HUMAN IPSC-BASED DRUG TESTING PLATFORM FOR MUSCULAR DYSTROPHY

Abstract

Methods for identifying compounds in the treatment of muscular dystrophies, include the use of disease relevant cells derived from a patient. Compounds identified by these methods are useful in the treatment of muscular dystrophy.

Claims

1. A method of screening for candidate therapeutic agents, comprising: obtaining fibroblasts from a subject and generating induced pluripotent stem cells (iPSCs); differentiating the iPSCs to generate myoblasts; contacting the myoblasts with a candidate therapeutic agent; culturing the myoblasts with a detectably labeled anti-myosin heavy chain antibody; and, imaging and analyzing the myoblasts generated from the subject's iPSCs as compared to myoblasts generated from a healthy subject's iPSCs; thereby, screening for the candidate therapeutic agent.

2. The method of claim 1, wherein the detectable label comprises: anti-myosin antibody is detected by comprises: an immunofluorescent agent, radio labeled molecules fluorophores, radiochemical, luminescent compounds, electron-dense reagents, enzymes, biotin, radioactive compounds, non-radioactive compounds or digoxigenin.

3. The method of claim 2, wherein the detectable label is an immunofluorescent agent.

4. The method of claim 1, wherein the analysis comprises measuring average length of cells, expression of myosin heavy chain (MyHC) polypeptides as compared to positive and negative controls.

5. The method of claim 3, wherein the average length of cells is determined by: cell average length+0.3*MyHC (myosin heavy chain).

6. The method of claim 1, wherein the expression of myosin heavy chain is detected by intensity of immunofluorescent staining of MyHC polypeptides.

7. The method of claim 1, wherein absolute values of cell average length are measured to include compounds which normalize myotube formation but do not increase MyHC immunofluorescence.

8. The method of claim 1, wherein the candidate therapeutic agents have an equal or higher value than an average value of the positive control as measured by cell average length+0.3*MyHC and intensity of MyHC staining.

9. The method of claim 1, wherein a candidate therapeutic agent enhances myogenic fusion abilities of patient specific myoblasts as compared to a control.

10. The method of claim 1, further comprising measuring dose responses to a candidate therapeutic agent as determined by anti-MyHC immunocytochemistry, anti--actinin immunocytochemistry and average cell length.

11. The method of claim 1, wherein the fibroblasts are reprogrammed with one or more reprograming factors to produce an iPSC.

12. The method of claim 1, wherein the iPSCs are cultured as single cells on defined extracellular matrix material in serum-free media.

13. The method of claim 1, wherein the iPSCs are cultured in medium comprising a Wnt agonist and Notch antagonist to generate myoblasts.

14. The method of claim 13, wherein the myoblasts are identified by an expression profile as neural cell adhesion molecule positive and human natural killer-1 negative (NCAM.sup.+/HNK1.sup.).

15. The method of claim 1, wherein the subject is suffering from a muscular dystrophy.

16. The method of claim 15, wherein the muscular dystrophy comprises: Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, congenital muscular dystrophy, myotonic dystrophy, facioscapulohumeral muscular dystrophy (FSHD), limb-girdle muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy or Emery-Dreifuss muscular dystrophy.

17. The method of claim 16, wherein the muscular dystrophy is Duchenne muscular dystrophy (DMD).

18. (canceled)

19. (canceled)

20. A composition comprising a myoblast derived from an induced pluripotent stem cell (iPSC), wherein the iPSC is derived from a fibroblast from a subject with a muscular dystrophy.

21. The composition of claim 21, wherein the iPSC is derived from a fibroblast from a subject with Duchenne muscular dystrophy (DMD).

22. A method of producing an induced pluripotent stem cell (iPSC), comprising: obtaining a biological sample comprising fibroblasts or obtaining fibroblasts from a subject with a muscular dystrophy, and reprograming the fibroblasts with one or more reprograming factors to produce an iPSC.

23. The method of claim 22, wherein the muscular dystrophy comprises: Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, congenital muscular dystrophy, myotonic dystrophy, facioscapulohumeral muscular dystrophy (FSHD), limb-girdle muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy or Emery-Dreifuss muscular dystrophy.

24. The method of claim 22, wherein the muscular dystrophy is Duchenne muscular dystrophy (DMD).

25. The method of claim 22, wherein the iPSCs are cultured as single cells on defined extracellular matrix material in serum-free media.

26. The method of claim 22, wherein the one or more reprograming factors comprise: Oct-3/4, Sox family, Klf family, Myc family, PAX family, Glis1, Nanog, LIN28 or combinations thereof.

27. The method of claim 26, wherein the Sox family comprises Sox1, Sox2, Sox3, Sox15, Sox 18 or combinations thereof; the Klf family comprises Klf1, Klf2, Klf4, Klf5 or combinations thereof; and, the Myc family comprises c-myc, L-myc, N-myc or combinations thereof.

28. (canceled)

29. (canceled)

30. A method of producing a myoblast, comprising obtaining a biological sample comprising fibroblasts or obtaining fibroblasts from a subject with Duchenne muscular dystrophy (DMD), and reprograming the fibroblasts with one or more reprograming factors to produce an iPSC, culturing the iPSCs in medium comprising a Wnt agonist and a Notch antagonist to generate myoblasts.

31. The method of claim 31, wherein the iPSCs are cultured as single cells on defined extracellular matrix material in serum-free media.

32. The method of claim 31, wherein the one or more reprograming factors comprise: Oct-3/4, Sox family, Klf family, Myc family, Nanog, LIN28 or combinations thereof.

33. The method of claim 30, wherein the Sox family comprises Sox1, Sox2, Sox3, Sox15, Sox 18 or combinations thereof; the Klf family comprises Klf1, Klf2, Klf4, Klf5 or combinations thereof; and, the Myc family comprises c-myc, L-myc, N-myc or combinations thereof.

34. (canceled)

35. (canceled)

36. The method of claim 31, wherein the myoblasts are identified by an expression profile as neural cell adhesion molecule positive and human natural killer-1 negative (NCAM.sup.+/HNK1.sup.).

37. The method of claim 31, wherein the Wnt agonist comprises 5-(Phenylsulfonyl)-N-4-piperidinyl-2-(trifluoromethyl)benzene sulfonamide hydrochloride (WAY-316606), 2-Amino-4-[3,4-(methylenedioxy)benzylamino]-6-(3-methoxyphenyl)pyrimidine (BML-284), (hetero)arylpyrimidines, 2-[2-(4-Acetylphenyl)diazenyl]-2-(3,4-dihydro-3,3-dimethyl-1(2H)-isoquinolinylidene)acetamide (IQ1), (2S)-2-[2-(Indan-5-yloxy)-9-(1,1-biphenyl-4-ylmethyl)-9H-purin-6-ylamino]-3-phenyl-propan-1-ol (QS11), N-[2-(3,4-dimethoxyphenyl)ethyl]-2-ethyl-5-(phenylsulfonul)benzenesulfonamide, (1-(4-(Naphthalen-2-yl)pyrimidin-2-yl)piperidin-4-yl)methanamine, 3-(2,4-Dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione, 2-amino-4-[3,4-(methylenedioxy)benzyl-amino]-6-(3-methoxyphenyl)pyrimidine, 3-(2,4-Dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione (SB-216763), 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR99021), (2Z,3E)-6-Bromoindirubin-3-oxime (BIO), 3-[9-Fluoro-2-(piperidin-1-ylcarbonyl)-1,2,3,4-tetrahydro[1,4]diazepino[6,7,1-hi]indol-7-yl]-4-imidazo[1,2-a]pyridin-3-yl-1H-pyrrole-2,5-dione (LY2090314), dichloroacetic acid (DCA) or combinations thereof.

38. The method of claim 31, wherein a Notch antagonist comprises gamma-secretase inhibitors (GSIs), alpha-secretase inhibitors (ASIs), N[N-(3,5-Difluorophenylacetyl-L-alanyl)]-S-phenylglycine t-Butyl ester (DAPT), (5S)-(tert-Butoxycarbonylamino)-6-phenyl-(4R)-hydroxy-(2R)-benzylhexanoyl)-L-leucy-L-phenylalaninamide (GSI L685,458), (s,s)-2-(3,5-Difluorophenyl)-acetylamino]-N-(1-methyl-2-oxo-5-phenyl-2,3-dihydro-1H-benzo[e][1,4]diazepin-3-yl)-propionamide (compound E), dibenzazepine compounds, 7-amino-4-chloro-3-methoxyisocoumarin (JLK6), [11-endo]-N-(5,6,7,8,9,10-hexahydro-6,9-methano benzo[9][8]annulen-11-yl)-thiophene-2-sulfonamide (Compound 18), stapled peptides, peptides, peptidomimetics, antibodies, antibody fragments, enzymes, small molecules or combinations thereof.

39. (canceled)

40. (canceled)

41. (canceled)

42. (canceled)

43. (canceled)

44. (canceled)

45. (canceled)

46. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0056] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0057] FIGS. 1A-1D are a series of flow charts, graphs and image analyses demonstrating that the primary compound screening identified 9 hit compounds. FIG. 1A: Flow-chart of primary compound screening showing the screening process where patient's fibroblasts were induced to hiPSCs and differentiated into myoblasts. These patient iPSC-derived myoblasts were expanded and treated with compounds from JHCCL (v1.3). Cells were fixed and stained with MyHC antibody, imaged and analyzed by BD pathway 855 automated imaging system. FIG. 1B: Graph of distinguishable algorithm 1 values between gentamicin and DMSO treated D2 myoblasts (z=0.58). FIG. 1C: Graph of distinguishable algorithm 2 values between gentamicin and DMSO treated D2 myoblasts (z=0.59). FIG. 1D: 9 primary hit compounds (listed) were plotted based on two parameters used in algorithms: normalized cell average length and normalized MyHC intensity.

