population in the breeding farm. Nei's genetic distance and genetic consistency coefficient among some samples are shown in Table 4. The results show that there is a negative correlation between genetic consistency coefficient and genetic distance coefficient.
TABLE-US-00004 TABLE 4 Nei's genetic distance and genetic consistency coefficient of samples 1-12 Sample ID 1 2 3 4 5 6 7 8 9 10 11 12 1 *** 0.2165 0.1369 0.6790 0.2646 0.1021 0.0990 0.2552 0.1485 0.2406 0.2552 0.2054 2 1.5301 *** 0.4743 0.0811 0.2778 0.4419 0.1143 0.3830 0.4287 0.2500 0.2946 0.4216 3 1.9883 0.7458 *** 0.1795 0.4480 0.4472 0.2712 0.3913 0.4339 0.3162 0.2236 0.3250 4 0.3871 2.5119 1.7173 *** 0.4056 0.1434 0.1113 0.1434 0.1113 0.3515 0.2007 0.1026 5 1.3295 1.2809 0.8030 0.9025 *** 0.3241 0.3144 0.2357 0.3716 0.5278 0.2946 0.3162 6 2.2822 0.8166 0.8047 1.9422 1.1267 *** 0.3638 0.5000 0.4548 0.4714 0.5000 0.3634 7 2.3125 2.1686 1.3050 2.1957 1.1570 1.0111 *** 0.1213 0.4412 0.2572 0.4244 0.4067 8 1.3659 0.9597 0.9383 1.9422 1.4452 0.6931 2.1098 *** 0.5760 0.2946 0.3125 0.2236 9 1.9070 0.8469 0.8350 2.1957 0.9900 0.7880 0.8183 0.5516 *** 0.3430 0.2122 0.4610 10 1.4248 1.3863 1.1513 1.0456 0.6391 0.7520 1.3577 1.2220 1.0700 *** 0.3241 0.2372 11 1.3659 1.2220 1.4979 1.6058 1.2220 0.6931 0.8570 1.1632 1.5501 1.1267 *** 0.1898 12 1.5828 0.8636 1.1239 2.2769 1.1513 1.0124 0.8996 1.4979 0.7744 1.4390 1.2747 *** Note: the genetic consistency coefficient is at the top of the table (i.e., above the labels of ***), and the genetic distance coefficient is at the bottom of the table (i.e., below the labels of ***).
[0055] The combined exclusion probability of 14 microsatellite loci is shown in Table 5. When the genotype of a candidate parent and its offspring is known (NE-1P), the exclusion probability of each locus is 0.276-0.419, and the cumulative exclusion probability of 14 loci is 0.9995. The genotype of another different candidate parent with different sex and its offspring is known (NE-2P), the exclusion probability of each locus is 0.448-0.713, and the cumulative exclusion probability of 14 loci is 0.9999. The genotype of both candidate parents and the corresponding offspring is known (NE-PP), the exclusion probability of each locus is 0.626-0.887, and the cumulative exclusion probability of 14 loci is 0.9999.
[0056] In the 14 microsatellite loci selected by the present disclosure, a total of 119 alleles are observed in Anqing six-end-white pig population, and the average count of alleles at each locus is 8.500±2.1031. The average count of effective alleles is 4.8162±1.3217. The average count of effective alleles of microsatellite loci in Anqing six-end-white pigs is higher than that of other types of local pigs in Anhui Province (e.g., Wei pig, Wannan black pig and Wannan flower pig), and also higher than that of some types of local pigs outside Anhui Province, such as Fengjing pig, Saba pig, Dahe pig and Bama Xiang pig. By detecting the Ne/Na ratio of each locus, it is found that the Ne/Na ratio of S0355 locus is the highest, i.e., 0.7138 and the ratio of SW24 locus is the lowest, i.e., 0.3614, indicating that the alleles of S0355 locus are evenly distributed in Anqing six-end-white pig population. In addition, the number of alleles of S0227 locus in Anqing six-end-white pig population is 7 while only 4 alleles are detected in pigs in Thailand. The alleless of other microsatellite loci in Anqing six-end-white pig are also different from those of Mexican hairless pig, Gubacrior pig and Iberian pig. This shows that there is specificity in the distribution of alleles of the 14 loci in Anqing six-end-white pig population.