[0058] FIGS. 2A-2F are a series of fluorescent stains, graphs and blots demonstrating that secondary and tertiary screening narrowed the list of candidate compounds down to final two hits. FIG. 2A: Representative images of Saponin Q., fenofibrate, clomiphene, gentamicin and DMSO treated D2 myoblasts along with healthy hiPSC-derived myoblasts showing MyHC positive myotubes. FIG. 2B: Cell average length dose-response curve of Saponin Q., fenofibrate, clomiphene and gentamicin. FIG. 2C: Representative image of ginsenoside Rd-treated myoblasts labeled by MyHC. FIG. 2E Cell average length dose-response curve of ginsenoside Rd (FIGS. 2E-2F) Western blot quantification of MEF2C protein level post Saponin Q. and ginsenoside Rd treatment alongside healthy hiPSC derived myoblasts control and DMSO negative controls, *P 5 0.05, n=3. FIG. 2G: Quantification of MEF2C expressing nuclei of saponin Q. and ginsenoside Rd-treated D2 myoblasts, n=3, *P 5 0.05. (Data=MeanSEM, one-way ANOVA with Dunnett's multiple comparison test with DMSO negative control).

[0059] FIGS. 3A-3G are a series of illustrations, blots and graphs showing that two selected compounds ginsenoside Rd and fenofibrate function via FLT3 signaling and TGF- signaling, respectively. FIG. 3A: Top pathways selected by ingenuity pathway analysis of microarray result from ginsenoside Rd and fenofibrate-treated D2 myoblasts for 24 hours. Absolute z-score values above 2 were highlighted in red. FIGS. 3B and 3D: Quantification of western blot of p21 protein expression in D2 myoblasts treated with ginsenoside (25 M), FLT3 recombinant protein (100 ng/ml) or DMSO for 30 min, n=4, *P0.05. FIG. 3C, 3E: Quantification of western blot of phosphorylated ERK 1/2 (p-ERK 1/2) in D2 myoblasts treated with ginsenoside (25 M), FLT3 recombinant protein (100 ng/ml) or DMSO for 30 min, n=4, *P0.05. FIGS. 3F-3G: Quantification of western blot of phosphorylated SMAD2/3 (p-SMAD2/3) after the combination treatment of fenofibrate (8 M) and/or TGF-1 recombinant protein (40 ng/ml) for 24 h, n=4, *P0.05. (Data=MeanSEM, FIGS. 3D, 3E: one-way ANOVA with Dunnett's multiple comparison test with DMSO negative control, FIG. 3G: one-way ANOVA with Tukey's multiple comparison test).

[0060] FIGS. 4A-4F are a series of illustrations, blots and graphs showing Ginsenoside Rd (gin) (10 mg/kg) and fenofibrate (fen) (0.1% w/w) treatment ameliorate the disease symptom of mdx.sup.5cv mice. FIG. 4A: Scheme showing procedure of compound treatment of mdx mice. FIG. 4B: Body weight of mdx mice measured weekly from 3-week old to 10-week old. Sham control was mdx mice treated with standard diet, n=7 for all 3 groups. FIGS. 4C-4D: Staining and quantification of Masson's Trichrome-labeled fibrotic area (blue) in diaphragm muscle of mice, n(sham)=14, n(gin)=8, n(fen)=8, *P0.05, scale bar=200 m. FIG. 4E: Measurement of fore-limb grip strength normalized to body weight from mdx mice treated with ginsenoside Rd or fenofibrate, n(sham)=16, n(gin)=8, n(fen)=9, *P0.05. FIG. 4F: Maximum distance mdx mice ran, n(sham)=16, n(gin)=8, n(fen)=9, **P0.01. FIG. 4G: Fatigue index (%) represents the reduction in maximal tetanic tension measured after 5 minutes of repeated tetanic stimulation at 1 Hz in TA muscle of mdx mice, n=5 for all 3 groups. FIG. 4H: Susceptibility to injury (percent loss of maximal isometric force after lengthening contractions) of quadriceps muscle, n=5 for all 3 groups. *P0.05, **P0.01. (Data=MeanSEM, one-way ANOVA with Dunnett's multiple comparison test with sham control).

[0061] FIGS. 5A-5C are a series of a schematic representation (FIG. 5A), an immunofluorescent image (FIG. 5B) and a graph (FIG. 5C), showing the phenotype of DMD hiPSC-derived myoblasts. FIG. 5A: Illustration of the point mutation in dystrophin gene of D2325 patient (SEQ ID NOS: 1-3). FIG. 5B: Representative image of MyHC antibody-labeled myotubes compared with myoblasts derived from healthy hiPSC or D2 myoblasts, scale bar=50 m. FIG. 5C: Quantification of fusion index of (FIG. 5B) n=9 for both groups, ***P0.001. d, Algorithm 1 plot of all tested compounds along with DMSO (blue) and gentamicin (red) treated D2 cells. (Data=MeanSEM, student's t-test).

[0062] FIGS. 6A and 6B are scatter plots showing the result of two algorithm of D2 myoblasts treated by the JHCCL compound library. Algorithm 1 (FIG. 6A) and algorithm 2 (FIG. 6B) plot of all tested compounds along with DMSO (blue) and gentamicin (red) treated D2 cells.

[0063] FIGS. 7A-7G are graphs showing the dose-response of 9 hit compounds and analogs of Saponin Q and fenofibrate. FIG. 7A: 9 primary hit compounds dose-response measured by MyHC antibody immunofluorescent intensity/nuclei. Concentrations of compounds were 0.001, 0.01, 0.1, 1, 2, 3, 4, 6 M, except for saponin Q. which was 0.001, 0.01, 0.1, 0.2, 0.4, 0.6, 1 M (n=3 for all). FIG. 7B: 9 primary hit compounds dose-response measured by -actinin antibody immunofluorescent intensity/nuclei. Concentrations were same as in (FIG. 7A) (n=3 for all). FIGS. 7C-7E: Dose-response measured by cell average length of 3 analogs of saponin Q (n=3). FIGS. 7F-7G: Dose-response measured by cell average length of 2 analogs of fenofibrate (n=3). (Data=MeanSEM).

[0064] FIG. 8A is a series of representative immunocytochemistry images of MEF2C antibody labeled healthy hiPSC derived myoblasts or D2 cells that were treated with DMSO, ginsenoside Rd or saponin Q, scale bar=50 m. FIG. 8B: is a flow chart of the tiered compounds screen.

[0065] FIGS. 9A-9C show a heatmap and plots demonstrating the gene expression profiling by microarray. (A) Heat map of gene expression level in D2 myoblasts treated by DMSO (control), fenofibrate (fen) and ginsenoside Rd (gin) showing how treatment with each compound results in distinct gene expression changes, n=3. FIGS. 9B and 9C: Correlation between log 2 fold change from microarray and from qPCR for ginsenoside treatment (FIG. 9B) (5 M, 24 h) vs. DMSO (control) treatment; fenofibrate treatment (FIG. 9C) (8 M, 24 h) vs. DMSO (control) treatment (n=3 for all groups).

[0066] FIGS. 10A-10G are a series of graphs showing the histological and physiological findings of 10-week old mice treated with Ginsenoside Rd (gin) (10 mg/kg) or fenofibrate (fen) (0.1% w/w). FIG. 10A: Quantification of Evans blue dye-stained area signifying necrotic fibers (n(sham)=7, n(gin)=6, n(feno)=3) in gastrocnemius muscle and (FIG. 10B) Percentage of central nucleated fibers in tibialis anterior (TA) muscle (n(sham)=12, n(gin)=8, n(feno)=8) from mdx mice treated by ginsenoside Rd, fenofibrate along with the sham control. FIG. 10C: Specific force (muscle force normalized to muscle mass (MM), g/g) of TA muscle. FIG. 10D: Specific force (muscle torque normalized to muscle mass (MM), N.Math.mm/g) generated by quadricep (Quad) muscle from mdx mice treated by ginsenoside Rd or fenofibrate along with the sham control (n=5 for all 3 groups). FIGS. 10E-10G) cholesterol (FIG. 10E), HDL (FIG. 10F) and triglycerides (FIG. 10G) content in serum from mice treated with fenofibrate and sham control (n(sham)=9, n(feno)=5, **P0.01, ***P0.001, P****0.0001). (Data=MeanSEM, a-d: one-way ANOVA with Dunnett's multiple comparison test with sham control, e-g: student's t-test)

DETAILED DESCRIPTION

[0067] Drug development costs a significant amount of time and resources for new pharmaceutical drugs. Progress has been limited for orphan diseases such as Duchenne muscular dystrophy (DMD). Here, an exemplary drug screening campaign is described using human induced pluripotent stem cells (hiPSCs) and the identification of two potential drugs effective in a DMD mouse model (mdx). A DMD-hiPSC screening platform utilizing high-content imaging to identify hit compounds that enhance myogenic fusion abilities of patient-specific myoblasts. Among 1524 compounds (Johns Hopkins Clinical Compound library), two hit compounds increased in vitro fusion rates of DMD patient hiPSC-derived myoblasts. Transcriptional profiling revealed that the function of two selected compounds, ginsenoside Rd (natural product, ginseng extract) and fenofibrate (FDA-approved drug), are associated with FLT3 signaling and TGF- signaling, respectively. Preclinical tests in mdx mice show that the treatment of the two hit compounds can ameliorate the skeletal muscle phenotypes caused by dystrophin deficiency, suggesting the therapeutic potential of these two compounds. The study demonstrates the feasibility of early-stage drug development for rare and neglected diseases using symptom-relevant cells derived from patient-specific hiPSCs.

[0068] Accordingly, embodiments of the invention are directed in part to a screening process for the identification of drugs in the treatment of muscular dystrophies. In general, the steps include obtaining fibroblasts from a patient, e.g., a patient that has been diagnosed or suffering from a muscular dystrophy, such as, for example, Duchenne's muscular dystrophy (DMD). These fibroblasts are then induced to hiPSCs and differentiated into myoblasts. These patient iPSC-derived myoblasts are then expanded and treated with compounds from a compound library, for example. Cells were fixed and stained with MyHC antibody, imaged and analyzed by an automated imaging system. Primary hit compounds were plotted based on two parameters used in algorithms: normalized cell average length and normalized MyHC intensity.

[0069] Generation of Myoblasts

[0070] To harness the potential of human iPSCs, a protocol to direct hPSCs into the skeletal muscle lineage was developed by the inventors (Choi et al., 2016, Cell Reports 15, 2301-2312; incorporated herein in its entirety). Briefly, as the somite is an intermediate stage between hPSCs and myogenic progenitor cells a MESOGENIN1::eGFP reporter hESC line was generated with the CRISPR/Cas9 system. MESOGENIN1 is a genetic marker for the pre-somite mesoderm fate. Brief treatment (4 days after day 0 of differentiation) with CHIR99021, a GSK-3 inhibitor, significantly increased expression of MESOGENIN1::eGFP (80.8%11.3% cells out of total cells in a dish), TBX6 (67.4%10.4%), and PAX3 in a dose-dependent manner at day 4 and gave rise to myogenic cells expressing MyHC (MF20), MYOG, and MYOD at day 40 (30.4%13.7%, 37.7%5.78%, and 30.4%13.70%, respectively). CHIR99021 appeared to activate the canonical WNT signaling pathway, confirmed by -catenin translocation into the nucleus. WNT activation and inhibition of the PI3K pathway was sufficient for induction of MESOGENIN1::eGFP from hPSCs. To increase the speed and efficacy of myogenic specification, treatment from day 4 to day 12 with DAPT, a -secretase inhibitor that blocks Notch signaling, promoted a robust and fast myogenic differentiation. At day 30, 63.6%9.68% of cells were MF20.sup.+, and 61.5%11.0% were MYOGENIN.sup.+.

[0071] The resulting CHIR99021-DAPT culture in defined N2 media was tested on multiple hiPSC lines (>10 different clones) and consistently resulted in differentiation of myoblasts into multinucleated and spontaneously contractile myotubes. The hESC- and hiPSC-derived myotubes in CHIR99021-DAPT culture were further characterized by transmission electron microscopy. The spontaneously contracting myotubes showed a highly organized structure, including intact sarcomeres with distinct Z-lines, M-lines, and I-bands.

[0072] As discussed in the examples section which follows, the DMD-hiPSC are differentiated into myoblasts in chemically defined conditions that is free from animal feeder cells, serum or growth factors (15). This differentiation protocol involves plating single hiPSCs on defined extracellular matrix material and growing them for 25-30 days in serum-free medium with temporal activation of WNT and inhibition of NOTCH pathways.

[0073] Wnt:

[0074] The conserved Wnt/-Catenin pathway regulates stem cell pluripotency and cell fate decisions during development. This developmental cascade integrates signals from other pathways, including retinoic acid, FGF, TGF-, and BMP, within different cell types and tissues. The Wnt ligand is a secreted glycoprotein that binds to Frizzled receptors, leading to the formation of a larger cell surface complex with LRPS/6. Frizzleds are ubiquitinated by ZNRF3 and RNF43, whose activity is inhibited by R-spondin binding to LGR5/6. In this manner R-spondins increase sensitivity of cells to the Wnt ligand. Activation of the Wnt receptor complex triggers displacement of the multifunctional kinase GSK-3 from a regulatory APC/Axin/GSK-3-complex. In the absence of Wnt-signal (Off-state), -catenin, an integral E-cadherin cell-cell adhesion adaptor protein and transcriptional co-regulator, is targeted by coordinated phosphorylation by CK1 and the APC/Axin/GSK-3-complex leading to its ubiquitination and proteasomal degradation through the -TrCP/Skp pathway. In the presence of Wnt ligand (On-state), the co-receptor LRPS/6 is brought in complex with Wnt-bound Frizzled. This leads to activation of Dishevelled (Dvl) by sequential phosphorylation, poly-ubiquitination, and polymerization, which displaces GSK-3 from APC/Axin through an unclear mechanism that may involve substrate trapping and/or endosome sequestration. Stabilized -catenin is translocated to the nucleus via Racl and other factors, where it binds to LEF/TCF transcription factors, displacing co-repressors and recruiting additional co-activators to Wnt target genes. Additionally, -catenin cooperates with several other transcription factors to regulate specific targets. Importantly, researchers have found -catenin point mutations in human tumors that prevent GSK-3 phosphorylation and thus lead to its aberrant accumulation. E-cadherin, APC, R-spondin and Axin mutations have also been documented in tumor samples, underscoring the deregulation of this pathway in cancer. Wnt signaling has also been shown to promote nuclear accumulation of other transcriptional regulator implicated in cancer, such as TAZ and Snail 1. Furthermore, GSK-3 is involved in glycogen metabolism and other signaling pathways, which has made its inhibition relevant to diabetes and neurodegenerative disorders.

[0075] Any number of Wnt activators may be used in the assays of the invention to generate myoblasts. In certain embodiments, a Wnt agonist comprises 5-(Phenylsulfonyl)-N-4-piperidinyl-2-(trifluoromethyl)benzene sulfonamide hydrochloride (WAY-316606), 2-Amino-4-[3,4-(methylenedioxy)benzylamino]-6-(3-methoxyphenyl)pyrimidine (BML-284), (hetero)arylpyrimidines, 2-[2-(4-Acetylphenyl)diazenyl]-2-(3,4-dihydro-3,3-dimethyl-1(2H)-isoquinolinylidene)acetamide (IQ1), (2S)-2-[2-(Indan-5-yloxy)-9-(1,1-biphenyl-4-ylmethyl)-9H-purin-6-ylamino]-3-phenyl-propan-1-ol (QS11), N-[2-(3,4-dimethoxyphenyl)ethyl]-2-ethyl-5-(phenylsulfonul)benzenesulfonamide, (1-(4-(Naphthalen-2-yl)pyrimidin-2-yl)piperidin-4-yl)methanamine, 3-(2,4-Dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione, 2-amino-4-[3,4-(methylenedioxy)benzyl-amino]-6-(3-methoxyphenyl)pyrimidine, Dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione (SB-216763), 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR99021), (2Z,3E)-6-Bromoindirubin-3-oxime (BIO), 3-[9-Fluoro-2-(piperidin-1-ylcarbonyl)-1,2,3,4-tetrahydro[1,4]diazepino[6,7,1-hi]indol-7-yl]-4-imidazo[1,2-a]pyridin-3-yl-1H-pyrrole-2,5-dione (LY2090314), dichloroacetic acid (DCA) or combinations thereof.

[0076] Notch:

[0077] Numerous functions have been ascribed to Notch, with some of these helping to explain its cancer-promoting effects in many tissues. Notch helps maintain certain stem cell populations, but interestingly it is also a master regulator of cell fate at critical differentiation branch points in various organ systems. Notch is one of the most powerful of the stem cell-promoting pathways, in conjunction with the Hedgehog and Wnt pathways. Notch seems more likely to play an oncogenic role in cell types that it favors in development and differentiation, such as glial cells or T-cells. Notch activity promotes cell survival and has anti-apoptotic function and numerous mechanisms have been proposed for this. It can also drive cell division in some settings and in some settings may be required for the cell cycle.

[0078] Any number of notch inhibitors may be used in the assays of the invention. In certain embodiments, a Notch antagonist comprises gamma-secretase inhibitors (GSIs), alpha-secretase inhibitors (ASIs), N[N-(3,5-Difluorophenylacetyl-L-alanyl)]-S-phenylglycine t-Butyl ester (DAFT), (5S)-(tert-Butoxycarbonylamino)-6-phenyl-(4R)-hydroxy-(2R)-benzylhexanoyl)-L-leucy-L-phenylalaninamide (GSI L685,458), (s,s)-2-(3,5-Difluorophenyl)-acetylamino]-N-(1-methyl-2-oxo-5-phenyl-2,3-dihydro-1H-benzo[e][1,4]diazepin-3-yl)-propionamide (compound E), dibenzazepine compounds, 7-amino-4-chloro-3-methoxyisocoumarin (JLK6), [11-endo]-N-(5,6,7,8,9,10-hexahydro-6,9-methano benzo[9][8]annulen-11-yl)-thiophene-2-sulfonamide (Compound 18), stapled peptides, peptides, peptidomimetics, antibodies, antibody fragments, enzymes, small molecules or combinations thereof.

[0079] Muscular Dystrophy

[0080] Muscular dystrophy (MD) is a group of muscle diseases that results in increasing weakening and breakdown of skeletal muscles over time. The disorders differ in which muscles are primarily affected, the degree of weakness, how fast they worsen, and when symptoms begin. Many people will eventually become unable to walk. Some types are also associated with problems in other organs.

[0081] The muscular dystrophy group contains thirty different genetic disorders that are usually classified into nine main categories or types. The most common type is Duchenne muscular dystrophy (DMD) which typically affects males beginning around the age of four. Other types include Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, and myotonic dystrophy. They are due to mutations in genes that are involved in making muscle proteins. This can occur due to either inheriting the defect from one's parents or the mutation occurring during early development. Disorders may be X-linked recessive, autosomal recessive, or autosomal dominant. Diagnosis often involves blood tests and genetic testing. There is no cure for muscular dystrophy. Physical therapy, braces, and corrective surgery may help with some symptoms. Assisted ventilation may be required in those with weakness of breathing muscles. Medications used include steroids to slow muscle degeneration, anticonvulsants to control seizures and some muscle activity, and immunosuppressants to delay damage to dying muscle cells. Outcomes depend on the specific type of disorder.

[0082] Myotonic.

[0083] Also known as Steinert's disease, this form is characterized by an inability to relax muscles at will following contractions. Myotonic muscular dystrophy is the most common form of adult-onset muscular dystrophy. Facial and neck muscles are usually the first to be affected.

[0084] Facioscapulohumeral (FSHD).

[0085] Muscle weakness typically begins in the face and shoulders. The shoulder blades might stick out like wings when a person with FSHD raises his or her arms. Onset usually occurs in the teenage years but may begin in childhood or as late as age 40.

[0086] Congenital.

[0087] This type affects boys and girls and is apparent at birth or before age 2. Some forms progress slowly and cause only mild disability, while others progress rapidly and cause severe impairment.

[0088] Limb-Girdle.

[0089] Hip and shoulder muscles are usually the first affected. People with this type of muscular dystrophy may have difficulty lifting the front part of the foot and as a result may trip frequently. Onset usually begins in childhood or the teenage years.