TABLE-US-00005 TABLE 5 Exclusion probability of 14 microsatellite loci Loci NE-1P NE-2P NE-PP NE-I NE-SI F (Null) S0155 0.419 0.6 0.79 0.929 0.625 0.0115 SW240 0.534 0.7 0.874 0.96 0.662 0.0019 SW72 0.278 0.448 0.626 0.858 0.564 −0.0080 S0227 0.344 0.522 0.708 0.896 0.597 0.0741 SW963 0.431 0.61 0.8 0.932 0.629 0.3810 SW122 0.456 0.632 0.814 0.94 0.64 −0.0060 S0101 0.408 0.588 0.782 0.923 0.618 0.0055 S0255 0.552 0.713 0.879 0.963 0.669 0.2350 S0386 0.343 0.524 0.719 0.896 0.592 0.2846 S0090 0.379 0.56 0.75 0.913 0.611 0.0353 S0355 0.482 0.655 0.831 0.947 0.65 0.1759 SW24 0.351 0.537 0.744 0.901 0.589 0.0410 S0026 0.276 0.453 0.643 0.859 0.557 0.0173 SW2156 0.562 0.722 0.887 0.929 0.625 0.1713 Cumulative 0.9995 0.9999 0.9999 0.9999 0.9999 exclusion probability Note: NE-1 denotes an average non-exclusion probability for identity of two unrelated individuals; NE-SI denotes an average non-exclusion probability for identity of two siblings; F (Null) denotes an estimated null allele frequency.
[0057] The count of effective alleles, polymorphic information content and heterozygosity are important indicators to study population genetic variation. Hardy Weinberg dynamic equilibrium may reflect population migration and selection. Heterozygosity may be used to measure the degree of variation of the population. The lower the value of heterozygosity is, the less genetic variation and diversity of the population are. The average expected heterozygosity of 14 microsatellite loci in Anqing six-end-white pigs is 0.7824±0.0573, which is in the middle level among local pigs in China. Polymorphic information content may be used as one of the indicators to measure the polymorphism of loci. If the value of polymorphic information content is high, it means that the proportion of heterozygotes in the population is high, and its genetic potential is also greater. The polymorphic information content of 14 microsatellite loci in Anqing six-end-white pig population is higher than 0.5, and the average polymorphic information content is 0.74±0.06. When a genetic locus reaches H-W dynamic equilibrium, its allele frequency and genotype frequency may be inherited stably in the population. In the present disclosure, among the 14 microsatellite loci in Anqing six-end-white pig population, eight loci such as S0155 do not reach H-W dynamic equilibrium, and six loci such as SW240 reach H-W dynamic equilibrium. A total of 14 microsatellite loci are selected for polymorphism detection, and each locus belongs to different chromosomes, which has little possibility of linkage with each other. The genetic distance clustering map drawn according to the microsatellite results may distinguish 98 Anqing six-end-white pigs into 7 pedigrees, which is consistent with the introduction records at the beginning of introducing the conservation population, indicating that the reliability of methods and/or kits of the present disclosure is high. The cumulative exclusion probability of NE-1P, NE-2P, NE-PP of the 14 microsatellite loci selected by the present disclosure is more than 99%, meeting the requirements of paternity testing among different individuals in production practice.
[0058] It can be seen that the above embodiment is only an exemplary embodiment adopted to illustrate the principle of the present disclosure. However, the present disclosure is not limited to this. Those skilled in the art can make various improvements and changes without departing from the essence of the present disclosure, which also belong to the protection scope of the present disclosure.