[0090] In boys with DMD, walking abnormalities are a major disease manifestation that has great importance to patients and families. The major goal of medical and physical therapy intervention during the ambulatory phase of DMD is to maintain ambulation for as long as possible. Given that ambulatory compromise is a key component of the DMD disease process and that ambulation measures the function of multiple muscle groups as well as cardiovascular activity, ambulation-related outcome measures are the most relevant endpoints in DMD patients who are still able to walk. The 6-minute Walk Test (6MWT) is feasible, safe, and reliable in boys with DMD who have not yet transitioned to full time wheelchair use. The patients have markedly compromised ambulation relative to healthy boys and correlated 6-minute walk distance (6MWD) with age, anthropometric characteristics, and measures which change with disease progression, including stride length and cadence. In addition, 6MWD can be considered a proxy measure for the energy cost of locomotion in DMD. The 6MWT has been shown to be an integrated global measure of ambulatory function in DMD that is influenced by decreased lower extremity strength, biomechanical inefficiencies during gait, diminished endurance, and compromised cardio-respiratory status. Longitudinal data concerning the 6MWT in DMD have supported the clinically meaningful change in 6MWD to be in the range of 20 to 30 meters, which can serve as the targeted treatment effect in 12-month trials in ambulatory DMD. It appears that a decline of approximately 30 meters from an average performance on the 6MWT in DMD to a threshold 6MWD of <325 meters or <55%-predicted would place a patient with DMD at risk for more precipitous decline in ambulatory function over the subsequent year. Given the limitations of other measures in DMD including surrogate biomarkers, strength by myometry, and timed function tests (TFTs), the 6MWD has become the recommended primary outcome measure in ambulatory DMD. (McDonald, Craig M et al., The 6-minute walk test and other endpoints in Duchenne muscular dystrophy: longitudinal natural history observations over 48 weeks from a multicenter study Muscle & Nerve vol. 48, 3 (2013): 343-56).

[0091] Candidate Therapeutic Agents

[0092] In certain embodiments, the candidate agents or potential therapeutic agents increase in vitro fusion rates of, for example, a DMD patient, hiPSC-derived myoblasts as determined by the assays embodied herein.

[0093] Candidate agents include numerous chemical classes, though typically they are organic compounds including small organic compounds, nucleic acids including oligonucleotides, and peptides. Small organic compounds suitably may have e.g. a molecular weight of more than about 40 or 50 yet less than about 2,500. Candidate agents may comprise functional chemical groups that interact with proteins and/or DNA.

[0094] Candidate agents may be obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of e.g. bacterial, fungal and animal extracts are available or readily produced.

[0095] Candidate/Test Agents:

[0096] Various candidate agents can be employed in the screening methods of the invention, including any naturally existing or artificially generated agents. They can be of any chemistry class, such as antibodies, proteins, peptides, small organic compounds, saccharides, fatty acids, steroids, purines, pyrimidines, nucleic acids, and various structural analogs or combinations thereof. In some embodiments, the screening methods utilize combinatorial libraries of candidate agents. Combinatorial libraries can be produced for many types of compounds that can be synthesized in a step-by-step fashion. Such compounds include polypeptides, beta-turn mimetics, nucleic acids, polysaccharides, phospholipids, hormones, prostaglandins, steroids, aromatic compounds, heterocyclic compounds, benzodiazepines, oligomeric N-substituted glycines and oligocarbamates. Large combinatorial libraries of the compounds can be constructed by the encoded synthetic libraries (ESL) method described in Affymax, WO 95/12608, Affymax, WO 93/06121, Columbia University, WO 94/08051, Pharmacopeia, WO 95/35503 and Scripps, WO 95/30642 (each of which is incorporated herein by reference for all purposes). Peptide libraries can also be generated by phage display methods. See, e.g., Devlin, WO 91/18980. In some methods, prior to examining their ability to disrupt or inhibit P-syn* formation in a cell or animal model, combinatorial libraries of candidate agents can be first examined for suitability by determining their capacity to bind to P-syn*.

[0097] Candidate agents include numerous chemical classes, though typically they are organic compounds including small organic compounds, nucleic acids including oligonucleotides, peptides or antibodies. Small organic compounds suitably may have e.g. a molecular weight of more than about 40 or 50 yet less than about 2,500. Candidate agents may comprise functional chemical groups that interact with proteins and/or DNA.

[0098] Candidate agents may be obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of e.g. bacterial, fungal and animal extracts are available or readily produced.

[0099] Chemical Libraries:

[0100] Developments in combinatorial chemistry allow the rapid and economical synthesis of hundreds to thousands of discrete compounds. These compounds are typically arrayed in moderate-sized libraries of small molecules designed for efficient screening. Combinatorial methods can be used to generate unbiased libraries suitable for the identification of novel compounds. In addition, smaller, less diverse libraries can be generated that are descended from a single parent compound with a previously determined biological activity.

[0101] A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical building blocks, such as reagents. For example, a linear combinatorial chemical library, such as a polypeptide library, is formed by combining a set of chemical building blocks (amino acids) in a large number of combinations, and potentially in every possible way, for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.

[0102] A library may comprise from 2 to 50,000,000 diverse member compounds. Preferably, a library comprises at least 48 diverse compounds, preferably 96 or more diverse compounds, more preferably 384 or more diverse compounds, more preferably, 10,000 or more diverse compounds, preferably more than 100,000 diverse members and most preferably more than 1,000,000 diverse member compounds. By diverse it is meant that greater than 50% of the compounds in a library have chemical structures that are not identical to any other member of the library. Preferably, greater than 75% of the compounds in a library have chemical structures that are not identical to any other member of the collection, more preferably greater than 90% and most preferably greater than about 99%.

[0103] The preparation of combinatorial chemical libraries is well known to those of skill in the art. For reviews, see Thompson et al., Synthesis and application of small molecule libraries, Chem Rev 96:555-600, 1996; Kenan et al., Exploring molecular diversity with combinatorial shape libraries, Trends Biochem Sci 19:57-64, 1994; Janda, Tagged versus untagged libraries: methods for the generation and screening of combinatorial chemical libraries, Proc Natl Acad Sci USA. 91:10779-85, 1994; Lebl et al., One-bead-one-structure combinatorial libraries, Biopolymers 37:177-98, 1995; Eichler et al., Peptide, peptidomimetic, and organic synthetic combinatorial libraries, Med Res Rev. 15:481-96, 1995; Chabala, Solid-phase combinatorial chemistry and novel tagging methods for identifying leads, Curr Opin Biotechnol. 6:632-9, 1995; Dolle, Discovery of enzyme inhibitors through combinatorial chemistry, Mol. Divers. 2:223-36, 1997; Fauchere et al., Peptide and nonpeptide lead discovery using robotically synthesized soluble libraries, Can J. Physiol Pharmacol. 75:683-9, 1997; Eichler et al., Generation and utilization of synthetic combinatorial libraries, Mol Med Today 1: 174-80, 1995; and Kay et al., Identification of enzyme inhibitors from phage-displayed combinatorial peptide libraries, Comb Chem High Throughput Screen 4:535-43, 2001.

[0104] Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to, peptoids (PCT Publication No. WO 91/19735); encoded peptides (PCT Publication WO 93/20242); random bio-oligomers (PCT Publication No. WO 92/00091); benzodiazepines (U.S. Pat. No. 5,288,514); diversomers, such as hydantoins, benzodiazepines and dipeptides (Hobbs, et al., Proc. Nat. Acad. Sci. USA, 90:6909-6913 (1993)); vinylogous polypeptides (Hagihara, et al., J. Amer. Chem. Soc. 114:6568 (1992)); nonpeptidal peptidomimetics with .beta.-D-glucose scaffolding (Hirschmann, et al., J. Amer. Chem. Soc., 114:9217-9218 (1992)); analogous organic syntheses of small compound libraries (Chen, et al., J. Amer. Chem. Soc., 116:2661 (1994)); oligocarbamates (Cho, et al., Science, 261:1303 (1993)); and/or peptidyl phosphonates (Campbell, et al., J. Org. Chem. 59:658 (1994)); nucleic acid libraries (see, Ausubel, Berger and Sambrook, all supra); peptide nucleic acid libraries (see, e.g., U.S. Pat. No. 5,539,083); antibody libraries (see, e.g., Vaughn, et al., Nature Biotechnology, 14(3):309-314 (1996) and PCT/US96/10287); carbohydrate libraries (see, e.g., Liang, et al., Science, 274:1520-1522 (1996) and U.S. Pat. No. 5,593,853); small organic molecule libraries (see, e.g., benzodiazepines, Baum C&E News, January 18, page 33 (1993); isoprenoids (U.S. Pat. No. 5,569,588); thiazolidinones and metathiazanones (U.S. Pat. No. 5,549,974); pyrrolidines (U.S. Pat. Nos. 5,525,735 and 5,519,134); morpholino compounds (U.S. Pat. No. 5,506,337); benzodiazepines (U.S. Pat. No. 5,288,514); and the like.

[0105] Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem. Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass., 433A Applied Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford, Mass.). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, Mo., ChemStar, Ltd., Moscow, RU, 3D Pharmaceuticals, Exton, Pa., Martek Bio sciences, Columbia, Md., etc.).

[0106] In some embodiments, a method of identifying candidate therapeutic agents comprises screening a sample containing the specific target molecule in a high-throughput screening assay.

[0107] In certain embodiments, a method of screening for candidate therapeutic agents, comprises obtaining fibroblasts from a subject and generating induced pluripotent stem cells (iPSCs); differentiating the iPSCs to generate myoblasts; contacting the myoblasts with a candidate therapeutic agent; culturing the myoblasts with a detectably labeled anti-myosin heavy chain antibody; and, imaging and analyzing the myoblasts generated from the subject's iPSCs as compared to myoblasts generated from a healthy subject's iPSCs.

[0108] In another aspect, the invention provides methods for diagnosing or monitoring disease progression in subjects affected by muscular dystrophy. The method comprises obtaining fibroblasts from a subject and generating induced pluripotent stem cells (iPSCs); differentiating the iPSCs to generate myoblasts; culturing the myoblasts with a detectably labeled anti-myosin heavy chain antibody; and, imaging and analyzing the myoblasts generated from the subject's iPSCs as compared to myoblasts generated from a healthy subject's iPSCs. Comparisons of the results over periods of time provides a measure of disease progression and whether a candidate agent is producing therapeutic results. A decrease in in the in vitro fusion rates of the patient hiPSC-derived myoblasts is diagnostic of the disease and/or the severity of disease.

[0109] Pharmaceutical Formulations.

[0110] The active compounds described herein, e.g. ginsenoside Rd, fenofibrate, a candidate therapeutic agent(s) or combinations thereof, may be formulated for administration in a pharmaceutical carrier in accordance with known techniques. See, e.g., Remington, The Science and Practice of Pharmacy (21.sup.st Ed. 2005). In the manufacture of a pharmaceutical formulation according to the invention, the active compound is typically admixed with, inter alia, an acceptable carrier. The carrier must, of course, be acceptable in the sense of being compatible with any other ingredients in the formulation and must not be deleterious to the subject. The carrier may be a solid or a liquid, or both, and is preferably formulated with the compound as a unit-dose formulation, for example, a tablet, which may contain from 0.01 or 0.5% to 95% or 99% by weight of the active compound. One or more active compounds may be incorporated in the formulations of the invention, which may be prepared by any of the well-known techniques of pharmacy comprising admixing the components, optionally including one or more accessory ingredients.

[0111] Furthermore, a pharmaceutically acceptable component such as a sugar, carrier, excipient or diluent of a composition according to the present invention is a component that (i) is compatible with the other ingredients of the composition in that it can be combined with the compositions of the present invention without rendering the composition unsuitable for its intended purpose, and (ii) is suitable for use with subjects as provided herein without undue adverse side effects (such as toxicity, irritation, and allergic response). Side effects are undue when their risk outweighs the benefit provided by the composition. Non-limiting examples of pharmaceutically acceptable components include any of the standard pharmaceutical carriers such as saline solutions, water, emulsions such as oil/water emulsion, microemulsions and various types of wetting agents.

[0112] The formulations include those suitable for oral, rectal, topical, buccal (e.g., sub-lingual), vaginal, parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous), topical (i.e., both skin and mucosal surfaces, including airway surfaces) and transdermal administration, although the most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular active compound which is being used.

[0113] Formulations suitable for oral administration may be presented in discrete units, such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of the active compound; as a powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water or water-in-oil emulsion. Such formulations may be prepared by any suitable method of pharmacy which includes the step of bringing into association the active compound and a suitable carrier (which may contain one or more accessory ingredients as noted above). In general, the formulations of the invention are prepared by uniformly and intimately admixing the active compound with a liquid or finely divided solid carrier, or both, and then, if necessary, shaping the resulting mixture. For example, a tablet may be prepared by compressing or molding a powder or granules containing the active compound, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing, in a suitable machine, the compound in a free-flowing form, such as a powder or granules optionally mixed with a binder, lubricant, inert diluent, and/or surface active/dispersing agent(s). Molded tablets may be made by molding, in a suitable machine, the powdered compound moistened with an inert liquid binder.

[0114] Formulations suitable for buccal (sub-lingual) administration include lozenges comprising the active compound in a flavored base, usually sucrose and acacia or tragacanth; and pastilles comprising the compound in an inert base such as gelatin and glycerin or sucrose and acacia.

[0115] Formulations of the present invention suitable for parenteral administration comprise sterile aqueous and non-aqueous injection solutions of the active compound(s), which preparations are preferably isotonic with the blood of the intended recipient. These preparations may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions may include suspending agents and thickening agents. The formulations may be presented in unit\dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water-for-injection immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described. For example, in one aspect of the present invention, there is provided an injectable, stable, sterile composition comprising an active compound(s), or a salt thereof, in a unit dosage form in a sealed container. The compound or salt is provided in the form of a lyophilizate which is capable of being reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection thereof into a subject. The unit dosage form typically comprises from about 10 mg to about 10 grams of the compound or salt. When the compound or salt is substantially water-insoluble, a sufficient amount of emulsifying agent which is physiologically acceptable may be employed in sufficient quantity to emulsify the compound or salt in an aqueous carrier. One such useful emulsifying agent is phosphatidyl choline.

[0116] Formulations suitable for rectal administration are preferably presented as unit dose suppositories. These may be prepared by admixing the active compound with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.

[0117] Formulations suitable for topical application to the skin preferably take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers which may be used include petroleum jelly, lanoline, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof.

[0118] Formulations suitable for transdermal administration may be presented as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. Formulations suitable for transdermal administration may also be delivered by iontophoresis (see, for example, Pharmaceutical Research 3 (6):318 (1986)) and typically take the form of an optionally buffered aqueous solution of the active compound. Suitable formulations comprise citrate or bis\tris buffer (pH 6) or ethanol/water and contain from 0.1 to 0.2M active ingredient.

[0119] Further, the present invention provides liposomal formulations of the compounds disclosed herein and salts thereof. The technology for forming liposomal suspensions is well known in the art. When the compound or salt thereof is an aqueous-soluble salt, using conventional liposome technology, the same may be incorporated into lipid vesicles. In such an instance, due to the water solubility of the compound or salt, the compound or salt will be substantially entrained within the hydrophilic center or core of the liposomes. The lipid layer employed may be of any conventional composition and may either contain cholesterol or may be cholesterol-free. When the compound or salt of interest is water-insoluble, again employing conventional liposome formation technology, the salt may be substantially entrained within the hydrophobic lipid bilayer which forms the structure of the liposome. In either instance, the liposomes which are produced may be reduced in size, as through the use of standard sonication and homogenization techniques.

[0120] Of course, the liposomal formulations containing the compounds disclosed herein or salts thereof, may be lyophilized which may be reconstituted with a pharmaceutically acceptable carrier, such as water, to regenerate a liposomal suspension.

[0121] Other pharmaceutical compositions may be prepared from the water-insoluble compounds disclosed herein, or salts thereof, such as aqueous base emulsions. In such an instance, the composition will contain a sufficient amount of pharmaceutically acceptable emulsifying agent to emulsify the desired amount of the compound or salt thereof. Particularly useful emulsifying agents include phosphatidyl cholines, and lecithin.

[0122] In addition to active compound(s), the pharmaceutical compositions may contain other additives, such as pH-adjusting additives. In particular, useful pH-adjusting agents include acids, such as hydrochloric acid, bases or buffers, such as sodium lactate, sodium acetate, sodium phosphate, sodium citrate, sodium borate, or sodium gluconate. Further, the compositions may contain microbial preservatives. Useful microbial preservatives include methylparaben, propylparaben, and benzyl alcohol. The microbial preservative is typically employed when the formulation is placed in a vial designed for multidose use. Of course, as indicated, the pharmaceutical compositions of the present invention may be lyophilized using techniques well known in the art.

[0123] In some embodiments of this invention, the compounds are present in an aqueous solution for subcutaneous administration. In some embodiments, the compounds are provided as a lyophilized powder that is reconstituted and administered subcutaneously.

EXAMPLES

Example 1: Duchenne Muscular Dystrophy hiPSC-Derived Myoblasts Based Drug Screen Identifies Small Molecule Compounds

[0124] Material and Methods

[0125] Animal and Treatment.

[0126] All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of The Johns Hopkins University, School of Medicine (Baltimore, Md.). Mdx.sup.5cv (B6Ros.Cg-Dmdmdx-5Cv/J) were obtained from The Jackson Laboratory. Mice were maintained in a 12-h light cycle (7 am-7 pm) with ad libitum access to food and water. Male mdx mice at 3-week-old were randomly assigned to one of the three groups, no treatment, fenofibrate or gensinoside Rd. Mice received either a regular diet of chow or a diet containing fenofibrate (0.1%, w/w, Sigma, St Louis, Mo., USA) mixed into the standard chow diet (Global 18% Protein Rodent Diet-Control, Teklad). Ginsenoside Rd was suspended in saline containing 10% 1,3-propanediol as vector. Ginsenoside Rd was provided to mdx mice through Intraperitoneal injection and fenofibrate through diet to age-matched and gender-matched db/m mice for 8 weeks starting at 3 weeks of age.

[0127] Generation of DMD Patient's iPSC.

[0128] Fibroblasts D2325 was obtained from a DMD patient with the approval of the Johns Hopkins Institutional Review Board. Genetic testing revealed that this patient had a stop codon mutation at c.457. Other fibroblasts were purchased from Coriell Institute for Medical Research (Catalog Number, Camden, N.J., USA) with appropriate Material Transfer Agreement documents. Human cells were cultured in DMEM media containing 10% fetal bovine serum (FBS). Fibroblasts were plated onto 24-well plates and reprogrammed with CytoTune-iPS Sendai Reprogramming Kit (Invitrogen) with the standard protocol. After 9 days, cells were seeded onto MEF feeder layer.

[0129] iPSC Differentiation and Myoblasts Maintenance.

[0130] The DMD hiPSC-derived myoblasts were differentiated using the CHIR-DAPT protocol (Chal J, et al. (2015) Differentiation of pluripotent stem cells to muscle fiber to model Duchenne muscular dystrophy. Nat Biotechnol 33(9):962-969). Briefly, hiPSCs were plated as single cells on Geltrex (Gibco) treated dishes, at a density of 1.510.sup.5 cells per well in a 24-well plate, in the presence of MEF-conditioned N2 media containing 10 ng/ml of FGF-2 (PeproTech) and 10 M of Y-27632 (Cayman). The cells were induced to differentiate into myoblasts by adding CHIR99021 (3 M) in N2 medium for 4 days and by DAPT (10 M) for the following 8 days. Cells continued to differentiate and mature in N2 medium for the next 13 days. Myoblasts were collected by FACS with the selection marker NCAM+/HNK1 (NCAM:5.1H11, DSHB; HNK1: C6680, Sigma).

[0131] The NCAM+/HNK1 myoblasts were maintained in a humidified incubator containing 5% CO.sub.2 at 37 C. and grown in N2 media supplemented with 10% FBS. To induce myotube formation, expanded NCAM+/HNK1 myoblasts were plated to confluence, and switched to N2 media without serum.

[0132] Drug Screen.

[0133] The FACS-sorted DMD-hiPSC-derived myoblasts were seeded at 25,000 cells per well in 96 well plates. Medium was changed to N2 without additional serum and cells were treated with compounds from the Johns Hopkins Clinical Compound Library (JHCCL v1.3) (1 M), DMSO (0.1%, negative control) or gentamicin (500 g/ml, Sigma) every 3 days for 9 days. The compound library consisted of 1,524 small molecules. Cells were then fixed with 4% PFA and stained with Myosin Heavy Chain antibody (MyHC). Automated image acquisition protocol with high content imaging/analyzing system (BD Pathway 855, available at ChemCore, JHSOM), and automated analysis programming (BD AttoVision) were used to image and analyze myotube formation. Primary hits were validated in secondary replicate experiments (n=3), and statistical significance was determined by one-way ANOVA with post-hoc Tukey Test for comparing multiple treatments

[0134] Western Blot.

[0135] Whole-cell extracts were prepared by lysing cells on plate with RIPA buffer (CST) supplemented by proteinase inhibitor and phosphatase inhibitor cocktail (CST). Western blotting was performed according to the standard protocol using precast NuPAGE (4-12%) Bis-Tris gel (Invitrogen). Protein transfer was performed with the Bio-Rad turbo or wet/tank blotting system. Nitrocellulose membranes were incubated with primary antibodies overnight at 4 C. Membranes were then incubated with a secondary IRDye 800 conjugated anti-rabbit IgG, or Alexa Fluor 680 anti-mouse IgG and proteins were visualized and quantified using the LI-COR Odyssey Infrared Imaging System (LI-COR). Primary antibodies applied in this study were all purchased from Cell Signaling Technology except for the MEF2C antibody, which was from Sigma.

[0136] Affymetrix Microarray and qPCR.

[0137] Triplicate samples were used in microarray analysis. D2 hiPSC derived myoblasts were treated with ginsenoside (5 M), fenofibrate (8 M) or DMSO for 24 h in the differentiation medium. RNA was isolated using TRIzol (Invitrogen Life Technologies, Carlsbad, Calif.) followed by purification and DNase digestion using RNeasy mini kits (Qiagen, Venlo, Netherlands) according to manufacturer's instructions. Quantification of total RNA was performed on a Nanodrop spectrophotometer (Thermo Scientific) and RNA quality was tested on an Agilent TapeStation with R6K ScreenTapes (RIN 7.6-9.8). Generation of sense strand cDNA from purified total RNA was followed by second strand synthesis, in vitro transcription cDNA synthesis, and single stranded cDNA synthesis and RNA hydrolysis. Fragmentation and labelling were performed according to manufacturer's instructions (GeneChip WT Plus reagent kit, Affymetrix, Santa). RNA extraction and qPCR were performed according to previous protocols, and primers are included in Table 1. The microarray data has been deposited in NCBI's Gene Expression Omnibus database and is accessible through the GEO series accession number GSE121023.

[0138] Treadmill and Grip Strength.

[0139] Forelimb grip strength was measured as maximal tensile force using a computerized force transducer (Grip Strength Meter, Bioseb). Five measurements were performed for each animal and the maximum value was used for the analysis. Treadmill testing was performed using a motor-driven treadmill (Columbus Instruments). Prior to the test day, acclimatization was performed 5 times over a period of 2 weeks at 10 m/min. On the test day, mice ran at 5 m/min for 5 min (warm up) and the speed was increased 1 m/min every min up to 10 m/min. Mice were considered exhausted when they sat for more than 10 sec on a shock pad for the third time.

[0140] Evans Blue Staining and Histology Analysis.

[0141] Gastrocnemius, tibialis anterior, and diaphragm muscles were embedded in OCT, frozen in isopentane, and cross-sectioned (2-10 m thickness). The sections were also stained with DAPI to visualize nuclei. In mice where Evans blue dye (EBD, 10 mg/ml) was used to evaluate membrane damage, EBD was injected at 0.05 ml/10 g intraperitoneally, 24 hours before sacrificing the mice. To evaluate EBD staining, gastrocnemius muscle sections were fixed with acetone and imaged with fluorescence microscopy. The area of EBD as a percentage of total area was calculated. To evaluate the number of central nucleated fibers, sections of the tibialis anterior muscle were stained with hematoxylin and eosin. Central nucleated fiber number was counted and analyzed against total fiber number. Diaphragm sections (10 m) were stained with Masson's trichrome to determine collagen content. The stained areas were quantified against the total area.

[0142] In vivo muscle physiology. Quadriceps strength (maximal isometric torque) and susceptibility to injury were assessed in vivo as described (69, 70). Briefly, animals were anaesthetized with 3-5% isoflurane and placed in a supine position. The thigh was stabilized and the ankle was secured on to a lever arm. The knee was aligned with the axis of the stepper motor (model T8904, NMB Technologies, Chatsworth, Calif., USA) and a torque sensor (QWFK-8M, Sensotec, Columbus, Ohio, USA), and the femoral nerve was stimulated via subcutaneous needle electrodes. A custom program based on commercial software (LabView version 8.5, National Instruments, Austin, Tex., USA) was used to synchronize contractile activation and the onset of forced knee flexion. The position of the leg that results in optimal muscle length has been previously described and maximum isometric torque was measured in Newton-millimeters (Nmm). Injury was induced by 15 forced lengthenings (knee flexion) superimposed onto maximal quadriceps contractions through a 40-100 degree arc of motion (with full knee extension considered 0 deg) spaced 1 min apart. Loss in maximal isometric torque was measured 5 min after the last lengthening contraction. Since the knee position, lever arm, and moment arm of the muscle are unchanged between tests, maximal isometric torque reflects maximal isometric muscle force.

[0143] Tibialis anterior muscle strength (maximal isometric force) and rate of fatigue were measured. Briefly, animals were anaesthetized with 3-5% isoflurane and placed in a supine position. The tibia was stabilized and the distal tendon of the tibialis anterior (TA) was surgically released and attached to the load cell (FT03, Grass Instruments, Warwick, R.I.). The load cell was adjusted via a micromanipulator to stretch the muscle to resting length (aka, optimal length). TA contraction was then triggered via subcutaneous stimulation of the fibular nerve, and the resulting force generated was sampled at 1 kHz and analyzed with acquisition software (PolyVIEW 16, Grass Instruments). After contractile function experiments, animals were euthanized and the TAs were harvested and weighed. As muscle length was fixed in all experiments, and muscle density is assumed to be a constant, physiological cross-sectional area of the TA was solely a function of muscle mass. Force was therefore normalized to TA mass to calculate as specific force (g/g). To provide an index of fatigue, muscle tension was measured after 5 minutes of tetanic stimulation (200 ms train duration) repeated at 1 Hz and expressed as a percentage of initial tension.

[0144] Blood Content Analysis.

[0145] Mdx mouse blood samples were collected by cardiac puncture. Serum samples were separated with microvette CB 300 (Sarstedt). Plasma samples were collected using microtainer, and plasma analyses were carried out at the Phenotyping and Pathology Core at the Johns Hopkins University School of Medicine. Serum triglyceride and cholesterol levels were measured with an infinity kit (Thermo Fisher Scientific, Middletown, Va.). Non-esterified free fatty acids were measured with a NEFA-HR (2) kit (Wako Chemicals, Richmond, Va.).

[0146] Statistical Analysis.

[0147] All data are shown as meanSEM and were subjected to statistical analysis. Significance was analyzed by one-Way ANOVA using Dunnett's, Tukey's multiple comparison test or were analyzed by two-tailed unpaired Student's t-test. The n values indicate the number of independent biological samples. Data were analyzed and represented with GraphPad Prism. Investigators were blinded to allocation during experiments and outcome assessment, except for when blinding was not possible.

[0148] Results

[0149] Primary Screening of a Small Molecule Compound Library with DMD Patient hiPSC-Derived Myoblasts.

[0150] DMD-patient-derived myoblasts were generated from hiPSC in a chemically defined system of Wnt activation and Notch inhibition (Choi I. Y, et al. (2016) Cell Reports 15(10):2301-2312) and used patient-specific myoblasts that were derived from D2325 hiPSC line of a DMD patient (hereafter D2 myoblast) whose DMD gene encoding dystrophin carried a nonsense mutation (c.457 C->T) (FIG. 5A). Compared with the healthy hiPSC-derived myoblasts, D2 myoblasts formed very few myotubes based on myosin heavy chain (MyHC) antibody staining (FIGS. 5B-5C). These data were consistent with the inventors' previous studies, in which myoblasts derived from multiple DMD-hiPSC lines with various DMD gene mutations formed significantly fewer myotubes, based on MyHC staining (Choi I. Y, et al. (2016); Chal J, et al. (2015). Nat Biotechnol 33(9):962-969; Blau H M, et al., (1983). Proceedings of the National Academy of Sciences of the United States of America 80(15):4856-4860), an observation also made in primary myoblasts of DMD patients (Jasmin G, et al. (1984). Lab Invest 50(2):197-207; Delaporte C et al. (1984). J Neurol Sci 64(2):149-160). Inefficient myotubes formation was partially reversed by a known stop-codon read-through compound, gentamicin (FIG. 2A) (Barton-Davis E R, et al. (1999) The Journal of Clinical Investigation 104(4):375-381). Although not used in the clinical setting due to an unfavorable risk/benefit profile (Malik V, et al. (2010). Annals of Neurology 67(6):771-78021), gentamicin provided a positive control in the screen. To test the feasibility of the compound screening format, myoblasts treated with gentamicin or vehicle control (DMSO) were imaged and analyzed by High-content imaging analysis system (BD pathway 855) that could detect and outline the MyHC positive cells (FIG. 1A). A variety of parameters were compared after the treatment of gentamicin or vector DMSO on D2 myoblasts in differentiation condition. It was found that when Average Length of Cells which describes the length of each outlined object was considered, statistically distinguishable values between positive and negative controls (Z=0.59) (FIG. 1C) were obtained. MyHC immunofluorescent intensity was also considered as it is a myotube marker and measuring its protein expression is a hall mark for myotube formation (Schiaffino S, et al. (2015) Skelet Muscle 5:22). However, as the background noise was higher in MyHC measurement, the impact on its value was reduced by 70%. Therefore, when both cell average length and MyHC intensity were taken into account, it is still a valid readout (Z=0.58) (FIG. 1B). To minimalize the plate to plate variation, the values obtained from each tested compound were normalized to positive and negative controls. Thus, algorithm 1 as equation: normalized Cell ave length+0.3*MyHC intensity. Also, in order to not exclude the compounds that can restore the myotube shape without increasing the MyHC immunofluorescent intensity, absolute values of cell average length (without normalization) were used as algorithm 2. Algorithm 2 also helps to eliminate the compounds that are auto-fluorescent.

[0151] After cell plating conditions were optimized (see Materials and Methods), D2 myoblasts were seeded onto 96-well plates and screened with 1,524 small molecule compounds from the Johns Hopkins Clinical Compound Library (v 1.3), which contains both FDA- and foreign-approved drugs (Chong C R, et al. (2006) Nat Chem Biol 2(8):415-416). The compounds in the library are structurally diverse and some of them are natural compounds. Therefore, they are suitable for drug repurposing for rare diseases. Compounds that had values of Algorithm 1 above the average value of gentamicin-treated myoblasts were selected (FIG. 6A). The absolute value of the cell average length (FIG. 6B) was also used to select candidate compounds that had the highest values of each plate. The compounds that fulfilled both criteria by both Algorithm 1 and Algorithm 2 included 9 compounds which showed distinctive value from negative controls and aligned with the gentamicin group (FIG. 1D).

[0152] Two out of nine hit compounds (methazolamide and clomiphene) have previously been reported to ameliorate the disease phenotype of the mdx mouse model. Methazolamide was identified in a drug screening of the C. elegans model and it was shown to increase the tetanic force in mdx mice. Clomiphene is an analog of tamoxifen that was shown to increase force production and suppress fibrosis in mdx mice. The identification of methazolamide and clomiphene by these two algorithms supported the validity of the screening efforts and data analysis.

[0153] Secondary and Tertiary Screen to Obtain 2 Final Hit Compounds.

[0154] To further evaluate the efficacy of the 9 hit compounds and determine their optimal concentrations, an 8-point dose response assay was conducted, based on three parameters: anti-MyHC immunocytochemistry, anti--actinin immunocytochemistry and average cell length (FIGS. 7A-7B). The final hit compounds were determined by their ability to generate does-dependent response curve with at least two of the above three parameters. Based on that, three hit compounds were selectedclomiphene, saponin Q. (saponin from quillaja bark) and fenofibrate (FIG. 2B, FIGS. 7A-7B). As the analog of clomiphene, tamoxifen, has been discovered and is already under clinical trial, Saponin Q. and fenofibrate were selected for further analysis. However, Saponin Q. has relatively high toxicity among all members in the saponin family and thus cell death was observed after a high concentration treatment of saponin Q. To find alternative natural products that were less toxic, 4 analogs of saponin (akebia, soya saponin, sasarpogenin and ginsenoside Rd) were tested (FIG. 2C, FIG. 7C-7E). Among them, ginsenoside Rd treatment not only showed a dose-dependent effect on D2 myoblasts, but also increased the levels of MEF2C protein expression as detected by both Western blots, whereas saponin Q. did not (FIGS. 2D-2E). Immunocytochemistry confirmed the above result by showing that upon ginsenoside Rd treatment, there were more MEF2C expressing cells compared with vector control (FIG. 2F, FIG. 8A). Therefore, ginsenoside Rd holds advantages over saponin Q. not only due to its lower toxicity, but also because it induces MEF2C protein expression, which is critical for myogenic differentiation. As a result, the selected final lead compounds were fenofibrate and ginsenoside Rd (FIG. 8B).

[0155] TGF-Beta and ERK1/2 Signaling Pathways Play Key Roles in Improving Myotube Formation of Dystrophin Deficient Myoblasts.

[0156] In order to elucidate the mechanism whereby the two final hit compounds ameliorate fusion defects of the D2 myoblasts, an unbiased global transcriptional profile was performed on D2 myoblasts treated with either fenofibrate (fen, 8 M) or ginsenoside Rd (gin, 5 M). The heat map showed distinctive gene expression profiles among groups (FIG. 9A), and the transcriptional analysis results were validated by qRT-PCR (27) (FIG. 9B-C). The ingenuity pathway analysis shows that the most significant positive correlation (z-score>2) after ginsenoside Rd treatment is with the FLT3 signaling pathway (FIG. 3A). It has been reported that FLT3 regulates myogenic differentiation by enhancing the expression of p21 (WAF1/CIP1), a cell cycle inhibitor, resulting in cells exiting the cell cycle. Increased levels of p21 were detected in D2 myoblasts under the treatment of FLT3 and this effect was also seen in ginsenoside Rd-treated D2 myoblasts (FIGS. 3B-3C). At the same time, ERK1/2, a known FLT3 pathway downstream effector, was activated both by FLT3 recombinant protein and ginsenoside Rd in D2 myoblasts (FIGS. 3D-E). As for fenofibrate, it was shown to suppress TGF- signaling in D2 myoblasts (z-score<2 in the pathway analysis. Indeed when fenofibrate was applied to D2 myoblasts together with TGF1 recombinant protein, SMAD2/3 phosphorylation was reduced, indicating fenofibrate suppressed TGF- signaling (FIG. 3F-G) (Derynck R & Zhang Y E (2003) Nature 425(6958):577-584.). As TGF- signaling plays a suppressive role in muscle differentiation, it is likely that fenofibrate improves D2 myoblasts differentiation/fusion efficiency by inhibiting TGF-. From the above results, it was concluded that the positive effects of ginsenoside Rd and fenofibrate are associated with the FLT3 and TGF- pathways, respectively.

[0157] Ginsenoside Rd and Fenofibrate Ameliorate the Disease Phenotype of the Mdx Mouse Model of DMD.

[0158] Since ginsenoside Rd and fenofibrate were effective in correcting the in vitro DMD phenotype of DMD hiPSC-derived myoblasts, it was sought to determine if they also had a therapeutic effect in vivo. Therefore, each of the two compounds were tested in mdx.sup.5cv mice, which carry a nonsense mutation in exon 10 of the DYSTROPHIN gene, causing a frameshift deletion in the encoded mRNA (Delaney K, et al. Cell Biology international 41(7):706-715). Ginsenoside Rd (10 mg/kg) was administered through daily intraperitoneal injection and fenofibrate (0.1% w/w) through diet beginning postnatal day 21, for 8 weeks (FIG. 4A). Neither of the compounds affected the growth curve of the mdx mice (FIG. 4B). Fenofibrate lowered the level of triglyceride while increasing high-density lipoprotein (HDL) and cholesterol in the blood (FIGS. 10E-10G). At the end of the treatment period, the pathology of different muscles was assessed. Skeletal muscle fibrosis is most prominent in the diaphragm of young mdx and the levels of fibrosis in diaphragm were reduced by the treatment of ginsenoside Rd (29%) and fenofibrate (42.1%) (FIG. 4C-D). The number of Evans blue dye positive fibers (a marker of cell membrane damage) and central nucleated fibers (a marker of muscle degeneration and regeneration) were not significantly different in treated muscles (FIG. 10A). A series of physiological tests were performed to assess muscle function, including grip strength and treadmill running. Both fenofibrate and ginsenoside Rd improved mdx mouse forelimb grip strength by 16% and 19%, respectively (FIG. 4E). Fenofibrate treatment improved the endurance on treadmill running by 50% compared with control mdx mice, while ginsenoside Rd had no effect on treadmill running (FIG. 4F). Interestingly, there was no significant difference in the maximal isometric force generated by tibialis anterior (TA) or quadriceps muscle with either treatment compared with sham control (FIGS. 10C-10D). However, repeated maximal isometric contractions showed that the TA muscles of treated mice were less susceptible to fatigue compared to mdx TA muscles (FIG. 4G). As expected based on previous studies, mdx quadriceps (Quad) muscles were highly susceptible to injury (785.3% loss in muscle force after injury), but treatment with ginsenoside Rd or fenofibrate resulted in significantly less contraction-induced injury (564.8% and 503.5% loss in muscle force, respectively) (FIG. 4H). Overall, the ginsenoside Rd and fenofibrate treatment significantly ameliorated disease phenotypes in the mdx mice.

[0159] Discussion

[0160] Drug discovery and repurposing for treating DMD has mostly employed two strategies: restoring dystrophin expression, and modifying downstream pathological pathways, including inflammation, fibrosis, and iPSC for oxidative stress (Blat Y & Blat S (2015) Drug Discovery of Therapies for Duchenne Muscular Dystrophy. Journal of Biomolecular Screening 20(10):1189-1203). A rapid and relevant method to identify disease-modifying treatments for DMD could enable a swift translation process, from drug screening to therapy. To improve drug discovery and repurposing of known or approved drugs for DMD, human dystrophic muscle cells that demonstrate the distinguishable DMD phenotype instigated by the lack of dystrophin expression are needed. Recently, the use of human induced pluripotent stem cells (hiPSCs) has gained interest as an emerging approach in drug discovery for genetic diseases. hiPSCs provide a scalable source of starting material that can be easily used in drug screening for DMD. Despite this advantage, there have been no reported applications of hiPSC for drug screens of DMD due to the lack of efficient and reproducible DMD hiPSC models.

[0161] During the past 3 years protocols have emerged for myogenic differentiation of DMD hiPSCs. Applying Wnt agonist and Notch antagonist, Choi et al. (Cell Reports 15(10):2301-2312; 2016) depicted a distinct transcription profile and phenotype of DMD hiPSC-derived my-oblasts from healthy controls. With Wnt activation and BMP inhibition, Choi et al. reported that myotubes formed from myoblasts derived from mdx mice presented abnormal branching. While both differentiation protocols showed myogenic commitment and ex vivo contraction of skeletal muscle myotubes, Hicks et al. (Nature cell biology 20(1):46-57; 2018) using Choi's protocol did not report a fusion defects in myoblasts derived from DMD hiPSCs following NCAM.sup.+/HNK1.sup. purification. The discrepancy in reported phenotypes of NCAM.sup.+/HNK1.sup. DMD hiPSC-derived myoblasts could be due to that IGF-1 and HGF growth factors which were used in Choi's protocol can enhance the myoblast fusion potential (Sotiropoulos A, et al. (2006) Proceedings of the National Academy of Sciences of the United States of America 103(19):7315-7320; Gonzalez M N, et al. (2017) Skelet. Muscle 7(1):2039, 40). In comparison, the myoblast culture system described herein, does not contain any growth factors, demonstrating the native myotube formation potential. Moreover, the transcriptional and translational profile data showed increased BMP and TGF- signaling in DMD hiPSC derived myoblasts. A similar phenomenon was found in myoblasts isolated from DMD patient biopsies and these myoblasts also demonstrated limited growth capability. Using the hiPSC differentiation method described above, an imaging-based screening system was developed herein, where myotube formation was visualized by staining the chemically-induced DMD iPSC-derived myoblasts with antibodies. This straightforward, easily detectable phenotype via imaging can be used in future compound library screens.

[0162] The JHCCL used in this study contains around 1000 FDA-approved and 500 foreign-approved compounds. While designing and approving a new drug is very costly and time consuming, screening approved drugs for previously unidentified activities could significantly speed up the process of drug development. Using this compound library together with the imaging-based screen system described above, two final compounds were selectedginsenoside Rd and fenofibrate. Ginsenosides are a group of active components found in Panax ginseng, a well-known herbal medicine touted to improve thinking, concentration, memory, work efficiency, physical stamina, and athletic endurance. Although the therapeutic potential of ginseng has been studied extensively, ginsenosides, which belong to the saponin family, have not yet been thoroughly investigated. The reported functions of ginsenosides are mainly composed of anti-inflammatory and anti-oxidant effects. Ginsenoside Rd was chosen among all the ginsenosides because of its function in inhibiting calcium influx (a hallmark of DMD pathology), inhibiting ROS, decreasing cellular apoptosis, and stabilizing the mitochondrial membrane potential. In this study, it was found that ginsenoside Rd helped restore fusion of DMD hiPSC-derived myoblasts. Gene ontology analyses was performed using microarray results from DMD hi-PSC-derived myoblasts treated with ginsenoside Rd to uncover this drug's mechanism. It was found that mitochondria complex II assembly was positively regulated, which might be relevant to the protective function of mitochondria in the presence of ginsenoside Rd. When analyzing the pathways affected by ginsenoside Rd treatment, FLT3 pathway topped the most significantly regulated pathways. FLT3, which is a type III tyrosine kinase, and its mutation in leukemia results in aberrant cell growth. So far, there has been only one study reporting FLEKR phT3 as necessary for myogenic differentiation, where overexpression of FLT3 appeared to promote cell cycle exit and activity through p120RasGAP phosphorylation was observed in D2 myoblasts by recombinant FLT3 (100 ng/ml) treatment as well as ginsenoside Rd (20 M) treatment (FIG. 3D-E). In the leukemia study, activated FLT3 receptor is known to induce RAS/ERK activation. Additionally, several reports have claimed that ERK phosphorylation is induced when myoblasts are terminally differentiated into myotubes. Therefore, in view of that, FLT3 is more likely to activate ERK and induce D2 myoblast differentiation upon recombinant FTL3 or Ginsenoside Rd treatment. In this study, when ginsenoside Rd was given to mdx mice, it improved their forelimb grip strength and increased their resistance to fatigue. This outcome could be the result of ginsenoside Rd's combined effects, including its anti-inflammatory and anti-oxidant function on muscle as well as its effect on promoting myotube differentiation.

[0163] The other identified compound, fenofibrate, is a well-established drug to treat hypertriglyceridemia, low HDL-C levels, or dyslipidemia. Fenofibrate's metabolite-fibrate acid-is a PPAR agonist that can reregulate fatty acid metabolism genes to reduce low-density lipoprotein (LDL), total cholesterol and triglycerides and increase high-density lipoprotein (HDL). In this study, when mdx mice were administrated with 0.1% wt/wt fenofibrate diet, they showed decreased triglyceride levels (FIG. 10G) and increased HDL levels (FIG. 10F), similar to what has been reported in humans (Najib J (2002). Clinical therapeutics 24(12):2022-2050). There have been reports suggesting fenofibrate is beneficial to muscle function. In one study, fenofibrate was shown to decrease glucocorticoid levels, thereby preventing muscle wasting in small lung cancer patients. Another study showed that fenofibrate administration in arthritic rats inhibited the expression of myostatin in skeletal muscle, prohibiting muscle atrophy. The results here demonstrated that fenofibrate inhibited TGF- signaling activity (FIGS. 3F-3G). TGF- signaling has been extensively studied in the context of muscular dystrophy due to its role as a negative regulator of muscle growth and inducer of fibrosis. Decreased fibrosis and increased muscle function was observed in the fenofibrate-treated mdx mice, further supporting the mechanism of fenofibrate as an inhibitor of TGF- signaling.

[0164] In summary, this study shows the application of hiPSC-derived myoblasts in a high-content imaging-based drug screening platform to discover two compounds, ginsenoside Rd and fenofibrate. These two compounds ameliorated the dystrophic phenotype in the mdx mouse model raising the possibility that these drugs could be trialed in DMD. This study presents the feasibility of a set of hiPSC-based medium-scale drug screening to identify FDA-approved drugs or natural products for orphan diseases.

TABLE-US-00001 Targetgene Forwardprimer Reverseprimer SMAD7 AGCCGACTCTGCGAACTAGA ATTCGTTCCCCCTGTTTCA (SEQIDNO:4) (SEQIDNO:5) SKI ACTGGAAGGCGAGACCATCT AGCACCGAGTTGAGAATCTGC (SEQIDNO:6) (SEQIDNO:7) NOS3-2 GATCCCCCAGAACTCTTCCT CAGGGCTGCAAACCACTC (SEQIDNO:8) (SEQIDNO:9) HSP90B1 CTGGAAATGAGGAACTAACAG TCTTCTCTGGTCATTCCTACACC TCA(SEQIDNO:10) (SEQIDNO:11) PRKG1 TTCTGAATTTGAAAGTCTTCAT CAGCATTTCCTCAACAGTGG GC(SEQIDNO:12) (SEQIDNO:13) LIPG GGGAGCCCCGTACCTTTTG CCTCACAGATGGTTTGACCTCA (SEQIDNO:14) (SEQIDNO:15) NLRP12 AGACTGGGGCCTGTGGTT TGTGAGGCCACAGCTATCC (SEQIDNO:16) (SEQIDNO:17) U2AF2 CAGGCCTCACGACTACCAG GGGACCACAGTGGACACAA (SEQIDNO:18) (SEQIDNO:19) DNAH5 TGGATTGCATGTTTGATGCT AACCCAGTGTACTAGAAATCCA (SEQIDNO:20) AGA(SEQIDNO:21) RANBP3L TTCCCAACCATCACGAAAAT TTTTGTTGAATATGAAAAGCTTG (SEQIDNO:22) C(SEQIDNO:23) CLEC7A TGAGATAGGGTCTCACTTTGTT GCTGAGGCGAGAGATAGCTG ACC(SEQIDNO:24) (SEQIDNO:25) TATDN2 GGAAGCGCTTAGGCATCTC GTTTCCAAGCCCACAACG (SEQIDNO:26) (SEQIDNO:27) ARHGAP42 CATTTAAATTTGTCCGCAAAGA GAAGTTCTGATGTTCTCGGTCA A(SEQIDNO:28) (SEQIDNO:29) MGEA5 GGAAACAGCGGAAGACCTAAG GGTCCTGTCCTCGTTCTCTG (SEQIDNO:30) (SEQIDNO:31) LRRC20 CCAACTGACAACACCAGTAAC TCACAAAAGGGCCTGAGC TAAA(SEQIDNO:32) (SEQIDNO:33) EGFLAM CCAGAAGTTTTCAGCCCTCA CGTGGAGTTCCGCTTTGA (SEQIDNO:34) (SEQIDNO:35) CLCA2 GCCAATGTGAAACAGGGATT AGGAGTCTCAGCGTAACAGGA (SEQIDNO:36) (SEQIDNO:37) LUZP2 CACAAAGAAAGTCCCCCAAG ACCTCACATTCAGAGCAAGGA (SEQIDNO:38) (SEQIDNO:39) GABRB1 TGGGTGTCTTTTTGGATCAAC TGTAAGCACTGTCGTGATTCCT (SEQIDNO:40) (SEQIDNO:41) GMNC ACGGAGACTTGGGTCTCTTTC TCCGGAAGAGGAAAATTTGA (SEQIDNO:42) (SEQIDNO:43) CBL TGACGTATGACGAAGTGAAAG CAGCTCAGCCGGAAGATATAA C(SEQIDNO:44) (SEQIDNO:45) GABRB3 GAAGGCTTTTCGGCATCTT CCGGGATCGTTCACACTC (SEQIDNO:46) (SEQIDNO:47) WNT2 TTTGGCAGGGTCCTACTCC CCTGGTGATGGCAAATACAA (SEQIDNO:48) (SEQIDNO:49) SDHAF3 AAGACCGTTGGTTCTGACGAG TCTTCTGGGAGGAAGGTGCCAA G(SEQIDNO:50) (SEQIDNO:51) ESR1 GCTTACTGACCAACCTGGCAG GGATCTCTAGCCAGGCACATTC A(SEQIDNO:52) (SEQIDNO:53) RPL12 GTGCACCGGAGGTGAAGT TGGCAATGTCATCACCAACT (SEQIDNO:54) (SEQIDNO:55) DGCR8 TGCAAAGATGAATCCGTTGA AGTAACTTGCTCAAAGTCAAAA (SEQIDNO:56) CG(SEQIDNO:57) PIP5K1C ACACAGTCGTCTGGACAGGA CCACCTGCACTGTAATCTGC (SEQIDNO:58) (SEQIDNO:59) DNAJC11 AAATGCACATATCCCAGTCCA GGTTGAGAGGCTTCCAGAGAG (SEQIDNO:60) (SEQIDNO:61) ANKRD36C GGAGAGCAAAAGAGGCTTGA GCTCACAGTGATTATCTTTAAGT (SEQIDNO:62) TCTG(SEQIDNO:63) SPAG5 TTTGCTCAGCGTCACACAG TCGGTTTCCTCTAAGTCCATTC (SEQIDNO:64) (SEQIDNO:65) OR51T1 AGCGGAGACTCCACAAACC AATGGTCAGACATAGATCAACA (SEQIDNO:66) GC(SEQIDNO:67) TATDN2 GGAAGCGCTTAGGCATCTC GTTTCCAAGCCCACAACG (SEQIDNO:68) (SEQIDNO:69) GPC4 GGAGATGTCGTGAGCAAGGT CTTCAACAGGGCATGGGTA (SEQIDNO:70) (SEQIDNO:71) FCHO1 TTGTACACACAACCGCTATTGA CACTCTGGGAGGGGTCACT (SEQIDNO:72) (SEQIDNO:73) BPGM CTAGGAGGCGCTGGCTCT TCAAATGGGCTAATATTCAAGG (SEQIDNO:74) A(SEQIDNO:75) ITIH4 CAGCACGTCCTGGAGTCA CGAAGGGAGTGTCTCACTCAT (SEQIDNO:76) (SEQIDNO:77) BBX CACCTCTCTGCGAGCTAATGT TCTTCATTCCAACACCCTTCA (SEQIDNO:78) (SEQIDNO:79) ERV3 GACCCACTGGAAGCCTAGAA CTAGGTCCTGTTGGCTGGTC (SEQIDNO:80) (SEQIDNO:81) SRP54 TGCAGGGAGCATACAGAAAG ATGCACCAAGGTGAACTGTG (SEQIDNO:82) (SEQIDNO:83) CDKL5 TCCATCGAGATATAAAACCAG CCTTCTGACAGATTACGAGCAA AAA(SEQIDNO:84) (SEQIDNO:85)

Other Embodiments

[0165] From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

[0166] All citations to sequences, patents and publications in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.